Vous êtes sur la page 1sur 0

Aspectosesencialesdelanlisis

forensedeADN,
parainvestigadoresyfiscales

CuadernodelMdulodeCapacitacin

ForensicTrainingNetwork
6604
th
Street#285
SanFrancisco,CA94107
18669636835
info@forensictrainingnetwork.com
www.forensictrainingnetwork.com

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina2
Graciasporparticiparenestemdulodecapacitacin.Puedeaccederalmduloenlnea,24horasalda,7das
porsemana,durantelos30dasquesiguenasuinscripcin.Puedecompletarelcursoalavelocidadqueaustedle
convenga.Puedehacerunapausayluegoseguirconelcurso,comoleseanecesario.Simplementecierresu
navegadorparasalirdelmdulo;paravolveraentrar,hagalaconexinloginenhttp://www.forensictraining
network.com/_pages/stsignin.htmlypodrcontinuarconelmdulo.

Requisitosdelsistema
IMPORTANTE!Lealosiguiente!

Paradescargarelmdulo,porfavorreviselosrequisitosdelsistemaycomprendalasinstruccionessiguientes:

ConexinInternetdealtavelocidad.
AdobeFlashPlayerdeversin10omsreciente.
NavegadorInternet
- MozillaFirefox3omsreciente(serecomienda)
- InternetExplorer6omsreciente
- Safari3omsreciente

LasopcionesdelnavegadorInternetdebenfijarseparaqueaceptegalletas(cookies)HTMLyFlash.
Siemprehagaellogindesdelamismacomputadorapararecibirelmensajedereiniciarenelpuntodonde
suspendielmdulo.
Comunqueseconnosotrossinorecibeelmensajedereiniciarenelpuntodondesuspendielmduloyla
navegacinestlimitadaparanotenerquevolveralprincipio.
LosusuariosdeMacpodrantenerproblemasparadescargarelcertificado.Siseproduceesteproblema,copie
lapantalladesusresultadosdelexamenyenvelaporcorreoelectrnicoainfo@forensictraining
network.com.
ElAdobeFlashPlayerestinstaladoparapermitirunalmacenamientolocalSINLIMITACIONESparaforensic
trainingnetwork.com.Unavezqueinicieelmdulodecapacitacin,sigalospasosqueseindicana
continuacin:
Hagaclicenelbotnderechodelratn,conelcursorenlapantalla.
SeleccioneSettings.
HagaclicenLocalStorage.
Muevalabarrahacialaderecha,paraunalmacenamientosinlimitaciones(Unlimited).
HagaclicenCloseparacerrar.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina3
Instrucciones

Estacapacitacinincluyeunanarracinenaudio.Serecomiendaencenderlosparlantesdesucomputadoraantes
deiniciarestacapacitacin.Sinopuedeescucharelaudio,puedehacerclicenAudioScriptenlaventanade
navegacin,paraleereltextodelaudio.

Encualquiermomentodurantelacapacitacin,puedevolveraunadiapositivaanterior,simplementehaciendoclic
sobreeltemadeseadoenlaventanadenavegacin.Sinembargo,lerogamosquenoseadelante.Porfavor
completecadadiapositivaantesdeavanzaraladiapositivasiguiente.

Completelosespaciosenblancoenestecuaderno,amedidaqueavanzaenelmdulo,paratenerunregistro
completodelasmateriasestudiadas.

Alfinaldelacapacitacinustedtendrquedarunexamen.Paraaprobaryrecibirelcertificadodeaprobacin,
debetenerunpuntajede85%oms.

Contenidodelcursoycalificacionesdelosautores

EstecursofueelaboradoporJaimeHandelsmanyCatherineCaballero,quesonperitasenelADNforense.Sus
biografassemuestranacontinuacin.

JaimeHandelsman,B.H.S.

JaimeHandelsmanesactualmentesociacofundadoraypropietariadeForensicTrainingNetwork.Tienela
responsabilidaddedesarrollareimpartircapacitacinsobreelADN,enlneaymediantepresentaciones
personales.Estasociadaconperitosqueofrecencapacitacinenlneaparaotrasdisciplinasforenses.Desde
2001,haestadoelaborandoyofreciendocursosdecapacitacin,conferenciasytalleresdetrabajosobrelasms
avanzadastecnologasdeADN.Hacapacitadoacientosdeanalistasforensesdelaboratoriosdecriminologaen
EstadosUnidosyhapresentadocharlassobretcnicasenconferenciasyreunionesdelrubro.Haparticipadoenel
desarrolloysoportetcnicodediversosproductoscomercialesdeanlisisforensedeADNcomercializadospor
AppliedBiosystems,dondetrabajdesde2001hasta2007comointegrantedelequipodeidentificacinhumana
(HumanIdentification,oHID).

AntesdesuempleoenAppliedBiosystems,JaimeHandelsmantrabajenTheBodeTechnologyGroupenel
estadodeVirginia,eneldesarrolloeimplementacindeunprogramadecontroldecalidadydeadministracinde
personaldelaboratorio.InicisucarreraenlascienciasforensesenelLaboratoriodeIdentificacindeADNdelas
FuerzasArmadas(ArmedForcesDNAIdentificationLaboratory,oAFDIL)enRockville,Maryland,dondese
capacitenelanlisisdeADNmitocondrialyanlisisdeSTR.Tuvounpapelimportanteenelprogramadecontrol
decalidaddellaboratorioyparticipenotrosproyectosdeinvestigacinforense,incluyendolaautomatizacin.
CompletcursosavanzadosdegenticaybiologaforensecomopartedelprogramadepostgradoenBiologa
MolecularForenseenGeorgeWashingtonUniversity,Washington,D.C.RecibilalicenciaturaenCienciasdela
SaluddelaUniversityofMiami,CoralGables,Florida.

jaime@forensictrainingnetwork.com|18669636835201

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina4
CatherineCaballero,B.S.

CatherineCaballerohaestadodedicadaalcampodelascienciasforensesdesde1994.Graciasasuamplia
colaboracinconexpertosforensesdetodoelmundo,tieneunaimportantepresenciaenlacomunidadforense.
EnsupapeldecofundadoraycopropietariadeForensicTrainingNetwork,proporcionacapacitacinmedianteel
desarrollodemdulosdecapacitacinenlneaycapacitacinmediantepresentacionespersonales.

DurantesutrabajoprevioenAppliedBiosystems,suresponsabilidadprincipalfuelacapacitacinyresolucinde
problemasenapoyoalosanalistasforensesdeADN.Tieneampliaexperienciaeneldesarrolloylaimplementacin
deprogramasdecapacitacinprctica,talleresdetrabajotcnicoypresentacionesenseminariosyreuniones
industriales.Seleconsideraldereneltemayhasidomentorademuchoscolegas.

CatherineCaballerotrabajparaelLaboratoriodeCriminologadelDepartamentodeSeguridadPblicadeTexas
durantelosaosenqueelestadodeTexascomenzaadoptarlatecnologadelADN.Estableciellaboratoriode
ADNenCorpusChristi,valideimplementlatecnologadeSTRenHoustonycapacitasuscolegasentodoel
estado.Adems,participconlosTexasRangersenlasinvestigacionesdelugaresdedelitos.Trabajencasos
penales,realizandoserologa,anlisisdeADNypresentandotestimoniopericialenlostribunales.Durantesus
estudiosuniversitarios,hizouninternadoenelInstitutodeCriminologadeCaliforniaytrabajendoslaboratorios
privados.RecibisulicenciaturaenCienciasForensesyenQumicadeCaliforniaStateUniversity,Sacramento.

catherine@forensictrainingnetwork.com|18669636835x202

Programa

Fundamentosdebiologaygentica.
AplicacindelADNenlascienciasforenses.
SistemasdelaboratoriosforensesdelADNenlosEE.UU.
VisingeneraldelosanlisisforensesdelADN.
FlujodetrabajoenellaboratoriodeanlisisdeSTR.
CODISycoincidenciasenlasbasesdedatos.
OtrosmtodosdeanlisisdelADN.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina5
Fundamentosdebiologaygentica

Elmaterialgenticohumano

Informacinbiolgicatransferidadeprogenitoresahijos.
Seencuentraen_____________(genomanuclear)y
_______________________(genomamitocondrial)decasitodas
lasclulas.
Seanticipaquelainformacingenticaseaigualencadaclula
delorganismodeunserhumano.
Secomponede__________.

QueselADN?

Sigladel________________________________________________.
Eselprogramagenticodelavida.
Esunamolcularelativamenteestable,viabledespusdelamuerteodel
desprendimientodeunaclula.
Secomponedeunasecuenciadecuatrobases:
Adenina(A) Guanina(G)
Timina(T) Citosina(C)

ACGCTTAGCCATTGCTAAGGCTAATACCT

EstructuradelADN

ElADNtienedosfilamentosqueseconectanentresatravsdepuentesdehidrgeno
entrebasescomplementarias.

ACGCTTAGCCATTGCTAAGGCTAATACCT
TGCGAATCGGTAACGATTCCGATTATGGA

Losfilamentosformanunaescaleraenformadeespiral,denominada_______________
ocadenaduplohelicoidal.
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina6
GenomadelADNmitocondrial

_______________.
Longitud:16,569paresdebases.
Cadaclulatieneentrecientosymilesdecopias.
Regindecontrol(lazod)
Abarca~1,144bases.
Secuenciavariable.
Reginnocodificante.

HerenciadelADNmt

ElADNmitocondrial(ADNmt)seheredaporva_________________.

TodoslosdescendientesporlavamaternatendrnlamismasecuenciadeADNmt.

GenomadelADNnuclear

Tienemsde3milmillonesdebases.
Hayunacopiaporclula.
Cadapersonatieneunasecuenciaqueesnica.
Msdel99%delgenomahumanoesidnticoentodaslas
personas.
Lascaractersticasnicasdeunapersonasedebena<1%
delgenoma,dondeestnlasdiferencias.
Estempaquetadoen_________________________.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina7
Cromosomashumanos

Cadancleotiene________paresde
cromosomashomlogos(46entotal).

22paressonautosmicos(nodeterminanel
sexo).

Elpar23determinaelsexo.
__________tienendoscromosomasX(X,X)
__________tienenuncromosomaXyun
cromosomaY(X,Y).

HerenciadelADNnuclear

Elvuloyelespermatozoidecontienen________________de
cadacromosoma.
Elcigotoohuevoseformacondoscopiasdecadacromosomacuandoun
espermatozoidefertilizaelvulo.
Seheredaunconjuntodecromosomasdelamadre,yotroconjuntodel
padre.

Marcadoresgenticos

SonregionesmuyestudiadasdelADNenuncromosomaespecfico,conunasecuencia
conocidadeADN.
Seencuentrangeneralmentedentroderegiones_______________________delADN.
Lasregionesson_________________,esdecirlasecuenciavaradeunapersonaaotra.
Seusanparaestudiarenfermedadesgenticasyparaidentificaralaspersonas.
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina8
Nomenclaturaparalosmarcadoresgenticos

Ellugarfsicoqueocupaelmarcadorsellamalocus(locienplural).
Algunoslocirecibensunombresegnelgendondeestnubicados.
Otroscumplenconunanomenclaturadesignada:

D7S820

D =______________
7 =seencuentraen____________________________
S =_____________(seencuentraunasolavezenelgenoma)
820 =_______________________________________________.

Ejemplosdemarcadoresgenticosporpersona

UbicadosenregionesdelADNenamboscromosomashomlogos.
Cadapersonatiene_________ejemplosdecadamarcadorgenticodesitionico.

Alelos

Diferentesvariacionesdegenesomarcadoresgenticos.
Cadapersonatienedosalelos(unoencadacromosomahomlogo).
Lavariacinsebasaenlasecuenciaolongituddelasecuencia.

Homocigtico
- Ambosalelostienen_____________________________________________

Heterocigtico
- Lasecuenciaolongituddecadaaleloes_______________________

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina9
Herenciaallica

MarcadoresgenticosSTR

STR=ShortTandemRepeat(cadenacortaconrepeticionesentndem).
MarcadoresempleadosenelanlisisforensedelADN.
RegionesdeADNquecontienen_____________________________________.
Secaracterizancomocortasportener___________basesporcadaunidadrepetitiva.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina10
VariacinSTR

ElnmeroderepeticionesenlasecuenciaSTRvaraentreunapersonayotra.

Lavariacinproducediferencias________________________enlareginSTRdelADN.
ElobjetivodelanlisisSTResdeterminarycompararlalongituddeciertosmarcadores
STR.

Poderdediscriminacin

Gradodediferenciacinentredospersonas,medianteelusodesuperfildeADN.
Mientrasmayorseaelnmerodemarcadoresgenticoscomparados,mayoreselpoder
dediscriminacin.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina11
LociSTRfundamentalesenlosEE.UU.

ImagencourtesiadeJohnButleryBruceMcCord
STRBiology,Markers,andMethods
http://www.cstl.nist.gov/strbase/pub_pres/AAFS2006_STRanalysis.pdf

Amelogenina

EsungenqueocurreenelcromosomaXyenel
cromosomaY.
Seempleaparadeterminar__________________.
Haydosalelosposibles(XeY).
ElaleloenelcromosomaXtieneunalongitud
diferentealaleloenelcromosomaY.
Genotipo__________=femenino
Genotipo__________=masculino

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina12
AplicacionesdelADNforense

Seempleaparaidentificara:
delincuentes
vctimasdedelitos
personasdesparecidas
vctimasdedesastresmasivos
elpadredeunnio(paternidad)
combatientesmuertosenguerras

SistemasdelaboratoriosforensesdeADNenlosEstadosUnidos

Examendecasoscomparadoconbasesdedatos

Examendecasos
SeenfocaenelanlisisdelADNdeevidenciavinculadacon_____________.
Elprocesodeanlisisvarasegnellaboratorio.
Elcasosepuedeasignaraunapersona,obien
seasignantareasespecficasadiferentespersonas.
Sepuedeprocesaruncasoindependientementedeotros,obien,
sepuedenjuntarcasosmltiplesenunasolatanda.
Basesdedatos
ProcesanmuestrasdeADNobtenidasde________________________________.
Muchasvecesesunprocesamientorpido.
Seesperaquelasmuestrasestnsumamente
concentradasyqueseandebuenacalidad.
Lainterpretacindedatosesmenosdifcil.

LaboratoriosforensesenlosEE.UU.

Federal
Estatal
Condado
Ciudad
NotodosloslaboratoriosforensesestncapacitadosparaanalizarelADN
Seempleanlaboratoriosparticularesubicadosendiferentesestados

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina13
PersonaldelaboratorioenlosEE.UU.

TcnicoenADN
Desempea__________________________________
Preparareactivoseinstrumentos,calibraelequipoyhaceotrastareasno
vinculadasconmuestras.
Puedetrabajarconmuestrasdeevidenciabajolasupervisindeun
analistacalificado.
Nohaceevaluacionesniproduceconclusionesenlosresultadosescritos.
Tampocopreparainformesfinales.
___________________________________________
Realizay/odirijeelanlisisdemuestrasforensesdecasos.
Interpretadatos,llegaaconclusionesypreparaelinformefinal.
___________________________________________
EsresponsableyrindecuentasdelaoperacintcnicadelaseccinADN.
SupervisalosmtodosdeanlisisdelADN,lainstrumentacin,validaciones,
garantaycontroldecalidad,etc.
Realizaevaluacionestcnicasdeloscasos.
____________________________________________
Esresponsabledelasoperacionesadministrativasydepersonaldelaseccin
ADN.
Directordelaboratorio
________________________________________________________________

GarantadecalidadenlosEE.UU.

Setomanmedidasatravsdetodoelsistemadelaboratoriosparaasegurarquela
calidaddelanlisisdeADNcumplacondeterminadosestndares.
Lassiguientesorganizacionesestablecenlosestndaresynormasdegarantadecalidad
enlosEE.UU.:
DepartamentoFederaldeInvestigaciones(FederalBureauofInvestigations,o
FBI).
Gruposdetrabajocientfico.
Juntasasesoras.
LoslaboratoriosforensescumplenconnormasespecficasparaelanlisisdelADNylas
basesdedatosdeADN.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina14
FaltadeestandarizacinenlosEE.UU.

Laspolticas,procedimentosyprotocolosanalticosvarandeunlaboratorioaotro.
Seanticipaqueloslaboratorioscumplanconsuspolticas,procedimientosyprotocolos
analticosdocumentados.
Lasexcepcionesincluyen:
Requisitoseducacionalesmnimosparaelpersonaldelaboratorio.
Nmeroexigidodehorasporaodeeducacindeposgrado.
Frecuenciadeexmenesdecompetencia.

AcreditacinenlosEE.UU.

Esunreconocimientoformalqueunlaboratoriocumpleconlosestndaresestablecidos.
Seotorgaporasociacionesforensessinfinesdelucroydereconocimientointernacional
integradasporperitosforensesexperimentados.
Ofreceunaevaluacinobjetivaeimparcialdellaboratorio.
Satisfacelosrequisitosparaque______________________________________pueda
participarenelsistemaNDIS.
Tiposdeacreditacin:
- AmericanSocietyofCrimeLabDirectors/LaboratoryAccreditationBoard
(ASCLD/LAB)
- ForensicQualityServicesInternational(FQSI)

CertificacinenlosEE.UU.

Procesoporelcual____________demuestratenerlascalificacionesparapracticarla
criminologa.
SlolaAmericanBoardofCriminalists(JuntaEstadounidensedeCriminalistas,oABC)
ofrececertificacinencriminologageneral
ybiologaforensepormediodeexmenes.
Losdistintosnivelesdecertificacinincluyen:
Diplomat
Fellow
Affiliate
Lacertificacinesvlidadurante5aos.
Sepuederenovaratravsdetrabajocontinuoencienciasforensesosisevuelve
aaprobarelexamen.
LosFellowsyAffiliatesdebenaprobarunexamenanualdecapacitacin.
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina15
ValidacinenlosEE.UU.

Consistedeunaseriedepruebascontodoslosnuevosmtodosyprotocolos,para
comprobarqueunprocedimientoesrobusto,confiableyreproducible.
Robusto:_______________________________
Confiable:______________________________
Reproducible:___________________________
Validacindedesarrollo
Sepruebannuevosmtodosqumicosoinstrumentos.
Laspruebaslasrealizaelfabricanteounlaboratoriorepresentante.
Validacininterna
Verificacindeprocedimientosgeneradosdelavalidacindedesarrollo.
Verificaqueelprocedimientoylatecnologasonrobustos,confiablesy
reproduciblesenunlaboratoriodeterminado.
Deberealizarseantesdeusarlanuevatecnologaenlosanlisisdecasoso
generacindebasesdedatos.
Deberealizarsesisemodificaunprocedimientoexistente.

VisingeneraldelosanlisisforensesdeADN

Anlisisdecasosforenses

Laactualtecnologaemplea:
ADNnuclear.
MarcadoresgenticosSTR.
Losprocedimientosempleadosgeneranun_____________________________.
CaracterizaaunapersonaconrespectoaciertoconjuntodemarcadoresSTR.
ElperfildeADNqueseobtienesecomparacon:
Perfilesdereferenciaydeeliminacin.
PerfilesdeADNenbasesdedatos.
____________________________secalculanyseinforman.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina16
EjemplodelanlisisdeADNparalainvestigacindeundelito

Lugardeldelito

Seencontraunhombredifuntoeneldormitoriodesuapartamento.Tenaeneltraxmltiples
heridaspunzantes.Enlassbanasseidentificaronmanchasdesangre.Fueradeldepartamento,se
encontrunacolilladecigarrilloenelsuelodebajodelaventanadelcuarto.Laventanaestaba
quebradayparecaserellugarpordondeentrelagresor.Serecogieronlassbanasylacolillayse
entregaronallaboratoriodeADNforense.

Elcadverseenviaellaboratoriodelmdicoforense.Elmdicoforensedeterminquelacausa
demuertefuehomicidio.EnviunamuestradesangredelavctimaallaboratoriodeADNparaque
seusaracomomuestradereferenciaomuestraconocida.

AnlisisdeADN

LaseccindeADNdellaboratorioforenseproceslaevidenciayrealizelanlisisdeADNenla
manchadesangreextradadelassbanas,enlacolilladecigarrilloyenlamuestradesangredela
vctima.ElperfildeADNdelasangreenlassbanascoincidiconelperfildelavctima.Sin
embargo,elperfildeADNobtenidodelacolilladecigarrillonocoincidiyelorigendelADNera
desconocido.

Sedetieneaunsospechoso

Losinvestigadoresrecibieronunapistaatravsdeunllamadotelefnicoannimo,queluegode
unainvestigacinadicionalllevaladetencindeunsospechoso.Cuandoloarrestaron,el
sospechosoestabaensuautomvil.Enelasientotraserodelautomvil,losinvestigadores
encontraronunatoallaconmanchasqueparecanserdesangre.

Llevaronalsospechosoaldepartamentodepolicaparaficharloyobtuvieronunamuestrapara
anlisisdeADN.Losinvestigadorestambinentregaronlatoallaallaboratorioforenseparaque
hicieranpruebasdeADN.

AnlisisdeADNadicionales

Enellaboratorioforense,determinaronquelasmanchasenlatoallahalladaenelautomvildel
sospechosoerandesangre.SeanalizelADNdelamanchadesangreenlatoallayenunamuestra
dereferenciatomadadelsospechoso.ElperfildeADNdelsospechosocoincidiconelperfilde
ADNobtenidodelacolilladecigarrillo.ElperfildeADNdelamanchadesangreenlatoalla
coincidiconelperfildeADNdelavctima.

ElfiscalluegoharalaevaluacindelaspruebasdeADNjuntocontodoslosdemshechosdelcaso
paradeterminarsihabaevidenciasuficienteparallevarelcasoaunjuicioyaunaeventual
condena.
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina17
PerfildeADN

Encadamarcador,la
personaproduceunoodos
picos.
Laubicacinhorizontaldel
picorepresenta_________
______________________.
Lalongituddelfragmento
deADNreflejacuntas
vecesserepitelaunidad.

PorquseusaelanlisisdeSTRenelanlisisforensedelADN?

Loci_______________________
Variedadenelnmeroderepeticionesdeunapersonaaotra.
Granpoderdediscriminacin.
Kitscomerciales
ComponentesyprotocolosPCRoptimizados.
___________________________,locualpermitecomparacionesdelADN.
Pruebasmltiplex
Combinamltipleslocienunaodosreacciones.
SeobtienenresultadosSTRen1a2das.
Puedeobtenerunperfilcuandolamuestraes________________________________.
Losmtodostienenampliaaceptacinenlostribunalesyenlacomunidadcientfica.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina18

FlujodetrabajoenellaboratoriodeanlisisSTR

Cadenadecustodia

Seexigeparaautenticarunelementodepruebaeneltribunal.
Contieneunalistadetodaslaspersonasquehantenidoposesindedeterminado
elementodepruebaylasfechasdeposesin.
Incluye:
Quin____________laevidencia.
Quin____________laevidencia.
Quin____________laevidenciaenellaboratorio.
Quin____________laevidenciaenellaboratorio.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina19
Deteccindeevidenciabiolgica

Manchasvisibles
Luzblancapotente
Manchasnovisiblesasimplevista
LuzUV
Fuentedeluzalternativa(ALS)
Pruebasdeluminiscenciaofluorescencia
(sangre)

TiposdePruebasBiolgicas

Sangre

Encasitodoslosdelitosdeviolencia,comoelhomicidio,sueleencontrarsesangreenellugar
deloshechos.Lasangrepuedeprovenirdelavctima,perosihubounalucha,tambinpuede
estarpresentelasangredelvictimario.Casisiemprelasangresesecayformaunamancha.Las
manchasdesangresepuedenencontrarendiversassuperficies,comolaropa,sbanas,
alfombrado,paredesyarmas.Aveceslacantidaddesangreestandiminutaquelamanchano
seobservaasimplevista.

Tambinseobtienesangrelquidaenellugardeundelito.Puedeextraersedelavctimaydel
sospechosocomomuestradereferenciaparacompararconlaevidencia.Sinembargo,la
extraccindesangreyanoestancomnporqueactualmenteseobtienenclulasbucalescon
unhisopo.

Lasangresecomponedeeritrocitos(glbulosrojos)yleucocitos(glbulosblancos)
suspendidosenelplasma.Solamente_________________________contienenADN.

Semen

Elsemenoespermaseencuentracomnmenteencasosdeagresinsexual.Seobtienen
muestrasdesemendediversassuperficiescomosbanasyprendasderopa,peroademsse
tomanmuestrasconhisopodelavaginay/odelrectodelavctimaconlaesperanzadeobtener
unacantidadsuficientedesemenparapermitirelanlisisdeADN.Desgraciadamente,cuando
setomanestasmuestrasconhisopo,lamayorpartedelmaterialbiolgicoobtenido
correspondealavctima.Adems,lacantidaddesemenpresentepodradependerdecunto
tiempohatranscurridoentrelacomisindeldelitoylaobtencindelamuestra.
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina20

________________________________enelsemencontienenelADNqueseanaliza.Ellquido
seminalcontienesolamentevestigiosdeADN.Sinembargo,sinoseencuentran
espermatozoidesenelsemen,ellquidoseminalpodratenerunnmeropequeodeotras
clulasquetienenADN,peroesmuchomenorlaprobabilidaddeencontrarunacantidadde
ADNsuficienteparaelanlisis.

Saliva

Enalgunoscasossepuededetectarsalivasecaenelsellodeunsobre,enunacolillade
cigarrillooenlavctima,ysepuedeprocesarparaelanlisisdeADN.Lasalivahumanaest
compuestacasitotalmentedeagua,perotambintieneclulas____________muertas.Las
clulasbucalesformanelrevestimientodelabocaydelacarainternadelasmejillas.
ContienenelADNutilizadoparaelanlisis.

LamayoradelosestadosenEE.UU.exigenquesetomenmuestrasdeADNdelosdelincuentes
condenadosyenalgunosestadosseobtienenestasmuestrasdetodaslaspersonasarrestadas.
Actualmente,estasmuestrascasisiempresetomanpasandounhisopoporelinteriordela
mejilladelapersona,paraobtenerclulasbucales.Estemtododeobtencindemuestraes
menosinvasivoquelaextraccindesangre.Lasclulasobtenidasconestemtodo
proporcionanunacantidadmsquesuficienteparaelanlisisdeADN.

Durantelainvestigacindeundelito,sepuedentomarmuestrasdeclulasbucalesdel
sospechoso,delavctimaodeotrasposiblesreferencias.Hayvariosproveedoresdekitsde
obtencindeclulasbucales.

Huesosydientes

Loshuesosydientesseusangeneralmenteparaidentificar__________________devctimas
dedelitos,personasdesaparecidas,combatientesmuertosenguerraovctimasdedesastres
masivosenloscualesnosedisponedeningnotromaterialbiolgico.

Amedidaquesedescomponenloshuesosydientes,elADNnuclearempiezaadegradarse.
Segnlaedaddelosrestos,podranoquedarsuficienteADNnuclearcomoparaobtenerun
perfildeSTRdeADN.Enestoscasos,sepuedeanalizarelADNmitocondrialporquenose
degradatanrpidamenteycadaclulacontienemuchascopiasdeADNmitocondrial.Los
anlisisdeADNmitocondrial,queusanunatecnologadiferentealanlisisdeADNnuclear,se
describirnbrevementemsadelanteenestacapacitacin.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina21
Peloycabello

Cuandounavctimaforcejeaconsuagresor,puedearrancarlepeloalagresor.Enotroscasos,el
pelodeunapersonadesaparecidaodeunavctimadeundesastremasivosepodraencontrar
entresuspertenenciasyusarsecomomuestradereferenciaparalacomparacinconlas
muestrasobtenidasdelosrestosencontrados.

ElADNnuclearseencuentra___________________delpelo.Silaraznoestintactaosiest
muydaada,elanlisisdeADNnuclearnoproducirunperfilcompletodeADN.Sinembargo,
anpodrahaberADNmitocondrialparaelanlisis.

Clulasepiteliales

Lasclulasepitelialesrevistenlassuperficiesdelorganismohumano._______________,por
ejemplo,secomponedeclulasepiteliales,quecontienenADN.Aveceselvictimario
desprendeclulasepitelialescuandotocaunasuperficie.Estetipodeevidenciabiolgicase
denominaevidencia_____________deADNdebidoalacantidadbajsimadematerial
biolgicopresente.Puedenencontrarseclulasepitelialesendiversassuperficies,comoarmas,
manillasdepuertas,ventanas,gorras.Lashuellasdactilarespuedenserunafuentedeevidencia
trazadeADN.

Comoconsecuenciadeunforcejeoounalucha,podranencontrarseclulasepitelialesdebajo
delasuasdelavctimaqueharasguadoasuagresor.

Tambinsepuedenencontrarclulasepitelialesenmuestrasdeorinaodemateriafecal,que
puedenusarsecomofuentedeADN.Lasclulasepitelialesenlaorinaprovienendel
revestimientodelavejigaylauretra;lasclulasepitelialesenlashecesprovienendel
revestimientodelrecto.Comosonpocaslasclulasepitelialesenlaorinaylasheces,puedeser
difcilobtenerunperfildeADNconestetipodemuestra.

Tejidos

Enalgunosdelitosviolentos,podranencontrarsetrozospequeosdetejidohumanoenellugar
deloshechos,enunarmaodebajoselasuasdeunavctima.Podradetectarsetejidocerebral
provenientedeunbalazosielarmasedisparaquemarropa.Podraencontrarsetejido
muscularenlaranuraentrelahojaylacachadeuncuchillo,inclusivesielcuchilloseha
limpiado.

Adems,cuandoesnecesarioobtenermuestrasdereferenciaparaidentificaraunavctima,
puedeutilizarsetejidomuscularotejidoderganosinternossisetratadeuncadver
descompuestooquemado,yaqueenestascircunstanciasnoesposibleobtenerunamuestra
desangreodeclulasbucales.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina22
Dificultadesconlaevidenciabiolgica

Lasmuestrasbiolgicaspuedenestarmezcladasconmolculasqueimpidenla
obtencindeunperfildeADNcompleto.
Elmaterialbiolgicorecuperadopuedecontenerunamezcladedosomspersonas.
Lacantidaddelamuestrapuedeserlimitada.
Lamuestrapudohaberestadoexpuestaacondicionesambientalesextremasque
producen_______________________delADN.

TTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTAC

TTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTACTTAC

________________________________.

Causasdedegradacin

Antesodespusdeobtenerse,lamuestrapuedeestarexpuestaalosiguiente:

Calorexcesivo
Condicionesdelmedioambiente
Luzsolar
Lluvia
Suelos,bacteriasyhongos
Exposicinasustanciasqumicas
Blanqueadores,detergentes
Luzultravioletadelsol
Algunoslaboratoriosusanluzultravioletacomopartedesusprotocolosde
limpiezayesterilizacindelassuperficiesdetrabajo

Ladegradacinseimpideconlaapropiadaobtencinyalmacenamientodelaevidencia.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina23
Contaminacin

EslatransferenciafortuitadeADN.
Estransferenciade:
Evidenciaaevidencia
Personaaevidencia
Puedeocurrirenellugardeloshechosoenellaboratorio.
Loslaboratoriosdebenmantenerunregistrodeincidentesylasmedidascorrectivas
tomadas.
Lacontaminacinponeendudalaintegridaddelaspruebas.

Tiposdecontaminacin

Contaminacin______________________osinexplicacin.
Muchasvecessedebeaproblemasenlamanipulacincausadospor
proveedoresdeartculosderecoleccinydelaboratorio.
Contaminacin_______________________.
Transferenciadeevidenciaaevidencia.
OcurreduranteelexameninicialdelaevidenciaolaextraccindelADN.
___________________________________.
Transferenciadelanalistaalaevidencia.
OcurreduranteelexameninicialdelaevidenciaolaextraccindelADN.

Prevencindelacontaminacin

Guantes.
Botinesoprotectoresdecalzado.
Usarelcabellorecogido,ungorroocachucha.
NOtocarselacaraolaboca.
NOtoser,estornudarnihablarsobrelaevidencia.
Descontaminarlosequipos,herramientasy
superficiesdetrabajo.
Manejarcadaartculodeevidenciaporseparado.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina24
MedidascontralacontaminacinenlaboratoriosdelosEE.UU.

Establecerambientesoespaciosseparadosenellaboratorioparadiferentespasos
analticos.
_______________________
Procesamientoyclasificacindelaevidencia
Extraccin
Cuantificacin
PreparacinparalaamplificacindeSTRporPCR
_______________________
OperacindelinstrumentoPCR(amplificacindeSTR)
Electroforesiscapilar
Realizarlosprocedimientosanalticosmsdelicadosenunacampanadeflujolaminar.
Usarartculosdesechablesdeplstico.

Obtencindeevidenciabiolgica

Losobjetostransportablesdebenserrecuperadosensutotalidad.
Menornmerodemanipulaciones.
Menoroportunidaddecontaminacin.
Muchasvecesseanalizalaparteno
manchadadelobjeto(controldesustrato).
Sinofueraposible,elmaterialbiolgicosedebe:
Cortar.
Raspar.
Levantarcontelaadhesiva.
Transferirusandounhisopodealgodn
estrilhumedecido.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina25
Empaquedelaevidenciabiolgica

Nuncaempaquetemuestrasdesangreodeotroslquidoscorporalessiestnhmedas.
Conunempaqueapropiadoseevitalacontaminacin.
Eldesarrollodebacteriascausadegradacin.
Sedebesecarlamuestraaalaire,atemperaturaambienteenunlugar
resguardadoyestril.
Elusodecalorexcesivo(porejemploun
secadordepelo)ylaexposicinarayos
ultravioletadelaluzsolarpuededegradarel
ADN.
Colocarlasmanchassecasyartculosdeevidencia
ensobresybolsasdepapel.
Nuncauseplstico.
Esindispensablepermitirqueelpaquete
respireparaimpedireldesarrollode
bacteriasyhongos.
Siemprerecolecteyempaquetecadamanchaoartculoseparadamente.

Otrasmuestrasobtenidas

Muestrasde_________________________.
Seobtienendepersonassupuestamentenoinvolucradaseneldelito.
ElADNdeestaspersonaspodraestarpresenteydetectarse.
Seobtienedepersonasquetuvieronaccesoallugardeloshechos.
Podraayudaradeterminarunafuentedecontaminacin.
Evitalaevaluacindeperfilesdesconocidos.
Muestrasde_________________________.
Seobtienendetodaslaspersonasdirectamenteinvolucradaseneldelito.
Seobtienenlasmuestrasfrotandolasuperficieinternadelamejillaconunhisopopara
recogerclulasbucales.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina26
Procesamientodeevidenciabiolgica

Clasificacin

Sehaceunexamencuidadosodelaevidenciaparadeterminarsi
tiene________________________________________.
Setomannotascuidadosamenteduranteesteprocedimiento.

Serologa

Sehacenpruebasdeserologaparadeterminar_________________demancha
presente:semen,sangre,saliva,etc.
Laspruebasseclasificanendosgrupos:
Pruebas__________________________:
Losresultadospositivosindicanquelamuestraprobablementeesla
sustanciabuscada.
Nosonespecficaspuestoqueotrassustanciaspuedendarresultado
positivo.
Pruebas___________________________:
Losresultadospositivosproporcionaninformacinconcluyentequela
muestraseslasustanciabuscada.
Sonespecficaspuestoquenodanreaccinpositivaconotrassustancias.
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina27
ConsumodeevidenciaenlosEE.UU.

Sedebeconservarunaporcinnoanalizadadelamanchadeevidenciaomuestrade
referencia.
Permitequelamanchasevuelvaaanalizarcuando:
Losresultadosinicialesdelapruebanosonconcluyentes.
Losresultadosindicanposiblecontaminacin.
Elimputadoinsisteenunnuevoanlisis.
Eltribunalpideunasegundaopinin.
Seempleacuandounadelaspartespideunanlisisadicional.
Permiterealizarpruebasconnuevastecnologas.
Siesnecesariousarlamuestraenteraparaobtenerresultadossuficientes,hayquedejar
constanciadelprotocoloutilizadoenellaboratorio.
Podraexigirseunaordenjudicialpararealizaresteanlisis.
Podraexigirselapresenciadeuntestigoparaobservarelanlisis.

ExtraccindelADN

SeliberaelADNde_______________________.
SeaslaelADNdetodoslosdemscomponentescelulares.

Paraobtenerlosmejoresresultados:
AislarlacantidadmximaposibledeADN.
Quitarelmaterialcelular,inhibidoreseimpurezasdelamuestra.
Nointroducirinhibidores.

CuantificacindelADN

Determina__________________________________________________enlamuestra.
LosactualesmtodosusanPCRentiemporealycomparanlasmuestrascontraunaserie
deestndaresquecontienenconcentracionesconocidasdeADN.
Aclaracindedudas:
- EssuficientelacantidaddeADNcomoparacontinuarconelanlisis?
- QuproporcindelamuestradeADNhayqueagregaralareaccindePCR?
- DeberarealizarseunanlisisYSTRenvezdelanlisisdeSTRautosmicoo
ademsdeste?
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina28
AmplificacindeSTR

LamayoradelasmuestrasbiolgicascontienerelativamentepocascopiasdeADN
nuclear.
Nonosinteresaanalizarelgenomahumanocompleto.
Necesitamosunmecanismopara:
Seleccionaryproducir________________________________delosmarcadores
STRquenosinteresan.
AplicarrtulosfluorescentesalosfragmentosSTRcopiadosparadetectarlos
durantelaelectroforesiscapilar.
LaamplificacindeSTRserealizaempleando:
PCR(PolymeraseChainReaction,oreaccinencadenadelapolimerasa)
__________________________________paralaamplificacindeSTR.

Reaccinencadenadelapolimerasa(PCR)

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina29
ComponentesclaveenlareaccinPCR

ADN

LareaccinPCRexigelapresenciadeADNquesecopiaoamplifica.LareaccinPCRnopuede
crearelADNdelanada.Solamentecopiasecuenciasqueyaestnpresentes.ElADNoriginal
queseagregaalareaccinsellama_______________________(templateDNA).

LacantidaddeADNagregadaalareaccindebeajustarsesegnlaconcentracindelosdems
componentesylascondicionesdelosciclosdetemperatura.Sinoseagregacantidadsuficiente
deADN,esposiblequenoseobservenresultados.Sinembargo,siseagregaunexcesodeADN
sealteralacalidaddelosdatosysedificultasuinterpretacin.Encasosextremosesimposible
interpretarlosresultados.

Cebadores

Uncebador(primer)enlareaccinPCResunfragmentopequeodeADNsintticoque
generalmentetieneunalongitudde15a25basesyescomplementarioalasregionesque
flanqueanlasecuenciaqueseamplificar.ElcebadordebeunirsealADNdemoldeparainiciar
laduplicacin.Elcebadorsenecesitapara__________________________________________.

ComoelADNtienedosfilamentos,lareaccinPCRexigeuncebadorparaleerunacadenadel
ADNhaciaadelanteyuncebadorparaleerlaotracadenadelADNalrevs.Estoaseguraquese
copiarnambosfilamentosdelADNduplohelicoidal.Sisecopiaraunsolofilamento,se
produciraunaaumentolinealdelnmerodecopias.Alcopiarambosfilamentos,selograun
crecimiento__________________delADN.

Desoxinucletidostrifosfato

LosdesoxinucletidostrifosfatoodNTPsonnucletidossintticoscompuestosdeunabase
unidaaunazcarquesuvezestunidaaungrupofosfato.SeagregancuatrotiposdedNTPa
lareaccin,unoparacadabasedelADN:_______________________.

LosdNTPsonloscomponentesqueusalareaccinPCRparacrearelnuevofilamentodeADN.
Durantelareaccin,seagreganalacadenalosdNTPunotrasotro,enformacomplementariaa
lasecuenciadelADNdemolde,formandonuevascopiasdeADN.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina30
Albminadesuerobovino

Laalbminadesuerobovino(bovineserumalbumin,oBSA)esunaprotenaqueseagregaala
reaccinparaprevenir________________________delaPCR.LaconcentracindeBSAenla
reaccinseajustadeacuerdoconeltipodemuestraylapresenciaanticipadadeinhibidores.

Solucinamortiguadora

LassolucionesamortiguadorasdelaPCRestabilizan__________paraquelareaccinpueda
llevarseacabo.

Clorurodemagnesio

Elclorurodemagnesio(MgCl)esuncofactoresencialdelaenzima_______________________.
SenecesitaparaquelaenzimafuncioneenlareaccinPCR.

ADNpolimerasa

LaenzimaADNpolimerasaagregalasmolculasdNTPcomplementariasalfragmentodeADN
copiado,unamolculatrasotra,empezandoconlaprimerabasequesiguealsitiodeunindel
cebador.

ExistenmuchostiposdeADNpolimerasaperolaformacomercialmscomnes
________________________.Estaenzima,quemuchasvecessellamasimplementeTaqGold,
seconsiguedeAppliedBiosystems.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina31
VisingeneraldelprocesoPCR

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina32
Aumentoexponencial

KitscomercialesparaelanlisisforensedeSTR

Losensayos________________________estndiseadosparaamplificar
simultneamenteunmnimode13locifundamentales.
PermitenlaestandarizacinylacomparacindeperfilesADN.
Loscomponentesnecesariosestnoptimizadosyseentreganjuntosenunkit.
Noserequiereinvestigacinydesarrolloenellaboratorio.
Elkitincluyeprotocolosparasimplificarsuadopcineimplementacin.
Lassecuenciasdeloscebadoresyotroscomponentesdereactivossuelenser
propiedadintelectual.
EstnfabricadosexlusivamenteporAppliedBiosystemsoPromega.
LoskitsdeusomscomnenlosEE.UU.son:
Identifiler(AppliedBiosystems)
PowerPlex16(Promega)

No.deciclo
ProductodePCR
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina33
PoderdediscriminacindeloskitscomercialesenlosEE.UU.

SGMPlus
10Loci
PowerPlex16
15Loci
Identifiler
15Loci
Caucsicos 1de3.310
12
1de1.8310
17
1de2.0010
17

Afro
Americanos
1de1.310
13
1de1.4110
18
1de7.6410
17

Hispanos 1de2.9310
17
1de1.3110
17

Asiticos 1de3.7410
17

Indgenas
Americanos
1de2.7610
16

Electroferisiscapilar(CE)

UnatpicamuestraforenseporPCRproducehasta32fragmentosdeADNconrtulo
fluorescente,dediferenteslongitudesycolor.
Losfragmentossedebensepararyexaminarparadeterminarsulongitud(tamao)Yel
colordeltinteaplicado.
LaelectroforesiscapilarseparaydetectalosampliconesPCRygeneralosdatos
necesarios.
Conceptosclave:
ElADNtieneunacarga_________________________constante.
ElADNmigrahaciaelpolopositivocuandoseaplicacorriente.
ElADNmigraatravsdelsistemasegnsutamao.
Losfragmentos_______________________deADNmigranmsrpidamente.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina34
Electroferisiscapilar(CE)

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina35
Datosnocorregidos

Electroferograma

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina36
Anlisiseinterpretacindedatos

Elsoftwareespecialdetermina:
- Eltamao
- Elmarcadorgentico
- Elalelo
Elnmerodelalelorepresentael
nmeroderepeticionesdeunidades
STR.
Elanalistahaceunexamenvisualy
confirmacadapicoygenotipoantesde
hacerunacomparacindeperfil.

Identificacindealelos

ElsoftwarecomparalospicosdefragmentosdeADNdesconocidoconfragmentosconocidos
(________________________________)

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina37
EjemplodelprocesodeanlisisdeADN

ComparacindeperfilesdeADN

Equiparacin(______________________)oidentificacin
LospicoscomparadosdentrodelosperfilesSTRtienenelmismogenotipoyno
haydiferenciasnoexplicables.
LapersonapuedeserincluidacomocontribuidoradeADNenlaevidencia.
_______________________
Seproduceunaunadiferenciadegenotipooms,indicandoquelasdos
muestrasnotienenelmismoorigen.
LapersonapuedeserexcluidacomocontribuidoraalADNenlaevidencia.
________________________
Hayalgoenlosdatosqueimpidellegaraunaconclusin.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina38
Comparacindelaevidenciaconsospechosos(origennico)

Anlisisestadstico

LasexclusionesyresultadosnoconcluyentesNOrequierenanlisisestadstico.
Elinformeslocontienedeclaracionescualitativas.
ElSospechosoAseexcluyecomocontribuidoralADNenlaevidencia.
SloserequiereelanlisisestadsticocuandodosperfilesdeADNcoincidenycuandose
______________alsospechosocomoposiblecontribuidoralADNenevidencia.
Dapesoestadsticoalosresultadosyaltestimonioeneltribunal.
Declaracincuantitativasobrelabajsimaprobabilidaddeencontrarelperfilde
ADN.
LoslaboratoriosforensesdeADNgeneralmentecalculaneinformanla
____________________________________________________(RMP).

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina39
ProbabilidaddeCoincidenciaAleatoria(RMP)

SedefinecomolaprobabilidaddequeelADNenunamuestraaleatoriadeuna
determinadapoblacinracialotnicatengaelmismoperfilqueelADNenlamuestrade
evidencia.
EsteclculoconsideralafrecuenciadelgenotipoparacadamarcadorSTR.
Declaracincuantitativa:LaprobabilidaddequeelADNdeunapersonaseleccionadaal
azardelapoblacincaucsicatengaelmismoperfilqueelADNenlamuestrade
evidenciaesde1en3,300,000,000(3.3milmillones).
Estosvaloressedocumentanenelinformedelcasoysepresentaneneltribunal.

Declaracionesdeidentidad

Estadeclaracinimplicaqueconciertogradodecertezacientfica,losresultadosdel
anlisisdelADNestablecenqueunindividuoenparticulareselorigendelamuestraen
evidencia.
Tambinseconocecomo_________________________________.
Algunoslaboratoriosusanestadeclaracionesenlugardepresentardatosestadsticos.
ElFBIusadeclaracionesdeidentidadsiseanticipaqueelperfildeADNocurrir
enmenosde1en260millonesdepersonas
(http://www.fbi.gov/hq/lab/fsc/backissu/july2000/source.htm)

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina40
CODISycoincidenciasenlasbasesdedatos

BasesdedatosforensesdeADN

SoncoleccionesinvestigablesdeperfilesdeADNobtenidosdeciertostiposde
delincuentesydeevidenciabiolgica.
Estndiseadasparaservircomoherramientaspararesolverdelitos.
Laestadsticaindicaquemuchosdelincuentesreinciden.
LacomparacindeperfilesdeADNprovenientedeevidenciacriminalcon
perfilesdeADNdedelincuentesconcondenapreviapuedeidentificaral
victimario.
EstambinposiblequecoincidanperfilesdeADNdedoslugaresdehechos.
Proporcionamsinformacinalinvestigadorsobredelitosydelincuentes
habituales.
Previenefuturosdelitos.
LasbasesdedatosfueronestablecidasporagenciaslocalesyestatalesenlosEE.UU.ya
enelao1989.

CODISenlosEE.UU.

COmbinedDNAIndexSystem(sistemacombinadodeindexacindeADN).
EsunprogramaadministradoporelFBIparacargaryhacerbsquedaselectrnicasde
perfilesdeADNanivellocal,estatalynacional.
Factoresclave
ComprendebasesdedatosdeADNentresdistintosniveles:local,estataly
nacional.
Requiereelusodeunsoftwareespecialyunaredsegura.
RequiereelusodeunconjuntoestandarizadodelociSTR.
Existenvariosndices,ycadaunocontieneperfilesdediferentestiposde
personas.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina41
JerarquasenlabasededatosCODIS

SistemanacionaldeindexacindeADN

FueautorizadoporlaLeyFederaldeIdentificacinporADNde1994.
Empezaoperaren1998.
LoadministraelFBI.
Contienemsde7.6millonesdeperfilesdedelincuentesymsde294,000perfiles
forenses(cifrasvlidashastanoviembrede2009).
Serealizanbsquedassemanales.
RequisitosparacargarperfilesdeADN:
Acreditacin.
Cumplimientoconestndaresvigentesdegarantadecalidadparaelanlisisde
ADN.
CumplimientoconestndaresdeaceptacinparaelADNdeterminadosporel
NDIS.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina42
ndicedeperfilesCODIS

Investigacionespenales
ndice_______________________________________
AlmacenaperfilesdeADNdedelincuentescondenadosdeciertosdelitos.
ndice_______________________________________
AlmacenaperfilesdeADNobtenidosdeevidenciacriminal.
ndice_______________________________________
AlmacenaperfilesdeADNdepersonasarrestadasenestadosconleyes
quepermitenunainvestigacinendichondice.
Lainvestigacinserealizaslocuandolopermitenlasleyesestatales.
Personasdesaparecidas
ndicedepersonasdesaparecidas
ContieneperfilesADNSTRyresultadosdeADNmtderestoshumanosno
identificados.
ndicedereferencia
Contienemuestrasdefamiliaresdepersonasdesaparecidas.

Coincidenciasenbasesdedatos

Serealizaunabsquedaencasossinsospechoso.
Unacoincidenciaocotejopuedeindicarelcomienzodeunainvestigacinoaportar
nuevaspistas.
Coincidenciadeperfilesdentrodelndiceforense
- Esposiblequedosomsdelitosestnvinculados.
- Puedeayudarenelarrestodeundelincuenteenserie.
Coincidenciadeperfilesenelndicedeconvictosyenelndiceforense
- Puedeaclararselaidentificacindeunsospechoso.
- Estableceunmotivodeprocesamiento.
- SeobtieneunanuevamuestradeADNdelsospechoso.
- LanuevamuestradeADNdebecoincidirantesdepoderhacerunarresto.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina43
Limitacionesdelasbasesdedatos

Elxitodepende______________________________________enlabasededatos.
Elexcesodetrabajopendienteimpidelacargadeperfiles,impidiendolas
investigacionessindemoras.
Recursosdelaboratoriolimitados.
AmplificacindeleyessobrebasesdedatosdeADN.
AumentodepresentacindecasosvinculadosconelADN.

ConsideracionesrelativasalasbsquedasenCODIS

Enrarasoportunidades,diferenteskitspuedenproducir
resultadosunpocodiferentesdebidoadiferenciasenlos
componentesqumicos.
Serecomiendanlasbsquedasderigurosidad______________.
Noexigequetodosloslocicoincidan,paraqueuna
coincidenciapuedaaparecercomoposibilidad.
Lascoincidenciascercadel100%puedenjustificarun
nuevoanlisisdelasmuestrasdeADN.

OtrosmtodosdeanlisisdeADN

MarcadoresYSTR

LosmarcadoresSTRsloseencuentranenelADN_____________________.
Sontilesencasosdeagresinsexual.
LasmuestrastienenpocoADNmasculinomezcladocongrandescantidadesde
ADNfemenino.
Mejoranlasposibilidadesdeinterpretacincuandoestnpresentesmltiples
contribuidoresdeADNmasculino.
Todoslosfamiliaresdelalnea_______________tienenelmismoperfilYSTR.
EstosmarcadoresnoexhibentantavariedadcomolosSTRtradicionales.
Sepuedeexcluirunsospechosoconabsolutacerteza.
HaydisponiblesdoskitscomercialesforensesdeYSTR:
AppliedBiosystemsYfiler
PromegaPowerplexYSystem
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina44
MarcadoresMiniSTR

SonlosmismosmarcadoresgenticosquelosSTR
tradicionales.
Semodificalareaccinqumicapara_______________el
largodelosfragmentosdelADNoriginalqueseamplifican.
Sirvenparaprocesarmuestras____________________o
__________________________________deADN.
ElMiniFilereselnicokitforensecomercialminiSTR(en
juniode2009).

AnlisisforensedelADNmt

SerealizacuandoelanlisisSTRproducepocooningnresultado.
Eselmtododepruebaprimariopara____________,_________y
________________.
Seconsiderafactibleporque:
ElADNmitocondrial(ADNmt)sedegradaconmenosfacilidadqueelADN
nuclear.
Lasclulastienen__________copiasdelADNmtquedeADNnuclear.
Cualquierfamiliardelalneamaternapuedeaportarmuestras,puesslose
heredadelalneamaterna.
ElanlisisADNmtnotieneelmismopoderdediscriminacinqueelanlisisSTR.

ComparacindelperfildeADNylasecuenciaADNmt

LospicosrepresentanlasecuenciadebasesenelADN.Noseevalaeltamao.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina45
OtrasaplicacionesdelanlisisdeADN

Cuandonoseencuentraningunaotraevidencia,lasmuestrasdeADN
nohumanopuedenaportarinformacinenciertoscasos.

Animales
Plantas
Polenyesporas
Microorganismos:bacterasyvirus

Conclusiones

ElgenomahumanoestcompuestodeADN,seencuentradentrodelncleoylas
mitocondriasdelamayoradelasclulas,yseheredadenuestrosprogenitores.
ElADNesunaherramientapoderosaqueayudaenlaidentificacindelaspersonasy
aportapistasenlainvestigacindelosdelitos.
LasventajasdelanlisisdeSTRincluyen:lanaturalezapolimrficadelosmarcadores
genticosSTR;ladisponibilidaddekitscomercialesmltiplex;obtencinderesultados
demuestrascontaminadas;aceptacindelacienciaytecnologa.
UnavezqueseprocesaelADNenellaboratorio,losperfilesdeADNobtenidodellugar
deloshechossecomparanconperfilesdereferenciaylosperfilesalmacenadosenlas
basesdedatosdeADN.
Laprobabilidaddecoincidenciaaleatoriaeseldatoestadstcoquetpicamentesecalcula
yseinformacuandocoincidendosomsperfilesSTR.
ExistenotrosmtodostalescomolosMiniSTR,YSTRypruebasdeADNmtparaaportar
informacinadicionalcuandonosonsuficienteslosSTRtradicionales.

AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina46
Referencias

Butler,J.M.(2005)ForensicDNATyping:Biology,TechnologyandGeneticsofSTRMarkers,2
nd
edition.
Burlington,Massachusetts:ElsevierAcademicPress.
AlternateLightSourceAnalysis,http://www.encyclopedia.com/doc/1G23448300020.html
TheProblemwithEyewitnessTestimony,
http://agora.stanford.edu/sjls/Issue%20One/fisher&tversky.htm
Chelex100,http://en.wikipedia.org/w/index.php?title=Chelex_100&oldid=276728614
DNAIQSystem,http://www.promega.com/applications/hmnid/productprofiles/dnaiq/Default.htm
ForensicDNADatabases:LinkingCriminalstoCrimes,http://www.dna.gov/dnadatabases/
PopulationGeneticandStatisticsforForensicAnalysts,http://populations.dna.gov/
SolvingCrimes,http://www.dna.gov/solvingcrimes/coldcases/howdatabasesaid/limitations/
STRBiology,Marker,andMethods,
http://www.cstl.nist.gov/strbase/pub_pres/AAFS2006_STRanalysis.pdf
SourceAttributionofaForensicDNAProfile,
http://www.fbi.gov/hq/lab/fsc/backissu/july2000/source.htm
STRDataAnalysisandInterpretationforForensicAnalysts:ReportingGuidelines,http://strdata.dna.gov/
Amelogenin,http://www.cstl.nist.gov/strbase/Amelogenin.htm
TransferTheoryinForensicDNAAnalysis,http://www.lawofficer.com/newsand
articles/columns/ryan/transfer_theory_in_forensic_dna_analysis.html
PrinciplesofForensicDNAforOfficersoftheCourt,http://dna.gov/training/otc/
MaternalInheritancePattern,http://static.forensic.dna.devis.com/flash/DNACD_mod08104.swf
DNAAnalystTraining,http://www.nfstc.org/pdi/
LaboratoryOrientationandTestingBodyFluidsandTissues,http://forensicbiology.dna.gov/
ShortTandemRepeat(STR)InterpretationGuidelines,
http://www.fbi.gov/hq/lab/fsc/backissu/july2000/strig.htm
StatisticsandPopulationGenetics,http://www.cstl.nist.gov/strbase/pub_pres/NJSP2006_Statistics.pdf
CODISCombinedIndexSystem,http://www.fbi.gov/hq/lab/html/codisbrochure_text.htm
NonhumanDNA,http://www.dna.gov/research/non_human/
TheScienceBehindtheHumanGenomeProject,
http://www.ornl.gov/sci/techresources/Human_Genome/project/info.shtml
ABCWebsitehttp://www.criminalistics.com/
ASCLD/LABWebsitehttp://www.ascldlab.org/dual/indexdual.html
ForensicQualityServicesWebsitehttp://www.forquality.org
DNAIdentificationActof1994http://thomas.loc.gov/cgi
bin/bdquery/z?d103:HR03355:|TOM:/bss/d103query.html
AspectosesencialesdelanlisisforensedeADN
2010ForensicTrainingNetwork,LLC Pgina47
USCensusBureauWebsitehttp://www.census.gov/main/www/popclock.html
DNAResourceWebsitehttp://www.dnaresource.com
AppliedBiosystems(2006)AmpFLSTRSGMPlusPCRAmplificationKitUsersManual.FosterCity,
California:AppliedBiosystems
AppliedBiosystems(2006)AmpFLSTRIdentifilerPCRAmplificationKitUsersManual.FosterCity,
California:AppliedBiosystems
PromegaCorporation(2007)Powerplex16SystemTechnicalManual.Madison,Wisconsin:Promega
Corporation.
MitochondrialDNA,http://en.wikipedia.org/w/index.php?title=Mitochondrial_DNA&oldid=334379162
Humangenome,http://en.wikipedia.org/w/index.php?title=Human_genome&oldid=336313795
Geneticmarker,http://en.wikipedia.org/w/index.php?title=Genetic_marker&oldid=326506957
QualityAssuranceStandardsforForensicDNATestingLaboratories,
http://www.cstl.nist.gov/strbase/QAS/FinalFBIDirectorForensicStandards.pdf
EverythingYouNeedtoKnowAboutValidation,
http://www.cstl.nist.gov/strbase/pub_pres/ValidationWorkshopISFG2009.pdf
Locard'sexchangeprinciple,
http://en.wikipedia.org/w/index.php?title=Locard%27s_exchange_principle&oldid=324771940
DNAIQSystem,http://www.promega.com/applications/hmnid/productprofiles/dnaiq/
Qiagen(2007).QIAampDNAInvestigatorHandbook
FamilialDNADatabaseSearches,
http://www.denverda.org/DNA/Familial_DNA_Database_Searches.htm
NationalResearchCouncil(NRCII).TheEvaluationofForensicDNAEvidence.NationalAcademyPress,
WashingtonDC,1996.

Graciasporparticiparenestemdulodecapacitacin!
Sitienealgunapreguntaocomentario,
sepuedecomunicarconnosotros:

ForensicTrainingNetwork
6604
th
Street#285
SanFrancisco,CA94107
18669636835
info@forensictrainingnetwork.com
www.forensictrainingnetwork.com