Supplemental Information Low genetic diversity in tepui summit vertebrates

P.J.R. Kok, R.D. MacCulloch, D.B. Means, K. Roelants, I. Van Bocxlaer, F. Bossuyt

Supplemental Materials and Methods Area of study and taxon sampling Many tepui summit taxa are apparently rare, or at least difficult to collect, and many summit species are known only from very few specimens, often only the type series. Technical (most of these flat-topped mountains are only reachable by helicopter) and financial aspects have always seriously hindered extensive sampling for detailed and in-depth phylogenetic analyses of large datasets. Over the past years, we managed to visit a total of 17 tepui summits/massifs and numerous uplands/lowlands localities in the Eastern Pantepui region and in other areas within the Guiana Shield, and obtained specimens and tissue samples of a considerable number of tepui taxa of almost all families represented on tepui tops. Some additional material was obtained from colleagues (see Acknowledgments). All specimens collected during our field surveys are housed in the collections of the Royal Belgian Institute of Natural Sciences, Belgium, the Royal Ontario Museum, Canada, and the National Museum of Natural History, USA. Tissue samples were deposited in the Amphibian Evolution Lab, Biology Department, Vrije Universiteit Brussel and in the Royal Ontario Museum. Additionally, we included useful sequences from GenBank in our phylogenetic analyses. A list of taxa and GenBank accession numbers is given in Supplemental Table 1.

Choice of markers The mitochondrial 16S rDNA gene was first selected because it is reported as performing well for DNA barcoding in amphibians and to detect candidate species [S2S5]. Because genetic divergences were surprisingly low among summit species/populations and among summit/uplands species/populations we also sequenced a faster protein-coding gene. Protein-coding genes are powerful markers for inferring evolutionary history in lower taxonomic categories such as families, genera and species [S6] and the subunit 1 of the NADH gene, shown to evolve at least 4 times faster than 16S, was therefore convenient for our purpose.

DNA extraction, PCR, sequencing and sequence alignment Tissue samples (thigh muscle or liver) were taken in the field and stored in 95% ethanol. Total genomic DNA was extracted and purified using the Qiagen DNeasy Tissue Kit following manufacturers instructions. Fragments of the mitochondrial ribosomal gene 16S (ca. 550 bp) and of the protein-coding gene NADH subunit 1 (ND1, ca. 650-730 bp) were amplified and sequenced using the primers listed in Supplemental Table 2 under previously described PCR conditions [S7]. PCR products were checked on a 1% agarose gel and purified with the Qiagen PCR purification kit following manufacturers instructions. PCR fragments were sequenced on both strands using the BigDye cycle sequencing kit (Applied Biosystems) on an ABI 3100 automated sequencer. Chromatograms were read using the Staden package [S8] and a consensus sequence was assembled from the forward and reverse primer sequences. ClustalX 2.0.11 [S9] was used to perform preliminary alignment using default parameters. Minor alignment corrections were made using MacClade 4.06 [S10] and the protein-coding gene ND1 was translated into amino-acid sequences to check for

unexpected stop codons that would indicate the presence of pseudogenes. When present, ambiguous regions were excluded from subsequent analyses.

Phylogenetic Analyses Uncorrected pairwise distances were estimated using PAUP* 4.0b10 [S11] (Supplemental Tables 310). For each of the six taxa studied, their closest known relatives according to previous phylogenetic studies were selected as outgroup taxa: Rheobates and Dendrobates for Anomaloglossus [S12], Atelopus for Oreophrynella [S7], Eleutherodactylus and Stefania for Pristimantis [S13], Pristimantis and Gastrotheca for Stefania [S14], Osteocephalus for Tepuihyla [S15], and Ameiva for the Gymnophthalmidae [S16]. Maximum Parsimony (MP) analyses of the concatenated 16S+ND1 dataset were performed in PAUP* as a heuristic search with TBR branch swapping and 1,000 random addition sequence replicates; bootstrap support was estimated with full heuristic search and 10,000 replicates. Maximum Likelihood (ML) analyses were conducted in PAUP* for the 16S+ND1 dataset under the model of nucleotide substitution selected by jModelTest 0.1.1 [S17]; bootstrap support was estimated with fast stepwise-addition and 500 replicates. Clade credibility was also estimated by Bayesian posterior probabilities (BPP) in MrBayes 3.2.1 [S18]. The Bayesian analyses implemented a mixed general time-reversible model (GTR + G + I) partitioned over the different gene fragments, flat Dirichlet priors for base frequencies and substitution rate matrices and uniform priors for among-site rate parameters. Two parallel Markov chain Monte Carlo (MCMC) runs of four incrementally heated (temperature parameter = 0.2) chains were performed, with a length of 6,000,000 generations, a sampling frequency of 1 per 1,000 generations, and a burn-in corresponding to the first 1,000,000 generations.

Convergence of the parallel runs was confirmed by split frequency SDs (<0.01) and potential scale reduction factors (1.0) for all model parameters, as reported by MrBayes. Adequate posterior sampling was verified using Tracer 1.4 [S19] if the runs had reached effective sampling sizes >200 for all model parameters. MrBayes trees are provided in Supplemental Figure 2.

Estimation of divergence times Recent phylogenetic studies have indicated that some taxa endemic to the Pantepui region originated in the Tertiary [e.g. S7, S20, S21]. However, the dynamics of faunal interchange among tepui summits has never been studied with molecular data. Molecular clock estimation of recent divergence times poses certain problems that are not addressed by the dating methods implemented in any of the frequently used computer programs like R8s [S22], Multidivtime [S23], and BEAST [S24]. Mitochondrial gene fragments that are commonly used to estimate divergence ages for ancient nodes may fail to provide accurate age estimates for very recent divergences due to an apparent time-dependency of evolutionary rates [S25S27]. Moreover, fast-evolving genes are likely to show substitutional saturation towards the past [S28], resulting in a nonlinear relationship between sequence divergence and the actual time since divergence. The likelihood models implemented in the commonly used molecular clock methods [S2224] are supposed to partially correct for substitutional saturation (by being capable to detect more hidden homoplasy than e.g. the maximum parsimony method). However, in the absence of recent calibration points, these molecular clock methods may still lead to considerable overestimation of recent divergence times as a result of saturation [S29].

The lack of a linear correlation between sequence divergence and time since divergence can be corrected by using correction curves [e.g. S25]. We used a saturation curve to correct substitutional saturation in the NADH-subunit 1 (ND1) fragment. This curve is described by the following function: d(t) = Dsat (1 et/T), where d is the uncorrected genetic distance between a pair of sequences, t is the divergence time between these sequences, Dsat is the sequence divergence at substitutional saturation (i.e. the maximum expected divergence between two DNA sequences), and is the time required to reach a sequence divergence of Dsat (1 e1) = 63.2% of Dsat. In other words, the shape of the saturation curve is determined by a parameter describing the expected sequence divergence at saturation (Dsat) and a parameter determining the rate at which the curve approaches saturation through time (T). This is analogous to saturation curves used in e.g. Michaelis-Menten enzyme kinetics. A saturation function allows us to obtain divergence time estimates for very recent nodes based on a fast-evolving gene by using divergence time estimates for older nodes that were based on slowly evolving genes. We proceeded through the following steps to obtain divergence times: First, we plotted uncorrected pairwise distances for the ND1 gene fragment of 260 Hyloidea representatives (in this case bufonid taxa) against their divergence times inferred from relaxed clock analyses of two nuclear and nine mitochondrial genes in a previous study [S7]. The resulting scatter plot clearly indicates substitutional saturation in the ND1 gene, with genetic distances levelling out at approximately 20% divergence (Supplemental Figure 3). Second, we used nonlinear regression based on the abovementioned function to estimate the best-fitting saturation curve through this scatter plot. This was done by searching the optimal values for Dsat and T using the Solver add-in in MS Excel

(Microsoft, 2008). The best fitting saturation curve (R2 = 0.641) corresponds to Dsat = 19.67% and T = 7.732 myr. Because the abovementioned time dependency of mitochondrial evolutionary rates may have also affected most recent divergence times in Van Bocxlaer et al. [S7] we additionally estimated a saturation curve on a scatter plot excluding all bufonid sequence divergences below 10%. Although this resulted in a reduced fit (R2 = 0.256), the resulting curve was nearly identical to the original one, with Dsat = 19.71% and T = 7.867 myr. Third, we used the obtained saturation curve and optimized parameters to convert uncorrected pairwise distances between two sequences from different tepui summits (we selected the highest and most isolated ones from which we have samples) and between a sequence from a tepui summit and the nearest sequence from upland into approximate divergence times. For each of the observed distances, the approximate divergence time using our saturation function corresponds to: t = T ln[1(d/Dsat)].

Supplemental Acknowledgments We are indebted to C. L. Barrio-Amors, C. Brewer-Caras, O. Fuentes, L. Minter, and J. Mesa for providing critical additional tissue samples and to C. Brewer-Caras for the photograph of Mount Roraima used in the main text. Research and export permits were issued by the Guyana Environmental Protection Agency.

Supplemental References S1. McPherson, S. (2008). Lost Worlds of the Guiana Highlands (Dorset: Redfern Nat. Hist. Prod.). S2. Vences, M. Thomas, M., Bonett, R.M., and Vieites, D.R. (2005). Deciphering amphibian diversity through DNA barcoding: chances and challenges. Philos. Trans. R. Soc. Lond. B Biol. Sci. 360, 1859-1868. S3. Vences, M., Thomas, M., van der Meijden, A., Chiari, Y., and Vieites, D.R. (2005). Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians. Front. Zool. 2, 5. S4. Fouquet, A., Gilles, A., Vences, M., Marty, C., Blanc, M., and Gemmell, N.J. (2007). Underestimation of species richness in Neotropical frogs revealed by mtDNA analyses. PLoS One 2, e1109. S5. Glaw, F., Khler, J., De La Riva, I., Vieites, D.R., and Vences, M. (2010). Integrative taxonomy of Malagasy treefrogs: combination of molecular genetics, bioacoustics and comparative morphology reveals twelve additional species of Boophis. Zootaxa 2383, 1-82. S6. Wan, Q.-H., Wu, H., Fujihara, T., and Fang, S.-G. (2004). Which genetic marker for which conservation genetics issue? Electrophoresis 25, 2165-2176. S7. Van Bocxlaer, I., Loader, S.P., Roelants, K., Biju, S.D., Menegon, M., and Bossuyt, F. (2010). Gradual adaptation toward a range-expansion phenotype initiated the global radiation of toads. Science 327, 679-682. S8. Bonfield, J.K., Smith, K.F., and Staden, R. (1995). A new DNA sequence assembly program. Nucleic Acids Res. 23, 4992-4999. S9. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. (1997). The CLUSTAL_X windows interface: flexible strategies for multiple

sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 48764882. S10. Maddison, D.R., and Maddison, W.P. (2000). MacClade version 4: Analysis of phylogeny and character evolution (Sinauer Associates, Sunderland, Massachusetts). S11. Swofford, D.L. (2002). PAUP* 4.0 Phylogenetic analysis using parsimony (*and other methods) (Sinauer Associates, Sunderland, Massachusetts). S12. Grant, T., Frost, D.R., Caldwell, J.P., Gagliardo, R., Haddad, C.F.B., Kok, P.J.R., Means, D.B., Noonan, B.P., Schargel, W.E., and Wheeler, W.C. (2006). Phylogenetic systematics of dart-poison frogs and their relatives (Amphibia: Athesphatanura: Dendrobatidae). B. Am. Mus. Nat. Hist. 299, 1-262. S13. Wiens, J.J., Kuczynski, C.A., Duellman, W.E., and Reeder, T.W. (2007). Loss and re-evolution of complex life cycles in marsupial frogs: does ancestral trait reconstruction mislead? Evolution 61-8, 1886-1889. S14. Hedges, S.B., Duellman, W.E., and Heinicke, M.P. (2008). New World directdeveloping frogs (Anura: Terrarana): molecular phylogeny, classification,

biogeography, and conservation. Zootaxa 1737, 1-182. S15. Faivovich, J., Haddad, C.F.B., Garcia, P.C.A., Frost, D.R., Campbell, J.A., and Wheeler, W.C. (2005). Systematic review of the frog family Hylidae, with special reference to Hylinae: phylogenetic analysis and taxonomic revision. B. Am. Mus. Nat. Hist. 294, 1-240. S16. Pellegrino, K.C.M., Rodrigues, M.T., Yonenaga-Yassuda, Y., and Sites Jr., J.W. (2001). A molecular perspective on the evolution of microteiids lizards (Squamata, Gymnophthalmidae), and a new classification for the family. Biol. J. Linn. Soc. 74, 315-338.

S17. Posada, D. (2008). jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25, 1253-1256. S18. Ronquist, F., and Huelsenbeck, J.P. (2003). MrBayes version 3.0: Bayesian phylogenetic inference under mixed models. Bioinformatics 19, 1572-1574. S19. Rambaut, A., and Drummond, A.J. (2007). Tracer version 1.4, available at http://beast.bio.ed.ac.uk/Tracer. S20. Givnish, T.J., Millam, K.C., Evans, T.M., Hall, J.C., Pires, J.C., Berry, P.E., and Sytsma, K.J. (2004). Ancient vicariance or recent long-dispersal? Inferences about phylogeny and South American-African disjunctions in Rapateaceae and

Bromeliaceae based on ndhF sequence data. Int. J. Plant. Sci. 165, S35-S54. S21. Heinicke, M.P., Duellman, W.E., Trueb, L., Means, D.B., MacCulloch, R.D., and Hedges, B. (2009). A new frog family (Anura: Terrarana) from South America and an expanded direct-developing clade revealed by molecular phylogeny. Zootaxa 2211, 1-35. S22. Sanderson, M.J. (2003). r8s: inferring absolute rates of molecular evolution and divergence times in the absence of a molecular clock. Bioinformatics 19, 301-302. S23. Thorne, J.L., and Kishino, H. (2002). Divergence time estimation and rate evolution with multilocus data sets. Syst. Biol. 51, 689-702. S24. Drummond, A.J., Ho, S.Y.W., Phillips, M.J., and Rambaut, A. (2006). Relaxed phylogenetics and dating with confidence. PLoS Biol. 4, e88. S25. Ho, S.Y.W., Phillips, M.J., Cooper, A., and Drummond, A.J. (2005). Time dependency of molecular rate estimates and systematic overestimation of recent divergence times. Mol. Biol. Evol. 22, 1561-1568.

S26. Subramanian, S., Denver, D.R., Millar, C.D., Heupink, T., Aschrafi, A., Emslie, S.D., Baroni, C., and Lambert, D.M. (2009). High mitogenomic evolutionary rates and time dependency. Trends Genet. 25, 482-486. S27. Ho, S.Y.W., Lanfear, R., Bromham, L., Phillips, M.J., Soubrier, J., Rodrigo, A.G., and Cooper, A. (2011). Time-dependent rates of molecular evolution. Mol. Ecol. 20, 3087-3101. S28. Rokas, A., and Carroll, S.B. (2006). Bushes in the Tree of Life. PLoS Biol. 4, e352. S29. Zheng, Y., Peng, R., Kuro-o, M., and Zeng, X. (2011). Exploring patterns and extent of bias in estimating divergence time from mitochondrial DNA sequence data in a particular lineage: a case study of salamanders (Order Caudata). Mol. Biol. Evol. 28, 2521-2535.

10

Supplemental Table 1. List of taxa used in this study and GenBank accession numbers. Sequences newly generated are in boldface.
Tissue sample n VUB3321 VUB3735 VUB3568 VUB3570 VUB3730 VUB3731 VUB3732 VUB3054 VUB3106 VUB3107 VUB3530 VUB3531 VUB3055 VUB3056 Genbank Genbank VUB3057 VUB3086 VUB3087 Genbank Genbank Genbank VUB3733 GenBank GenBank VUB3128 VUB3126 VUB3092 VUB3093 VUB3527 VUB3525 VUB3526 GenBank VUB3734 VUB3736 VUB3737 VUB3573 VUB3132 GenBank Museum n IRSNB15863 Uncatalogued IRSNB15849 IRSNB15848 IRSNB13741 IRSNB13752 ROM39635 IRSNB14454 ROM43327 ROM43333 ROM44102 ROM44104 IRSNB1986 IRSNB14410 CPI10198 CPI10208 IRSNB15864 IRSNB15865 IRSNB15851 CPI10216 CPI10217 Untagged tadpoles Uncatalogued UTAA56469 UTAA56710 ROM43892 ROM43902 ROM43320 ROM43323 ROM44110 ROM44112 ROM44113 MJH3950 Uncatalogued Uncatalogued IRSNB15781 PK3306 IRSNB14477 TNHC64416 16S JQ742236 JQ742102 JQ742125 JQ742126 JQ742107 JQ742108 JQ742109 JQ742110 JQ742116 JQ742117 JQ742123 JQ742124 ##### ##### DQ502255 DQ502256 ##### ##### ##### DQ502258 DQ502259 DQ502260 JQ742101 DQ502249 DQ502254 JQ742119 JQ742118 ##### JQ742115 JQ742122 JQ742120 JQ742121 DQ502108 JQ742104 JQ742103 JQ742148 JQ742150 JQ742149 HQ290991 ND1 JQ742403 JQ742283 JQ742302 JQ742303 ##### ##### JQ742287 ##### JQ742293 JQ742294 JQ742300 JQ742301 JQ742285 JQ742286 ##### ##### JQ742288 JQ742289 JQ742290 ##### ##### ##### ##### ##### ##### JQ742296 JQ742295 JQ742291 JQ742292 JQ742299 JQ742297 JQ742298 ##### ##### JQ742284 JQ742324 ##### ##### HQ290991 Order Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Genus "Hyla" Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Anomaloglossus Atelopus Atelopus Atelopus Dendrobates Species warreni verbeeksnyderorum aff. degranvillei baeobatrachus beebei beebei beebei kaiei kaiei kaiei kaiei kaiei megacephalus praderioi praderioi praderioi roraima roraima roraima roraima roraima roraima rufulus sp "Brownsberg" sp "Tomasing" sp A sp A sp B sp B sp C sp C sp C stepheni tepuyensis wothuja aff. hoogmoedi franciscus hoogmoedi tinctorius Locality Maringma Tepui Kaw Mountain Angoulme Kaieteur National Park Kaieteur National Park Mt Ayanganna Kaieteur National Park Wokomung Massif Wokomung Massif Meamu River Meamu River Maringma Tepui Maringma Tepui Roraima Tepui Roraima Tepui Maringma Tepui Wei Assipu Tepui Wei Assipu Tepui Roraima Tepui Roraima Tepui Roraima Tepui Churi Tepui Brownsberg Mt Tomasing Wokomung Massif Wokomung Massif Wokomung Massif Wokomung Massif Seroun River Merume Mountain Meamu River Manaus Auyantepui Cerro Sipapo Iwokrama Forest Angoulme Kaieteur National Park Sipaliwini Country Guyana Venezuela French Guiana French Guiana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Venezuela Suriname Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Brazil Venezuela Venezuela Guyana French Guiana Guyana Suriname Coordinates N 512'15" W 6034'38" N 523' W 6734' N 432'41" W 5209'09" N 524'38" W 5339'23" N 510' W 5929' N 508' W 5924' N 524' W 5957' N 508' W 5924' N 506'35" W 5948'37" N 506'35" W 5948'37" N 616'21" W 6029'59" N 611'44" W 6028'48" N 512'37" W 6033'59" N 512'16" W 6034'39" N 516'30" W 6043'00" N 516'30" W 6043'00" N 512'59" W 6035'05" N 512'58" W 6042'16" N 512'58" W 6042'16" N 515'30" W 6043'30" N 515'30" W 6043'30" N 515'30" W 6043'30" N 516' W 6200' N 504' W 5458' N 544'22" W 6017'51" N 506'35" W 5948'37" N 505'33" W 5950'35" N 507'46" W 5949'16" N 505'33" W 5950'35" N 608'11" W 6022'46" N 556'03" W 6009'24" N 611'44" W 6028'48" S 257' W 5955' N 546' W 6233' N 505' W 6727' N 419'60" W 5848'00" N 524'38" W 5339'23" N 508' W 5924' N 200' W 5604' Elevation (m) 1376 56 221 22 440 580 1490-1550 580 700 700 664 781 1060 1376 1310 1310 2147 2216 2216 1860-2350 1860-2350 1860-2350 ca. 2325 80 550 700 1411 1234 1400 695 950 781 100 ca. 2100 150 67 22 580 300

11

VUB1624 VUB1036 Genbank VUB985 VUB3372 VUB3532 VUB3533 VUB3065 VUB3067 VUB3142 VUB3534 VUB3535 VUB3537 VUB3536 VUB3635 VUB3068 VUB3698 VUB3713 VUB3061 VUB3145 VUB3146 VUB3058 VUB3069 VUB3738 VUB3739 VUB3740 VUB3387 VUB3380 VUB3382 VUB3674 VUB3751 VUB3485 VUB3491 VUB3741 VUB3742 VUB3743 VUB3744 VUB3745 VUB3746 VUB3499 VUB3747 VUB3748 VUB3626 VUB3493 GenBank

Uncatalogued Uncatalogued JLG09 Uncatalogued IRSNB15870 ROM39651 ROM46402 IRSNB14364 IRSNB14366 IRSNB14334 ROM46405 ROM46413 ROM46429 ROM46432 CPI10594 IRSNB14389 IRSNB15704 IRSNB15732 IRSNB14347 IRSNB15866 IRSNB1979 IRSNB1980 IRSNB14398 IRSNB15760 IRSNB15761 Uncatalogued IRSNB14673 IRSNB14656 IRSNB14657 IRSNB15634 IRSNB15786 IRSNB14471 IRSNB12862 IRSNB15643 IRSNB15820 IRSNB15821 IRSNB15824 IRSNB15825 IRSNB4152 IRSNB4153 IRSNB4154 Uncatalogued (egg) Uncatalogued IRSNB15867 KU181015

FJ882750 FJ882745 AY843592 AY948744 JQ742239 JQ742139 JQ742140 JQ742141 JQ742142 JQ742143 JQ742144 JQ742145 JQ742147 JQ742146 JQ742135 JQ742136 JQ742137 JQ742138 JQ742133 JQ742134 JQ742132 JQ742131 JQ742130 JQ742128 JQ742129 JQ742127 JQ742235 JQ742237 JQ742238 JQ742165 JQ742164 JQ742166 JQ742167 JQ742151 JQ742153 JQ742158 JQ742155 JQ742156 JQ742157 JQ742159 JQ742154 JQ742152 JQ742170 JQ742169 EU186723

FJ882750 FJ882745 ##### AY948744 JQ742406 JQ742316 JQ742317 ##### JQ742318 JQ742319 JQ742320 JQ742321 JQ742323 JQ742322 JQ742312 JQ742313 JQ742314 JQ742315 JQ742310 JQ742311 JQ742309 JQ742308 JQ742307 JQ742305 JQ742306 JQ742304 JQ742402 JQ742404 JQ742405 ##### JQ742338 ##### JQ742339 JQ742325 JQ742327 JQ742332 JQ742329 JQ742330 JQ742331 JQ742333 JQ742328 JQ742326 JQ742342 JQ742341 #####

Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia

Eleutherodactylus Eleutherodactylus Gastrotheca Melanophryniscus Myersiohyla Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Oreophrynella Osteocephalus Osteocephalus Osteocephalus Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis

coqui marnockii fissipes stelzneri kanaima dendronastes macconnelli macconnelli macconnelli macconnelli macconnelli macconnelli macconnelli macconnelli nigra nigra nigra nigra quelchii quelchii seegobini seegobini vasquezi vasquezi vasquezi vasquezi exophthalmus leprieurii oophagus aff. pulvinatus aff. pulvinatus aff. pulvinatus aff. pulvinatus aureoventris aureoventris aureoventris aureoventris aureoventris aureoventris aureoventris aureoventris aureoventris cf. marmoratus jester pulvinatus

El Verde no data Guarapari, ES no data (pet trade) Maringma Tepui Mt Ayanganna Wokomung Massif Roraima Tepui Mt Kopinang Maringma Tepui Wokomung Massif Wokomung Massif Merume Mountain Wokomung Massif Kukenan Tepui Kukenan Tepui Yuruani Tepui Yuruani Tepui Roraima Tepui Wei Assipu Tepui Maringma Tepui Maringma Tepui Ilu Tepui Tramen Tepui Tramen Tepui Ilu Tepui Kaieteur National Park Kaieteur National Park Kaieteur National Park La Escalera Iwokrama Forest Kaieteur National Park Maringma Tepui Roraima Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Cacao Mountain Maringma Tepui La Escalera

Puerto Rico USA Brazil "South America" Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Venezuela Venezuela Venezuela Venezuela Guyana Guyana Guyana Guyana Venezuela Venezuela Venezuela Venezuela Guyana Guyana Guyana Venezuela Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana French Guiana Guyana Venezuela

no data no data N 2039' W 4030' no data N 512'37" W 6033'59" N 521' W 5957' N 506' W 5951' N 515'30" W 6043'30" N 500'08" W 5952'47" N 512'16" W 6034'39" N 505' W 5950' N 508' W 5949' N 556' W 6009' N 619' W 6032' N 513'28" W 6049'43" N 513'28" W 6049'43" N 518'50" W 6051'50" N 518'50" W 6051'50" N 512'00" W 6044'00" N 513'03" W 6042'23" N 512'59" W 6035'05" N 512'59" W 6035'05" N 524'20" W 6100'23" N 526'40" W 6101'20" N 526'40" W 6101'20" N 524' W 6100' N 510' W 5930' N 510' W 5930' N 508' W 5925' N 554'57" W 6126'05" N 420'11" W 5846'54" N 508' W 5924' N 512'15" W 6034'38" N 515' W 6043' N 513'04" W 6042'21" N 513'03" W 6042'21" N 513'04" W 6042'21" N 513'04" W 6042'21" N 513'05" W 6042'15" N 513'05" W 6042'15" N 513'04" W 6042'21" N 513'04" W 6042'21" N 433'42" W 5227'09" N 512'16" W 6034'39" N 559' W 6124'

350 no data 24 no data 1060 1490 1400 1830 1524 1376 1700 1234 950 700 2600 2600 2303 2303 2590 2207 2088 2088 2680 2371 2371 ca. 2600 430 430 540 1416 950 580 1376 2305 2196 2219 2196 2196 2210 2210 2196 2196 107 1376 1250

12

VUB3490 VUB3749 VUB3750 GenBank VUB3717 VUB3720 VUB3624 GenBank VUB3538 VUB3539 VUB3558 VUB3299 VUB3555 VUB3557 VUB3302 VUB3540 VUB3542 VUB3541 VUB3543 VUB3544 VUB3277 VUB3294 VUB3551 VUB3553 VUB3552 VUB3752 VUB3753 VUB3754 VUB3697 VUB3705 VUB3545 VUB3546 VUB3309 VUB3310 VUB3311 VUB3312 VUB3315 VUB3549 VUB3633 VUB3548 VUB3755 VUB3756 VUB3280 Genbank VUB3266

IRSNB12859 IRSNB15868 IRSNB15869 SBH268110 IRSNB15640 IRSNB15641 IRSNB15850 TNHCFS4955 ROM39475 ROM42811 ROM39470 PK1846 ROM44254 ROM44264 IRSNB15871 ROM39640 ROM42906 ROM42925 ROM39478 ROM42856 IRSNB14588 IRSNB14595 ROM39450 ROM42862 ROM42882 PK3566 PK3580 Uncatalogued IRSNB15703 IRSNB15716 ROM39469 ROM42843 IRSNB15872 IRSNB15873 IRSNB15874 IRSNB15875 IRSNB15876 ROM44271 ROM44277 ROM44279 IRSNB15839 IRSNB15844 PK2060V MNHN2002.692 IRSNB15853

JQ742168 JQ742162 JQ742163 EU186721 JQ742160 JQ742161 JQ742171 HQ290967 JQ742208 JQ742209 JQ742190 JQ742194 JQ742195 ##### JQ742199 JQ742210 JQ742212 JQ742211 JQ742179 JQ742180 JQ742192 JQ742193 JQ742196 JQ742198 JQ742197 JQ742173 JQ742174 JQ742172 JQ742177 JQ742178 JQ742213 JQ742214 JQ742203 JQ742204 JQ742205 JQ742206 JQ742207 JQ742202 JQ742200 JQ742201 JQ742175 JQ742176 JQ742191 AY843768 JQ742181

JQ742340 JQ742336 JQ742337 ##### JQ742334 JQ742335 ##### HQ290967 JQ742376 JQ742377 JQ742361 JQ742365 JQ742366 JQ742367 JQ742371 JQ742378 JQ742380 JQ742379 JQ742350 JQ742351 JQ742363 JQ742364 JQ742368 JQ742370 JQ742369 JQ742344 JQ742345 JQ742343 JQ742348 JQ742349 JQ742381 JQ742276 JQ742372 JQ742373 JQ742374 JQ742375 JQ742275 JQ742274 JQ742272 JQ742273 JQ742346 JQ742347 JQ742362 ##### JQ742352

Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia

Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Pristimantis Rheobates Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania

saltissimus sp "Abakapa" sp "Angasima" sp "Aprada" yuruaniensis yuruaniensis zeuctotylus palmatus ackawaio ackawaio scalae aff. evansi aff. evansi aff. evansi aff. evansi ayangannae ayangannae ayangannae coxi coxi evansi evansi evansi evansi evansi ginesi ginesi riae riveroi riveroi roraimae roraimae roraimae roraimae roraimae roraimae roraimae roraimae roraimae roraimae satelles satelles scalae schuberti sp Wei-Assipu

Maringma Tepui Abakapa Tepui Angasima Tepui Aprada Tepui Yuruani Tepui Yuruani Tepui Cacao Mountain Boyaca Mt Ayanganna Wokomung Massif Mt Ayanganna Wayalayeng Kurupung River Merume Mountain Maringma Tepui Mt Ayanganna Wokomung Massif Wokomung Massif Mt Ayanganna Wokomung Massif Kaieteur National Park Kaieteur National Park Mt Ayanganna Mt Ayanganna Wokomung Massif Abakapa Tepui Abakapa Tepui Sarisarinama Tepui Yuruani Tepui Yuruani Tepui Mt Ayanganna Wokomung Massif Maringma Tepui Maringma Tepui Maringma Tepui Maringma Tepui Maringma Tepui Seroun River Partang Apakai River Angasima Tepui Angasima Tepui El Danto Auyantepui Wei Assipu Tepui

Guyana Venezuela Venezuela Venezuela Venezuela Venezuela French Guiana Colombia Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Venezuela Venezuela Venezuela Venezuela Venezuela Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Venezuela Venezuela Venezuela Venezuela Guyana

N 512'38" W 6033'60" N 511'21" W 6217'40" N 502'35" W 6204'51" N 524' W 6226' N 518'50" W 6051'50" N 518'50" W 6051'50" N 433'42" W 5227'09" N 538'16" W 7332'08" N 521' W 5957' N 508' W 5949' N 521' W 5957' N 514'11" W 6031'04" N 602' W 6016' N 556' W 6009' N 512'37" W 6033'59" N 521' W 5957' N 506' W 5951' N 505' W 5950' N 521' W 5957' N 505' W 5950' N 510' W 5929' N 508' W 5925' N 525' W 5958' N 518' W 5950' N 507' W 5949' N 511'23" W 6217'52" N 511'07" W 6217'21" N 441' W 6413' N 518'50" W 6051'50" N 518'50" W 6051'50" N 521' W 5957' N 508' W 5949' N 512'15" W 6034'38" N 512'15" W 6034'38" N 512'15" W 6034'38" N 512'15" W 6034'38" N 512'15" W 6034'38" N 608' W 6023' N 549'07" W 6013'26" N 554' W 6007' N 502'36" W 6204'51" N 502'36" W 6204'51" N 557'52" W 6123'31" N 546' W 6233' N 512'58" W 6042'16"

1060 2160 2121 2540 2303 2303 107 2118 1490 1234 1550 678 614 950 1060 1490 1400 1700 1490 1700 440 530 870 676 700 2137 2209 ca. 1100 2303 2303 1490 1234 1376 1376 1376 1376 1376 700 728 984 2122 2122 1208 2325 2216

13

VUB3269 VUB3274 VUB3282 VUB3307 VUB3308 VUB3550 VUB3547 VUB3757 VUB3401 VUB3402 VUB3403 VUB3405 VUB3406 VUB3407 VUB3408 VUB3761 VUB3762 VUB3763 VUB3695 VUB3696 VUB3417 VUB3418 VUB3758 VUB3759 VUB3760 GenBank VUB3651 VUB3653 VUB3634 GenBank GenBank GenBank GenBank VUB3764 VUB3222 VUB3224 VUB3218 VUB3220 VUB3221 VUB3591 GenBank GenBank VUB3223 VUB3592 VUB3226

IRSNB15854 IRSNB15855 IRSNB13799 IRSNB15877 IRSNB15878 ROM20570 ROM39465 ROM42833 IRSNB15856 IRSNB15857 IRSNB15858 IRSNB15859 IRSNB15860 IRSNB15861 IRSNB15862 IRSNB15765 IRSNB15769 IRSNB15770 IRSNB15701 IRSNB15702 IRSNB14752 IRSNB14753 IRSNB15879 IRSNB15880 IRSNB15881 MNHN1998.311 IRSNB15655 IRSNB15658 ROM44135 LSUMZH13856 LG1026 LSUMZH12692 ENS10011 IRSNB2674 PK2066V ROM42976 IRSNB17342 ROM39471 IRSNB2653 PK3272 MRT978011 MRT976977 PK2068V PK3261 ROM28532

JQ742182 JQ742183 JQ742185 JQ742186 JQ742187 JQ742189 JQ742188 JQ742184 JQ742218 JQ742219 JQ742220 JQ742221 JQ742222 JQ742223 JQ742224 JQ742215 JQ742216 JQ742217 JQ742225 JQ742226 JQ742227 JQ742228 JQ742232 JQ742233 JQ742234 AY843770 JQ742230 JQ742231 JQ742229 AF420746 AF420744 AF420745 HM012699 JQ742263 JQ742259 JQ742261 JQ742258 ##### JQ742257 JQ742262 AF420721 AF420722 JQ742260 JQ742271 JQ742264

JQ742353 JQ742354 JQ742356 JQ742357 JQ742358 JQ742360 JQ742359 JQ742355 JQ742385 JQ742386 JQ742387 JQ742388 JQ742389 JQ742390 JQ742391 JQ742382 JQ742383 JQ742384 JQ742392 JQ742393 JQ742394 JQ742395 JQ742399 JQ742400 JQ742401 ##### JQ742397 JQ742398 JQ742396 ##### ##### ##### ##### JQ742425 ##### JQ742279 JQ742422 JQ742423 JQ742421 JQ742280 ##### ##### JQ742424 JQ742282 JQ742426

Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Amphibia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia

Stefania Stefania Stefania Stefania Stefania Stefania Stefania Stefania Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Tepuihyla Alopoglossus Alopoglossus Alopoglossus Ameiva Anadia Arthrosaura Arthrosaura Arthrosaura Arthrosaura Arthrosaura Arthrosaura Arthrosaura Arthrosaura Arthrosaura Bachia Cercosaura

sp Wei-Assipu sp Wei-Assipu woodleyi woodleyi woodleyi woodleyi woodleyi woodleyi galani galani galani galani galani galani galani galani galani galani galani galani talbergae talbergae aff. edelcae aff. edelcae aff. edelcae edelcae rodriguezi rodriguezi sp atriventris carinicaudatus copii undulata mcdiarmidi aff. reticulata aff. reticulata guianensis guianensis hoogmoedi kockii kockii reticulata sp "Chimanta" flavescens ocellata

Wei Assipu Tepui Wei Assipu Tepui Kaieteur National Park Maringma Tepui Maringma Tepui Tukeit, KNP Mt Ayanganna Wokomung Massif Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Wei Assipu Tepui Uei Tepui Uei Tepui Uei Tepui Guadacapiapu Tepui Guadacapiapu Tepui Kaieteur National Park Kaieteur National Park Abakapa Tepui Abakapa Tepui Abakapa Tepui Auyantepui Gran Sabana Gran Sabana Ayangaik Porto Walter Guajara Mirim RPF Cuyabeno Chamela-Cuixmala BR Abakapa Tepui Puerto Ayacucho Wokomung Massif Kaieteur National Park Mt Ayanganna Maringma Tepui Kaw Mountain Vila Rica Juruena Churi Tepui Kaw Mountain Paramakatoi

Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Guyana Venezuela Venezuela Venezuela Venezuela Venezuela Guyana Guyana Venezuela Venezuela Venezuela Venezuela Venezuela Venezuela Guyana Brazil Brazil Ecuador Mexico Venezuela Venezuela Guyana Guyana Guyana Guyana French Guiana Brazil Brazil Venezuela French Guiana Guyana

N 512'58" W 6042'16" N 512'58" W 6042'16" N 508' W 5924' N 512'37" W 6033'59" N 512'37" W 6033'59" N 512' W 5927' N 525' W 5958' N 507' W 5949' N 512'58" W 6042'16" N 513'05" W 6042'23" N 513'05" W 6042'23" N 513'05" W 6042'23" N 513'05" W 6042'23" N 512'52" W 6042'13" N 513'05" W 6042'23" N 501' 01" W 6036'59" N 501' 01" W 6036'59" N 501' 01" W 6036'59" N 517'24" W 6055'06" N 517'24" W 6055'06" N 510' W 5929' N 510' W 5929' N 511'24" W 6217'49" N 511'24" W 6217'49" N 511'17" W 6217'30" N 552' W 6234' N 549'21" W 6125'42" N 549'21" W 6125'42" N 604'54" W 6036'30" no data no data no data no data N 510'50" W 6217'50" N 537' W 6728' N 505'33" W 5950'35" N 511' W 5928' N 521' W 5957' N 512'60" W 6035'06" N 432'41" W 5209'09" no data no data N 516' W 6200' N 432'41" W 5209'09" N 443'00" W 5942'00"

2216 2216 580 1060 1060 205 870 700 2216 2244 2244 2244 2244 2184 2244 2065 2065 2065 1242 1242 440 440 2172 2172 2193 2015 1330 1330 1310 no data no data no data no data 2242 200 1411 480 1490 2112 221 no data no data ca. 2300 221 970

14

GenBank GenBank GenBank VUB3232 VUB3594 VUB3233 GenBank VUB3234 VUB3236 GenBank GenBank VUB3238 VUB3239 VUB3243 VUB3245 VUB3247 VUB3598 VUB3249 VUB3250 VUB3251 VUB3666 VUB3667 VUB3668 GenBank VUB3765 VUB3766 GenBank VUB3253 GenBank GenBank GenBank GenBank GenBank GenBank VUB3263 VUB3254 VUB3767

ROM22892 LG1356 LSUMZH12697 IRSNB17322 PK3264 PK2065V MRT977435 IRSNB17840 IRSNB17853 USNM531665 LG1409 IRSNB17344 IRSNB17345 IRSNB18146 IRSNB18147 PK2058V IRSNB18149 ROM20514 ROM39498 ROM42644 IRSNB18109 IRSNB18110 IRSNB18111 MRT926008 IRSNB18150 IRSNB18151 MRT968462 IRSNB2650 LG1006 MRT0472 LSUMZH13823 KU21677 LSUMZH13603 MRT887336 IRSNB18152 IRSNB18153 Uncatalogued

AF206584 AF420738 AF101370 JQ742265 JQ742269 JQ742270 AF420723 JQ742267 JQ742268 AF420735 AY217954 JQ742242 JQ742243 JQ742244 JQ742245 JQ742246 JQ742250 JQ742247 JQ742248 JQ742249 JQ742251 JQ742252 JQ742253 AF420709 JQ742240 JQ742241 AF420708 JQ742266 AF420734 AF420748 AF420757* AY507866 AF420758* AF420737 JQ742256 JQ742255 JQ742254

##### ##### ##### JQ742281 JQ742430 JQ742431 ##### JQ742428 JQ742429 ##### ##### JQ742409 ##### JQ742410 JQ742411 JQ742412 JQ742278 JQ742277 JQ742413 JQ742414 JQ742415 JQ742416 JQ742417 ##### JQ742407 JQ742408 ##### JQ742427 ##### ##### ##### ##### ##### ##### JQ742420 JQ742419 JQ742418

Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia Reptilia

Echinosaura Ecpleopus Iphisa Kaieteurosaurus Leposoma Leposoma Leposoma Leposoma Leposoma Leposoma Leposoma Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Neusticurus Pantepuisaurus Placosoma Potamites Potamites Potamites Ptychoglossus Rachisaurus Riolama Riolama Riolama

sulcarostrum gaudichaudii elegans hindsi guianensis hexalepis oswaldoi percarinatum percarinatum percarinatum scincoides aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis aff. rudis bicarinatus rodriguesi cordylinum ecpleopus juruazensis strangulatus brevifrontalis brachylepis leucosticta leucosticta leucosticta

Baramita Boissucanga RPF Cuyabeno Kaieteur National Park Kaw Mountain Puerto Ayacucho Aripuana Kaieteur National Park Kaieteur National Park Iwokrama Forest Una Kaieteur National Park Kaieteur National Park Maringma Tepui Maringma Tepui Chivaton Kaw Mountain Tukeit, KNP Mt Ayanganna Wokomung Massif El Danto La Escalera La Escalera Serra do Navio Abakapa Tepui Angasima Tepui Apiacas Maringma Tepui Teresopolis Apiacas Porto Walter no data Porto Walter Serra do Cipo Maringma Tepui Wei Assipu Tepui Yuruani Tepui

Guyana Brazil Ecuador Guyana French Guiana Venezuela Brazil Guyana Guyana Guyana Brazil Guyana Guyana Guyana Guyana Venezuela French Guiana Guyana Guyana Guyana Venezuela Venezuela Venezuela Brazil Venezuela Venezuela Brazil Guyana Brazil Brazil Brazil no data Brazil Brazil Guyana Guyana Venezuela

N 722' W 6029' no data S 00' W 7610' N 511' W 5928' N 432'41" W 5209'09" N 537' W 6728' no data N 511' W 5928' N 508' W 5925' no data no data N 508'44" W 5925'31" N 508' W 5924' N 512'37" W 6033'59" N 512'16" W 6034'39" N 535'15" W 6140'50" N 432'41" W 5209'09" N 512' W 5927' N 521'06" W 5957'24" N 507'46" W 5949'16" N 557'52" W 6123'31" N 557' W 6123' N 557' W 6123' no data N 511'06" W 6217'28" N 502'30" W 6204'54" no data N 512'57" W 6035'07" no data no data no data no data no data no data N 512'39" W 6035'30" N 513'03" W 6042'21" N 518'54" W 6051'44"

100 no data 250 480 221 200 no data 480 530 no data no data 515 580 1060 1376 1400 221 205 1490 1234 1208 1100 1100 no data 2156 2162 no data 2080 no data no data no data no data no data no data 1942 2219 2346

* These taxa are swapped in the GenBank database

15

Supplemental Table 2. Primers used in this study.

Name 16S-A 16S-B NDH-AA NDH-AB NDH-J NDH-L NDH-M NDH-Q NDH-R NDH-S NDH-W

Gene 16S 16S ND1 ND1 ND1 ND1 ND1 ND1 ND1 ND1 ND1

Sequence 5-3 CGCCTGTTTAYCAAAAACAT CCGGTYTGAACTCAGATCAYGT TACATACAACTACGNAARGGYCC AAGGTGTATTAGTTGRTCRTANCG TTTACGACCTCGATGTTGGA AAACTATTTAYYAAAGARCC GGGTATGANGCTCGNACTCA TAAAACTATTCATNAARGAACC TAAAACTATTCATNAARGAGCC GGGTATGANGCTCGNATCCA GGGTATGANGCTCGNATTCA

Reference Simon et al. (1994) Simon et al. (1994) This study This study Roelants & Bossuyt (2005) Roelants & Bossuyt (2005) Roelants & Bossuyt (2005) Roelants & Bossuyt (2005) Roelants & Bossuyt (2005) Roelants & Bossuyt (2005) Roelants & Bossuyt (2005)

Supplemental Table 3. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Oreophrynella species/populations from tepui summits and uplands in the Eastern Pantepui Region.

Maringma Maringma Wei Assipu Roraima Kukenan Yuruani Ilu Tramen Uplands 0.0250 0.0250 0.0250 0.0250 0.0192 0.0196 0.0556

Wei Assipu 0.1054 0.0000 0.0000 0.0000 0.0153 0.0156 0.0421

Roraima 0.1054 0.0000 0.0000 0.0000 0.0153 0.0156 0.0421

Kukenan 0.1054 0.0063 0.0063 0.0000 0.0153 0.0156 0.0421

Yuruani 0.1054 0.0095 0.0095 0.0032 0.0153 0.0156 0.0421

Ilu 0.1134 0.0649 0.0649 0.0665 0.0665 0.0000 0.0487

Tramen 0.1134 0.0649 0.0649 0.0665 0.0665 0.000 0.0487

Uplands 0.1615 0.1472 0.1472 0.1487 0.1519 0.1424 0.1424

16

Supplemental Table 4. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Tepuihyla species/populations from tepui summits and uplands in the Eastern Pantepui Region; n.d. = no data.

Wei Assipu Wei Assipu Uei Auyantepui Abakapa Uplands 0.0018 0.0089 0.0054 0.0000

Uei 0.0000 0.0125 0.0089 0.0018

Auyantepui n.d. n.d. 0.0071 0.0106

Abakapa 0.0491 0.0506 n.d. 0.0071

Uplands 0.0000 0.0000 n.d. 0.0459

Supplemental Table 5. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Pristimantis species/populations from tepui summits and uplands in the Eastern Pantepui Region; n.d. = no data.

Wei Assipu Wei Assipu Yuruani Aprada Abakapa Angasima Uplands 0.0082 0.0329 0.0309 0.0288 0.0036

Yuruani 0.0812 0.0329 0.0350 0.0463 0.0268

Aprada n.d. n.d. 0.0165 0.0144 0.0498

Abakapa 0.1204 0.1402 n.d. 0.0062 0.0391

Angasima 0.1189 0.1386 n.d. 0.0016 0.0517

Uplands 0.0114 0.1202 n.d. 0.1315 0.1300

17

Supplemental Table 6. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Stefania species/populations from tepui summits and uplands in the Eastern Pantepui Region; n.d. = no data.

Wei Assipu Wei Assipu Yuruani Auyantepui Abakapa Angasima Uplands 0.0409 0.0702 0.0916 0.0838 0.0391

Yuruani 0.1669 0.0682 0.0955 0.0838 0.0234

Auyantepui n.d. n.d. 0.0682 0.0663 0.0604

Abakapa 0.2422 0.2532 n.d. 0.0721 0.0858

Angasima 0.2163 0.2159 n.d. 0.1833 0.0731

Uplands 0.1434 0.1645 n.d. 0.2305 0.2021

Supplemental Table 7. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Anomaloglossus species/populations from tepui summits and uplands in the Eastern Pantepui Region; n.d. = no data.

Maringma Maringma Wei Assipu Auyantepui Churi Uplands 0.0019 0.0478 0.0344 0.0019

Wei Assipu 0.0079 0.0459 0.0325 0.00000

Auyantepui n.d. n.d. 0.0363 n.d.

Churi n.d. n.d. n.d. n.d.

Uplands n.d. n.d. n.d. n.d.

18

Supplemental Table 8. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Riolama species/populations from tepui summits in the Eastern Pantepui Region.

Maringma Maringma Wei Assipu Yuruani 0.0000 0.0096

Wei Assipu 0.0075 0.0096

Yuruani 0.1045 0.1003

Supplemental Table 9. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Arthrosaura species/populations from tepui summits and uplands in the Eastern Pantepui Region.

Maringma Maringma Churi Uplands 0.0120 0.0000

Churi 0.1024 0.0416

Uplands 0.0057 0.0953

19

Supplemental Table 10. Lowest uncorrected pairwise distances in 16S (below diagonal) and in ND1 (above diagonal) between Neusticurus species/populations from tepui summits and uplands in the Eastern Pantepui Region.

Abakapa Abakapa Angasima Uplands 0.0162 0.0022

Angasima 0.0469 0.0198

Uplands 0.0129 0.0433

20

Supplemental Figure 1 [Next page] - Typical tepui landscapes showing vertical cliffs and tepui summit isolation. Numbers above tepuis correspond to those provided in Fig. 1B (main text). A: Mount Roraima, photographed from Wei Assipu-tepui (photo by PJR Kok). B: Spectacular vertical cliffs of Mount Roraima, photographed from the air (photo by DB Means). C: Kukenan-tepui, Yuruani-tepui and Ilu-tepui, photographed from the air flying over Mount Roraima (photo by DB Means). D: Ilutepui and Tramen-tepui, photographed from the air (photo by DB Means). E: Apradatepui above the clouds, photographed from the air (photo by PJR Kok). F: Angasimatepui (left) and Akopan-tepui (right), photographed from Upuigma-tepui (photo by PJR Kok). G. Part of the Eastern Tepui Chain rising above the Gran Sabana, photographed from the air (photo by PJR Kok). H: Upuigma-tepui, photographed from Angasima-tepui (photo by PJR Kok).

21

22

Supplemental Figure 2 [Next page] - Phylogenetic relationships among tepui summit populations and their upland-lowland relatives in six typical Pantepui taxa. Taxa labelled by colored blocks represent summit populations, with differently colored blocks indicating different tepuis, as listed in the legend. Taxa without labels represent upland/lowland populations. The trees represent Bayesian consensus phylograms based on the analysis of the concatenated data set of 16S and ND1. Numbers above branches are Bayesian posterior probabilities. Internal nodes labelled by red dots represent divergences between tepui populations and their closest sampled relatives (either from another tepui or from the upland/lowland) for which approximate divergence times were inferred (see supplemental text). Outgroups (see supplemental text) were removed for presentation purposes.

23

24

Supplemental Figure 3 - Saturation curve (red line) obtained by nonlinear regression to estimate approximate divergence times based on observed pairwise sequence divergences in the ND1 fragment (dotted lines). The curve is based on a scatter plot (grey circles) of ND1 sequence divergences against reported divergence ages in the toad family Bufonidae [S7]. See supplemental text for full details.

25