Biotechnol Lett (2011) 33:20912101 DOI 10.

1007/s10529-011-0653-1

ORIGINAL RESEARCH PAPER

Analysis of collagen expression during chondrogenic induction of human bone marrow mesenchymal stem cells
` re Emeline Perrier Marie-Claire Ronzie Reine Bareille Astrid Pinzano de ric Mallein-Gerin Anne-Marie Freyria Fre

Received: 26 February 2011 / Accepted: 23 May 2011 / Published online: 10 June 2011 Springer Science+Business Media B.V. 2011

Abstract Adult mesenchymal stem cells (MSCs) are currently being investigated as an alternative to chondrocytes for repairing cartilage defects. As several collagen types participate in the formation of cartilage-specic extracellular matrix, we have
Electronic supplementary material The online version of this article (doi:10.1007/s10529-011-0653-1) contains supplementary material, which is available to authorized users.
` re F. Mallein-Gerin E. Perrier M.-C. Ronzie A.-M. Freyria (&) ines, Universite Institut de Biologie et Chimie des Prote Lyon 1, Univ Lyon, CNRS FRE 3310, IFR128 BioSciences Gerland-Lyon Sud, 7 Passage du Vercors, 69367 Lyon Cedex 7, France e-mail: am.freyria@ibcp.fr E. Perrier e-mail: emeline.groult@ibcp.fr ` re M.-C. Ronzie e-mail: mc.ronziere@ibcp.fr F. Mallein-Gerin e-mail: f.mallein-gerin@ibcp.fr R. Bareille 577, Universite Victor Segalen , Inserm Unite Bordeaux 2, 33076 Bordeaux, France e-mail: reine.bareille@inserm.fr A. Pinzano Laboratoire de Physiopathologie, Pharmacologie et nierie Articulaires, UMR 7561 CNRS-Nancy Inge , 9, avenue de la Fore t de Haye, Universite ` s-Nancy, France 54505 Vanduvre-Le e-mail: astrid.pinzano@medecine.uhp-nancy.fr

investigated their gene expression levels during MSC chondrogenic induction. Bone marrow MSCs were cultured in pellet in the presence of BMP-2 and TGFb3 for 24 days. After addition of FGF-2, at the fourth passage during MSC expansion, there was an enhancing effect on specic cartilage gene expression when compared to that without FGF-2 at day 12 in pellet culture. A switch in expression from the prechondrogenic type IIA form to the cartilage-specic type IIB form of the collagen type II gene was observed at day 24. A short-term addition of FGF-2 followed by a treatment with BMP-2/TGF-b3 appears sufcient to accelerate chondrogenesis with a particular effect on the main cartilage collagens. Keywords Bone morphogenetic protein-2, chondrogenesis Collagen Fibroblast growth-factor2 Mesenchymal stem cells Transforming growth factor-beta3

Introduction Cartilage tissue engineering is currently exploring the potential of adult mesenchymal stem cells (MSCs), present in different tissues, as an alternative to the use of autologous chondrocyte transplantation for cartilage repair (Khan et al. 2010; Freyria et al. 2008). Prior to their use for tissue repair, there have been extensive studies to develop methods to enhance MSC proliferation and subsequent chondrogenic

123

2092

Biotechnol Lett (2011) 33:20912101

differentiation, using both animal and human models. Some procedures have now been standardized but before obtaining a sufcient cell reservoir for laboratory and clinical purposes it is necessary to amplify MSCs in vitro. These cells represent a minor fraction of the total nucleated cell population in the bone marrow (BM), the most common and best-characterized MSC source, with an approx. frequency of 1 MSC per 5 9 103 mononuclear cells (Kastrinaki et al. 2008). Fibroblast growth factor-2 (FGF-2) has been most frequently used as it was known to maintain the differentiation potential of MSCs after several mitotic divisions (Karlsson et al. 2007; Murdoch et al. 2007; Solchaga et al. 2005, 2010; Varas et al. 2007). Interestingly, FGF-2 treatment of MSCs during expansion has the potential to delay the loss of chondrogenic potential (Solchaga et al. 2010). In addition, to promote chondrogenic differentiation, the expanded MSCs need to be subsequently cultured in a three-dimensional environment as micromasses or in scaffold materials and this differentiation also requires the presence of various compounds such as vitamins, dexamethasone and members of the TGF-b superfamily (Karlsson et al. 2007; Marsano et al. 2007; Mehlhorn et al. 2006; Merceron et al. 2009; Miyanishi et al. 2006; Murdoch et al. 2007; Pelttari et al. 2006; Solchaga et al. 2005; Varas et al. 2007). Bone morphogenetic proteins (BMPs) have also been added to the culture medium of BM-MSCs alone, such as BMP-2 or in various combinations with TGFb (Schmitt et al. 2003; Sekiya et al. 2005; Shen et al. 2009). Interestingly, all BMPs enhance the chondrogenic effect of TGF-b. These studies have mainly investigated the essential components of hyaline cartilage to assess and characterize the chondrogenic induction of MSCs such as type II collagen and sGAG (Tew et al. 2008). Regarding the collagens, those characteristic of cartilaginous tissues include type II collagen [a1(II)3] representing about 9095%, as well as types IX [a1(IX) a2(IX) a3(IX)] and XI [a1(XI) a2(XI) a3(XI)], representing less than 10% of the total collagen content of the ECM in adult articular cartilage (Petit et al. 1992). Type II collagen is synthesized as a larger precursor procollagen molecule under two forms, IIA and IIB, resulting from alternative splicing of exon 2, which codes for a cysteine-rich (CR) domain located in the N-propeptide region (Sandell et al. 1991). Type IIA procollagen

contains the CR domain and is produced by chondroprogenitor cells, whereas type IIB procollagen does not contain this domain and is synthesized only when chondrocytes are fully differentiated (Aigner et al. 1999; Zhu et al. 1999). Thus, the switch from type IIA to type IIB procollagen mRNA expression is a marker of the chondrocyte phenotype. Besides, the brilassociated collagens present in cartilage and forming the primary core brillar network (types II, IX and XI collagens), other collagen molecules, such as types VI [a1(VI) a2(VI) a3(VI) a4(VI) a5(VI) a6(VI)], XII [a1(XII)3] and XXVII [a1(XXVII)3], have a structural role in cartilage organization or are temporally or qualitatively associated with cartilage development and thus their encoding genes represent potential reference markers to monitor chondrogenesis in MSC cultures (Alexopoulos et al. 2009; Gregory et al. 2001; Hjorten et al. 2007). The aim of the present study was to seek a concise system for analyzing the effects of the growth factors on the chondrogenic ability of human BM-MSCs, with special attention given to collagen expression. We sought conditions that would produce expression of the characteristic markers with the minimal and effective content of growth factors. In order to treat the cells similarly given by each donor, independently of the time of harvest, we chose to expand MSCs during three passages to obtain a sufcient cell reservoir for our experimental purposes and to add FGF-2 at the fourth passage. The subsequent level of cell differentiation in pellet cultures was investigated, and especially the mRNA expression of spliced forms of type II procollagen, as well as other collagens. The occurrence of chondrogenesis was characterized by the expression of marker genes for chondrocytes, hypertrophic chondrocytes and by the synthesis of extracellular matrix proteins.

Materials and methods Isolation and cell culture of MSCs and human chondrocytes Adult bone marrows were obtained from iliac aspirations of three donors (age range: 3766 years) undergoing total hip replacement, after informed consent and according to local ethical guidelines. The BM-MSCs were separated from BM mononuclear

123

Biotechnol Lett (2011) 33:20912101

2093

cells by adherence on plastic (Cournil-Henrionnet et al. 2008; Vilamitjana-Amedee et al. 1993). Cells (0.5 9 106/cm2) were then expanded in monolayer culture in Dubelccos modied Eagles Medium (DMEM) supplemented with 10% (v/v) fetal calf serum (FCS), 100 U penicillin/ml and 100 lg streptomycin/ml in humidied incubators at 37C with 5% CO2. As surface markers on MSCs showed little variation during the culture, the cell surface receptor prole of the BM-MSCs was not reported in this paper (Cournil-Henrionnet et al. 2008). Cells were cultured until 80% conuence and harvested with 0.25% trypsin/1 mM EDTA for 34 min at 37C and seeded in new asks for expansion. After the third subculture, cells were harvested and frozen in a cryopreservation medium containing 50% FCS, 40% DMEM and 10% dimethyl sulfoxide (DMSO). Before the formation of pellets, a fourth passage was carried out in the presence or absence of 5 ng/ml of human recombinant FGF-2 (R&D Systems). After each trypsination, cells were counted with a Cellometer Auto T4 (Nexcelom Bioscience) and the proliferation rate was calculated between the different culture conditions. Articular chondrocytes were isolated from the macroscopically healthy zone of cartilages obtained, according to the local ethical guidelines and after informed consent, from three donors undergoing total knee replacement. The rationale to compare the induced MSCs with cultured articular chondrocytes is that both cells are in a nonmatrix environment, while with fresh tissue the gene expression represents in vivo levels. Cells were cultured in monolayer for 36 h (Ach), as previously described (Hautier et al. 2008). Total cell RNA obtained at this stage gave us a chondrocytic gene expression reference to compare with the induced MSCs.

pyruvate/ml, 100 nM dexamethasone, 50 lg ascorbate-2-phosphate/ml (Asc-P) and BMP-2 (R&D Systems) and TGF-b3 (R&D Systems) in combination [10 ng TGF-b3/ml ? 50 ng BMP-2/ml (BT)]. In a preliminary experiment, we veried that the combination TGF-b3/BMP-2 was a better inducer of chondrogenesis than each growth factor alone. Media in both groups was changed every 3 days. Pellet sizes were regularly measured on micrographs taken with a bright-eld Nikon TE300 microscope equipped with a QICAM Fast 1394 camera (Qimaging).

Gene expression analysis Four to six pellets for each culture condition and for each donor were homogenized with TissueLyser (Qiagen). Total RNA was isolated after 1, 12 and 24 days of culture, using the RNeasy kit (Qiagen) and reverse transcription of 50500 ng total RNA was performed as previously described (Cortial et al. 2006). Quantitative RT-PCR was performed with an iCycler iQ (BioRad). Each analysis was carried out in duplicate. PCR primers (Table 1) were obtained from Invitrogen. We focused our interest on genes coding for collagens (types I, II, VI, IX, X, XI, XII and XXVII), proteoglycan (aggrecan: ACG1), transcription factor (SOX9) and one MEC-degrading enzyme (MMP13). For each cDNA sample the Ct value of the reference gene ribosomal protein L30 (RPL30) was subtracted from the Ct value of the target gene to obtain the DCt. The level of expression was then calculated as 2-DCt and was expressed in relative quantity. In addition, the total amounts of type II collagen transcripts and of procollagen IIA and IIB isoform transcripts were assessed by conventional PCR after 12 and 24 days of culture, using previously described parameters (Hautier et al. 2008). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the housekeeping gene. Photographs of gels obtained using a Baby Imager (Appligene Oncor, Illkirch, France) were scanned using an Epson 1640 scanner (Epson France). The relative ratios of the bands corresponding to type IIA (475 bp) and type IIB (268 bp) procollagen transcripts were quantied using Image Quant software (GE Healthcare).

Pellet cultures Cells (0.25 9 106) were seeded in V-bottomed 96-well plates and pelleted for 5 min at 250 g. The pellets were cultured in 250 ll high glucose DMEM supplemented with 1% (w/v) insulin/transferring/ selenium/bovine serum albumin/linoleic acid (ITS ? Premix; BD), 100 U penicillin/ml, 100 lg streptomycin/ml, 40 lg L-proline/ml, 100 lg sodium

123

2094 Table 1 Nucleotide sequences of primers used for real-time PCR Genes Extracellular matrix proteins a1 chain of collagen I (COL1A1) a1 chain of collagen II (COL2A1) a1 chain of collagen VI (COL6A1) a1 chain of collagen IX (COL9A1) a1 chain of collagen X (COL10A1) a1 chain of collagen XI (COL11A1) a2 chain of collagen XI (COL11A2) a1 chain of collagen XII (COL12A1) a1 chain of collagen XVII (COL27A1) Aggrecan (AGC1) Transcription factor SOX9 Housekeeping gene Ribosomal protein L30 (RPL30) Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Primers

Biotechnol Lett (2011) 33:20912101

References

CAGCCGCTTCACCTACAGC TTTTGTATTCAATCACTGTCTTGCC GCCTGGTGTCATGGGTTT GTCCCTTCTCACCAGCTTTG GAAGAGAAGGCCCCGTTG CGGTAGCCTTTAGGTCCGATA ACGGTTTGCCTGGAGCTAT ACCGTCTCGGCCATTTCT CAAGGCACCATCTCCAGGAA AAAGGGTATTTGTGGCAGCATATT TCCTCTTCCAAGCTAGAGAGGTC GGAGAATTGTGAAAATCTAGTGCT CCTGAGCCACTGAGTATGTTCATT TTGCAGGATCAGGGAAAGTGA TGGTCATCCAGCAGTCAGG TGGCAAGCTCATTGTAGTCG GGTCTCCTGCAACTTCACTCAT GCTTAGCAGGTGCAGGAAATTC TCGAGGACAGCGAGGCC TCGAGGGTGTAGCGTGTAGAGA ACGCCGAGCTCAGCAAGA CACGAACGGCCGCTTCT CCTAAGGCAGGAAGATGGTG AGTCTGCTTGTACCCCAGGA

Hautier et al. (2008) NM 001844.4 NM 001848.2 NM 001851.4 NM 000493 NM 080629.2 Khan et al. (2008) NM 004370.5 Hjorten et al. (2007) Hautier et al. (2008)

Hautier et al. (2008)

NM 000989.2

Immunohistological analysis Pellets collected after 12 and 24 days of culture were xed for 24 h in 4% neutral buffered formalin, processed in parafn wax, and then sectioned. Peroxidase staining was performed, according to the horseradish peroxidase conjugated Envision method as previously described (Freyria et al. 2004). Before their application, polyclonal antibodies to type I, type II, or type VI collagen and aggrecan (Novotec) were diluted 1:1000, 1:500, 1:1000 and 1:1000, respectively, in PBS/3% BSA. Sections were lightly counterstained using Harriss haematoxylin stain, washing in PBS between each step of the procedure. Control sections without the addition of primary antibodies were processed in parallel to rule out nonspecic

labeling. Sections were observed with a Leica DMLB microscope directly coupled to a JVC color camera ` mes SAS). (Leica Microsyste For immunouorescence staining of type II collagen, pellets were rapidly frozen at -20C in Tissue Tek OCT (Sakura Finetek Microm France). Frozen sections (5 lm thick) were xed with acetone, permeabilized with PBS/3% BSA/1% Tween20 and incubated (45 min at 20C) with a polyclonal antiserum recognizing the CR domain in the type IIA propeptide (Oganesian et al. 1997) and then diluted 1:300 in PBS/3% BSA. Following washes in PBS, sections were incubated (45 min at 20C) with secondary antibodies [Alexa-Fluor 488 goat antirabbit IgG (H ? L): AF488, Invitrogen] diluted 1:500. Fluorescent nuclear staining was obtained

123

Biotechnol Lett (2011) 33:20912101

2095

after incubation with propidium iodide diluted 1:100 in PBS, for 30 min at 20C. In some experiments, a sequential double immunostaining was carried out with, rst, immunolabeling of type II collagen (Novotec; antibodies diluted 1:300) detected with AF488, then with immunolabeling of the type IIA propeptide (Oganesian; antibodies diluted 1:300) detected by Cy3 conjugated sheep anti-rabbit IgG (Sigma), diluted 1:100. Sections were observed with a Zeiss Axioplan 2 Imaging or a Nikon E600 microscope, equipped for epiuorescence. Statistical analysis Changes in gene expression were given as fold change of FGF-2 treated compared with untreated MSCs. To determine the statistical signicance of induced gene expression (BT) compared with controls (CTL), the t-test was used. A value of P \ 0.05 was considered signicant.

Results Increases in cell proliferation and changes in BMMSC pellet morphology BM-MSCs expanded during the fourth passage in the presence of FGF-2 exhibited a shorter population doubling time than those expanded in the absence of FGF-2 (2.1 vs. 11 days). Moreover in the presence of the inducers, pellets from FGF-2-treated cells exhibited a larger diameter at day 24 (1.6 mm) in comparison to the pellets from untreated cells (1 mm). Expansion with FGF-2 accelerates chondrogenic induction and favors expression of the cartilagespecic collagens Since FGF-2 increases not only the growth rate but also maintains the multidifferentiation potential of human MSCs, we investigated whether the short-term addition of FGF-2 during the expansion step, could inuence the effects of BMP-2/TGF-b3 observed in our preliminary experiment, when cells were subsequently cultured in pellets. BM-MSCs were rst expanded in the presence or absence of 5 ng FGF-2/ ml during the fourth passage and then cultured in pellets in the presence of the BT combination.

In order to evaluate the effect of this culture condition on gene expression levels, the data are presented as a ratio (FGF-2?/FGF-2-) for each gene in Fig. 1. The data were pooled and presented as means SEM as the gene expression proles under all the culture conditions were similar for the three donors examined. First, we measured the expression level variations for several collagen genes. With FGF-2?/FGF-2- ratios close to 1, the same expression levels for COL6A1 and for COL27A1 mRNA were recorded throughout the study under all culture conditions (Fig. 1a). A similar pattern of expression was observed for COL1A1 and COL12A1 mRNA with an increase in the presence of FGF-2 only on day 12 under both culture conditions (CTL and BT). For the other collagen genes, their expression levels were maximal on day 12 in those (?FGF-2) pellets that received the inducers and levels decreased slightly over time in culture. Statistically signicant increases were recorded only on day 12 for COL9A1 (885-fold; P = 0.07), COL11A2 (540-fold; P = 0.009). For COL2A1 (311-fold; P = 0.01 and 23-fold; P = 0.06), COL10A1 (575-fold; P \ 0.001 and 75-fold; P \ 0.001) and for COL11A1 (33-fold; P = 0.02 and 12-fold; P = 0.006) increases were signicant both on day 12 and day 24. Second, we investigated the variations in expression levels for other components playing a role in ECM production during chondrogenesis (Fig. 1b). For a gene such as MMP13 the presence of FGF-2 during expansion was followed by a slight increase in the expression levels under all the culture conditions. A similar expression pattern was recorded for SOX9 and AGC1 mRNA levels, with the highest levels on day 12 in (?FGF-2) pellets receiving the inducers. When compared to the control conditions, the largest increases (56-fold; P \ 0.001) were recorded for the AGC1 mRNA level. Finally, higher expression levels were observed for all the genes in the pellets on day 24 compared to human articular chondrocytes, whatever the culture conditions (Electronic Supplementary Figs. 1 and 2). The cartilage-characteristic gene expression levels measured on day 24 in inducer-treated-pellets were higher than those in articular chondrocytes (Ach), strongly suggesting a chondrogenic conversion of MSCs. Furthermore, the greatest difference was noted for COL10A1 mRNA, certainly due to the non-hypertrophic and non-osteoarthritic characteristics of articular chondrocytes.

123

2096

Biotechnol Lett (2011) 33:20912101

A
10000 1000 100 10 1 0
CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT CTL BT COL1A1 COL2A1 COL6A1 COL9A1 COL10A1 COL11A1 COL11A2 COL12A1 COL27A1

B
100

10

0
CTL BT
AGC1

CTL

BT
SOX9

CTL

BT

MMP13

Fig. 1 a Effect of FGF-2 during MSC expansion on gene expression during subsequent culture in pellet. The levels of collagen genes associated with the chondrogenic phenotype (COL1A1, COL2A1, COL6A1, COL9A1, COL10A1, COL11A1, COL11A2, COL12A1, COL27A1) were analyzed by real-time PCR on total RNA isolated on days 1, 12 and 24 from the MSCs of three donors, amplied in the absence or presence of FGF-2 (?) during the fourth passage and further induced towards chondrogenesis in pellets in the absence (CTL) or presence of BMP-2 and TGF-b3 (BT). The results are presented as the ratio of the relative quantities corresponding to expansion (?FGF-2/-FGF-2), obtained under each condition for each donor. Data are presented as means SE and

P values are given. b Effect of FGF-2 during expansion of MSCs on gene expression during subsequent pellet culture. The levels of genes associated with the formation of chondrogenic extracellular matrix components (AGC1, SOX9 and MMP13) were analyzed by real-time PCR on total RNA isolated on days 1, 12 and 24 from MSCs of three donors, amplied in the absence or presence of FGF-2 (?) during the fourth passage and further induced towards chondrogenesis in pellet culture in the absence (CTL) or presence of BMP-2 and TGF-b3 (BT). The results are presented as the ratio of the relative quantities corresponding to expansion (?FGF-2/FGF-2), obtained under each condition for each donor. Data are presented as means SE and P values are given

Expansion with FGF-2 favors the expression of the cartilage-specic collagen isoform of type II procollagen To examine the extent of this chondrogenic conversion more closely, we analyzed the expression of the pre-cartilaginous isoform (IIA) and cartilaginous isoform (IIB) of type II procollagen. First, total type

II procollagen expression was detected, for the three donors, in the presence of BT at high levels in (?FGF-2) pellets, on days 12 and 24 (Fig. 2a, Electronic Supplementary Fig. 3), whereas in (-FGF-2) pellets it could only be detected on day 24. Second, both IIA and IIB transcripts were expressed and a sharp decrease in IIA expression occurred between days 12 and 24 (Fig. 2a). Indeed, quantitative analysis of the

123

Biotechnol Lett (2011) 33:20912101

2097

IIA and IIB amplicons showed that their relative values switched from 36:64 on day 12 to 5:95 on day 24, supporting the view that BM-MSCs had entered a chondrogenic differentiation pathway. Furthermore, these latter data differed from that measured (25:75) for human Ach which rapidly and partially dedifferentiate in monolayer culture. Finally, immunohistological analysis was carried out to visualize accumulation and localization of cartilage matrix components synthesized by the cells during the course of chondrogenic induction. As shown on Fig. 2b, type II collagen, including the type IIA isoform, was progressively synthesized and deposited in the extracellular matrix of the pellets, in a time and culture condition-dependent manner. There was more intense immunouorescent staining at the periphery of the (?FGF-2) pellets induced with BT (Fig. 2b). Immunostaining of type IIA procollagen was observed at the periphery of the pellets on day 12, showing the early presence of chondroprogenitor-like cells in the pellets, and this staining was still observed on day 24 (Fig. 2b). When peroxidase staining was used, both extracellular and intracellular labeling of type II collagen could be clearly seen on day 24 although with a non-homogenous deposition (Electronic Supplementary Fig. 4), suggesting that the cells were still metabolically active towards chondrogenic differentiation. It is also interesting to report that labeling for type VI collagen was present in the (-FGF-2) pellet more at the periphery on day 24. In the BT-treated pellet this collagen was deposited at similar locations than type II collagen and aggrecan (Electronic Supplementary Fig. 4). Altogether these immunohistological ndings also upheld the results from real-time PCR.

Discussion BM-MSCs are capable of chondrogenic differentiation in vitro in the presence of various growth factors provided during the expansion and induction steps. In this study, we found that expanding the MSCs in the presence of FGF-2 for a short-term addition during the fourth passage stimulated the cell chondrogenic conversion induced by the combination of BMP-2 and TGF-b3. The switch in expression from the precartilaginous IIA isoform to the cartilaginous IIB isoform of the type II procollagen gene and an increase

in gene expression of the main collagen types forming the primary core brillar network of cartilage supported this conversion. When we performed cell expansion with growth medium supplemented with FGF-2, we obtained data consistent with the ndings of other groups concerning the stimulatory effects of this growth factor on BM-MSC proliferation and differentiation (Solchaga et al. 2005, 2010; Varas et al. 2007). Our data are of interest as they report the effect of adding FGF-2 for a short time, at the fourth passage, in comparison to its presence during all passages in the other studies. The cell proliferation that we observed, assessed by the shortening of the population doubling time, is the mark that the cells after 3 passages in culture were still responsive to the mitogenic factor FGF-2. As in many studies the chondrogenic differentiation was induced in cells expanded with or without a cocktail of growth factors and at different passages (15) our data are not surprising and they correspond to another cell amplication condition (Ronziere et al. 2010). In the presence of the inducers (BMP-2/TGF-b3) the cells in pellets exhibited a higher chondrogenic potential with larger pellet derived from FGF-2treated cells than those made from control cells corresponding to a higher matrix synthesis as previously reported (Solchaga et al. 2005). There was an enhancing effect of FGF-2-treatment on the gene expressed in pellet cultures between days 1 and 12 mainly for the genes coding for cartilage components. Changes were about one hundred-fold for the major cartilage collagens (COL2A1, COL9A1, COL11A2 and COL10A1 mRNA) and about ten-fold for the genes coding for other cartilage specic components (AGC1 and COL11A1 mRNA). Only the levels of expression of 2 chondrogenic-specic genes COL2A1 and COL11A2 increased between days 12 and 24 attesting that it was sufcient to add FGF-2 at the passage preceding the induction to observe its chondrogenic capacity. It is still not clear how FGF-2 plays a role in chondrogenesis as several signal transduction pathways might be activated in addition to the MEK/ERK (mitogen-activated protein kinase kinase/extracellular-signal regulated kinase) cascade and the Wnt signaling by FGFs stimulation described in these cells (Bobick et al. 2007; Solchaga et al. 2010). As FGFs and their receptors play fundamental roles regulating growth morphogenesis and cartilage formation in

123

2098

Biotechnol Lett (2011) 33:20912101

Fig. 2 a Expression of the type II procollagen gene, COL2A1 (total) and isoforms IIA and IIB in pellet culture. MSCs were rst expanded in the absence or presence of FGF-2 (?) and further induced towards chondrogenesis in pellet culture in the absence or presence of BMP-2 and TGF-b3 (BT). Total RNA were extracted from the pellets after 12 and 24 days of culture and measured by conventional PCR, using specic primers. GAPDH was used as the housekeeping gene. Data are obtained from one donor representative of all three. b Collagen type II deposition by MSCs in pellet culture. The pellets were obtained

as described in Fig. 2a. The pellets were xed and immunostained for type II collagen using a polyclonal antibody against the triple helical domain (total type II collagen) and a polyclonal antibody against the CR domain (propeptide of type IIA collagen) (green collagen, red nucleus). Bar 250 lm. Inset double-stained immunouorescence for type II collagen (triple helix staining, Alexa Fluor 488) and type IIA collagen (propeptide IIA staining, Cy3 labeled antibodies) under 24-day culture (green collagen). Bar 500 lm. Results are obtained from one representative of three independent experiments

embryonic limbs further studies have to be conducted to describe and understand the precise role of FGFs on in vitro MSC chondrogenesis. The chondrogenesis, in our culture conditions, was not totally efcient in the pellets as the ECM was not homogeneously deposited around the cells in FGF-2 treated samples contrary to previously reported data with FGF-2 present at all passages (Solchaga et al. 2005). Beside

the differences in cell harvesting, donor variability and culture conditions in different laboratories these data likely correspond to the heterogeneity of the cell population after the expansion steps (Kastrinaki et al. 2008). Chondrogenic conversion was also clearly shown on day 12 by the expression of both the IIA and IIB forms of procollagen type II and on day 24 by the

123

Biotechnol Lett (2011) 33:20912101

2099

switch in expression from type IIA to type IIB. In addition, type II collagen synthesis (including the type IIA form) was only detected in (?FGF-2) pellets treated with BT. Importantly, the switch was observed under these culture conditions with cells obtained from three donors. Indeed, this combination overtook donor-to-donor phenotypic differences that were observed in the other culture conditions (Electronic Fig. 3). Thus, our data show that measuring the procollagen IIA: procollagen IIB ratio gives a useful index of chondrogenic induction during the culture of MSCs. Moreover, Murdoch demonstrated that only 4 days were necessary for a complete switch of phenotype in Transwell culture, while more than 12 days were required in pellet culture, implying that the microenvironment of the MSCs played a role together with the addition of growth factors (Murdoch et al. 2007). Our data also showed that the increase in gene expression was correlated with an increase in ECM synthesis, as attested by immunostaining of type II collagen and aggrecan in the pellets. The fact that type IIA procollagen, the nonchondrogenic form of type II collagen, was still present at day 24 in the pellet is likely an indicator of an incomplete or slow chondrogenesis in our culture model in comparison with, for example, the Transwell culture. However, our model may be used to study the mechanisms involved in the synthesis of type II collagen and it organization in the ECM during MSC chondrogenesis. We also paid particular attention to the expression of collagens rarely studied in the context of MSCs and not investigated in an in vitro model of chondrogenesis. We found that BM-MSC cultures expressed COL6A1, COL12A1 and COL27A1, three genes coding for proteins previously described as playing a structural role in the perichondrocytic matrix and at the bone cartilage interface (Alexopoulos et al. 2009; Gregory et al. 2001; Hjorten et al. 2007). Interestingly, these three genes appeared not to response, contrary to the other collagen genes, to the addition of FGF-2 during cell expansion. Furthermore, COL12A1 and COL27A1 genes appeared to be up-regulated by the combination of inducers but not COL6A1 gene, which was unresponsive to the culture conditions of the study. Along this study we were able to visualize type VI collagen which, in normal articular cartilage, has an exclusive location in the pericellular matrix together with proteoglycan,

bronectin and type II and IX collagens (Poole et al. 1997). Type VI was recently reported as an integrating molecule in a Col6a1-knockout mice as its deciency led to an alteration in the biologic and mechanical environment of the chondrocyte (Alexopoulos et al. 2009). Thus our nding of the presence of type VI collagen together with type II collagen and aggrecan in the pellets indicates that the cells accumulate a cartilage-like matrix with an organization of the molecules not yet characteristic of native articular chondrocytes. Chondrogenesis is a dynamic process where ECM production is constantly changing. Thus the presence of different type of collagens described to play a role in the alignment of the brils (type XII collagen) or in the later stages of the cartilage to bone formation to likely offer a transient scaffold for cartilage mineralization (type XXVII collagen) may be required to produce different cell matrix interactions corresponding to a specic stage of the chondrogenic program (Gregory et al. 2001; Hjorten et al. 2007; Plumb et al. 2007). Additional studies will be required to more completely describe and understand the role of these collagens in chondrogenesis.

Conclusion The competency of MSCs for chondrogenesis, under treatment with BMP-2 and TGF-b3, is accelerated and enhanced by the presence of FGF-2, during cell amplication at the passage preceding the induction. This was particularly demonstrated by the induction of a subset of genes coding for collagens forming the primary core of the brillar cartilage network. However, the persistent expression of COL1A1, a marker gene for mesenchymal cells, and the induction of COL10A1 expression observed in our cell model and in other studies indicate that turning off these expressions, and thus the deposition of non cartilage-characteristic proteins, should be one of the main future aims in cartilage therapy strategies that use MSCs as a cell source. For instance, the use of decoy or siRNA strategies targeting transactivators of the genes could be considered in further studies.
Acknowledgments This work was supported by Cluster crypHandicap Vieillissement NeuroSciences (HVN) (De tage des interactions des cellules souches avec la matrice

123

2100 cessaires a ` leur conversion en chondrocytes) extracellulaire ne gion Rho ne-Alpes. The authors would like to thank from the Re Dr L J Sandell (Washington University School of Medicine, St Louis, MO, USA) for rabbit antiserum against recombinant human type IIA and Sylviane Guerret (Novotec, Lyon, France) for ne tique and her expertise in histological analysis. The Analyse Ge Platim platforms of IFR 128 are gratefully acknowledged for the use of the iCycler iQ (BioRad) and the Nikon E600 microscope.

Biotechnol Lett (2011) 33:20912101 P, Jacquet R, Landis WJ, Byers PH, Pace JM (2007) Type XXVII collagen at the transition of cartilage to bone during skeletogenesis. Bone 41:535542 Karlsson C, Brantsing C, Svensson T, Brisby H, Asp J, Tallheden T, Lindahl A (2007) Differentiation of human mesenchymal stem cells and articular chondrocytes: analysis of chondrogenic potential and expression pattern of differentiation-related transcription factors. J Orthop Res 25:152163 Kastrinaki MC, Andreakou I, Charbord P, Papadaki HA (2008) Isolation of human bone marrow mesenchymal stem cells using different membrane markers: comparison of colony/ cloning efciency, differentiation potential, and molecular prole. Tissue Eng C Methods 14:333339 Khan WS, Tew SR, Adesida AB, Hardingham TE (2008) Human infrapatellar fat pad-derived stem cells express the pericyte marker 3G5 and show enhanced chondrogenesis after expansion in broblast growth factor-2. Arthritis Res Ther 10(4):R74 Khan WS, Johnson DS, Hardingham TE (2010) The potential of stem cells in the treatment of knee cartilage defects. Knee 17(6):369374 Marsano A, Millward-Sadler SJ, Salter DM, Adesida A, Hardingham T, Tognana E, Kon E, Chiari-Grisar C, Nehrer S, Jakob M, Martin I (2007) Differential cartilaginous tissue formation by human synovial membrane, fat pad, meniscus cells and articular chondrocytes. Osteoarthr Cartil 15:4858 Mehlhorn AT, Schmal H, Kaiser S, Lepski G, Finkenzeller G, Stark GB, Sudkamp NP (2006) Mesenchymal stem cells maintain TGF-beta-mediated chondrogenic phenotype in alginate bead culture. Tissue Eng 12:13931403 Merceron C, Vinatier C, Portron S, Masson M, Amiaud J, Guigand L, Cherel Y, Weiss P, Guicheux J (2009) Differential effects of hypoxia on osteochondrogenic potential of human adipose-derived stem cells. Am J Physiol Cell Physiol 298:C355C364 Miyanishi K, Trindade MC, Lindsey DP, Beaupre GS, Carter DR, Goodman SB, Schurman DJ, Smith RL (2006) Doseand time-dependent effects of cyclic hydrostatic pressure on transforming growth factor-beta3-induced chondrogenesis by adult human mesenchymal stem cells in vitro. Tissue Eng 12:22532262 Murdoch AD, Grady LM, Ablett MP, Katopodi T, Meadows RS, Hardingham TE (2007) Chondrogenic differentiation of human bone marrow stem cells in transwell cultures: generation of scaffold-free cartilage. Stem Cells 25:27862796 Oganesian A, Zhu Y, Sandell LJ (1997) Type IIA procollagen amino propeptide is localized in human embryonic tissues. J Histochem Cytochem 45:14691480 Pelttari K, Winter A, Steck E, Goetzke K, Hennig T, Ochs BG, Aigner T, Richter W (2006) Premature induction of hypertrophy during in vitro chondrogenesis of human mesenchymal stem cells correlates with calcication and vascular invasion after ectopic transplantation in SCID mice. Arthritis Rheum 54:32543266 Petit B, Freyria AM, van der Rest M, Herbage D (1992) Cartilage collagens. In: Adolphe M (ed) Biological regulation of the chondrocytes. CRC, Boca Raton, pp 3384 Plumb DA, Dhir V, Mironov A, Ferrara L, Poulsom R, Kadler KE, Thornton DJ, Briggs MD, Boot-Handford RP (2007)

References
Aigner T, Zhu Y, Chansky HH, Matsen FA 3rd, Maloney WJ, Sandell LJ (1999) Reexpression of type IIA procollagen by adult articular chondrocytes in osteoarthritic cartilage. Arthritis Rheum 42:14431450 Alexopoulos LG, Youn I, Bonaldo P, Guilak F (2009) Developmental and osteoarthritic changes in Col6a1-knockout mice: biomechanics of type VI collagen in the cartilage pericellular matrix. Arthritis Rheum 60:771779 Bobick BE, Thornhill TM, Kulyk WM (2007) Fibroblast growth factors 2, 4, and 8 exert both negative and positive effects on limb, frontonasal, and mandibular chondrogenesis via MEK-ERK activation. J Cell Physiol 211: 233243 Cortial D, Gouttenoire J, Rousseau CF, Ronziere MC, Piccardi N, Msika P, Herbage D, Mallein-Gerin F, Freyria AM (2006) Activation by IL-1 of bovine articular chondrocytes in culture within a 3D collagen-based scaffold. An in vitro model to address the effect of compounds with therapeutic potential in osteoarthritis. Osteoarthr Cartil 14: 631640 Cournil-Henrionnet C, Huselstein C, Wang Y, Galois L, Mainard D, Decot V, Netter P, Stoltz JF, Muller S, Gillet P, Watrin-Pinzano A (2008) Phenotypic analysis of cell surface markers and gene expression of human mesenchymal stem cells and chondrocytes during monolayer expansion. Biorheology 45:513526 Freyria AM, Cortial D, Ronziere MC, Guerret S, Herbage D (2004) Inuence of medium composition, static and stirred conditions on the proliferation of and matrix protein expression of bovine articular chondrocytes cultured in a 3-D collagen scaffold. Biomaterials 25:687697 Freyria AM, Courtes S, Mallein-Gerin F (2008) [Differentiation of adult human mesenchymal stem cells: chondrogenic effect of BMP-2]. Pathol Biol (Paris) 56:326333 in French Gregory KE, Keene DR, Tufa SF, Lunstrum GP, Morris NP (2001) Developmental distribution of collagen type XII in cartilage: association with articular cartilage and the growth plate. J Bone Miner Res 16:20052016 Hautier A, Salentey V, Aubert-Foucher E, Bougault C, Beauchef G, Ronziere MC, De Sobarnitsky S, Paumier A, Galera P, Piperno M, Damour O, Mallein-Gerin F (2008) Bone morphogenetic protein-2 stimulates chondrogenic expression in human nasal chondrocytes expanded in vitro. Growth Factors 26:201211 Hjorten R, Hansen U, Underwood RA, Telfer HE, Fernandes RJ, Krakow D, Sebald E, Wachsmann-Hogiu S, Bruckner

123

Biotechnol Lett (2011) 33:20912101 Collagen XXVII is developmentally regulated and forms thin brillar structures distinct from those of classical vertebrate brillar collagens. J Biol Chem 282:1279112795 Poole CA, Gilbert RT, Herbage D, Hartmann DJ (1997) Immunolocalization of type IX collagen in normal and spontaneously osteoarthritic canine tibial cartilage and isolated chondrons. Osteoarthr Cartil 5:191204 Ronziere MC, Perrier E, Mallein-Gerin F, Freyria AM (2010) Chondrogenic potential of bone marrow- and adipose tissue-derived adult human mesenchymal stem cells. Biomed Mater Eng 20:145158 Sandell LJ, Morris N, Robbins JR, Goldring MB (1991) Alternatively spliced type II procollagen mRNAs dene distinct populations of cells during vertebral development: differential expression of the amino-propeptide. J Cell Biol 114:13071319 Schmitt B, Ringe J, Haupl T, Notter M, Manz R, Burmester GR, Sittinger M, Kaps C (2003) BMP2 initiates chondrogenic lineage development of adult human mesenchymal stem cells in high-density culture. Differentiation 71:567577 Sekiya I, Larson BL, Vuoristo JT, Reger RL, Prockop DJ (2005) Comparison of effect of BMP-2, -4, and -6 on in vitro cartilage formation of human adult stem cells from bone marrow stroma. Cell Tissue Res 320:269276 Shen B, Wei A, Tao H, Diwan AD, Ma DD (2009) BMP-2 enhances TGF-beta3-mediated chondrogenic differentiation of human bone marrow multipotent mesenchymal stromal cells in alginate bead culture. Tissue Eng A 15: 13111320

2101 Solchaga LA, Penick K, Porter JD, Goldberg VM, Caplan AI, Welter JF (2005) FGF-2 enhances the mitotic and chondrogenic potentials of human adult bone marrow-derived mesenchymal stem cells. J Cell Physiol 203:398409 Solchaga LA, Penick K, Goldberg VM, Caplan AI, Welter JF (2010) Fibroblast growth factor-2 enhances proliferation and delays loss of chondrogenic potential in human adult bone-marrow-derived mesenchymal stem cells. Tissue Eng A 16:10091019 Tew SR, Murdoch AD, Rauchenberg RP, Hardingham TE (2008) Cellular methods in cartilage research: primary human chondrocytes in culture and chondrogenesis in human bone marrow stem cells. Methods 45:29 Varas L, Ohlsson LB, Honeth G, Olsson A, Bengtsson T, Wiberg C, Bockermann R, Jarnum S, Richter J, Pennington D, Johnstone B, Lundgren-Akerlund E, Kjellman C (2007) Alpha10 integrin expression is up-regulated on broblast growth factor-2-treated mesenchymal stem cells with improved chondrogenic differentiation potential. Stem Cells Dev 16:965978 Vilamitjana-Amedee J, Bareille R, Rouais F, Caplan AI, Harmand MF (1993) Human bone marrow stromal cells express an osteoblastic phenotype in culture. In Vitro Cell Dev Biol Anim 29A:699707 Zhu Y, Oganesian A, Keene DR, Sandell LJ (1999) Type IIA procollagen containing the cysteine-rich amino propeptide is deposited in the extracellular matrix of prechondrogenic tissue and binds to TGF-beta1 and BMP-2. J Cell Biol 144:10691080

123