Vous êtes sur la page 1sur 228

DOCTEUR DE L'UNIVERSITE MONTPELLIER II

Section
Ecole Doctorale : Sciences des Procds
APPORTS DE LA MODELIS
COMPREHENSIO
APPLICATION A DES BA


M. Philippe Lemenceau
M. Jean-Christophe Poggiale
M. Jean-Jacques Godon
M. Jrme Harmand
M. Antoine Sciandra
Mme Tatiana Vallaeys
M. Denis Dochain

UNIVERSITE MONTPELLIER II
SCIENCES ET TECHNIQUES DU LANGUEDOC
T H E S E

pour obtenir le grade de

DOCTEUR DE L'UNIVERSITE MONTPELLIER II

Section : Biotechnologie et Microbiologie
Sciences des Procds Sciences des aliments


prsente par



Maxime Dumont



PPORTS DE LA MODELISATION DES INTERACTIONS POUR UNE
COMPREHENSION FONCTIONNELLE DUN ECOSYSTEME
APPLICATION A DES BACTERIES NITRIFIANTES EN CHEMOSTAT


soutenue le 18 dcembre 2008



JURY
M. Philippe Lemenceau directeur de recherche INRA,
Christophe Poggiale professeur UMR CNRS 6117, rapporteur
Jacques Godon directeur de recherche INRA, directeur de thse
charg de recherche INRA, directeur de thse
directeur de recherche UMR
Mme Tatiana Vallaeys professeur UMR 5119 Ecolag,
professeur Universit de Louvain, examinateur
UNIVERSITE MONTPELLIER II
SCIENCES ET TECHNIQUES DU LANGUEDOC
DOCTEUR DE L'UNIVERSITE MONTPELLIER II
Sciences des aliments
NS POUR UNE
UN ECOSYSTEME,
EN CHEMOSTAT
ecteur de recherche INRA, rapporteur
professeur UMR CNRS 6117, rapporteur
che INRA, directeur de thse
INRA, directeur de thse
UMR 7093, examinateur
professeur UMR 5119 Ecolag, prsidente du jury
professeur Universit de Louvain, examinateur
2



3


UNIVERSITE MONTPELLIER II
SCIENCES ET TECHNIQUES DU LANGUEDOC


T H E S E


pour obtenir le grade de

DOCTEUR DE L'UNIVERSITE MONTPELLIER II

Section : Biotechnologie et Microbiologie
Ecole Doctorale : Sciences des Procds Sciences des aliments


prsente par



Maxime Dumont



APPORTS DE LA MODELISATION DES INTERACTIONS POUR UNE
COMPREHENSION FONCTIONNELLE DUN ECOSYSTEME,
APPLICATION A DES BACTERIES NITRIFIANTES EN CHEMOSTAT


soutenue le 18 dcembre 2008



JURY


M. Philippe Lemenceau directeur de recherche INRA, rapporteur
M. Jean-Christophe Poggiale professeur UMR CNRS 6117, rapporteur
M. Jean-Jacques Godon directeur de recherche INRA, directeur de thse
M. Jrme Harmand charg de recherche INRA, directeur de thse
M. Antoine Sciandra directeur de recherche UMR 7093, examinateur
Mme Tatiana Vallaeys professeur UMR 5119 Ecolag, prsidente du jury
M. Denis Dochain professeur Universit de Louvain, examinateur
4





5

REMERCIEMENTS REMERCIEMENTS REMERCIEMENTS REMERCIEMENTS
Voil !! Nous y sommes !... La thse acheve, la soutenance effectue Une page se tourne,
laventure narbonnaise touche sa fin et avec elle les huit annes dtudes qui ont conduit ce
manuscrit
Puisquon parle dtudes, je voudrais tout dabord remercier les profs (au sens large) qui
mont tant apport durant toutes ces annes (non, non, cela na rien voir avec le fait que je sois
un fils de profs !!).
Merci cette prof de bio dont je ne connais ni le nom ni le prnom et que jai dtest
durant de nombreuses semaines, voir de nombreux mois, pour mavoir recal dun point au bac !
Sa clairvoyance mtonnera toujours, sans elle cette thse nexisterait pas.
Merci Bernard Calvez et tous les profs de lIUT Gnie Biologique de Lyon pour leurs
enseignements si passionnants mme sil est vrai que jen ai rat quelques un ! Quelle ide aussi
de mettre des cours le vendredi matin alors que les soires tudiantes sont le jeudi soir !!!...
Merci Jrme Boissier, Olivier Vernaux, Andr Thron, Guillaume Mitta, Anne
Rognon, Hlne Mon, Richard Galinier, Jean-Franois Allienne et Claude Combes du Centre de
Biologie et dEcologie Tropicale et Mditerranenne de Perpignan. Les deux stages de six mois
passs vos cts ont t extraordinaires ! Je sais tout ce que je vous dois et vous en serais
ternellement reconnaissant.
Merci Jean-Jacques Godon, Jrme Harmand, Alain Rapaport, Claude Lobry, Patrice
Loisel, Jean-Philippe Steyer, Jrme Hamelin, Nicolas Bernet, Valrie Bru, Eric Latrille,
Emmanuelle Zumstein, Eric Trably, Nathalie Wery et Frdric Mazenc, pour toutes les
connaissances que vous mavez apport durant ces trois annes passes au Laboratoire des
Biotechnologies de lEnvironnement de Narbonne.
Merci Sylvie Farine, Nadine Le Thinh, Annie Vidal et Vronique Maugenet pour votre
bonne humeur permanente et pour avoir su me guider travers les mandres de
ladministration !!
Toutes ces annes nauraient pas t si agrables et si enrichissantes sans les nombreux liens
damitis qui se sont nous au fil du temps.
6

Merci aux Mconnais : Marco, Matthieu, Paul, Yann Depuis le collge, que de chemin
parcouru !! Finalement, on ne sen sort pas si mal pour les cancres quon tait !!!...
Merci Aurlie et Yann pour les deux annes passes vos cts Je garderai
ternellement en mmoire toutes nos vires lyonnaises ainsi que la magnifique rue Paul Ricard
des Saintes Marie de la Mer !!...
Merci mes amis de la licence pro de Reims : Jrme, Willy, Mama, Laure qui mont
permis de garder le cur au chaud malgr la froideur du nord ! Sans vous, il naurait pas t
possible de tenir toute une anne l-haut !!!...
Merci aux trois mousquetaires du DEA de Parasitologie de Montpellier : Tit Math,
Bertrand, Paulo pour toutes ces soires passes parler Ecologie et Evolution en y mlant la
politique bien videment !! Merci galement Anne et Arthur pour votre douceur et votre
gentillesse incomparable.
Merci aux amis du LBE : Gurmite (vive lanarchie !!), Matthieu M. (prends soin des
belles affiches de notre bureau !!), Maialen (Aloha !!! Ce mot te va si bien !), Alexis (arrte le
sport, cest trop dangereux !!), Matthieu L. (Merci dtre l, somewhere in the world !! hein ?!!!
Quoi ?!!!!), Bruno (vive rue89, les algues et les bactries !!), Bruno (courage lami !!!), Sarah
(courage toi aussi !!), Olivier Z. (prochain road trip au Chili mais toujours sur fond de Joe
Dassin !!!), Olivier L.G. ( quand la Bretagne libre ?!!!), Romy-Alice et Seb (cest fou !!! Avoir
une ludothque pareille et ne pas avoir fait un seul jeu en un an !!! Dun autre ct, boire et
manger cest bien aussi !!!), sans oublier linnarrable Magalou (continue d envoyer du
lourd !!!!) et le toujours fatigu Yannis (quand cest que tu prends ta carte camarade ?!!!)
Un grand merci aux Camarades narbonnais quils soient au PCF, au NPA, la Ligue, au
PG, la CGT, Sud, au Planning ou nul part En particulier, un grand merci Patric et Vro
(nos longues discussions passionnantes vont me manquer et vive le calvados des copains !!),
Carmen et Jojo (il ny a pas de mots suffisamment forts pour vous exprimer toute mon
admiration), Charles et Jeanine (on vous attend au Chili avec votre camping-car !), Laurent (
quand un Luxembourg rouge ?!!), Bastosse (tu as fais le bon choix), Roland (tes blagues
continuent de rsonner dans la salle de runion !!), Denise et Jean-Pierre (vous nimaginez sans
doute pas tout ce que vous mavez apport), Luc et Manu (on se retrouvera rue Santa Fe ?!),
Marie-Pierre et Matthias (vive le Pays-Basque, les tites brebis et les olives !), Jean-Louis
(linfatigable !), Domi (hasta siempre !!), Francis ( du pass faisons table rase !...), Alain
V. (je suis sur que mme lautre bout de la terre on entendra le son de ta voix au
mgaphone !!), Alain et Simone (la bonne humeur permanente, un rayon de soleil qui rchauffe
7

en toutes circonstances), Christine et Yvan (merci pour les bouquins, les sourires, les clins
dil), Thierry (je compte sur toi pour convertir JJ et Jj !!!) Je vous souhaite tous tout
plein de luttes victorieuses ! Unis par un maillage dinteractions positives, je ne doute pas que
vous puissiez contribuer faire merger des proprits nouvelles faites de Paix, de Solidarit, de
Fraternit pour un monde meilleur !...
Un grand merci nos chers colocs du trois cour de la Pomme ! Gros bisous toi Cathy,
durant quelque temps a sera dur de venir frapper ta porte pour te piquer des ufs, de la farine,
du lait, du sucre !!!... Mais gardes en sous la main car on na pas fini de ten demander !!!! Merci
pour tes sourires, ta complicit et ta joie de vivre Je te souhaite tout le bonheur du monde, tu le
mrite tant !... Gros bisous toi Romain ! Tu es un mec bien, faut juste que tu descotches un peu
de lordi !!! lol !! All, ctait juste pour tembter !!... Mes meilleures penses de Gauche
Cloclo et mon camarade banquier Doude (en fait, tu aurais du faire agriculteur en
Bourgogne !!! Le bleu de travail tirait si bien !!!!...). Un grand merci aussi tous ceux qui sont
venu lappart et qui ont marqu leur passage dune petite cration en fil de fer !!...
Le meilleur pour la fin !
Un immense merci mes parents, Dominique et Jean-Pierre Que dire sinon que je vous
aime Vous tes extraordinaires !
Merci ma frangine Alexandra, Nico, Milo et Lilou dont le bonheur sert de phare au
milieu du brouillard.
Merci mon tit Ange, Coralie, pour tout ce que tu mas apport et continuera de
mapporter. La vie tes cts est un enchantement quotidien. Te quiero mi amor. Merci
galement ta famille qui ma si bien accueilli : Franoise pour toutes tes douces attentions,
Loic, Julie et Marine (en vous souhaitant plein de bonnes choses en Guadeloupe), Philippe pour
tous tes bons petits plats, Lilette et Pierre pour votre gentillesse, Jean-Franois pour toutes nos
discussions politique
Merci tous !!!


Je vous laisse maintenant la lecture de ce manuscrit sur ces belles paroles de Pierre Bourdieu :
Pour rpondre aux dfis qui nous font faces, il faut que chaque chercheur soit militant, chaque
militant soit chercheur et que chaque citoyen soit militant

8


















Sommaire
9

SOMMAIRE SOMMAIRE SOMMAIRE SOMMAIRE
Remerciements
Sommaire
Communications scientifiques lies la thse
Avant-propos

DE LA COMPLEXITE DU VIVANT ET DU FONCTIONNEMENT DES ECOSYSTEMES
I. DE LA COMPLEXITE DU VIVANT AU SEIN DES ECOSYSTEMES
I.1. Les cosystmes et la science qui les tudie.................................................21
I.1.1. La dfinition dun cosystme
I.1.2. Lcologie, science des cosystmes
I.2. La biodiversit et les interactions : la complexit du vivant....................25
I.2.1. La notion de diversit du vivant
I.2.2. La richesse spcifique
I.2.3. Les indices de diversit
I.2.3.1. Lindice de diversit de Shannon-Weaver
I.2.3.2. Lindice de diversit de Simpson
I.2.3.3. Lindice de diversit de Hill
I.2.4. Le lien entre la diversit et les interactions du vivant
I.3. La diversit des interactions du vivant...........29
I.3.1. La description phnomnologique des interactions
I.3.2. La description mcaniste des interactions
I.3.3. Les rseaux trophiques
I.3.3.1. La description des rseaux trophiques
I.3.3.2. Le flux de matire et dnergie au sein des rseaux trophiques
I.4. Les thories sur la complexit du vivant............................................................................32
I.4.1. Les prmices dune thorie globale
I.4.2. La thorie darwinienne
I.4.3. La double interprtation de la thorie darwinienne
I.4.3.1. La coopration comme moteur de lvolution des espces
I.4.3.2. La comptition comme moteur de lvolution des espces
I.4.4. Et demain, quelle thorie de la complexit du vivant ?
II. DE LA MODELISATION DE LA COMPLEXITE DU VIVANT
II.1. Les diffrentes approches de la modlisation en cologie...............................................39
II.1.1. Lapproche stochastique de la modlisation du vivant
Sommaire
10

II.1.2. Lapproche dterministe de la modlisation du vivant
II.1.2.1. La dfinition du dterminisme
II.1.2.2. Les quations diffrentielles, outils de la modlisation dterministe
II.2. Les modles dterministes historiques en cologie...........................................................43
II.2.1. Le modle malthusien ou de croissance exponentielle dune espce
II.2.2. Le modle logistique ou de croissance borne dune espce
II.2.2.1. La prsentation du modle logistique
II.2.2.2. La stratgie r et la stratgie k
II.2.2.3. Le chaos dterministe
II.2.3. Le modle de Lotka-Volterra ou modle proie-prdateur
II.2.3.1. Lhistorique du modle de Lotka-Volterra
II.2.3.2. Les hypothses du modle de Lotka-Volterra
II.2.3.3. La description du modle de Lotka-Volterra
II.2.4. Le modle de Lotka-Volterra comme modle de comptition
II.2.4.1. La prsentation du modle
II.2.4.2. Le principe dexclusion comptitive
II.2.4.3. Le concept de niche cologique
III. DU FONCTIONNEMENT DES ECOSYSTEMES
III.1. La complexit du vivant et les fonctions des cosystmes.............................................57
III.1.1. La notion de fonctions des cosystmes
III.1.2. Ltude de la productivit des cosystmes
III.1.2.1. Lapproche exprimentale
III.1.2.2. Lapproche thorique
III.1.2.3. Une synthse des tudes exprimentales et thoriques
III.2. La complexit du vivant et la stabilit des cosystmes.................................................64
III.2.1. La notion de stabilit des cosystmes
III.2.2. Ltude de la stabilit des cosystmes
III.2.2.1. Lapproche exprimentale
III.2.2.2. Lapproche thorique
III.2.2.3. Une synthse des tudes exprimentales et thoriques
III.3. Les limites des approches exprimentales et thoriques...............................................70
III.3.1. Les limites de lapproche exprimentale classique en cologie
III.3.2. Les limites de lapproche thorique
Sommaire
11

DE LINTERET DU MONDE MICROBIEN POUR LA COMPREHENSION DES ECOSYSTEMES
COMPLEXES
IV. DU MONDE MICROBIEN ET DES OUTILS DANALYSE DE SA DIVERSITE
IV.1. A la dcouverte du monde microbien...................................................................................75
IV.1.1. La naissance de lcologie microbienne
IV.1.2. La diversit du monde microbien
IV.1.2.1. La prsentation gnrale de la diversit du monde microbien
IV.1.2.2. La diversit des organismes procaryotes
IV.1.3. La formidable odysse du monde microbien
IV.2. Les outils danalyse de la diversit du monde microbien...............................................82
IV.2.1. Les outils danalyse classique de la diversit microbienne
IV.2.2. Les outils danalyse molculaire de la diversit microbienne
IV.2.2.1. Lamplification de lADN
IV.2.2.2. Lanalyse de lADN ribosomique
IV.2.2.3. Les techniques dempreintes molculaires
IV.2.2.3.1. Les gels dlectrophorse gradient de dnaturation
IV.2.2.3.2. Lanalyse de polymorphisme de conformation secondaire
IV.2.2.3.3. Lanalyse de fragments de restriction terminaux
V. DU MONDE MICROBIEN COMME MODELE DETUDE EN ECOLOGIE
V.1. La pertinence du monde microbien en cologie..................................................................93
V.2. Les racteurs biologiques, des microcosmes sous contrle............................................94
V.2.1. Le principe des racteurs biologiques
V.2.2. Le fonctionnement des racteurs biologiques
V.2.2.1. Le fonctionnement discontinu des racteurs biologiques
V.2.2.2. Le fonctionnement semi-continu des racteurs biologiques
V.2.2.3. Le fonctionnement continu des racteurs biologiques
V.3. La modlisation des systmes microbiens en chmostat................................................96
V.3.1. Limportance du schma ractionnel et du bilan de matire
V.3.2. La modlisation dune population microbienne dans un chemostat
V.3.2.1. La prsentation du modle propos par Monod
V.3.2.2. Les fonctions de croissance des microorganismes
V.3.2.3. Lanalyse du modle propos par Monod
V.3.3. La modlisation de plusieurs populations microbiennes dans un
chmostat

Sommaire
12

DE LETUDE DUN ECOSYSTEME MICROBIEN COMPLEXE : DES BACTERIES NITRIFIANTES
EN CHEMOSTAT
VI. DE LA MISE EN PLACE ET DU SUIVI DE BACTERIES NITRIFIANTES EN CHEMOSTAT
VI.1. La nitrification et les bactries nitrifiantes.......................................................................107
VI.1.1. La nitrification
VI.1.2. Les bactries nitrifiantes
VI.1.2.1. Les bactries nitrifiantes lithotrophes
VI.1.2.1.1. La taxonomie des bactries nitrifiantes lithotrophes
VI.1.2.1.2. Le mtabolisme des bactries nitrifiantes lithotrophes
VI.1.2.2. Les bactries nitrifiantes htrotrophes
VI.1.3. Les facteurs influant le processus de nitrification
VI.1.3.1. Le taux doxygne dissous
VI.1.3.2. Le pH
VI.1.3.3. La temprature
VI.2. La mise en place de chmostats nitrifiants......................................................................112
VI.2.1. Les caractristiques physiques des chmostats nitrifiants
VI.2.2. Le milieu de culture des chmostats nitrifiants
VI.2.3. Le choix du temps de sjour hydraulique
VI.2.4. Linoculation des chmostats nitrifiants
VI.3. Le suivi fonctionnel et populationnel des chmostats nitrifiants..............................115
VI.3.1. Le suivi fonctionnel des chmostats nitrifiants
VI.3.2. Le suivi populationnel des chmostats nitrifiants
VI.3.2.1. La quantification de la biomasse totale des chmostats
VI.3.2.2. La dtermination des phylotypes composant la biomasse totale
VI.3.2.2.1. La mthode de prlvement et de conservation des chantillons
VI.3.2.2.2. La mthode dextraction des ADN totaux
VI.3.2.2.3. Lamplification de la rgion V3 de lADNr 16S
VI.3.2.2.4. La discrimination par SSCP des brins dADN amplifis
VI.4. La perturbation des chmostats nitrifiants......................................................................119
VI.4.1. Les perturbations abiotiques des chmostats nitrifiants
VI.4.2. Les perturbations biotiques des chmostats nitrifiants
VI.4.2.1. La perturbation biotique globale des chmostats nitrifiants
VI.4.2.2. La perturbation biotique cible des chmostats nitrifiants

Sommaire
13

VII. DE LA DETERMINATION DU ROLE FONCTIONNEL DES DIFFERENTES ESPECES PRESENTES
DANS UN ECOSYSTEME MICROBIEN COMPLEXE
VII.1. Rsum de la problmatique et de lapproche mise en uvre..................................123
VII.2. Toward functional molecular fingerprints.......................................................................125
VIII. DE LA MODELISATION DU MAILLAGE DINTERACTIONS ENTRE LES ESPECES PRESENTES
DANS UN ECOSYSTEM MICROBIEN COMPLEXE
VIII.1. Rsum de la problmatique et de lapproche mise en uvre.................................143
VIII.2. Coexistence in a nitrifying chemostat: a model of microbial interaction.....145
IX. DE LINFLUENCE DE PERTURBATIONS BIOTIQUES SUR LA DIVERSITE ET LE
FONCTIONNEMENT DE BACTERIES NITRIFIANTES EN CHEMOSTAT
IX.1.Linfluence de la perturbation biotique globale................................................................161
XIX.1.1. Linfluence populationnelle de la perturbation biotique globale
XIX.1.2. Linfluence fonctionnelle de la perturbation biotique globale
IX.2.Linfluence de la perturbation biotique cible...................................................................163
IX.2.1. Linfluence populationnelle de la perturbation biotique globale
IX.2.2. Linfluence fonctionnelle de la perturbation biotique globale
CONCLUSION ET PERSPECTIVES
X.1. Le potentiel des chmostats en cologie microbienne ...................................................169
X.2. La difficult de la modlisation des systmes microbiens ...........................................170
X.2.1. La question du chaos dterministe
X.2.2. La question de la neutralit
X.2.3. La question du niveau dintgration de la diversit biologique dans les
modles mathmatiques
X.2.3.1. Le niveau de diversit spcifique
X.2.3.2. Le niveau de diversit mtabolique
X.3. La pertinence des approches transdisciplinaires.............................................................178
Rfrences bibliographiques
Liste des figures
Liste des tables
Annexes


14




Communications scientifiques lies la thse
15

COMMUNICATIONS SCIENTIFIQUES LIES LA COMMUNICATIONS SCIENTIFIQUES LIES LA COMMUNICATIONS SCIENTIFIQUES LIES LA COMMUNICATIONS SCIENTIFIQUES LIES LA
THSE THSE THSE THSE
ARTICLES
Dumont M., Godon J.J., Rapaport A., Benyahia B., Harmand J. (2008)
New observers for microbial ecology, How including molecular data into bioprocess modeling.
Proceeding of the 16
th
Mediterranean conference on control and automotion.
Dumont M., Harmand J., Godon J.J. (sous presse)
Toward functional molecular fingerprint.
Environmental microbiology.
Dumont M., Harmand J., Godon J.J. (en prparation)
Coexistence in nitrifying chemostat: a model of microbial interactions.
CONFERENCES
Dumont M., Godon J.J., Harmand J. (2007)

De la modlisation des cosystmes microbiens, entre hypothses simples et ralit complexe :
linterface des fingerprints.
5
ime
congrs de lAssociation Franaise dEcologie Microbienne, La Grande Motte, France.

Dumont M., Godon J.J., Harmand J. (2008)

How automatic control may help to investigate ecological questions.

International Symposium on Biotechnology, Sfax, Tunisie.

Dumont M., Godon J.J., Rapaport A., Benyahia B., Harmand J. (2008)
New observers for microbial ecology: How including molecular data into bioprocess modeling.
16
th
Mediterranean conference on control and automotion, Ajaccio, France.
POSTERS
Dumont M., Harmand J., Godon J.J. (2008)
Functional assignation of molecular species in a complex microbial ecosystem using
mathematical tools and molecular fingerprints.
12th congress of International Society of Microbial Ecology, Cairns, Australia.
Hamelin J., Dumont M., Harmand J., Godon J.J., Haegeman B. (2008)
Microbial diversity and the neutral chemostat
12
th
congress of International Society of Microbial Ecology, Cairns, Australia.
Harmand J., Rapaport A., Dumont M., Dochain D., Godon J.J. (2008)
How taking into account biodiversity into anaerobic digestion models ?
9
th
Latin-American worshop and Symposium on anaerobic digestion, Easter Island, Chile.

16



Avant-propos
17

AVANT AVANT AVANT AVANT- -- -PROPOS PROPOS PROPOS PROPOS
Les travaux dvelopps dans cette thse ont t mens au sein du Laboratoire des
Biotechnologies de lEnvironnement de Narbonne
1
(11) et ont fait lobjet dune approche
transdisciplinaire faisant intervenir lcologie microbienne, le gnie des procds, lautomatisme
et la modlisation mathmatique. La convergence de ces diffrents champs disciplinaires a t
rendue possible par une collaboration troite avec diffrents chercheurs issus de ces domaines, le
soutien de trois dpartements de lInstitut National de la Recherche Agronomique (INRA) :
MICA (MIcrobiologie et Chanes Alimentaires), MIA (Mathmatiques et informatique
Appliques) et EA (Environnement et Agronomie) ainsi que le soutien de lInstitut National de
Recherche en Informatique et en Automatique (INRIA) travers le projet MERE (Modlisation
Et Ressource en Eau). Ces acteurs ont pu tre runis par la conviction commune de limportance
de ltude du monde microbien dans le dveloppement humain (par son implication dans les
systmes de dpollution et de production alternative dnergie notamment) ainsi que sa
pertinence comme modle biologique pour rpondre des questions dcologie gnrale.
Au cours de ce manuscrit, rdig avec le souci dtre comprhensible par lensemble des
spcialistes de chaque discipline, nous synthtiserons dans une premire partie les connaissances
relatives lcologie gnrale : sa dfinition et ses principes suivant le contexte historique, les
grandes interrogations qui proccupent les cologues et comment ils tentent dy rpondre. Nous
montrerons les limites des travaux classiquement raliss en cologie sur des macrocosystmes
et la ncessit dtudier dautres types dcosystmes. Dans une seconde partie, nous
soulignerons lintrt du monde microbien comme modle biologique pour la comprhension des
cosystmes complexes. Nous aborderons galement les difficults rencontres limitant
grandement lutilisation des microorganismes en cologie gnrale. Dans une troisime partie,
nous prsenterons le travail effectu durant la thse visant dpasser ces difficults par une
approche transdisciplinaire du suivi fonctionnel et populationnel de bactries nitrifiantes en
chmostat. Nous proposerons une mthode gnrique de dtermination du rle fonctionnel de
diffrentes espces assembles dans un cosystme donn. Nous proposerons galement un
modle dinteractions pouvant stablir entre ces diffrentes espces . Enfin, nous discuterons
de quelques rsultats complmentaires relatifs linfluence de perturbations biotiques sur la
rsistance et la rsilience des systmes que nous avons tudis avant de proposer des
perspectives et de conclure.
En vous souhaitant une bonne lecture.

1
Site internet du LBE : http://www.montpellier.inra.fr/narbonne/

18




19


De la complexit du vivant et
du fonctionnement des
cosystmes


O il sera question :



De la complexit du vivant au sein des cosystmes

De la modlisation de la complexit du vivant

Du fonctionnement des cosystmes







20





De la complexit du vivant au sein des cosystmes
21

I. I. I. I. DE L DE L DE L DE LA A A A COMPLEXIT COMPLEXIT COMPLEXIT COMPLEXIT DU VIVANT AU SEIN DES DU VIVANT AU SEIN DES DU VIVANT AU SEIN DES DU VIVANT AU SEIN DES
COSYSTMES COSYSTMES COSYSTMES COSYSTMES
Lcologie est une science gnrale, qui ne senferme pas dans un domaine donn mais
traite des rapports entres sciences particulires et tente de synthtiser leurs rsultats.
Ainsi, lcologie nest pas une discipline scientifique de plus mais une science de
convergence des autres sciences
J. H. Woodger.
I.1. Les cosystmes et la science qui les tudie
I.1.1. La dfinition dun cosystme
Un cosystme est une unit cologique forme dun biotope correspondant lensemble
des paramtres abiotiques (ou physico-chimiques) et dune biocnose correspondant
lensemble des organismes y vivant (Frontier, Pichod-Viale et al. 2004). Ces deux ensembles,
qui constituent chaque cosystme, entretiennent de nombreux types dinteractions diffrentes
(Fig. 1).

Figure 1 : Schma reprsentant les interactions stablissant dans un cosystme donn.
Ainsi, un cosystme inclut :
- Le biotope, facteurs physico-chimiques du milieu (structure physique, temprature,
intensit lumineuse, humidit, teneur en lments chimiques).
- La biocnose, ensemble des tres vivants.
- Les relations entre les tres vivants (interactions inter et intraspcifiques).
- Les relations entre les tres vivants et leur biotope.
- Les relations entre la biocnose, le biotope et lenvironnement.
Lagencement plus ou moins complexe de ces interactions cre un ensemble qui prsente les
caractristiques dune entit nouvelle manifestant des proprits mergentes par rapport celles
des lments qui la composent, do laphorisme bien connu : Le tout est suprieur la somme
des parties . Lensemble ainsi constitu agit, en retour, sur les proprits, le fonctionnement et
De la complexit du vivant au sein des cosystmes
22

lvolution des lments qui le composent. En dautres termes, les proprits qui manent dun
lment ne sont pas les mmes selon que cet lment est isol ( supposer quil puisse tre isol
ce qui nest bien souvent pas le cas) ou lorsquil est inclus dans un systme plus ou moins
complexe. Chaque lment pouvant tre considr comme un sous-systme, il sensuit que
chaque systme est doublement pilot : par laction des sous-systmes qui le composent et par le
systme plus vaste dans lequel il sinsre.
De plus, les cosystmes:
- Sont des systmes ouverts et dissipatifs, cest--dire ayant des changes dnergie et de
matire avec leur environnement.
- Sont composs dun trs grand nombre dlments diffrents.
- Sont fonds sur de trs grands nombres dinteractions montrant des dlais de rponses
divers, et ralisant de frquentes boucles rtroactives.
- Prsentent une htrognit spatio-temporelle importante toutes les chelles.
- Ont une histoire et une volution non rversible.
- Prsentent une succession de niveaux dorganisations hirarchiss (ou niveaux
dintgration).
- Sont caractriss par des proprits mergentes.
Ainsi, les cosystmes apparaissent comme des systmes complexes difficiles aborder
(Frontier, Pichod-Viale et al. 2004). LEcologie, science des cosystmes, tente den amliorer la
comprhension.
I.1.2. Lcologie, science des cosystmes
LEcologie est une discipline extrmement rcente. Signifiant tymologiquement Science
de lhabitat (de okos : habitat et logos : science), elle na, en effet, t leve au rang
de discipline acadmique que vers la fin du XIX
ime
sicle. Ceci fut possible grce une prise de
conscience du fait que les organismes vivants et les populations ne sont pas gouverns par le
hasard mais, au contraire, organiss de faon former des communauts ou associations
dont la structure et la fonction ne peuvent tre comprises en en examinant sparment les parties.
Victor Shelford (1877-1968), grand pionnier de lEcologie aux Etats-Unis, la dfinie alors assez
logiquement comme la science des communauts (Shelford and Clements 1939). Attention
cependant, ne nous y trompons pas, Shelford ne parlait pas de ltude des diffrentes
communauts mais de ltude de lensemble des communauts. En effet, les premiers cologues
taient fortement marqus par une vision holistique (i.e. trs gnrale, globale) de leur discipline.
La Terre tant un habitat, lEcologie est la science de la Terre et de tous ses habitants. Il sagit
donc pour eux dune superscience , dune science unificatrice, dune science de synthse
De la complexit du vivant au sein des cosystmes
23

essentielle la comprhension de la structure et du fonctionnement de la biosphre. Ils
considraient, en effet, que ni lcosphre ni aucun de ses processus constitutifs ne pouvait tre
expliqu par aucune des disciplines indpendantes en lesquelles le savoir moderne stait divis.
Alfred North Whitehead (1861-1947) refusait mme dadmettre quune barrire fondamentale
puisse sparer la physique de la biologie, selon lui : la physique est ltude des petits
organismes, la biologie celle des grands organismes et lEcologie est ltude de tout les
organismes (Whitehead 1922). Plus encore, les premiers cologues voyaient lensemble des
communauts comme un organisme part entire constitu de diffrentes entits agissant de
concert linstar des diffrentes cellules, flore bactrienne et autres qui constituent un tre
vivant. Il sagit l du premier paradigme de lEcologie auquel sont rattachs trois grands
principes :
- Le tout est suprieur la somme des parties.
- La Nature est en quilibre constant.
- La diversit est source de stabilit.
Cette vision holistique des premiers cologues fut, par la suite, ddaigne au profit dune
vision rductionniste o il sagit alors dtudier sparment les diffrents lments qui
composent les systmes. Deux considrations principales peuvent tre vues comme lorigine de
ce revirement conceptuel.
La premire considration porte sur un aspect que lon pourrait qualifier de philosophique et
qui concerne la place de lHomme dans le systme. Concernant les tenants de la vision
holistique, Richard Saint Barbe-Baker (1889-1943) rsume assez bien la pense gnrale des
pionniers de lcologie de la manire suivante : Presque partout dans le monde, en
mconnaissant les lois de la nature, lHomme a travaill sa propre perte. Dans son orgueil, il
sest livr toutes sortes dactes de violence partout sur la scne terrestre, oubliant quil ntait
quun des acteurs destins jouer un rle dans lharmonie et lunit avec tous les autres tres
vivants . Or il convient de garder lesprit que la fin du XIX
ime
et le dbut du XX
ime
sicle
sont marqus par des effervescences idologiques extrmement fortes et opposes notamment en
France. La lutte des classes vit alors, sans aucun doute, ses heures les plus froces (rpression
sanglante de la Commune de Paris, massacres de Fourmille, Narbonne, Carmaux...). LEcologie
et les cologues vont, dans ce contexte, concentrer sur eux les conceptions inconciliables qui
saffrontent alors dans la socit : lacit versus religion, capitalisme versus socialisme. En effet,
proclamer que lHomme nest quun des acteurs parmi tant dautres ne va pas sans
consquences !... Cela est totalement oppos aux dogmes religieux qui proclament : Faisons
l'Homme notre image, selon notre ressemblance, et qu'il domine sur les poissons de la mer, sur
les oiseaux du ciel, sur le btail, sur toute la terre, et sur tous les reptiles qui rampent sur la
De la complexit du vivant au sein des cosystmes
24

terre Laffrontement idologique qui en rsulta fut dune certaine manire comparable
celui qui opposa, en son temps, les tenants du gocentrisme aux tenants de lhliocentrisme aprs
les travaux effectus par Copernic (1473-1543). Lhorreur et le barbarisme des guerres
mondiales du XX
ime
sicle porteront, de plus, un rude coup la vision dharmonie et dunit
entre les tres vivants au profit de la vision de domination.
La seconde considration pouvant expliquer le revirement de la conception holistique vers
la conception rductionniste en Ecologie concerne lamlioration des moyens danalyse du
vivant. En effet, lessor de la gntique partir des annes 1930 engendra un intrt grandissant
envers les gnomes des organismes vivants et, paralllement, diminua limportance des tudes
relatives leurs traits de vie ou aux interactions quils tablissent entre eux. Cest notamment
partir de cette priode que sachve lpope des grands naturalistes. De plus, le dveloppement
des outils danalyses molculaires partir des annes 1970-1980 conduisit une course au
squenage de lADN des tres vivants. La grande majorit des tudes sintressaient alors (et
continuent de sintresser) plus particulirement quelques gnes pouvant tre exploits par
lHomme, que se soit au niveau agricole ou mdical, plutt que dessayer de comprendre le
fonctionnement global de la biosphre.
Nanmoins, depuis la fin du XX
ime
sicle, un retour sur le devant de la scne de la conception
holistique samorce. Ainsi, lhypothse Gaa dveloppe par James Lovelock partir des annes
1980 et qui suggre que la plante ragit comme un organisme part entire (reprenant le point
de vue des premiers cologues) est aujourdhui largement reconnue dans le domaine scientifique
aprs avoir t ardemment critique (Lovelock 1979). Ce retour la conception holistique peut
sexpliquer par le fait que la communaut scientifique ressent de plus en plus la ncessit dune
mta-analyse des normes quantits de donnes gnres par le dveloppement des outils
danalyse et quainsi une cohrence leur soit donne. De plus, la vision rductionniste a conduit
une dconnection de la socit humaine moderne de son environnement se traduisant aujourdhui
par une pression anthropique (i.e. dorigine humaine) sans prcdent sur lensemble des
cosystmes. Cette pression a notamment pour consquence un drglement climatique brutal
menaant de modifier gravement lensemble des cycles biogochimiques et par l-mme les
quilibres cologiques. Le caractre gnralis de ce changement ncessite une vision holistique
pour mettre en place des moyens de lutte efficaces contre les causes de ces modifications
climatiques. Aussi, ce dfi majeur que lhumanit a relever permettra-t-il lHomme de
trouver sa place dans la biosphre et dentretenir des interactions avec tous les autres tres
vivants dans lharmonie et lunit ?!... Encore faut-il pour ce faire avoir les connaissances
ncessaires la comprhension de la complexit du vivant et du fonctionnement des cosystmes
De la complexit du vivant au sein des cosystmes
25

car : comprendre les principes de lEcologie est essentiel pour comprendre la condition
humaine (Margulis and Sagan 2002).
I.2. La biodiversit et les interactions : la complexit du vivant
I.2.1. La notion de diversit du vivant
Selon la Convention
2
sur la diversit biologique qui s'est tenue du 3 au 14 juin 1992 Rio de
Janeiro lors de la confrence des Nations Unies sur lenvironnement et le dveloppement
regroupant 157 pays signataires, la diversit biologique correspond : la variabilit des
organismes vivants de toute origine y compris, entre autres, les cosystmes terrestres, marins et
autres cosystmes aquatiques et les complexes cologiques dont ils font partie; cela comprend
la diversit au sein des espces et entre espces ainsi que celle des cosystmes.
La diversit est en gnrale subdivise en trois niveaux :
- La diversit gntique qui se dfinit par la variabilit des gnes au sein dune mme espce
ou dune population. On parle aussi de diversit intraspcifique qui se caractrise par la
diffrence de deux individus dune mme espce ou sous-espce.
- La diversit spcifique, appele aussi diversit interspcifique qui correspond la diversit
des espces. Ce niveau est le plus couramment utilis par les cologues.
- La diversit cosystmique, qui correspond la diversit des cosystmes prsents sur
Terre, des interactions des populations naturelles et de leur environnement physique.
Ces trois niveaux de diversit sont relis entre eux, mais sont suffisamment distincts pour que
chacun puisse tre tudi en soi. Il ne peut donc y avoir une mesure unique et objective de la
diversit, mais uniquement des mesures relatives des tendances ou objectifs prcis d'utilisation
ou d'application. La plupart des tudes sintressent plus particulirement la diversit
spcifique car elle constitue le palier le plus abordable tant au niveau conceptuel que pratique.
Nanmoins, celle-ci peut galement tre tudie selon diffrentes considrations du fait que la
diversit biologique prsente au moins deux dimensions dans un environnement donn : la
composition reprsentant le nombre despces prsentes et la structure reprsentant
lorganisation des espces prsentes en termes de nombre dindividus. Cette diffrenciation
conduit lexistence de diffrents outils de mesure de la diversit spcifique.
I.2.2. La richesse spcifique
Une premire mesure de la diversit spcifique consiste en ltude de sa richesse, note r .
Elle dsigne le nombre total d'espces qui coexistent dans un espace considr (Fig. 2).

2
Le texte intgral de la convention est disponible sur internet ladresse : http://www.cbd.int/doc/legal/cbd-fr.pdf
De la complexit du vivant au sein des cosystmes
26


r = 3 r = 3 r = 4
Figure 2 : Valeurs de la richesse spcifique correspondant au nombre despces coexistant dans un espace
considr. Les individus sont reprsents ici par des carrs et les espces par des couleurs, lensemble de chaque
damier constituant le peuplement considr.
Cette premire approche dpend de la taille des chantillons et de la surface chantillonne et
ne considre pas l'abondance relative des diffrentes espces. Ainsi, une forte richesse rsulte
dune accumulation despces par habitat et dune grande spcialisation de celles-ci.
Gnralement, dans de tels cosystmes, chaque espce utilise peu dhabitat ce qui se traduit par
des abondances faibles en termes deffectif populationnel de chaque espce (Mac Arthur 1967).
I.2.3. Les indices de diversit
Une autre approche de la diversit consiste tenir compte la fois du nombre despces
prsentes et de labondance de celles-ci. Il existe plusieurs indices mathmatiques, qui
constituent proprement parler les indices de la diversit spcifique, fournissant des
informations relatives cette double considration de la richesse spcifique et de labondance.
I.2.3.1. Lindice de diversit de Shannon-Weaver
Lindice de diversit de Shannon-Weaver est dfini par : H

o N
i

correspond au nombre dindividus dune espce donne, i allant de 1 S (nombre total
despces) et N au nombre total dindividus (Shannon and Weaver 1962) (Fig. 3).

H = 1,56 H = 1,27 H = 1,95
Figure 3 : Valeurs de lindice de Shannon-Weaver pour diffrents types de peuplement. Les individus sont
reprsents ici par des carrs et les espces par des couleurs, lensemble de chaque damier constituant le peuplement
considr.

Lindice de Shannon-Weaver est donc minimal (H=0) quand tous les individus du
peuplement appartiennent une seule et mme espce. Il est galement minimal si, dans un
peuplement, chaque espce est reprsente par un seul individu, except une espce qui compte
lensemble des autres individus du peuplement. A linverse, lindice est maximal quand tous les
individus sont rpartis de faon quivalente entre toutes les espces prsentes (Frontier, Pichod-
Viale et al. 2004).

De la complexit du vivant au sein des cosystmes
27

I.2.3.2. Lindice de diversit de Simpson
Lindice de Simpson mesure la probabilit que deux individus slectionns au hasard
appartiennent la mme espce (Simpson 1949). Il est dfini par :

o N
i

correspond au nombre dindividus dune espce donne, i allant de 1 S (nombre total
despces) et N au nombre total dindividus (Fig. 4).

S = 0,70 S = 0,59 S = 0,78
Figure 4 : Valeurs de lindice de diversit de Simpson (i.e. gale 1-D) pour diffrents types de peuplement. Les
individus sont reprsents ici par des carrs et les espces par des couleurs, lensemble de chaque damier constituant
le peuplement considr.
Cet indice a une valeur nulle pour indiquer le maximum de diversit (i.e. lorsque la
probabilit est faible que deux individus tirs au hasard appartiennent la mme espce) et une
valeur de 1 pour indiquer le minimum de diversit (i.e. lorsque la probabilit est forte que tous
les individus appartiennent la mme espce). En pratique, dans le but dobtenir des valeurs
plus intuitives , lindice de diversit de Simpson, not S, dtermin par 1-D est trs
gnralement prfr lindice de Simpson, D. Ainsi, le maximum de diversit est reprsent par
la valeur 1 et le minimum de diversit par la valeur nulle. Il est important de noter galement que
cet indice donne plus de poids aux espces abondantes quaux espces rares. En effet, le fait
dajouter des espces rares au peuplement considr ne modifie pratiquement pas la valeur de
lindice de diversit.
I.2.3.3. Lindice de diversit de Hill
Lindice de diversit de Hill, not H, permet dobtenir une mesure de labondance
proportionnelle liant les indices de Shannon-Weaver et de Simpson. En effet, lindice de Hill est
dfini par :

(Fig. 5)

H = 0,70 H = 0,68 H = 0,64
Figure 5 : Valeurs de lindice de diversit de Hill pour diffrents types de peuplement. Les individus sont
reprsents ici par des carrs et les espces par des couleurs, lensemble de chaque damier constituant le peuplement
considr.
De la complexit du vivant au sein des cosystmes
28

Ainsi, lindice de Hill donne une vue encore plus prcise de la diversit dun peuplement
donn. La composante 1/D va permettre de tenir compte des espces prsentant des abondances
en individus leves tandis que la composante e
H
va permettre de tenir compte des espces rares.
Selon sa formulation, plus lindice de Hill est proche de 1 et plus la diversit sera faible. De la
mme manire que pour lindice de Simpson, lindice 1-H est prfr pour une lecture plus
intuitive des valeurs fournies.
I.2.4. Le lien entre la diversit et les interactions du vivant
Si la diversit du vivant tient compte du nombre despces prsentes et de labondance de
chacune delles dans un environnement donn, un autre facteur de la complexit du vivant
consiste prendre en compte le nombre dinteractions quentretiennent les individus entre eux ou
connectance (ou connectivit). La connectance, note c , est dfinie comme le rapport entre le
nombre de liaisons existant effectivement entre les organismes et le nombre total de liaisons
possibles (Frontier, Pichod-Viale et al. 2004). Si n espces coexistent dans un environnement
donn, il y a n(n-1)/2 couples possibles ou n(n-1) interactions possibles si le sens des
interactions est distingu (i.e. si linteraction de lespce ou de lindividu A sur B est diffrent de
linteraction de lespce ou de lindividu B sur A) et la connectance est alors le rapport du
nombre dinteractions effectives sur ce total.
La relation entre diversit spcifique et connectance dans les rseaux trophiques peut tre
aborde selon deux hypothses (Fig. 6).

L = 1

4
12

1
3

L = 1

6
30

1
5

L = 2

8
12

2
3

L = 3

18
30

3
5

Figure 6 : Relation entre la diversit (en termes de nombre despces) et la connectance selon deux modalits
dinteractions : spcifiques (figures de gauche o chaque espce entretient une relation particulire avec une autre
espce) ou gnralistes (figures de droite o chaque espce entretient des relations avec plusieurs autres espces).
Le nombre dinteractions par espce est dsign par L , la connectance au niveau de la communaut par c .
Une premire hypothse suggre que le nombre de liens par espce, not L , est constant et
donc que la connectance diminue de manire hyperbolique quand la richesse spcifique
augmente (Cohen, Briand et al. 1990; Martinez 1992). Selon une deuxime hypothse, la
connectance est constante lorsque la richesse spcifique varie, et le nombre de liens par espce
augmente donc linairement avec la richesse spcifique (Martinez 1992). Enfin, dautres tudes
prdisent une variation du nombre de liens par espce, hypothse intermdiaire entre les deux
prcdentes (Havens 1992; Martinez 1994).
De la complexit du vivant au sein des cosystmes
29

Il est vraisemblable que la relation entre richesse spcifique et connectance dans un rseau
trophique dpend du niveau de richesse spcifique. La forme de la relation peut galement
dpendre du degr de gnralisme des prdateurs : en prsence de prdateurs plutt spcialistes,
le nombre de liens par espce a tendance rester invariant, tandis quen prsence de prdateurs
plus gnralistes le nombre de liens par espce a tendance augmenter avec le nombre.
Si le nombre dinteractions participe, avec la diversit, la complexit du vivant, la diversit
des interactions qui peuvent stablir entre organismes vivants y contribue aussi grandement.
I.3. La diversit des interactions du vivant
Une interaction biologique (ou biotique) dsigne un processus impliquant des changes ou
relations rciproques entre deux ou plusieurs lments (espces, groupes, biocnoses) dans un
cosystme. Les interactions constituent un ensemble complexe de phnomnes biologiques
htrognes dont la classification sest avre ncessaire. Si une interaction biologique a lieu
entre deux individus ou populations issus despces diffrentes alors linteraction sera qualifie
dinterspcifique. Si une interaction concerne deux individus ou plusieurs individus d'une mme
population alors elle sera qualifie dintraspcifique. Les effets des interactions sur des individus
ou sur des populations ont pu tre tudis bien avant que leurs mcanismes ne soient expliqus.
Cest pourquoi, historiquement, les interactions ont t caractrises par leurs effets apparents
(description phnomnologique) avant quelles ne le soient en fonction du mcanisme biologique
impliqu (description mcaniste).
I.3.1. La description phnomnologique des interactions
En 1953, Odum proposa une description phnomnologique des interactions considrant que
chaque individu ou population peut avoir un effet positif (facilitation, mutualisme), ngatif
(inhibition, comptition, prdation) ou neutre (absence deffet) sur la croissance dun autre
individu ou dune population (Odum 1953). La nature de linteraction bidirectionnelle tablie
entre deux partenaires dpend du signe des effets unidirectionnels de chacun des deux
partenaires sur lautre partenaire (Fig. 7).

Figure 7 : Schma reprsentant la classification phnomnologique des interactions biotiques pouvant stablir entre
deux ou plusieurs individus despces identiques ou diffrentes (reprsentes par les cercles colors nomms X
1
et
X
2
suivant la nomenclature mathmatique usuelle) dans un cosystme donn (Odum 1953).
De la complexit du vivant au sein des cosystmes
30

Ainsi, la classification dOdum nest pas fonde sur les mcanismes biologiques mis en jeu
mais uniquement sur les effets observables quelles induisent.
I.3.2. La description mcaniste des interactions
En 1977, Fredrickson proposa une classification des interactions en fonction du mcanisme
biologique impliqu (Fredrickson 1977). Il distingua notamment les interactions directes des
interactions indirectes (Fig. 8).

Figure 8 : Schma reprsentant la classification mcaniste des interactions biotiques pouvant stablir entre deux ou
plusieurs individus despces identiques ou diffrentes (reprsentes par les cercles colors nomms X
1
et X
2

suivant la nomenclature mathmatique usuelle) dans un cosystme donn (Fredrickson 1977).
Les interactions directes impliquent obligatoirement un contact physique entre les individus
ou populations concerns. Fredrickson limite donc ce type dinteractions au parasitisme et la
prdation. Les interactions indirectes sont, quant elles, ralises via une modification du
biotope comme par exemple la variation de ses paramtres physico-chimiques. Une majorit de
ces interactions indirectes font intervenir la production dune substance particulire. Si cette
substance napparait pas mtabolisable par une des populations prsentes dans lcosystme
donn et quelle a un effet positif ou ngatif sur la croissance dune de ces populations alors il
sagira dune interaction de type interfrence . Si cette substance apparait comme un substrat
du mtabolisme dau moins une des populations prsentes alors il sagira dune interaction dite
trophique .
I.3.3. Les rseaux trophiques
I.3.3.1. La description des rseaux trophiques
Selon leur principale source de nourriture, les espces prsentes dans un cosystme se
rpartissent en niveaux trophiques dpendant tous de celui des producteurs primaires ou
organismes autotrophes, nots P . La plupart de ces producteurs sont des organismes
photosynthtiques qui, laide de lnergie lumineuse, synthtisent des glucides et dautres
composs organiques qui serviront de combustible leur respiration cellulaire et de matriaux
leur croissance. Il est noter que dans les communauts qui vivent prs de sources thermales,
dans les fonds ocaniques, les producteurs primaires ne sont pas des organismes
photosynthtiques (la lumire ne parvenant pas les atteindre) mais des bactries
chimioautotrophes qui obtiennent leur nergie en oxydant le sulfure dhydrogne (Sibuet and
De la complexit du vivant au sein des cosystmes
31

Olu 1998; Tunnicliffe, Mac Arthur et al. 1998). Tous les autres organismes dun cosystme sont
des consommateurs, ou htrotrophes, qui se nourrissent directement ou indirectement de
produits issus des producteurs primaires. Ces organismes se dcomposent en diffrents niveaux
trophiques :
- Les consommateurs primaires, gnralement appels herbivores (nots H ) qui se
nourrissent des producteurs primaires et/ou des produits de leur mtabolisme.
- Les consommateurs secondaires et plus, gnralement appels carnivores (nots C ) qui
se nourrissent des consommateurs primaires et/ou des produits de leurs mtabolismes.
Lensemble de ces organismes sorganisent donc en un rseau reprsentant les diffrents liens
trophiques qui les unissent et mettant en vidence des interactions indirectes par interfrences
(Fig. 9).

Interactions dans un rseau
trophique comprenant deux
producteurs et un
consommateur
Interactions dans un rseau trophique
comprenant un producteur primaire, un
consommateur primaire et un consommateur
secondaire
Interactions dans un rseau trophique
comprenant un producteur primaire et
plusieurs consommateurs primaires et
secondaires
Figure 9 : Schma reprsentant diffrents rseaux trophiques ainsi que les interactions directes (reprsentes par les
flches continues) et indirectes (reprsentes par les flches discontinues) stablissant entre les diffrents
organismes qui composent les diffrents niveaux trophiques : producteurs primaires (P), consommateurs primaires
(H) et consommateurs secondaires (C).
Tous les cosystmes, quils soient terrestres ou aquatiques, peuvent tre reprsents par une
telle structuration trophique qui dtermine la circulation de lnergie et de la matire.
I.3.3.2. Le flux de matire et dnergie au sein des rseaux trophiques
Les rseaux trophiques sont caractriss par une structure pyramidale lie au flux dnergie et
de matire le long des niveaux trophiques (Fig. 10).

Figure 10 : Schma reprsentant les pertes nergtiques le long dun rseau trophique partir de 1 000 000 joules
dnergie solaire reus au cours dune priode donne.
La structure pyramidale des rseaux trophiques tient au fait que la productivit dcline
chaque transfert dnergie dans la hirarchie trophique. Cette diminution est une consquence
De la complexit du vivant au sein des cosystmes
32

des lois de la thermodynamique. En effet, pour une quantit dnergie constante donne
(premire loi de la thermodynamique), les organismes convertissent invitablement une partie de
lnergie quils consomment en chaleur qui se dissipe dans lcosystme (deuxime loi de la
thermodynamique). Daprs la loi de Raymond Laurel Lindeman (1942), la quantit d'nergie
passant d'un maillon l'autre de la chane trophique nest seulement que de 10% (Lindeman
1942). Autrement dit, 90% environ de lnergie disponible un niveau trophique ne se rend
jamais au niveau suivant. Cette perte dnergie le long de la chane alimentaire limite
radicalement la biomasse totale des consommateurs secondaires et suprieurs qui peuvent vivre
dans un cosystme. Cest pourquoi les rseaux trophiques comprennent rarement plus de quatre
cinq niveaux. Aussi, les populations de superprdateurs, au sommet de la chane, sont
gnralement de petite taille et sont donc trs vulnrables lextinction et aux risques volutifs
en cas de perturbations de leur cosystme.
Conceptualiser, quantifier, comprendre linfluence des diffrents types dinteractions sur les
espces assembles dans des rseaux trophiques, la diversit de la biocnose, le fonctionnement
des biotopes et lvolution de lensemble des diffrents cosystmes constituent certainement un
des plus complexes et des plus importants challenge pour lHomme qui trne au sommet de la
chaine et qui est donc sensible aux vnements atteignant les niveaux trophiques infrieurs
Bien que la route de la connaissance semble encore excessivement longue pour y parvenir, des
pas importants ont t franchis au cours des sicles passs et notamment partir du XIX
ime

sicle avec les travaux de Charles Darwin et sa thorie de la slection naturelle.
I.4. Les thories sur la complexit du vivant
I.4.1. Les prmices dune thorie globale
Si lEcologie est une science rcente, la comprhension du lien entre les espces et leur
organisation est une proccupation trs ancienne. Certains philosophes grecs y avaient dj
beaucoup rflchi. Il est tonnant de constater que leur philosophie tait essentiellement
transformiste (i.e. qui explique la diversit des espces par des transformations au cours du
temps). Ainsi, Epicure (341-270 avant J.C.) mit une rflexion qui sera reprise avec clat par
Lamarck quelque vingt sicles plus tard : suggrer que les organes des animaux se dveloppent
par lusage et saffaiblissent par inaction (concept dusage et non-usage dvelopp par Lamarck
en 1809 dans sa thorie de lEvolution). Aristote (382-922 avant J.C.), dans le livre IX de
Partibus Animalium nona le principe mme de la lutte pour lexistence : Les animaux sont en
guerre les uns contre les autres, quand ils habitent les mmes lieux et quils usent de la mme
nourriture. Si la nourriture nest pas assez abondante, ils se battent, fussent-ils de la mme
espce . Il se demande mme si de cette lutte nauraient pas pu rsulter lextinction des
De la complexit du vivant au sein des cosystmes
33

formes insuffisamment adaptes aux conditions dexistence et la conservation des formes bien
adaptes, do lapparente finalit que nous observons . Cependant, il repousse aussitt cette
ide considrant que les ressources de la nature sont assez grandes pour rendre impossible la
destruction dune de ses uvres (Perrier 1996). Malheureusement, ces prmices dune
thorie sur la complexit du vivant furent longtemps ignores. Il faudra attendre la Renaissance,
lre des grands navigateurs et des grandes dcouvertes, pour de nouveau voir poindre de la
curiosit pour le monde vivant. Ds lors, de nombreuses classifications des espces animales et
vgtales sont labores. Dans les annes 1550, le franais Pierre Belon (1517-1564) publie deux
ouvrages de classification : un sur les poissons (1553) lautre sur les oiseaux (1555). Dans ce
dernier, Belon, comparant les squelettes dun homme et dun poulet, fait remarquer un certain
nombre danalogies. Il sagissait l dune ide tellement originale pour lpoque quelle fut
oublie pendant prs de trois sicles avant de ressurgir avec Etienne Geoffroy Saint Hilaire
(1772-1844). Au tout dbut du XIX
ime
sicle, Jean-Baptiste Pierre Antoine Monnet, Chevalier
de Lamarck (1744-1829), labora pour la premire fois, dans son livre Philosophie Zoologique
(1809), une thorie globale et cohrente pour expliquer les mcanismes de lvolution
biologique. La philosophie de Lamarck tait profondment dterministe, ainsi crit-il dans son
ouvrage : La Nature, en produisant successivement toutes les espces danimaux et en
commenant par les plus imparfaits ou les plus simples pour terminer son ouvrage par les plus
parfaits, a compliqu graduellement leur organisation. Ces animaux se rpandant gnralement
dans toutes les rgions habitables du globe, chaque espce a reu, de linfluence des
circonstances dans lesquelles elle sest rencontre, les habitudes que nous lui connaissons et les
modifications dans ses parties que lobservation nous montre en elle . Selon lui lvolution est
unidirectionnelle et repose sur trois principes fondamentaux :
- Laction directe du milieu qui contraint le vivant au changement.
- Le rle de lusage et du non-usage, les organes ou fonctions utiles pour un organisme dans
un environnement donn se dveloppent tandis que les non-utiles satrophient.
- La transmission la descendance des transformations acquises au contact avec le milieu,
ce que lon traduira par lhrdit des caractres acquis.
Lamarck fut lobjet deffroyables attaques des derniers grands naturalistes adeptes du fixisme
(i.e. crationnisme), tel Georges Cuvier (1769-1832), qui parvinrent minorer la porte de sa
thorie en la maintenant ignore par une conspiration du silence (Chaline, 2006). Lamarck meurt
en 1829, aveugle et oubli. Mme si elle est aujourdhui largement dpasse, sa thorie a
constitu une tape fondamentale dans llaboration de la thorie darwinienne et il convient de
reconnatre le mrite et laudace de Lamarck, qui lon doit galement la cration du terme
De la complexit du vivant au sein des cosystmes
34

biologie signifiant tymologiquement Science du Vivant , ce qui ne fut pas fait en son
temps.
I.4.2. La thorie darwinienne
La formidable aventure de Darwin commena vritablement en dcembre 1831 lorsquil fut
recommand par lun de ses professeurs auprs du capitaine du Beagles Fitz-Roy (1805-1865)
pour effectuer une mission de cartographie du continent sud amricain. Ce voyage, qui dura cinq
annes, permit Darwin dobserver les adaptations des organismes qui peuplaient des milieux
aussi divers que la jungle brsilienne, la pampa argentine, les tendues dsertiques de la Terre de
Feu, les sommets vertigineux des Andes Darwin fut trs frapp de constater que la faune et la
flore des rgions tempres de lAmrique du Sud taient plus proches, dun point de vue
taxonomique, des espces des rgions tropicales de ce continent que des espces des rgions
tempres dEurope. En observant plus particulirement des populations de pinsons installes sur
larchipel des Galpagos, Darwin comprit peu peu que lorigine de nouvelles espces et
ladaptation constituent des processus troitement lis.
A son retour en Angleterre, en octobre 1836, Darwin commena rassembler ses notes et en
rdiger une synthse. En 1838, il prit connaissance du livre de lconomiste anglais Thomas
Robert Malthus (1766-1834), Le principe de population (1798), qui pose la ncessit dune lutte
pour lexistence. Finalement, cest en novembre 1859 que Darwin publie Lorigine des espces
et expose alors sa thorie de lvolution. Cette grande thorie regroupe deux ides matresses (i)
Toutes les espces ont un lien de parent, un anctre commun (ii) La slection naturelle, ou
lutte pour lexistence, est le moteur de lvolution des espces.
Laffirmation dune origine commune des espces provoqua un vritable choc notamment
dans les milieux bourgeois et religieux. En effet, Darwin niait une conception du monde qui avait
t enseigne pendant des sicles (et qui continue de ltre) : le crationnisme, qui veut que la
Terre ne soit ge que denviron 6 000 ans et que les formes vivantes aient t individuellement
et immuablement cres par Dieu en six jours ! Freud dira dailleurs, propos du choc provoqu
par Darwin, quil sagit l de la deuxime humiliation de lhumanit tout entire : la Terre nest
pas le centre de lUnivers et lHomme nest pas au centre de la cration Ceci peut
certainement expliquer le fait quen France, pays fortement catholique, le nom de Darwin resta
pratiquement inconnu du grand public jusquen 1862, ne fut reconnu quen 1878 loccasion de
son admission comme membre correspondant de lAcadmie des Sciences (dans la section
botanique comme spcialiste des plantes et non comme volutionniste !) et enseign seulement
vers la fin du XIX
ime
sicle.
De la complexit du vivant au sein des cosystmes
35

Concernant lide de la slection naturelle, Ernst Mayr (1904-2005), qui proposa en 1942 le
concept biologique de lespce, a dcompos les travaux de Darwin en partant de cinq
observations majeures :
- Toutes les espces ont une telle fertilit potentielle que leur effectif saccrotrait de manire
exponentielle si tous les descendants engendrs se reproduisaient.
- En dehors des fluctuations saisonnires, la plupart des populations ont normalement une
taille stable.
- Les ressources naturelles sont limites.
- Les caractristiques des individus dune population varient normment, il nexiste pas
deux individus identiques.
- Les variations sont en grande partie hrditaires.
Ces observations conduisent trois infrences formant la thorie darwinienne :
- La production dun nombre dindividus trop lev pour les ressources du milieu entrane
une lutte pour lexistence entre les membres dune population, et une fraction seulement des
descendants survit chaque gnration.
- Dans la lutte pour lexistence, la survie nest pas laisse au hasard : elle dpend en partie
de la constitution hrditaire. Les individus qui, grce des caractres dont ils ont hrit, sont les
plus aptes affronter leur milieu produisent vraisemblablement plus de descendants que les
individus moins aptes.
- Les individus nayant pas les mmes aptitudes la survie et la reproduction, la
population se modifie graduellement, et les caractres favorables saccumulent au fil des
gnrations.
Il est noter que si lide dune origine commune des espces fut assez rapidement accepte
par une trs grande majorit des biologistes, lide de la slection naturelle le fut bien moins. Il
manquait pour cela une thorie de la gntique qui aurait rendu compte des variations dues au
hasard tout en expliquant la prcision avec laquelle les caractres des parents sont transmis leur
progniture. En somme, il manquait Darwin les travaux, pourtant contemporains, de Gregor
Mendel (1822-1884) qui sont rests longtemps mconnus. Ce nest quen 1930, avec lessor de
la gntique des populations que les travaux des deux chercheurs seront mis en relation.
I.4.3. La double interprtation de la thorie darwinienne
Si lide de la slection naturelle mit du temps tre accepte, cest galement du fait que les
notions de lutte pour lexistence et de survie du plus apte qui y sont dveloppes faisaient
(et continuent de faire) largement dbat selon linterprtation qui en est faite. En effet, ces
notions peuvent tre perues au sens le plus troit : celui dune lutte violente et perptuelle
De la complexit du vivant au sein des cosystmes
36

entre les individus dune mme espce pour leur propre survie ou tre perues au sens large :
celui de la coopration entre individus dune mme espce pour la lutte contre la pression de
slection et la survie du plus grand nombre. Cette double interprtation qui peut paratre
subtile prend tout son sens lorsquil sagit de savoir qui est le plus apte survivre : celui qui
est le plus belliqueux avec ses congnres ou, au contraire, celui qui coopre le plus ?...
I.4.3.1. La coopration comme moteur de lvolution des espces
Si Darwin se rendait compte de limportance de la conception de lutte pour lexistence
quil introduisait en science, il prvoyait galement que cette expression puisse perdre sa
signification philosophique si elle tait employe exclusivement dans son sens troit. Dans les
premiers chapitres de lOrigine des espces, il insistait dj pour que la conception de lutte pour
lexistence soit prise dans son sens large et mtaphorique, comprenant la dpendance des tres
vivants entre eux, et comprenant aussi non seulement la vie de lindividu mais aussi le succs de
sa progniture (Origine des espces, ch. III). Bien que lui-mme, pour les besoins de sa
thorie, ait employ surtout le terme dans son sens troit, il mettait ses continuateurs en garde
contre lerreur dexagrer la porte dune signification restreinte de lexpression. Dans The
Descent of Man, il crivit quelques pages pour en expliquer le sens troit et le sens large. Il y
signale comment, dans dinnombrables socits animales, la lutte pour lexistence entre les
individus isols disparait, comment la lutte est remplace par la coopration et comment cette
substitution aboutit lmergence de proprits nouvelles qui assurent lespce de meilleures
conditions de survie. Il dclare ainsi que les plus aptes ne sont pas les plus forts physiquement, ni
les plus adroits mais ceux qui apprennent sunir de faon se soutenir mutuellement pour la
prosprit de la communaut. Les communauts, crit-il, qui renferment la plus grande
proportion de membres les plus sympathiques les uns aux autres, prosprent le mieux et lvent
le plus grand nombre de rejetons . Ainsi, lide de concurrence entre chacun et tous, ne de
ltroite conception malthusienne, perdait son troitesse dans lesprit dun observateur qui
connaissait la Nature. De nombreux auteurs se sont, en effet, attachs dmontrer, laide
dexemples, que la comptition au sein dune mme espce est un phnomne marginal au sein
des cosystmes naturels et qu linverse lentraide, la facilitation, le mutualisme prdominent.
Parmi eux peuvent tre cits notamment le zoologiste russe Karl Fedorovitch Kessler (1815-
1881) qui proposa La loi de lentraide rciproque et Pierre Kropotkine (1842-1921) qui
publia en 1902 Lentraide, un facteur de lvolution .
I.4.3.2. La comptition comme moteur de lvolution des espces
Nanmoins, au lieu dlargir sa thorie selon ses propres indications et en tenant compte des
remarques prcdentes, la grande majorit (tout du moins en termes dinfluence) des
De la complexit du vivant au sein des cosystmes
37

continuateurs de Darwin la restreignit encore. Ils en vinrent concevoir le monde animal comme
un monde de lutte perptuelle entre des individus affams de sang. Ils firent retentir la littrature
moderne du cri de guerre Malheur aux vaincus comme si ctait l le dernier mot de la
biologie moderne. Ainsi, Huxley, considr comme lun des meilleurs interprtes de la thorie de
lvolution, dcrte dans son article Struggle for existence and its bearing upon Man que :
jug au point de vue moral, le monde animal est peu prs au niveau dun combat de
gladiateurs [] Les plus faibles et les plus stupides taient crass, tandis que survivaient les
plus rsistants et les plus malins [] La guerre dont parle Hobbes de chacun contre tous est
ltat normal de lexistence (Huxley 1888).
Plus saisissante encore est la prface par Clmence Royer dune dition franaise de lOrigine
des espces (1866) : La loi de slection naturelle, applique lhumanit, fait voir avec
surprise, avec douleur, combien jusquici ont t fausses nos lois politiques et civiles, de mme
que notre morale religieuse. Il suffit den faire ressortir ici un des vices le moins souvent signal,
mais non pas lun des moins graves. Je veux parler de cette charit imprudente et aveugle pour
les tres mal constitus o notre re chrtienne a toujours cherch lidal de la vertu sociale et
que la dmocratie voudrait transformer en une source de solidarit obligatoire, bien que sa
consquence la plus directe soit daggraver et de multiplier dans la race humaine les maux
auxquels elle prtend porter remdes [] Que rsulte-t-il de cette protection inintelligente
accorde exclusivement aux faibles, aux infirmes, aux incurables, enfin tous les disgracis de
la nature ? Cest que les maux dont ils sont atteints tendent se perptuer indfiniment ; cest
que le mal augmente au lieu de diminuer . Ainsi donc fut thoris le darwinisme social et par l
mme lgitimes les atrocits qui feront du XX
ime
sicle lun, si ce nest le plus, sanglant de
lhistoire de lhumanit.
Nul doute que Darwin aurait t constern de constater la dformation de ses ides.
Ladaptation, en termes dvolution, est synonyme de fcondit. Le point important nest pas
dinfliger la mort, qui est invitable, mais de propager la vie, ce qui lest beaucoup moins.
I.4.4. Et demain, quelle thorie de la complexit du vivant ?
Les thories relatives la complexit du vivant ont grandement volu au cours de lhistoire
de lhumanit. Durant de nombreux sicles, la vision fixiste (i.e. crationniste) prdomina et avec
elle une perception caricaturale de lharmonie de la Nature au service des joies et profits de
lHomme. Cette perception se retrouve tout particulirement dans le fameux texte de Bernardin
de Saint-Pierre (1737-1814) : Les harmonies de la nature crit la toute fin de sa vie. Dans
celui-ci, lauteur expose entre autres ides et sans plaisanteries que si les melons ont des dessins
de tranches cest pour tre mangs en famille Cette vision statique fut par la suite balaye par
De la complexit du vivant au sein des cosystmes
38

la perception troite de la thorie darwinienne. Lallgorie de la Reine rouge illustre parfaitement
la vision volutionniste actuelle. Celle-ci fait rfrence un passage du livre De lautre ct du
miroir , suite dAlice au pays des merveilles, crit en 1871 par Lewis Caroll (1832-1898) :
Alice et la Reine Rouge se mirent courir [] la Reine allait si vite que la fillette avait toutes
les peines du monde se maintenir sa hauteur. [] Ce quil y avait de plus curieux dans
laventure cest que les arbres et les autres objets qui les entouraient ne changeaient pas du tout
de place. Si vite quelles courussent, il semblait quelles ne dpassassent jamais rien. Puis,
lorsquAlice demanda la Reine rouge pourquoi elles couraient, celle-ci lui rpondit : Il faut
courir de toute la vitesse de ses jambes pour simplement rester l o lon est . La perception
actuelle de la Nature est ainsi un systme dans lequel toutes les espces, tous les gnes courent
aussi vite que possible, parce que celui qui se laisse distancer est irrmdiablement perdu ou plus
exactement parce que ne restent que ceux qui ont couru plus vite que les autres
Mais alors que penser des espces dites fossiles telles que les limules, euarthropodes marins
dont le groupe semble ne pas avoir volu depuis plus de 500 millions dannes ? Plus troublant
encore est le paradoxe des mutations. En effet, les mutations alatoires apparaissent extrmement
rares car les systmes naturels mettent au point des mthodes extrmement sophistiques pour
viter leur apparition ou rduire leur frquence au maximum Voil qui conduit nous poser
une question fondamentale : sil faut sans cesse courir pour conserver sa place, si les mutations
gntiques jouent un rle aussi important dans le changement volutif alors pourquoi les
systmes vivants ont-ils acquis des processus de correction aussi perfectionns ? Richard
Dawkins crit : Pouvons-nous concilier lide que la duplication derreurs est une condition
sine qua non de lEvolution avec laffirmation que la slection naturelle favorise une fidlit
extrme de la copie ? . Ainsi, entre un fixisme rigide et une course frntique, nul doute que
notre perception de la Nature va continuer voluer, se modifier. Encore faut-il pour cela que
nous ne nous focalisions pas sur quelques dimensions de la complexit du vivant telles que la
richesse spcifique et les interactions trophiques, comme ce fut longtemps le cas, mais que nous
abordions la complexit dans tous ces aspects et notamment dans les tudes thoriques relatives
la modlisation du vivant.




De la modlisation de la complexit du vivant
39

II. DE LA II. DE LA II. DE LA II. DE LA MODLISATION MODLISATION MODLISATION MODLISATION DE LA DE LA DE LA DE LA COMPLEXIT COMPLEXIT COMPLEXIT COMPLEXIT DU DU DU DU
VIVANT VIVANT VIVANT VIVANT
Homme qui marche, il ny a pas de chemin,
le chemin se dessine en marchant
Antonio Machado.
II.1. Les diffrentes approches de la modlisation en cologie
Dune manire gnrale, les modles mathmatiques en cologie constituent des outils de
reprsentation, de comprhension du fonctionnement de systmes naturels et/ou de prdiction de
leur volution. Selon que la modlisation est aborde uniquement partir de donnes relles ou
en tenant compte galement des connaissances de lois fondamentales censes rgir le phnomne
modliser, deux grands types de modles peuvent tre distingus : les modles de
comportement et les modles phnomnologiques. Les premiers, galement appels botes
noires , ont pour seul objectif de reproduire le comportement du systme tudi. Si ces modles
sont largement utiliss en automatique pour synthtiser des lois de commandes, comme nous le
verrons par la suite, ils sont relativement peu utiles lorsque l'objectif de la modlisation est une
meilleure comprhension du systme ou lorsquil sagit de tester des hypothses relatives sa
dynamique. Les modles phnomnologiques sont construits partir de la connaissance et des
hypothses ralistes qui peuvent tre faites sur le phnomne tudi que l'on souhaite modliser.
Ils font intervenir les principes premiers de la physique et notamment les lois relatives la
conservation de la masse et au transfert de la matire et de l'nergie entre plusieurs
compartiments. Cest ce type de modlisation que nous avons travaill au cours de cette thse.
Un second niveau de classification des diffrentes approches thoriques fait intervenir la
relation du phnomne tudi au temps. En effet, il est possible de considrer que le phnomne
est susceptible d'avoir une valeur continue dans le temps ou, linverse, quil ne prend qu'un
nombre fini de valeurs. Dans le premier cas, il sagira de modles dits continus, dans le second
cas, il sagira dun modle dit discret ne dcrivant le phnomne tudi qu'en un nombre
dtermin d'instants (c'est le cas par exemple de la pullulation d'espces, l'effectif de ce type de
population restant pratiquement constant entre deux instants de multiplication). Bien que n'ayant
utilis en pratique que des modles continus, nous aborderons brivement le cas des modles
discrets dans cette partie bibliographique, ceux-ci ayant jou un rle particulirement important
en cologie concernant l'hypothse chaotique du comportement de certains cosystmes.
Enfin, le dernier niveau de classification pertinent souligner ici est le caractre dterministe
ou stochastique des modles. Dans le domaine de lautomatique, cette distinction est souvent lie
la manire dont les incertitudes du modle ou celles entachant les donnes sont prises en
De la modlisation de la complexit du vivant
40

compte. Par exemple, ne disposant pas d'informations fines sur les processus menant d'une
procdure d'chantillonnage l'tablissement d'une grandeur physique (par exemple la mesure de
la masse d'un chantillon) et au regard de la disparit des sources d'erreurs manant de la
procdure en elle-mme (lie par exemple ici la prise d'chantillon), les modlisateurs ont
coutume de considrer que toute mesure est entache d'une erreur modlise par une variable
alatoire pourvue de proprits statistiques connues (voire inconnues dans certaines approches
sophistiques). Lorsquil nest pas possible de quantifier ni mme de qualifier les erreurs et
incertitudes lies la modlisation d'un phnomne donn ou lorsque l'on suppose que ces
erreurs sont ngligeables, on peut s'en remettre, pour dcrire le phnomne, une approche
purement dterministe dont l'objet est la description des liens entre des causes et des effets. A
linverse, si les liens de causalit dans un phnomne ne sont pas tablis ou ignors alors il
sagira dune approche purement stochastique faisant appel des calculs de probabilits. Dans
cette thse, c'est lapproche dterministe qui prvaut et que nous dvelopperons de faon plus
dtaille ci-aprs. Concernant lapproche stochastique, nous nous contenterons simplement d'en
rappeler les grands principes sans rentrer dans davantage de dtails.
Quelle que soit lapproche choisie, il ne faut pas oublier que la modlisation induit ltude des
proprits du modle mathmatique et non vritablement celle du systme naturel tudi. Un
modle permet daller au bout des consquences logiques de ses hypothses initiales, et il ne sera
acceptable que dans certains intervalles de valeurs des variables introduites. Aussi, dun champ
dapplication un autre il devra tre modifi mme sil semble premire vue dcrire un mme
type de processus. De plus, les modles doivent tre valids par la confrontation de leurs
rsultats avec ceux dexpriences ralisables (Fig. 11).


Figure 11 : Comparaison dun modle de variations priodiques temporelles avec les variations rellement obtenues
partir dobservations ralises dans le temps avec une frquence leve.
Si ces nouvelles expriences corroborent les prdictions du modle, alors la validation de
celui-ci est confirme et la connaissance du domaine modlis est rellement augmente. Cette
dynamique de construction est la seule valable pour ltude du vivant car seule lexprience est
capable de nous aider nous faire une ide sur la vrit ou la fausset des noncs portant sur
des faits (Popper 1972). Nanmoins, nous verrons que bien souvent cette tape est nglige
notamment du fait de la sparation persistante entre approche thorique et approche
exprimentale.
De la modlisation de la complexit du vivant
41

II.1.1. Lapproche stochastique de la modlisation du vivant
Une modlisation est dite stochastique si des variables alatoires interviennent dans la
dfinition du systme. La sortie du modle nest alors pas une valeur mais une distribution de
valeurs. Notons que cette dernire approche a rcemment pris une plus grande importance en
cologie depuis la publication du modle neutre (Hubbell 2001). Dans un premier temps, cette
approche pourrait paratre provocatrice pour une trs grande majorit dcologues et
dvolutionnistes car elle repose sur le postulat que toutes les espces sont quivalentes et ont la
mme capacit de reproduction contredisant, ainsi la thorie de la slection naturelle (Bell 2001).
En fait, le mcanisme qui sous-tend le modle neutre est la limitation de la dispersion et du
recrutement dindividus au sein dun cosystme. La limitation de dispersion est ralise
lorsquune espce ne parvient pas un site qui lui serait favorable tandis que la limitation du
recrutement est ralise lorsquune espce ne parvient pas se dvelopper dans un site favorable
(Nathan and Muller-Landau 2000; Muller-Landau 2002). Ces mcanismes permettent, au moins
en thorie, des espces moins comptitives que dautres de sinstaller et de se dvelopper.
Nanmoins, si un tel modle parvient reproduire la dynamique de populations darbres dans
des cosystmes forestiers, domaine de prdilection de Hubbell et ce pour quoi il a labor ce
modle, son utilisation dans dautres cosystmes savre plus dlicate.
II.1.2. Lapproche dterministe de la modlisation du vivant
II.1.2.1. La dfinition du dterminisme
Le dterminisme est une thorie selon laquelle les phnomnes sont causs par leurs
antcdents. Pour expliquer le principe de causalit, le savant franais Pierre-Simon de Laplace
recourait une mtaphore qui par la suite a t appele le dmon de Laplace . Il affirmait
Nous devons envisager l'tat prsent de l'univers comme l'effet de son tat antrieur, et comme
la cause de celui qui va suivre. Une intelligence qui, pour un instant donn, connatrait toutes les
forces dont la nature est anime et la situation respective des tres qui la composent, si d'ailleurs
elle tait assez vaste pour soumettre ces donnes l'analyse, embrasserait dans la mme formule
les mouvements des plus grands corps de l'univers et ceux du plus lger atome : rien ne serait
incertain pour elle, et l'avenir, comme le pass, seraient prsents ses yeux. L'esprit humain
offre, dans la perfection qu'il a su donner l'astronomie, une faible esquisse de cette
intelligence. Ses dcouvertes en mcanique et en gomtrie, jointes celles de la pesanteur
universelle, l'ont mis porte de comprendre dans les mmes expressions analytiques les tats
passs et futurs du systme du monde. En appliquant la mme mthode quelques autres objets
de ses connaissances, il est parvenu ramener des lois gnrales les phnomnes observs, et
De la modlisation de la complexit du vivant
42

prvoir ceux que les circonstances donnes doivent faire clore (Essai philosophique sur les
probabilits
3
, 1886).
Le principe du dterminisme est, en quelque sorte inn dans la science, puisqu'il confre un
sens la recherche scientifique. Ce sens consiste, en dfinitive, dans l'ide qu'il existe des lois
qu'il est possible et significatif de dterminer. Autrement dit, la science est une connaissance
rationnelle parce qu'elle dmontre les connexions relles entre les causes et les effets, et qu'elle
n'a pas recours dans ses explications des lments sotriques ou mystiques.
II.1.2.2. Les quations diffrentielles, outils de la modlisation
dterministe
La modlisation dterministe des systmes dynamiques fait intervenir des quations
diffrentielles dont les prcurseurs sont les mthodes de calcul dveloppes par Newton (1642-
1727) lors de ses tudes sur la gravitation et les orbites des plantes quil dveloppa dans son
ouvrage majeur : Principes mathmatiques de la philosophie naturelle publi en 1687.
Lutilisation de ces quations diffrentielles fut ensuite gnralise et largement employe pour
la modlisation de la dynamique des populations et notamment lorsquil sagit de prdire
leffectif futur dune population partir dinformations sur son effectif initial et sur les lois
qui rgissent son volution.
Une quation diffrentielle est une quation du type :
qui peut galement scrire

.
Cette seconde notation permet de mieux percevoir que y et y sont des fonctions du
temps. Une telle quation a pour solution une fonction y(t) drivable qui vrifie cette relation
en tout point t . La condition initiale de la solution y(t) , note y(0) , est une constante
prciser. Laspect dterministe des quations diffrentielles a des implications fortes et se
concrtisent mathmatiquement par le thorme de Cauchy-Lipschitz. Nanmoins, la plupart des
quations diffrentielles ne peuvent pas tre rsolues explicitement.
Le mathmaticien franais Henri Poincar (1854-1912) proposa, dans son ouvrage
Mmoires sur les courbes dfinies par une quation diffrentielle (1881), des outils
permettant de connatre lallure globale des courbes intgrales. Pour visualiser lallure de ces
courbes, Poincar dfinit un point dans un repre, ou espace, caractrisant ltat du systme un
instant t . Lorsque le temps scoule, le point figurant ltat du systme dcrit, en gnral, une
courbe ou orbite dans cet espace qualifi despace des phases. Poincar a mis en vidence que
ces orbites ne pouvaient prendre quun nombre restreint de formes (Fig. 12).

3
Lensemble de cet ouvrage est disponible gratuitement sur internet ladresse : http://www.vigdor.com/index.html

Figure 12 : Schma reprsentant les diffrentes allures globales ou orbites des courbes intgrales. Les
haut reprsentent la dynamique dun systme en visualisation classique tandis que les graphiques du bas
reprsentent les mmes dynamiques visualises dans lespace des phases
en ordonne. (a) Lorbite converge vers un point dquilibre. (b) Lorbite saccumule autour dune orbite priodique.
(c) Lorbite prsente plusieurs boucles priodiques
Le systme dcrit par des quations diffrentielles peut
d'quilibre aprs maintes oscillations, ce qui correspond dans l'espace des phases des boucles
qui convergent vers un point (Fig. 12, a). Le systme peut galement
ce qui correspond dans l'espace des phases une orbite cyclique
galement prsenter un mouvement priodique
quaprs trois oscillations diffrentes : on dit qu'
correspond des boucles plus compliques dans l'espace
systme peut prsenter une dynamique
dans l'espace des phases (Fig. 12, d)
II.2. Les modles dterministes historiques en cologie
II.2.1. Le modle malthusien
La construction dun modle mathmatique en cologie ncessite de faire des hypothses
pralables sur les traits de vie des organismes. Celles
caractristiques essentielles de la ralit et de la simplifier suffisamment pour quelle puisse tre
tudie par les mathmatiques. Un cas relativement classique est de poser lhypothse, H
suivante : Le taux de variation de la population est proportionnel, en tout temps
densit de population X(t) prsente au temps
diffrentielle par :
o r est une constante pouvant tre positive et dans ce cas la taille de la population augmente
ou ngative et dans ce cas la taille de la population diminue au cours du temps. Ainsi,
constitue en fait le taux de croissance intrin
modle fut propos en 1798 par Malthus qui salarmait du fait que la production de ressources
De la modlisation de la complexit du vivant
Schma reprsentant les diffrentes allures globales ou orbites des courbes intgrales. Les
haut reprsentent la dynamique dun systme en visualisation classique tandis que les graphiques du bas
reprsentent les mmes dynamiques visualises dans lespace des phases o y est reprsent en abscisse et
(a) Lorbite converge vers un point dquilibre. (b) Lorbite saccumule autour dune orbite priodique.
(c) Lorbite prsente plusieurs boucles priodiques. (d) Lorbite prend la forme dune aile de papillon
dcrit par des quations diffrentielles peut, entre autres, converge
s maintes oscillations, ce qui correspond dans l'espace des phases des boucles
(Fig. 12, a). Le systme peut galement se rpte
ce qui correspond dans l'espace des phases une orbite cyclique (Fig. 12, b)
un mouvement priodique plus complexe tel que ne
aprs trois oscillations diffrentes : on dit qu'il possde un cycle de priode trois.
correspond des boucles plus compliques dans l'espace des phases (Fig. 12, c)
peut prsenter une dynamique chaotique, et prsente alors une forme en aile de papillon
s l'espace des phases (Fig. 12, d).
II.2. Les modles dterministes historiques en cologie
II.2.1. Le modle malthusien ou de croissance exponentielle dune espce
La construction dun modle mathmatique en cologie ncessite de faire des hypothses
pralables sur les traits de vie des organismes. Celles-ci ont pour rle de prserver certaines
es de la ralit et de la simplifier suffisamment pour quelle puisse tre
tudie par les mathmatiques. Un cas relativement classique est de poser lhypothse, H
Le taux de variation de la population est proportionnel, en tout temps
population X(t) prsente au temps t . Cela se traduit laide dune quation

est une constante pouvant tre positive et dans ce cas la taille de la population augmente
ou ngative et dans ce cas la taille de la population diminue au cours du temps. Ainsi,
constitue en fait le taux de croissance intrinsque spcifique de la population considre. Ce
modle fut propos en 1798 par Malthus qui salarmait du fait que la production de ressources
modlisation de la complexit du vivant
43

Schma reprsentant les diffrentes allures globales ou orbites des courbes intgrales. Les graphiques du
haut reprsentent la dynamique dun systme en visualisation classique tandis que les graphiques du bas
est reprsent en abscisse et
(a) Lorbite converge vers un point dquilibre. (b) Lorbite saccumule autour dune orbite priodique.
aile de papillon (Gleick 1999).
converger vers un tat
s maintes oscillations, ce qui correspond dans l'espace des phases des boucles
rpter priodiquement,
(Fig. 12, b). Le systme peut
plus complexe tel que ne se rpter seulement
il possde un cycle de priode trois. Cela
(Fig. 12, c). Enfin, le
forme en aile de papillon
ou de croissance exponentielle dune espce
La construction dun modle mathmatique en cologie ncessite de faire des hypothses
ci ont pour rle de prserver certaines
es de la ralit et de la simplifier suffisamment pour quelle puisse tre
tudie par les mathmatiques. Un cas relativement classique est de poser lhypothse, H
0
,
Le taux de variation de la population est proportionnel, en tout temps t , la
. Cela se traduit laide dune quation
est une constante pouvant tre positive et dans ce cas la taille de la population augmente
ou ngative et dans ce cas la taille de la population diminue au cours du temps. Ainsi, r
de la population considre. Ce
modle fut propos en 1798 par Malthus qui salarmait du fait que la production de ressources
De la modlisation de la complexit du vivant
44

suivait, selon lui, une croissance arithmtique tandis que les populations suivaient une croissance
exponentielle.
II.2.2. Le modle logistique ou de croissance borne dune espce
II.2.2.1. La prsentation du modle logistique
Le modle malthusien peut tre considr comme prdictif pour des pas de temps
raisonnables. En effet, si lon considre r comme positif alors la population ne cessera
daugmenter ce qui, biologiquement, traduirait un contexte de ressources non-limitantes
rarement ralis dans les cosystmes naturels. Aussi pour tenir compte de ce ralisme
biologique, le modle malthusien peut tre modifi par lintroduction dun substrat limitant, not
S , conduisant au systme dquations suivant :


Une autre manire de lexprimer consiste en lintroduction dun facteur rtroactif limitant la
hausse de la population quand sa densit devient leve par rapport lenvironnement. Pour cela,
la notion de capacit biotique du milieu, note k , correspondant la quantit dorganismes
vivants pouvant tre supporte par le milieu considr est ajout dans lquation du modle
malthusien. Ainsi, une autre faon dexprimer ces contraintes biologiques pourrait tre :

.
Cette quation, qui donne le modle mathmatique de la croissance des populations animales
est dnomme modle de Verhulst du nom de son concepteur : le mathmaticien belge
Verhulst (1804-1849) qui la propos en 1838 et est aussi appel modle logistique (Britton
2004).
II.2.2.2. La stratgie r et la stratgie k
Lquation de Verhulst, qui fait intervenir le taux de croissance r et la capacit biotique
k du milieu, est, avec la thorie de biogographie (Mac Arthur and Wilson 1967) lorigine
du concept de stratgie dmographique r versus stratgie k qui peut caractriser chaque
espce. En effet, au sein dun cosystme, une espce donne se trouve confronte :
- Un milieu ambiant dont les proprits sont plus ou moins fluctuantes.
- Des ressources alimentaires plus ou moins limitantes et plus ou moins diversifies.
- Dautres espces avec lesquelles elles peuvent ventuellement tre en comptition pour la
mme ressource.
- Des causes de mortalit ou dinhibition varies.
De la modlisation de la complexit du vivant
45

Pour faire face ces alas, chaque espce a, au cours de son volution, acquis une stratgie
dmographique le long dun gradient allant dune stratgie r une stratgie k . Les
espces prsentant une stratgie r sont caractrises par une grande vitesse de multiplication
et la possibilit de coloniser rapidement une ressource, quil sagisse dune ressource alimentaire
ou dun espace disponible. A linverse, les espces prsentant une stratgie k sont
caractrises par un taux de croissance faible mais une trs bonne capacit maintenir leurs
effectifs constants, qui tendent vers le maximum de la capacit biotique du milieu, ce qui
ncessite des mcanismes de protection et de spcialisation.
Cette diffrence de stratgie pour loccupation dun milieu donn se caractrise par de
profondes diffrences entre les deux types despces (Tableau 1).
Tableau 1 : Comparaison des caractristiques entre les espces r et k (Fischesser and Dupuis-Tate 1996).
Stratgie r Stratgie k
Petite taille
Productivit forte
Grande prcocit sexuelle
Mortalit forte
Esprance de vie courte
Perte nergtique considrable
Espces de type gnraliste
Espces pionnires et colonisatrices
Effectifs trs fluctuants
Grande taille
Productivit faible
Priode dimmaturit longue
Mortalit faible
Esprance de vie longue
Economie de lutilisation de lnergie
Espces de type spcialiste
Espces infodes au climax
Faibles fluctuations des effectifs
Quelques exemples dorganismes stratgie r et k peuvent tre cits en guise
dillustration. Les mammifres, en rgle gnrale, sont caractristiques dune stratgie k . En
effet, ils font peu de descendants mais ceux-ci sont trs protgs par un investissement parental
important tant en ce qui concerne lalimentation que la protection vis--vis dventuels
prdateurs. A linverse, les poissons, par exemple, pondent gnralement beaucoup dufs mais
linvestissement parental est absent laissant les juvniles leur propre destin.
II.2.2.3. Le chaos dterministe
Le modle de Verhulst sera, entre autres, repris par le dmographe amricain Raymond Pearl
au dbut du XX
ime
sicle ainsi que par le mathmaticien italien Vito Volterra, intrigus par le
comportement diffrent de lvolution de la population dune espce une autre. En effet, sur un
territoire donn, il est possible dobserver que la population de certaines espces semble se
stabiliser tandis que dautres semblent suivre des cycles rguliers ou encore fluctuer de faon
apparemment alatoire. Ainsi peut-on se poser la question de savoir pourquoi certaines espces
se stabilisent et dautres non quand toutes les populations animales semblent avoir un
comportement de mme nature.
De la modlisation de la complexit du vivant
46

Dans les annes 1970, le mathmaticien James Yorke et un physicien australien, Robert May,
tudirent des populations dinsectes. Ils dcouvrirent alors que lvolution de chaque population
peut tre dcrite par une loi logistique et dpend grandement de la valeur de r (Fig. 13). Il
faut prciser ici que ces auteurs nont pas utilis le modle logistique tel quil est dcrit
prcdemment mais une quivalence en temps discret, soit une suite logistique (May 1976).

Figure 13 : Dynamiques dune population selon une suite logistique en fonction de la valeur du paramtre r
(Gleick 1999).
En effet, tandis que pour des valeurs relativement faibles de X
0
, nombre dindividus dans
la population considre ltat initial, et de r , la suite logistique prdit une stabilisation de la
population considre, une augmentation de la valeur de r se traduit par une augmentation
doscillations irrgulires, ou chaotiques, allant de la saturation du milieu lextinction de la
population. De plus, Yorke et May ont galement mis en vidence que lvolution dune
population dcrite par la suite logistique dpend galement de la valeur de X
0
(Fig. 14).
r=1

X
0
=0,1 X
0
=0,8
r=2
X
0
=0,1 X
0
=0,8
r=3,8
X
0
=0,1 X
0
=0,8
r=3,8
X
0
=0,8 X
0
=0,8001
Figure 14 : Dynamiques dune population selon une suite logistique en fonction de la valeur des paramtres X
0

et r (daprs Gleick, 1999).
De la modlisation de la complexit du vivant
47

En effet, pour une valeur de k fixe en dehors de la zone chaotique, soit quand r<3, la valeur
du nombre dindividus ltat initial, X
0
, na aucune influence. En revanche, dans la phase
chaotique, soit quand r>3, alors une trs petite variation de la valeur initiale X
0
modifie
grandement lvolution dmographique de la population. Cest leffet papillon .
Les phnomnes mis en vidence par Yorke et May sont plus perceptibles encore si lon
adopte une reprsentation suivant le diagramme de Feigenbaum, du nom du mathmaticien
amricain qui la propos en 1975, qui se prsente de la faon suivante : pour chaque valeur du
taux de croissance intrinsque, r , en abscisse, sont gnres, en phase asymptotique, cent
valeurs successives de X(t) en ordonnes pour un instant dt donn (Fig. 15).

Figure 15 : Dynamiques dune population selon le modle logistique, ou de Verhulst, en fonction de la valeur des
paramtres X
0
et r (Feigenbaum 1980).
Ainsi, le diagramme de Feigenbaum indique clairement que :
- Quand r<3, le systme tend vers un tat final stable.
- Quand r>3, le nombre dindividus dans la population se met osciller entre deux, puis
quatre, puis huit valeurs jusqu entrer dans une zone chaotique o toutes les valeurs semblent
possibles.
Le diagramme de Feigenbaum montre ainsi deux rsultats particulirement curieux :
- Les bifurcations en deux, puis quatre, puis huit vont se multiplier linfini sur un
intervalle qui ne dpassera jamais le point r=3,57 appel le point de Feigenbaum ou porte
dentre sur le chaos . En effet, cest toujours partir de ce point que le systme devient
chaotique cest--dire quil se met fluctuer entre des valeurs imprvisibles .
- La longueur des intervalles propres aux diffrentes classes de bifurcation (2, 4, 8)
diminue dans un rapport qui tend vers une constante 4,67 appel constante de Feigenbaum .
Il est galement noter que ces bifurcations, points et constantes de Feigenbaum ne se
retrouvent pas seulement dans le cas de la fonction logistique mais galement dans de nombreux
phnomnes physiques comme lhydrodynamique, llectronique, les lasers, lacoustique
(Peitgen, Jurgens et al. 1992)


De la modlisation de la complexit du vivant
48

II.2.3. Le modle de Lotka-Volterra ou modle proie-prdateur
II.2.3.1. Lhistorique du modle de Lotka-Volterra
Le modle de Verhulst, sil tient compte de la capacit du milieu et donc de la densit de la
population, ne considre pas les interactions du vivant qui peuvent influencer labondance des
diffrentes espces. Un des premiers modles dinteraction entre espces fut dvelopp
indpendamment par lamricain Alfred Lotka (1880-1949) et litalien Vito Volterra (1860-
1940) et est connu sous le nom de modle de Lotka-Volterra. En 1925, Volterra prta son
attention sur un trange phnomne : durant la premire guerre mondiale, la population de
sardines dans la mer Adriatique avait fortement baiss bien que lactivit de pche y fut
nettement moins intense. De plus, Volterra remarqua que le nombre de requins, prdateur naturel
de la sardine, avait paralllement fortement augment. Aussi, Volterra rechercha un modle
reprsentant cette relation proie-prdateur. En 1924, Lotka, de son ct, tudia un problme
analogue pos dans le domaine agricole et tenta de le rsoudre de la mme manire.
Le modle de Lotka-Volterra est depuis devenu un des modles les plus utiliss en cologie
car il peut tre considr comme lanctre de tous les modles diffrentiels dinteractions bien
qu lorigine il ne sintressait quaux relations trophiques, cest--dire des relations de type
proie-prdateur, refltant la conception restreinte de la thorie darwinienne que nous avons
aborde prcdemment.
II.2.3.2. Les hypothses du modle de Lotka-Volterra
Le modle de Lotka-Volterra concerne deux populations dont les effectifs au temps t sont
respectivement nots X(t) et Y(t) , la seconde (les prdateurs) se nourrissant de la
premire (les proies). Les hypothses, invitablement simplificatrices, sont :
- Les proies disposent de nourriture en quantit illimite, seuls les prdateurs sopposent
leur croissance et en labsence de prdateurs, la population des proies a une croissance
exponentielle.
- Le nombre de prdateurs est limit par la quantit de proies dont ils disposent pour se
nourrir et en labsence de proies, la population a une dcroissance exponentielle.
- Le nombre de rencontres entre proies et prdateurs est la fois proportionnel au nombre de
proies et au nombre de prdateurs.
- Le taux de disparition des proies ainsi que le taux de croissance des prdateurs dus ces
rencontres sont lun et lautre proportionnels au nombre de rencontres entre les deux populations.


De la modlisation de la complexit du vivant
49

II.2.3.3. La description du modle de Lotka-Volterra
Le modle de Lotka-Volterra fait donc intervenir deux populations reprsentes chacune par
une quation diffrentielle.
Lquation relative la proie introduit :
- Un modle malthusien de croissance comprenant un terme du premier degr en X
entranant une croissance exponentielle.
- Un terme ngatif dcrivant linfluence du prdateur et refltant une mortalit
proportionnelle au taux de rencontre entre un individu de lespce proie et un individu de
lespce prdatrice, taux proportionnel aux deux densits de population soit leur produit
XY .
Ceci conduit lquation diffrentielle :

soit


o r est le taux de croissance intrinsque de la population et le taux de prdation. Ces deux
coefficients sont invariables dans le temps et invariables vis--vis des densits des deux
populations. Ainsi, ces deux coefficients restent constants au cours du temps ce qui, bien
entendu, constitue une simplification de la ralit.
Lquation relative au prdateur introduit :
- Un modle malthusien de mortalit comprenant un terme du premier degr en Y
entranant une mortalit exponentielle en labsence de proies.
- Un terme positif dcrivant linfluence de la proie et refltant une croissance
proportionnelle au taux de rencontre entre un individu de lespce proie et un individu de
lespce prdatrice, taux proportionnel aux deux densits de population soit leur produit
XY
Ceci conduit lquation diffrentielle :

soit


o est le taux de mortalit de la population et la capacit de prdation du prdateur
vis--vis de la proie. De la mme manire que pour les coefficients de lquation de lespce
proie, ceux-ci restent constants au cours du temps.
Le modle de Lotka-Volterra consiste donc en un systme de deux quations diffrentielles
couples et ce systme prdateurs-proies est considr lquilibre quand les densits de proies
et les densits de prdateurs sont constantes. Cela revient chercher la quantit de prdateurs,
De la modlisation de la complexit du vivant
50

alors note Y* , telle que la variation de proies soit nulle dans le temps et la quantit de
proies, alors note X* , telle que la variation de prdateurs soit nulle. Ainsi, lquilibre :

0
do


Chacune des quations ci-dessus reprsente une isocline du systme et lquilibre est atteint
lintersection des deux (Fig. 16).

Figure 16 : Espaces des phases du modle de Lotka-Volterra et volution de labondance des proies et des
prdateurs de part et dautres des isoclines nulles du systme.
Dans les quations du modle de Lotka-Volterra, la vitesse maximale daccroissement dune
population de prdateurs se situe au moment de la densit maximale de ses proies refltant que le
taux de multiplication du prdateur dpend essentiellement de la disponibilit de sa nourriture.
Rciproquement, la vitesse maximale de dcroissance dune population de proies se situe au
moment de la densit maximale de prdateurs refltant que la cause de mortalit de cette
population est la prdation. Les oscillations des deux populations sont donc de mme frquence
mais dcales dun quart de priode (Fig. 17).

Figure 17 : Oscillations entretenues indfiniment des populations de prdateurs et de proies selon le modle de
Lotka-Volterra.
Le fait quun modle proie-prdateur trs simple puisse prsenter des fluctuations priodiques
est un rsultat trs important du point de vue biologique. En effet, cela signifie que mme en
labsence de perturbations extrieures, des populations peuvent grandement fluctuer.
De la modlisation de la complexit du vivant
51

Quelques modifications intressantes peuvent tre apportes au modle de Lotka-Volterra
prsent ci-dessus rendant compte de la relation proie-prdateur entre deux espces. En effet, il
est possible de tenir compte, par exemple, de la densit de chacune des populations et de les
borner en intgrant dans les quations un terme dauto-limitation, soit dinteraction
intraspcifique, conduisant au systme suivant :



Les oscillations gnres par ce modle apparaissent amorties, aboutissant des densits
constantes lquilibre de la population de la proie et de celle du prdateur. De mme, lespace
de phase apparait diffrent, la trajectoire est alors une spirale qui senroule, dans le sens
trigonomtrique, autour dun certain point du plan dont les coordonnes sont gales aux densits
lquilibre de la proie et du prdateur (Fig. 18).

Figure 18 : Donnes gnres des populations de prdateurs et de proies selon le modle de Lotka-Volterra tenant
compte dune limitation densit-dpendante des deux espces. A gauche figurent les oscillations amorties telles que
donnes par le modle. A droite les mmes donnes reprsentes sous espace de phases.
Il est galement possible de supposer que la population de proies nait pas de mcanisme
dautolimitation mais quau contraire, sa reproduction sacclre quand sa densit augmente.
Une telle considration revient remplacer par + dans lquation diffrentielle dcrivant
lvolution de la population de proies (Fig. 19).

Figure 19 : Donnes gnres des populations de prdateurs et de proies selon le modle de Lotka-Volterra tenant
compte dune facilitation densit-dpendante des deux espces. A gauche figurent les oscillations amorties telles que
donnes par le modle. A droite les mmes donnes reprsentes sous espace de phases.
De la modlisation de la complexit du vivant
52

Les oscillations gnres par ce modle apparaissent amplifies. La trajectoire dans lespace
des phases est encore une spirale parcourue dans le sens trigonomtrique, mais qui se droule au
lieu de senrouler et :
- Ou bien tend asymptotiquement rencontrer un des axes de coordonnes. Lautre
coordonne devenant alors quasi-nulle, un des deux partenaires tend alors disparatre du
systme.
- Ou bien dcrit des spires de plus en plus serres atteignant, par lintrieur, un cycle limite
reproduisant la premire situation.
Ainsi, en dpit de sa grande simplicit, le modle de Lotka-Volterra permet de rendre compte
de comportements complexes entre deux espces entretenant une relation de proie-prdation. Ce
modle est devenu ce que lon peut appeler un grand classique et marque lentre de la
modlisation en Ecologie. Le modle de Lotka-Volterra peut tre considr comme le pre des
modles dinteractions du vivant. En effet, par quelques modifications supplmentaires, ce
modle peut tre utilis pour dcrire le comportement de plusieurs, espces en comptition pour
une mme ressource.
II.2.4. Le modle de Lotka-Volterra comme modle de comptition
II.2.4.1. La prsentation du modle
Dans le cas de deux espces en comptition pour la mme ressource, lvolution des deux
populations dpendra dun terme dinteraction ngatif. En effet, labondance dune des espces
limite la croissance de lautre en accaparant la ressource et inversement, la raret de lune
favorisant la deuxime. Un modle simple, bas sur le modle de Lotka-Volterra, traduisant ces
hypothses et tenant compte des interactions intraspcifiques est :


o les termes dautolimitation de chaque espce sont

et

et les termes de limitation mutuelle


sont

et

.
Comme prcdemment, les isoclines nulles donnes par dX/dt=0 et dY/dt=0 peuvent
tre dtermines, lvolution du systme dpendant de la position des deux droites rsultantes.
Plusieurs cas peuvent alors tre distingus dans lanalyse des directions de trajectoires :
- Les droites se croisent de telle sorte que

et

<


De la modlisation de la complexit du vivant
53

Lintersection des droites apparat alors comme un point de convergence des trajectoires. Le
systme volue vers un tat dquilibre stable comprenant une certaine proportion des deux
espces. Il y a donc coexistence des deux espces en comptition pour la mme ressource. Les
densits lquilibre des deux espces correspondent leurs coordonnes au point dintersection
des deux droites soit :

et

.
Nanmoins, cette coexistence est conditionne par la double ingalit :

et

<


car si lune des deux nest pas satisfaite alors on se retrouve dans le deuxime cas de figure.
Ainsi, ce modle nous apprend que deux espces en comptition pour une mme ressource ne
peuvent coexister que si, pour chacune delles, lautolimitation est plus forte que la limitation
croise ou en dautres termes que la comptition intraspcifique est plus forte que la comptition
interspcifique.
- Les droites se croisent de telle sorte que

et

>


Alors une des deux espces disparait car toutes les trajectoires divergent en sloignant de
lintersection des deux droites. Une telle intersection constitue une ligne de catastrophe car
en fonction de fluctuations pouvant tre minimes, le systme va voluer vers la disparition soit
de la premire espce soit de la deuxime.
- Les droites ne se croisent pas et alors lextinction, dtermine par les valeurs des
coefficients des quations dynamiques, dune des deux espces est inluctable.
Ces deux derniers cas fournissent une illustration du principe dexclusion comptitive.
II.2.4.2. Le principe dexclusion comptitive
Le principe dexclusion comptitive stipule que deux ou plusieurs espces prsentant des
modes dutilisation des ressources identiques ne peuvent coexister dans un environnement stable,
la plus apte liminant les autres (Harding 1960; Grover 1997). Le principe dexclusion
comptitive fait appel la notion de ressource limitante. Trois types de ressources limitantes
prpondrantes ont t voqus : lespace, les ressources trophiques et le temps (Schoener 1974).
Plus les espces en comptition sont similaires dans lutilisation partage de ces ressources
limitantes et plus leur coexistence est prcaire (May 1981). Les expriences de Gause avec des
paramcies ou celles de Park avec des coloptres ont dmontr la validit du principe
dexclusion comptitive mais dans des conditions environnementales trs simplifies (Gause
1934; Park 1948; Park 1954; Park 1957). Ce principe a galement t mis en vidence dans des
De la modlisation de la complexit du vivant
54

cosystmes naturels mais gnralement dans le cas particulier dintroduction despces
exotiques par lHomme. En effet, trs souvent des espces introduites se retrouvent en
comptition avec des espces endmiques (i.e. natives) et dans certains cas il arrive que lespce
invasive limine compltement les espces endmiques (Mooney and Cleland 2001).
Cependant, de nombreuses rserves ont t mises par rapport au principe dexclusion
comptitive. En effet, en 1961, Hutchinson observa un grand nombre despces de phytoplancton
coexistant dans un milieu prsentant un nombre restreint de ressources disponibles (Hutchinson
1961). Ces observations, allant lencontre des prdictions des modles, conduisirent
lexpression du paradoxe du plancton . Putman et Wratten voquent que le principe
dexclusion comptitive ne serait thoriquement possible que si lune des espces en comptition
ne change pas de comportement trophique (Putman and Wratten 1984). Ces auteurs utilisent le
mot thoriquement pour indiquer que les espces ont, en fait, des possibilits de raction et
peuvent sadapter la prsence dun comptiteur de diffrentes faons. En effet, mis part
certaines situations particulires, les tudes de terrain suggrent quil existe souvent des
mcanismes de relchement de la comptition (Loreau and Ebenhoh 1994; Schluter 1994;
Huisman and Weissing 1999). Dans ce dernier cas, les relations entre comptition et coexistence
apparaissent plus simples : lvitement, la rduction ou le relchement de la comptition
interspcifique peuvent favoriser la coexistence entre espces. Il existe diffrents cas
dinteractions coexistence-comptition : (i) il y a coexistence-comptitive lorsque la coexistence
est rendue possible par des facteurs extrinsques malgr une forte comptition, par exemple via
la prdation (ii) il y a coexistence non comptitive si la comptition est faible, par exemple
lorsque les ressources ne sont plus limitantes (iii) sil y a eu une forte comptition dans le pass,
la coexistence est possible via une sparation plus ou moins complte des niches cologiques au
cours dun processus de covolution. Ce troisime cas, qui fait appel au concept majeur de la
niche cologique, pourrait jouer un rle fondamental dans les conditions naturelles (Tokeshi
1999).
II.2.4.3. Le concept de niche cologique
Le concept de niche cologique dfinit le rle et la place dun organisme dans le
fonctionnement dun cosystme. Hutchinson la dfinit comme lensemble des conditions dans
lesquelles vit et se maintient une population (Hutchinson 1957). Il sagit donc dun hyper-
volume n dimensions correspondant la niche potentielle ou optimale dune espce. La
niche relle serait quant elle plus restreinte par suite des interactions biotiques et abiotiques
entre la population considre et les autres populations locales. Nanmoins, pour des besoins
analytiques, les auteurs divisent gnralement le terme de niche en autant de dimensions
De la modlisation de la complexit du vivant
55

correspondant aux activits essentielles de la vie des organismes : niche alimentaire, niche
spatiale, niche comportementale (Leibold 1995). Cette approche analytique permet daccder
aux phnomnes de divergence partielle ou totale de niche qui aboutissent la rduction de la
comptition (Hutchinson, 1957). Malgr son caractre intuitif, la mise en vidence du partage
des ressources comme base de la coexistence despces nest pas si aise dmontrer. En effet,
la sparation des niches cologiques saccompagne dadaptations diffrentielles entre les
espces, par exemple pour acqurir une nourriture spcifique (Grant 1999). Comme la plupart
des mcanismes se droulant sur de grandes chelles de temps, il est souvent impossible de
diffrencier les causes des consquences. Les adaptations spcifiques sont-elles lorigine du
partage des ressources ou une consquence ?
Ainsi, la modlisation savre un outil particulirement intressant pour la comprhension des
interactions du vivant et en dgager des principes ou concepts. Nanmoins, si le modle de
Lotka-Volterra a t trs souvent utilis comme modle de base pour ltude des relations
trophiques et de la comptition entre deux ou plusieurs espces, bien peu dtudes se sont
intresses aux autres types dinteractions et notamment linfluence des interactions dites
positives telles que la facilitation et le mutualisme sur le fonctionnement des cosystmes.



56







Du fonctionnement des cosystmes
57

III. III. III. III. DU DU DU DU FONCTIONNEMENT DES FONCTIONNEMENT DES FONCTIONNEMENT DES FONCTIONNEMENT DES COSYSTMES COSYSTMES COSYSTMES COSYSTMES
Nous nhritons pas la terre de nos anctres,
Nous lempruntons nos enfants
Antoine de Saint Exupery.
Lanalyse des liens entre la complexit du vivant et le fonctionnement des cosystmes est
une des grandes problmatiques de lEcologie (Loreau, Naeem et al. 2001). De plus,
lacquisition de connaissances solides sur les liens entre la structuration et le maintien des
communauts assembles et les fonctions exprimes par les cosystmes devient cruciale dans le
contexte actuel de perte de diversit biologique. En effet, les pertes despces lies directement
ou indirectement aux activits humaines se produisent un rythme 100 1 000 fois suprieur
aux extinctions naturelles et il devient indispensable de connatre limpact de ces pertes sur les
fonctions des cosystmes (Naeem, Thompson et al. 1994). Lintgrit fonctionnelle des
cosystmes est en effet primordiale : de trs nombreux services sont rendus aux socits
humaines via le bon fonctionnement des cosystmes comme par exemple lpuration des eaux
ou encore le maintien de la fertilit des sols (Costanza, dArge et al. 1997).
Nanmoins, si la question de lvaluation de la biodiversit reste complexe (richesse
spcifique, abondance des individus de chaque espce, connectance, type dinteractions), la
question du fonctionnement ne lest pas moins dans la mesure o les attributs pouvant servir
lvaluation fonctionnelle peuvent concerner le nombre de fonctions exprimes, la productivit
ou encore la stabilit des cosystmes.
III.1. La complexit du vivant et les fonctions des cosystmes
III.1.1. La notion de fonctions des cosystmes
Les fonctions exprimes par un cosystme sont traditionnellement dfinies comme les
diffrentes tapes des processus lis aux flux de matire et dnergie qui traversent lcosystme
considr. En effet, les systmes biologiques obissent au principe thermodynamique de
conservation de lnergie : lnergie qui les traverse peut tre convertie sous une forme ou sous
une autre mais cette nergie nest jamais cre ni dtruite ou pour paraphraser Lavoisier : rien
ne se perd, rien ne se cre, tout se transforme . Les grands cycles biogochimiques tels que le
cycle de lazote sont des illustrations de ces cycles de la matire et de lnergie (Fig. 20).

Figure 20 : Schma du cycle de lazote (source
Dans un tel cycle, lazote atmosphrique est transfor
azote molculaire (N
2
) ; ions nitrites (NO
dazote (N
2
O) auxquels sajoutent de petites molcules organiques parfois directement
assimilables par les vgtaux ou les micr
Chacun de ces processus de transformation que sont
lammonification, la nitrification, la dnitrification peut tre considr comme une fonction de
lcosystme. Lexpression de ces fonctions dpendra des conditions abiotiques telles que la
temprature, le pH ainsi que des conditions biotiques telles que la richesse spcifique ou la
structuration des communauts qui considre le nombre de rseaux trophiques, la conne
la communaut, la force et le type dinteraction
III.1.2. Ltude de la productivit des cosystmes
La plupart des tudes qui se sont intresses la relation entre diversit et fonctions des
cosystmes ont port sur la quanti
celle de chaque niveau trophique et sur la production des diffrents niveaux trophiques dfinie
comme le flux entrant dans ce niveau trophique et dpendant donc de la biomasse du niveau
trophique considr et de la masse de ressources consomme
sont intresses linfluence de la structuration de la communaut assemble sur la productivit
des cosystmes. Ces tudes ont t ralises tant par des approches exp
approches thoriques faisant intervenir la modlisation mathmatique.
III.1.2.1. Lapproche exprimentale
La grande majorit des travaux exprimentaux portant sur la relation entre la biodiversit et la
productivit des cosystmes a t ralise sur des communauts vgtales. Ces travaux ont
gnralement consist en ltude comparative dassemblages de communauts prsentant une
richesse spcifique diffrente. Parmi ceux
al. conduits dans plusieurs pays europens
Du fonctionnement des cosystmes

Schma du cycle de lazote (source : wilkipedia).
Dans un tel cycle, lazote atmosphrique est transform en diffrentes
; ions nitrites (NO
2
-
) ; nitrate (NO
3
-
), ammonium (NH
O) auxquels sajoutent de petites molcules organiques parfois directement
assimilables par les vgtaux ou les microorganismes (acides amins, ure, acide urique).
Chacun de ces processus de transformation que sont : la fixation de lazote atmosphrique,
lammonification, la nitrification, la dnitrification peut tre considr comme une fonction de
xpression de ces fonctions dpendra des conditions abiotiques telles que la
temprature, le pH ainsi que des conditions biotiques telles que la richesse spcifique ou la
structuration des communauts qui considre le nombre de rseaux trophiques, la conne
la communaut, la force et le type dinteraction (Giller, Berninger et al. 2004)
III.1.2. Ltude de la productivit des cosystmes
La plupart des tudes qui se sont intresses la relation entre diversit et fonctions des
cosystmes ont port sur la quantit de biomasse du systme, que se soit la biomasse totale ou
celle de chaque niveau trophique et sur la production des diffrents niveaux trophiques dfinie
comme le flux entrant dans ce niveau trophique et dpendant donc de la biomasse du niveau
considr et de la masse de ressources consommes. Plus rarement, quelques tudes se
sont intresses linfluence de la structuration de la communaut assemble sur la productivit
des cosystmes. Ces tudes ont t ralises tant par des approches exprimentales que par des
approches thoriques faisant intervenir la modlisation mathmatique.
III.1.2.1. Lapproche exprimentale
La grande majorit des travaux exprimentaux portant sur la relation entre la biodiversit et la
es a t ralise sur des communauts vgtales. Ces travaux ont
gnralement consist en ltude comparative dassemblages de communauts prsentant une
richesse spcifique diffrente. Parmi ceux-ci peuvent tre cits les importants travaux dHector et
. conduits dans plusieurs pays europens : Royaume Unis, Allemagne, Irlande, Grce, Portugal,
Du fonctionnement des cosystmes
58
m en diffrentes formes minrales :
), ammonium (NH
4
+
) ; protoxyde
O) auxquels sajoutent de petites molcules organiques parfois directement
oorganismes (acides amins, ure, acide urique).
la fixation de lazote atmosphrique,
lammonification, la nitrification, la dnitrification peut tre considr comme une fonction de
xpression de ces fonctions dpendra des conditions abiotiques telles que la
temprature, le pH ainsi que des conditions biotiques telles que la richesse spcifique ou la
structuration des communauts qui considre le nombre de rseaux trophiques, la connectance de
(Giller, Berninger et al. 2004).
La plupart des tudes qui se sont intresses la relation entre diversit et fonctions des
t de biomasse du systme, que se soit la biomasse totale ou
celle de chaque niveau trophique et sur la production des diffrents niveaux trophiques dfinie
comme le flux entrant dans ce niveau trophique et dpendant donc de la biomasse du niveau
. Plus rarement, quelques tudes se
sont intresses linfluence de la structuration de la communaut assemble sur la productivit
rimentales que par des
La grande majorit des travaux exprimentaux portant sur la relation entre la biodiversit et la
es a t ralise sur des communauts vgtales. Ces travaux ont
gnralement consist en ltude comparative dassemblages de communauts prsentant une
les importants travaux dHector et
: Royaume Unis, Allemagne, Irlande, Grce, Portugal,

Sude et Suisse (Hector, Schmid et al. 1999)
productivit, en termes de biomasse produite, est corrle positivement avec la diversit de
lcosystme tudi, la diversit tant reprsente ici par la richesse en espces, et ce
indpendamment des conditions environnementales e
Figure 21 : Corrlation entre la baisse de productivit en biomasse et la perte de diversit, en terme
spcifique, telle que dmontre par les travaux dHector et al. (1999) dans diffrents pays dEurope
Irlande, Royaume Unis, Suisse, Portugal, Sude et Grce
Plusieurs autres tudes ont obtenu des rsultats similaires
qui a tudi limpact de la perte de diversit sur la productivit en terme
sur la capture et le lessivage des nutriments a
spcifique conduit une plus grande productivit et une meilleure utilisation de lazote du sol
qui constitue la ressource limitante de
arrivera des conclusions identiques en propos
pendant plusieurs annes (Tilman, Reich et al. 2001)
Quelques tudes se sont galement intresses aux rseaux dinteractions plantes
pollinisateurs (Kremen, Williams et al. 2004;
Fontaine et al., consistant tester diffrents assemblages dinsectes pollinisateurs vis
productivit en fruits et en graines des plantes pollinises, ont mis en vidence que la
productivit des plantes est fortement affecte par une perte de diversit, toujours au sens de
richesse spcifique, des pollinisateurs
Le rle de la diversit dans la productivit a galement t montr exprimentalement dans
des rseaux mutualistes. Ainsi, Van der Heijden et al. ont montr que la diversit des
champignons mycorhiziens augmente la diversit des plantes ainsi que leur productivit
Heijden, Klironomos et al. 1998)
Quelques tudes ont galement t ralises sur des systmes aquatiques tels les trav
Cardinale (Cardinale 2002) sur des larves de phrygane (petits
des Trichoptres. Ces larves
communment comme appt). Testant diffrents assemblages despces, cet auteur
que dans le milieu o la diversit est la plus forte, la consommation des particules en suspension
Du fonctionnement des cosystmes
(Hector, Schmid et al. 1999). Ces auteurs ont mis en vidence que la
productivit, en termes de biomasse produite, est corrle positivement avec la diversit de
lcosystme tudi, la diversit tant reprsente ici par la richesse en espces, et ce
indpendamment des conditions environnementales et climatiques (Fig. 21).
Corrlation entre la baisse de productivit en biomasse et la perte de diversit, en terme
spcifique, telle que dmontre par les travaux dHector et al. (1999) dans diffrents pays dEurope
Irlande, Royaume Unis, Suisse, Portugal, Sude et Grce.
Plusieurs autres tudes ont obtenu des rsultats similaires (Spehn, Hector et al. 2005)
qui a tudi limpact de la perte de diversit sur la productivit en termes de biomasse ainsi que
le lessivage des nutriments a mis en vidence quune plus grande richesse
spcifique conduit une plus grande productivit et une meilleure utilisation de lazote du sol
qui constitue la ressource limitante de son exprimentation (Tilman 1996)
arrivera des conclusions identiques en proposant une exprimentation similaire mais effectue
(Tilman, Reich et al. 2001).
Quelques tudes se sont galement intresses aux rseaux dinteractions plantes
(Kremen, Williams et al. 2004; Memmott, Waser et al. 2004)
Fontaine et al., consistant tester diffrents assemblages dinsectes pollinisateurs vis
productivit en fruits et en graines des plantes pollinises, ont mis en vidence que la
ntes est fortement affecte par une perte de diversit, toujours au sens de
richesse spcifique, des pollinisateurs (Fontaine, Dajoz et al. 2006).
Le rle de la diversit dans la productivit a galement t montr exprimentalement dans
s rseaux mutualistes. Ainsi, Van der Heijden et al. ont montr que la diversit des
champignons mycorhiziens augmente la diversit des plantes ainsi que leur productivit
Heijden, Klironomos et al. 1998).
Quelques tudes ont galement t ralises sur des systmes aquatiques tels les trav
sur des larves de phrygane (petits insectes, 20 30 mm, de l'ordre
larves sont bien connues des pcheurs de truite qui les lutilisent
communment comme appt). Testant diffrents assemblages despces, cet auteur
la diversit est la plus forte, la consommation des particules en suspension
Du fonctionnement des cosystmes
59
mis en vidence que la
productivit, en termes de biomasse produite, est corrle positivement avec la diversit de
lcosystme tudi, la diversit tant reprsente ici par la richesse en espces, et ce
t climatiques (Fig. 21).

Corrlation entre la baisse de productivit en biomasse et la perte de diversit, en termes de richesse
spcifique, telle que dmontre par les travaux dHector et al. (1999) dans diffrents pays dEurope : Allemagne,
(Spehn, Hector et al. 2005). Tilman
s de biomasse ainsi que
mis en vidence quune plus grande richesse
spcifique conduit une plus grande productivit et une meilleure utilisation de lazote du sol
(Tilman 1996). Le mme auteur
ant une exprimentation similaire mais effectue
Quelques tudes se sont galement intresses aux rseaux dinteractions plantes-
Memmott, Waser et al. 2004). Les travaux de
Fontaine et al., consistant tester diffrents assemblages dinsectes pollinisateurs vis--vis de la
productivit en fruits et en graines des plantes pollinises, ont mis en vidence que la
ntes est fortement affecte par une perte de diversit, toujours au sens de
Le rle de la diversit dans la productivit a galement t montr exprimentalement dans
s rseaux mutualistes. Ainsi, Van der Heijden et al. ont montr que la diversit des
champignons mycorhiziens augmente la diversit des plantes ainsi que leur productivit (van der
Quelques tudes ont galement t ralises sur des systmes aquatiques tels les travaux de
, 20 30 mm, de l'ordre
s des pcheurs de truite qui les lutilisent
communment comme appt). Testant diffrents assemblages despces, cet auteur a constat
la diversit est la plus forte, la consommation des particules en suspension
Du fonctionnement des cosystmes
60

lest aussi et dpasse la consommation totale attendue correspondant la somme de la
consommation de chaque espce prise sparment (Fig. 22).

Figure 22 : Corrlation entre la diversit des espces assembles et la capacit totale de consommation dune
ressource, telle que dmontre par les travaux de Cardinale (2002).
Lauteur attribue la corrlation positive entre la diversit et la consommation de la ressource
par leffet de complmentarit entre les espces et particulirement une facilitation
interspcifique de la capture des ressources. Cardinale a galement dmontr que laugmentation
de la diversit entrane des changements dans lenvironnement (modification des flux deau) qui
favorisent le fonctionnement de la communaut.
Si les tudes exprimentales vont gnralement toutes dans le mme sens en dmontrant une
corrlation positive entre la diversit biologique et la productivit cosystmique, il est noter
que les rares tudes stant intresses des rseaux trophiques, gnralement simples, montrent
que cette corrlation nest pas toujours positive et quelle est complexifie par les interactions
trophiques (Paine 2002; Duffy, Richardson et al. 2003; France and Duffy 2006).
Par ailleurs, des tudes se sont galement intresses au lien entre interactions non-trophiques
et productivit, en particulier linfluence des interactions positives telles que le mutualisme ou
la facilitation. Ainsi, les expriences de Rixen et Mulder sur des communauts arctiques de
mousses montrent que la diversit augmente la rtention deau, via une augmentation de la
facilitation, conduisant en une augmentation de la productivit (Rixen and Mulder 2005). De
mme, les travaux de Bertness et al. sur des communauts intertidales rocheuses montrent que le
couvert vgtal form par les algues diminue le stress physique, comme la temprature ou
lvaporation, engendrant un effet positif sur le recrutement dindividus, la croissance et la survie
mais galement un effet ngatif notamment en augmentant la pression exerce par les
consommateurs (Bertness, Leonard et al. 1999).
Plusieurs critiques peuvent tre mises sur les tudes par approche exprimentale. En premier
lieu, ces tudes ont t ralises sur peu dcosystmes diffrents en se consacrant surtout des
communauts vgtales. Ensuite, la diversit ny est bien souvent tudie qu travers la richesse
spcifique qui ne constitue quune dimension particulire de la complexit du vivant et les
interactions, qui constituent une part importante de la biodiversit, ne sont que trop rarement
Du fonctionnement des cosystmes
61

considres. Enfin, une augmentation de la richesse spcifique ne conduit un effet sur les
fonctions cosystmiques exprimes que si la diversit fonctionnelle est elle-mme affecte. En
dautres termes, en augmentant le nombre despces dans un assemblage exprimental, la
probabilit dintgrer des espces fonctionnellement diffrentes et donc de recruter : (i) une
espce trs efficiente pour la fonction considre (ii) un ensemble despces prsentant des traits
de vie diffrents dont lassociation augmente le rendement de la fonction considre (Loreau,
Naeem et al. 2001).
Une approche thorique du lien diversit-productivit des cosystmes, en lien avec
lapproche exprimentale, pourrait permettre de pallier ces biais exprimentaux.
III.1.2.2. Lapproche thorique
La majorit des tudes thoriques qui se sont intresses au lien entre diversit et productivit
des cosystmes a t ralise sur des modles de communauts vgtales bass sur des
extensions du modle de Lotka-Volterra. Ainsi, Loreau a labor un modle considrant un pool
de nutriments inorganiques dans un sol et une communaut de plantes dont la richesse spcifique
peut varier (Loreau 1998). Avec un tel modle, cet auteur arrive la conclusion quune
augmentation de la richesse spcifique en plantes naugmente pas ncessairement la productivit
du systme (correspondant ici la quantit de nutriments utilise par rapport la quantit
prsente). De plus, il apparat que des variations dans les facteurs abiotiques contrlant, en
partie, le flux de nutriments peut interfrer sur la comprhension de la relation diversit-
productivit. En effet, de tels facteurs masquent systmatiquement leffet de la diversit. Les
travaux de Tilman et al., galement effectus sur des modles de communauts vgtales, ont
compar les rsultats de trois modles diffrents relativement simples. Le premier modle
considre des espces vgtales en comptition pour une unique ressource. Le second considre
la mme communaut mais avec deux ressources limitantes diffrentes. Enfin, le troisime
reprsente un modle gnral de niche cologique dans lequel deux facteurs, le pH et la
temprature, limitent labondance des espces. Pour lensemble de ces trois modles, les auteurs
ont mis en vidence que la productivit primaire est positivement corrle avec la richesse
spcifique de la communaut assemble (Tilman, Lehman et al. 1997).
Dautres modles ont t labors pour tenir compte de plusieurs niveaux trophiques et non
plus un seul comme les modles de communauts vgtales. Ainsi, Thbault et Loreau ont
prsent un modle comprenant : un pool de nutriments, une communaut de plantes, une
communaut dherbivores et une communaut de carnivores (Thebault and Loreau 2003). Leur
tude met en vidence limportance de la structure du rseau trophique sur le lien diversit-
productivit. En effet, il apparat quun des facteurs influant fortement cette relation est le
Du fonctionnement des cosystmes
62

nombre dherbivores gnralistes par rapport au nombre dherbivores spcialistes correspondant
la connectance du systme (cf. chapitre I.1.4). Ces auteurs ont montr que lorsque les
herbivores sont gnralistes alors la productivit naugmente pas linairement avec la diversit et
peut mme dcrotre pour de fortes valeurs en richesse spcifique. En effet, une augmentation du
nombre dherbivores gnralistes conduit une augmentation de la consommation dun grand
nombre de plantes et donc une diminution de la production primaire. La comptition entre
herbivores qui sensuit pour la consommation des plantes restantes conduit galement une
diminution du nombre total dherbivores et donc une diminution du nombre de carnivores.
Ainsi la diversit naugmente la productivit que si chaque plante est consomme par un
herbivore diffrent cest--dire que si la connectivit du systme nest pas trop importante. Ces
auteurs se consacreront dailleurs un peu plus au lien entre connectance et productivit avec un
modle dassemblage de rseaux trophiques comparable mais incluant le recyclage de la matire
(Thbault and Loreau 2006).
Par ailleurs, si une espce de plante est dfinie comme non-comestible, donc non-accessible
pour les herbivores, quils soient gnralistes ou spcialistes, alors le lien diversit-productivit
apparat beaucoup plus complexe. Thbault et Loreau expliquent cette diffrence de
comportement par la combinaison dun rtrocontrle des herbivores sur les plantes comestibles
et dun rtrocontrle des plantes non-comestibles sur la concentration en nutriments prsents
dans le sol. De tels rtrocontrles ont une grande importance dans le fonctionnement des
cosystmes. En effet, il a t montr que dans un rseau trois niveaux trophiques, le contrle
exerc par un carnivore sur les herbivores favorise la croissance des producteurs primaires et
favorise donc la productivit primaire (Hairston, Smith et al. 1960). Cest le phnomne des
cascades trophiques pouvant aller de haut en bas (contrle dit top-down ) quand il sagit dun
contrle des herbivores par les carnivores (ou plus gnralement du contrle dun niveau
trophique donn par le niveau trophique suprieur), ou de bas en haut (contrle dit bottom-
up ) quand il sagit dun contrle des producteurs primaires et des carnivores par la ressource
(ou plus gnralement du contrle dun niveau trophique donn par le niveau trophique
infrieur). De telles cascades trophiques sont actives dans de nombreux cosystmes quils soient
terrestres ou aquatiques (Pace, Cole et al. 1999). Si Thbault et Loreau ont mis en vidence que
la force de ces rtrocontrles est influence par un taux de consommation diffrent selon la
comestibilit des proies, dautres tudes ont soulign limportance des espces ayant un rgime
omnivore sur ces cascades trophiques ainsi que limportance du cannibalisme (Kuijper, Kooi et
al. 2003; Bruno and O'Connor 2005; Rudolph 2007; Stachowicz, Bruno et al. 2007).
Du fonctionnement des cosystmes
63

Il est noter que trs peu dtudes thoriques ont t consacres au rle des interactions non-
trophiques sur la productivit des cosystmes (Ringel, Hu et al. 1996; Holland, DeAngelis et al.
2002).
III.1.2.3. Une synthse des tudes exprimentales et thoriques
La plupart des tudes, quelles soient exprimentales ou thoriques, qui se sont intresses au
lien entre la biodiversit et la productivit des cosystmes ont rvl une corrlation positive.
Cet effet positif de la complexit du vivant est expliqu par trois hypothses principales :
- Leffet dchantillonnage qui repose sur lhypothse selon laquelle quelques espces, ayant
des traits particuliers, ont un effet majeur sur la productivit cosystmique. Leffet de slection
explique limpact positif dune plus grande diversit sur la productivit par une plus grande
probabilit que de telles espces soient prsentes dans lcosystme considr. Cet effet de
slection a t montr exprimentalement sur des communauts vgtales (Aarssen 1997; Loreau
and Hector 2001) ainsi que par des modles de producteurs primaires (Tilman, Lehman et al.
1997; Loreau 1998). Pour que leffet de slection soit positif sur la relation entre diversit et
production dans les systmes de comptition indirecte pour les ressources, il est nanmoins
ncessaire que les espces les plus productives soient aussi les plus comptitives (Troumbis,
Dimitrakopoulos et al. 2000) car les espces ayant la plus forte productivit en monoculture ne
sont pas ncessairement celles qui dominent en polyculture ou cultures mixes.
- Leffet de complmentarit qui inclut la diffrenciation de niche et la facilitation. Plus le
recouvrement des niches est important, plus le nombre despces qui sont redondantes lest aussi
(Walker 1992). Si les espces utilisent des ressources diffrentes, ou identiques mais dans des
lieux et/ou moments diffrents, les espces sont dites complmentaires par diffrenciation des
niches cologiques. Lorsque les espces sont redondantes, la perte dune espce peut tre
compense par les autres espces de la communaut et la productivit ne dpend alors pas de la
diversit. Lorsque les espces sont complmentaires, une plus grande diversit peut tre
lorigine dune plus grande productivit (Tilman, Lehman et al. 1997; Loreau 1998). La
facilitation est un effet biotique courant dans les cosystmes et peut influencer fortement les
processus fonctionnels comme la productivit (Mulder, Uliassi et al. 2001) en modifiant les
paramtres abiotiques de lcosystme (temprature, pH) ou en apportant une ressource utile
aux autres espces. Ainsi, la facilitation peut tre un des mcanismes expliquant leffet positif de
la diversit spcifique sur les processus fonctionnels, reposant alors sur lhypothse que les
interactions positives sont majoritaires, ou ont une influence majoritaire, dans lcosystme.
- Lhypothse idiosyncratique, selon laquelle limpact de la perte dune espce dpend de la
composition de la communaut et de lenvironnement. La nature de la relation entre diversit et
Du fonctionnement des cosystmes
64

productivit est alors difficilement prvisible car spcifique chaque cosystme. Cette
hypothse est notamment avance quand la diversit spcifique est faible, chaque espce ayant
alors un effet important sur les processus fonctionnels (Hooper et al., 2005).
Ces diffrentes hypothses expliquant la relation entre la complexit du vivant et la
productivit des cosystmes ont fait lobjet dun dbat anim en particulier sur limpact relatif
de la diversit par rapport la contribution des facteurs abiotiques (Hutson 1997; Wardle 2001).
Ces diffrents mcanismes ne sont pas exclusifs les uns vis--vis des autres et il apparat
ncessaire de dterminer leur contribution relative (Loreau and Hector 2001). De mme,
linfluence des interactions non-trophiques sur la productivit mriterait galement dtre plus
tudie afin daborder la complexit du vivant dans lensemble de ses dimensions et non pas
uniquement travers la richesse spcifique et les relations trophiques.
III.2. La complexit du vivant et la stabilit des cosystmes
III.2.1. La notion de stabilit des cosystmes
La notion de stabilit en cologie renvoie deux notions clefs : la rsilience et la rsistance.
Le terme de rsilience vient du latin Resilio qui signifie rebondir . La rsilience fut
dabord un concept de physique qui mesure la rsistance dun solide vis--vis dun choc
(Mathieu 1991). Ainsi, la rsilience est lampleur maximale du choc quun systme peut recevoir
avant de rompre. Ce concept fut ensuite utilis dans diffrentes disciplines et notamment en
psychologie et en cologie. Un cosystme rsilient est un cosystme qui revient son tat
antrieur aprs une perturbation cest--dire qui persiste sans changement qualitatif de sa
structure (Holling 1973). Le concept de rsilience garde donc son sens physique originel mais
senrichit par lampleur de la perturbation, le seuil ne pas franchir qui menacerait la survie de
lcosystme.
Par ailleurs, pour retourner son tat dquilibre, le systme met un certain temps. La
rsilience est donc galement assimilable au temps de retour lquilibre, autrement dit la
vitesse quil met pour revenir son tat initial. La rsilience se distingue ainsi de la rsistance
qui concourt galement la stabilit dun systme. En effet, la rsistance caractrise la capacit
dun systme absorber un choc et donc rester inchang sous leffet dune perturbation
extrieure.
III.2.2. Ltude de la stabilit des cosystmes
III.2.2.1. Lapproche exprimentale
Un des premiers principes dEcologie a t de considrer quun cosystme est dautant plus
stable dans le temps que la biodiversit qui le compose et les interactions qui sy nouent sont
Du fonctionnement des cosystmes
65

grandes, soit : que la complexit est source de stabilit. En effet, selon la proposition de Mac
Arthur (1955) la connectance stabiliserait le rseau trophique (Mac Arthur 1955).
Cependant, tudier leffet de la complexit du vivant sur les capacits de rsistance et/ou de
rsilience des cosystmes par une approche exprimentale nest pas chose si aise que cela ny
parat. En effet, cela ncessite des conditions parfaitement contrles afin dviter que les
rsultats exprimentaux ne soient le fait dautres facteurs, en particulier des facteurs abiotiques,
que la biodiversit. Cela ncessit galement des tudes plus ou moins longues dans le temps
suivant lcosystme considr. Un champ exprimental qui na pas dgal vis--vis de ce
dernier point est le Park Grass Experiment bas Rothamsted en Angleterre qui est en
fonctionnement depuis 1856. Des gnrations de chercheurs sy sont succd, tudiant
notamment linfluence de la richesse spcifique sur la production annuelle de foin pour
diffrentes communauts vgtales. En ralisant une mta-analyse des donnes comprises entre
1862 et 1991, Dodd et al. ont mis en vidence que les communauts contenant un grand nombre
despces diffrentes prsentent des variations de production annuelle de foin moins importantes
laissant ainsi supposer que la diversit est source de stabilit (Dodd, Silvertown et al. 1994). De
nombreuses autres tudes portant sur les communauts vgtales arrivent la conclusion que la
stabilit temporelle de proprits cosystmiques varies augmente avec la richesse spcifique
(Tilman and Downing 1994; Tilman 1996; Mac Grady-Steed, Harris et al. 1997; Pfisterer, Joshi
et al. 2005). Il est noter que parmi celles-ci, quelques tudes ont relev que si une augmentation
du nombre despces engendrait une augmentation de la stabilit de la communaut, en termes
de biomasse totale, une telle augmentation engendrait galement une baisse de la stabilit
populationnelle, soit de plus grandes fluctuations dans les effectifs respectifs de chaque espce
(Tilman and Downing 1994; Tilman 1996). Nanmoins, une critique peut tre faite ces travaux.
La richesse spcifique ntait pas directement contrle par les exprimentateurs mais variait en
rponse des additions dazote dans le sol. Aussi, il est possible de penser que dautres facteurs
que le nombre despces interviennent dans les rsultats que ces auteurs ont obtenus. Ces
rsultats seront pourtant confirms par les travaux de Calderia et al. effectus durant trois ans sur
des prairies mditerranennes en contrlant directement la richesse spcifique. En effet, ces
auteurs relvent que les effectifs populationnels sont dstabiliss par laugmentation du nombre
despces. Leur interprtation de ces rsultats est que la stabilit de la communaut serait le fait
de lasynchronie des espces, rsultant de diffrences biologiques, en rponse la modification
de lenvironnement introduite par laugmentation du nombre despces (Caldeira, Hector et al.
2005).
Dautres tudes portant sur les communauts vgtales se sont plus particulirement
focalises sur la stabilit des cosystmes en rponse des changements dans les conditions
Du fonctionnement des cosystmes
66

environnementales correspondant aux scenarii du rchauffement climatique (Macgillivray,
Grime et al. 1995; Grime, Brown et al. 2000; Kahmen, Perner et al. 2005). Ainsi, Grime et al. se
sont intresss des prairies calcaires, qui constituent les communauts vgtales prsentant la
plus forte richesse spcifique en Europe (Hillier, Walton et al. 1990), quils ont soumises
artificiellement diffrents climats durant cinq annes. Ces auteurs ont mis en vidence que les
communauts les moins diverses sont les plus sensibles des modifications climatiques et
notamment la scheresse. Les rsultats des travaux de Kahmen et al. sont concordants, ces
auteurs ayant galement not une relation favorable entre diversit et rsistance aux changements
climatiques. Diffrentes tudes dmontrent que plus le systme est simple plus il est sensible aux
perturbations de lcosystme.
Quelques tudes ont galement portes sur linfluence des interactions biotiques sur la
stabilit des cosystmes. Des analyses de rseaux trophiques rels ont mis en vidence que la
plupart des cosystmes naturels sont caractriss par une majorit dinteractions de faible
intensit et un petit nombre dinteractions de forte intensit (Paine 1992; Wootton 1994;
Deruiter, Neutel et al. 1995; McCann, Hastings et al. 1998). De plus, il apparat que les
interactions de forte intensit sont plus particulirement concentres dans le premier niveau
trophique (Deruiter, Neutel et al. 1995). Une mta-analyse des tudes portant sur des rseaux
trophiques naturels renseignant la taille de la communaut et lintensit des interactions liant les
espces a t ralise (Neutel, Heesterbeek et al. 2002). Celle-ci a montr quune grande
proportion dinteractions faibles peut stabiliser la communaut en tamponnant les oscillations
des populations de consommateurs et de ressources diminuant ainsi la probabilit dextinctions.
Des travaux ont galement t conduits sur des rseaux mutualistes. Ainsi, les expriences,
dj cites sur le lien diversit-productivit des cosystmes, ralises par Fontaine et al. (2006)
ont montr que la diversit des pollinisateurs augmente la persistance des communauts de
plantes. Dans ce cas, leffet positif de la diversit sur la stabilit pourrait sexpliquer par une
complmentarit des groupes fonctionnels de pollinisateurs notamment du fait des diffrences de
morphologie de leurs pices buccales conduisant une spcialisation (Fontaine, Dajoz et al.
2006).
Enfin, quelques tudes se sont intresses un autre niveau de diversit du vivant que la
richesse spcifique sur la stabilit des cosystmes (Madritch and Hunter 2003; Whitham, Young
et al. 2003; Hughes and Stachowicz 2004). Ainsi, Hughes et Stachowicz ont cherch mettre en
vidence linfluence de la diversit gntique sur la rsilience de communauts dalgues marines
(des zostres, plantes de mer avec de longues feuilles fines en ruban, d'une taille de 20 50 cm
voire exceptionnellement de 2 mtres et constituant de vritables prairies sous-marines refuges
Du fonctionnement des cosystmes
67

de nombreuses espces animales) en rponse une attaque de prdateur, en loccurrence des oies
sauvages venues les brouter. Ces auteurs ont montr que, comme la richesse spcifique, une plus
grande diversit gntique dans la communaut assemble confre une plus grande rsilience et
donc stabilit temporelle.
Ainsi, nombreux sont les travaux qui tablissent une corrlation positive entre diversit et
stabilit des cosystmes. Ces rsultats ont conduit lmission de lhypothse d assurance
(Yachi and Loreau 1999). Cette hypothse se base sur le concept que diffrentes espces
ragissent diffremment aux changements environnementaux. Aussi, lors dune perte de
diversit, la probabilit de perdre des espces avec des rponses diffrentes aux changements
climatiques augmente et par consquent la capacit de la communaut rsister ou rsilier sen
trouve diminue. Les cosystmes aux diversits les plus faibles ont donc moins de chance
davoir des espces pouvant faire face aux changements environnementaux et/ou compensant la
diminution des espces moins adaptes ce qui augmente le risque de dstabilisation du
fonctionnement de lcosystme.
III.2.2.2. Lapproche thorique
Si la corrlation positive entre complexit et stabilit est confirme par de trs nombreuses
tudes exprimentales, ce principe cologique fut remis en question par la modlisation
mathmatique et notamment partir des travaux des physiciens Gardner et Ashby (Gardner and
Ashby 1970). Ces auteurs ont formul un modle dynamique relativement simple dfini par :


o
ij
est une matrice dcrivant linfluence de lespce j sur le taux de croissance de
lespce i . Si
ij
=0 alors lespce j na pas dinfluence particulire sur lespce i . Dans
leur tude, Garner et Ashby ont dfini la connectance comme le nombre dlments de la matrice

ij
non nuls en dehors de la diagonale. Les valeurs des lments diagonaux, correspondant
linfluence des individus dune espce sur eux-mmes, sont tires alatoirement dans une
distribution uniforme borne de -1 -0,1 considrant quil ne pouvait y avoir quune influence
ngative de la densit de population dune espce. Les lments extra-diagonaux sont, eux,
distribus de manire rgulire entre -1 et 1. Gardner et Ashby ont alors cherch tester la
stabilit asymptotique de leur modle, un systme tant considr comme asymptotiquement
stable si et seulement si toutes les variables retournent leur valeur dquilibre aprs une
perturbation. Par des simulations, ces auteurs ont trouv que la probabilit que le systme soit
asymptotiquement stable diminue quand la complexit du maillage dinteractions liant les
espces entre elles augmente. Leur conclusion fut donc que la complexit est source dinstabilit.
Du fonctionnement des cosystmes
68

Nanmoins, plusieurs critiques importantes peuvent tre faites au modle dvelopp par
Gardner et Ashby. Dabord, les communauts complexes contiennent plusieurs centaines
despces avec de trs nombreuses interactions et donc peuvent difficilement tre assimiles un
systme si simple. Ensuite, le caractre alatoire des connections du modle de Gardner et Ashby
parat peu pertinent biologiquement et leurs rsultats signifient simplement que la stabilit ne
peut tre maintenue par une diversit relie stochastiquement (Fig. 23.1)
Lawlor (1978), conscient de la divergence entre les modles mathmatiques et la ralit des
communauts assembles dans un environnement donn chercha alors remettre un peu de
ralisme biologique au cur de la modlisation et pour ce faire, proposa trois critres
respecter (Laylor 1978) :
- Quil y est au moins un producteur primaire dans le systme.
- Quil ny est pas plus de 5 7 niveaux trophiques.
- Quil ny est pas de boucles trois espces (i.e. o A mange B qui mange C qui mange A).
Suivant ces suggestions, Pimm construisit en 1982 alors un nouveau modle, toujours sur la
base du modle de Lotka-Volterra, pour tudier le lien entre la complexit du vivant et la
stabilit des cosystmes (Pimm 1982) :


o x
i
est la densit de lespce i , r
i
est le taux de croissance intrinsque de lespce
considre et
ij
linfluence de lespce j sur le taux de croissance de lespce i .
Les contraintes prises appliques par Pimm dans son modle sont les suivantes :
- Seules les interactions trophiques sont considres do ij=ji=0 sauf si i est le
prdateur de j . Dans ce cas, les valeurs de ij sont choisies alatoirement selon les bornes
suivantes : 0< ij<0,1 et -10< ji<0.
- Seules les espces basales sont auto-limitantes avec -1<ii<0.
- La structure des interactions trophiques nest ici pas alatoire, seuls les cas biologiquement
raisonnables sont tests, il sagit alors dun modle de rseau trophique dit structur (Fig. 23.2).
- Le taux de croissance est fix 1 pour les espces basales et -0,02 pour les autres.
Avec ce modle, Pimm montre que les modles biologiquement raisonnables sont plus stables
que les modles stochastiques tels que celui de Gardner et Ashby. Nanmoins, il montre
galement que la probabilit de stabilit diminue quand la complexit augmente.
Si de nombreux rsultats vont alors gnralement dans ce sens, il est noter la petite
originalit de De Angelis (1975) qui, en utilisant une fonction mathmatique quelque peu
diffrente, a dtermin que la stabilit pouvait augmenter avec la complexit dans quelques cas
Du fonctionnement des cosystmes
69

bien particuliers (De Angelis 1975). Il est noter galement que tous ces auteurs ont en commun
de ne pas avoir tenu compte dans leurs analyses des explosions cologiques , cest--dire des
augmentations dmographiques infinies dune espce, considrant quil sagissait l dartfacts
mathmatiques. En effet, ces explosions infinies ne pouvant avoir lieu dans les milieux naturels,
ils les ont gnralement ignores, mme Taylor (1988) qui a pourtant observ que le nombre de
ces explosions augmentait avec le nombre dinteractions du systme (Taylor 1988). Pour
Michalski et Arditi (1999), ces explosions doivent tre considres car elles correspondent aux
cas o la croissance dune population nest limite que par des facteurs (espace, lments
nutritifs) absents des modles utiliss par les prcdents auteurs cits qui nont considr que les
interactions trophiques. En reprenant les travaux de Taylor, Michalski et Arditi ont montr que
sil tait avr que les systmes complexes sont moins stables, leur instabilit est plus due des
phnomnes dexplosions cologiques qu des extinctions (Michalski and Arditi 1999). Aussi,
implmenter dans les modles les facteurs qui permettent de borner ces explosions pourrait
conduire la conclusion que la complexit peut tre source de stabilit dans de plus nombreux
cas que les quelques exceptions du modle de De Angelis (1975) Un nouveau modle de
rseau trophique structur, capable de reprsenter des interactions trophiques et rhagogiques
(i.e. interaction ainsi qualifie lorsquune espce modifie positivement ou ngativement une
interaction trophique tablie entre deux autres espces) a t propos (Arditi, Michalski et al.
2005). Ainsi, la complexit du vivant est reprsente mathmatiquement de manire beaucoup
plus satisfaisante (Fig. 23.3)

Figure 23 : Schma reprsentant les diffrents types de modles mathmatiques visant la simulation de rseaux
trophiques. Les ronds correspondent ici aux espces et les flches aux interactions trophiques. 1) Schma dun
rseau trophique stochastique (i.e. o les interactions sont dtermines ne manire alatoire). 2) Schma dun rseau
trophique structur (i.e. o les interactions sont tablies de manire rendre compte dun certain ralisme
biologique). 3) Schma dun rseau trophique structur o figurent en vert les rhagogies telles que dfinies par
Arditi et al. (2005).
Les simulations ralises sur le modle de rseau trophique structur avec rhagogies ont
mis en vidence que plus le nombre de rhagogies est lev et plus ces rhagogies sont de
type positif, soit facilitant la relation trophique entre deux espces, plus la communaut
assemble est super-efficace. En effet, de telles communauts prsentent une biomasse totale et
1. Schma dun rseau
trophique stochastique
2. Schma dun rseau
trophique structur
3. Schma dun rseau trophique
structur avec rhagogies
Du fonctionnement des cosystmes
70

une richesse spcifique forte ainsi quune importante utilisation des ressources (Arditi, Michalski
et al. 2005).
Par ailleurs, des travaux de modlisation raliss sur des communauts vgtales ont mis en
vidence un effet stabilisateur de la diversit sur les proprits cosystmiques sexpliquant par
une asynchronie des rponses des espces aux fluctuations de lenvironnement reprenant ainsi le
concept dassurance (Naeem 1998; Tilman, Lehman et al. 1998; Yachi and Loreau 1999).
III.2.2.3. Une synthse des tudes exprimentales et thoriques
Bien quelle soit cruciale, notamment du fait de la crise cologique actuelle, la question du
rapport entre la complexit du vivant et la stabilit des cosystmes na toujours pas t rsolue
de manire claire et dfinitive. Cependant, le grand nombre dtudes exprimentales relevant une
corrlation positive entre la diversit et la stabilit ainsi que les nouveaux modles ou approches
de modlisation laissent penser que la complexit est source de stabilit pour trois raisons
majeures :
- Leffet de protection (ou dassurance) qui stipule que toute espce possde des atouts qui
lui permettent daffronter avec succs certaines circonstances. Aussi, plus les espces sont
nombreuses et plus la probabilit est forte quau moins certaines dentre elles puissent survivre,
voire prosprer quelles que soient les conditions. Si une perturbation venait se produire dans
lenvironnement, ces espces seraient mme de protger la communaut dans son ensemble.
- Leffet de moyenne d au fait que la stabilit est souvent dfinie par la variabilit des
populations vis--vis de labondance de la communaut. Ainsi, quand la diversit augmente, la
valeur de la variabilit baisse-t-elle automatiquement. Ce phnomne pose nanmoins problme
du fait que limpact despces additionnelles dans la communaut assemble peut alors se
confondre avec laugmentation du nombre des individus de populations dj prsentes dans la
communaut.
- Leffet de covariance ngative qui stipule que, du fait des comptitions, tout gain ralis
par une espce se fait, dans une certaine mesure, au dtriment dune ou plusieurs autres. Par
consquent, les perturbations ne seraient pas aussi nuisibles quelles pourraient le sembler pour
le systme dans son ensemble car les pertes subies par une espce sont compenses par les gains
quelles permettent aux autres de raliser.
III.3. Les limites des approches exprimentales et thoriques
III.3.1. Les limites de lapproche exprimentale classique en cologie
Comme nous venons de le voir au cours de la description des tudes portant sur la
comprhension de linfluence de la complexit du vivant sur la productivit et la stabilit des
Du fonctionnement des cosystmes
71

cosystmes (chapitres III.1.2.1. et III.2.2.1.), la grande majorit des exprimentations a t
mene sur des communauts vgtales et plus gnralement sur des macrocosystmes. Ces
exprimentations montrent certaines limites en particulier du fait que les paramtres
environnementaux sont gnralement difficilement matrisables ce qui conduit des
interprtations dlicates vis--vis du phnomne tudi. Par ailleurs, dans de tels
macrocosystmes, il apparat difficile de manipuler de grandes populations despces ce qui
rend parfois les analyses statistiques peu robustes. De plus, des chantillonnages de taille
restreinte peuvent conduire des effets de slection rendant l encore controverse lanalyse des
rsultats. Enfin, les macrocosystmes prsentent gnralement des temps de gnration trs
longs qui rendent laborieuses les tudes notamment lorsquil sagit de sintresser la
dynamique des populations et au lien entre la diversit et la stabilit des cosystmes.
Nous verrons dans la suite de ce manuscrit que dautres types dcosystmes peuvent pallier
ces difficults. En particulier, nous traiterons de lintrt du monde microbien dans la
comprhension des cosystmes complexes et comment des communauts microbiennes
peuvent tre suivies dans des conditions parfaitement contrles.
III.3.2. Les limites de lapproche thorique
Comme nous lavons vu au cours de la partie consacre la modlisation du vivant (chapitre
II), les approches thoriques savrent pertinentes en Ecologie pour la comprhension des
cosystmes complexes. De tels modles permettent une reprsentation de la complexit du
vivant et fournissent une aide prcieuse lmergence de concepts et thories gnrales. De plus,
si pendant longtemps les modles taient bass strictement sur des relations de proie-prdation et
de comptition, la complexit se trouve aujourdhui reprsente dans toutes ses dimensions
mme si peu de rsultats sont encore disponibles notamment sur la comprhension des
interactions positives telles que le mutualisme ou la facilitation.
Par ailleurs, lapparition depuis les annes 1980 de puissants moyens de calcul, leur
dmocratisation et leur banalisation ont entran une explosion des modles mathmatiques en
cologie. En quelques jours, il est devenu facile de concevoir le modle dun systme
biologique complexe et de gnrer un grand nombre de simulations. Bouleau (1999) dresse une
liste des modles que lon peut dsormais rencontrer en biologie et en conclut acerbe :
Limpression gnrale que donnent ces travaux est un ensemble assez htroclite. Parfois, des
schmatisations trs sommaires sont appliques des situations complexes aux implications
dlicates, parfois au contraire sont employes des mthodes trs sophistiques sur des donnes
trs vagues. Des bauches maladroites avoisinent des effets de style qui voquent les Prcieuses
Ridicules. Lemploi de mathmatiques trop complexes est un travers frquent qui nuit gravement
Du fonctionnement des cosystmes
72

la rputation des mathmatiques. Le but peut tre dempcher la discussion par des
considrations savantes ou de tirer avantage dune tournure la mode mais le plus souvent cela
vient de la tendance spontane du modlisateur amliorer en perfectionnant et en
compliquant. De plus, bien souvent ces modles mathmatiques ne sont jamais confronts
des donnes exprimentales. En effet, encore aujourdhui les biologistes et les mathmaticiens
apparaissent dans deux sphres dconnectes mme si de plus en plus de lien sont crs.
Pour viter ces cueils il apparat donc important de combiner une exploration
exprimentale de la dynamique des communauts et des fonctions exprimes dans des
cosystmes avec une approche mathmatique de modlisation (Fussmann, Loreau et al.
2007). En effet, la mthode qui semble la plus pertinente pour dcouvrir de nouvelles lois du
vivant passe par (i) lcriture dun modle phnomnologique capable de prdire des
comportements qualitatifs dun systme, (ii) la mise au point dexpriences dont lanalyse des
donnes permet de discriminer diffrents scnarii qualitatifs afin de valider ou dinvalider les
hypothses qui sous-tendent la cohrence du modle, (iii) un aller-retour entre la thorie et
lexprimentation permettant daffiner ou de modifier les hypothses relatives au systme tudi.
Nous verrons dans la suite de ce manuscrit que les cosystmes microbiens apparaissent comme
de bons modles biologiques pour mettre en uvre une telle approche.




73


De lintrt du monde
microbien pour la
comprhension des
cosystmes complexes


O il sera question :



Du monde microbien et des outils danalyse de sa diversit

Du monde microbien comme modle dtude en cologie


74







Du monde microbien et des outils danalyse de sa diversit
75

IV. IV. IV. IV. DU DU DU DU MONDE M MONDE M MONDE M MONDE MICROBIEN ET D ICROBIEN ET D ICROBIEN ET D ICROBIEN ET DES OUTILS ES OUTILS ES OUTILS ES OUTILS
DANALYSE DE SA DIVERSIT DANALYSE DE SA DIVERSIT DANALYSE DE SA DIVERSIT DANALYSE DE SA DIVERSIT
Quelque soit le critre auquel on se rfre, les bactries furent ds le dbut, sont
aujourdhui et resteront les organismes les plus russis de la Terre
Sephen Jay Gould.
IV.1. A la dcouverte du monde microbien
IV.1.1. La naissance de lcologie microbienne
Lcologie microbienne, qui aborde la place et le rle des microorganismes dans un
environnement donn ainsi que les interactions des microorganismes entre eux et avec leur
milieu, na vritablement commenc quavec linvention doutils danalyses du monde
microbien dont le premier fut le microscope par Antoine van Leeuwenhoek (1632-1723) en 1676
qui a rvl lincroyable diversit de ce qui tait alors appel les animalcules . Nanmoins, il
faudra attendre encore deux sicles avant que la discipline ne prenne un rel essor. En effet, cest
dans les annes 1830 que sont ralises les premires descriptions scientifiques et les premires
tentatives de classification de ces animalcules notamment sous limpulsion du zoologiste
allemand Christian Ehrenberg (1795-1876). Celui-ci identifie une grande variabilit de formes
bactriennes parmi lesquelles Bacterium (ayant laspect de btonnets droits et rigides), Vibrio
(btonnets tordus non rigides), Spirochaeta (filaments spiraux non rigides) et Spirillum
(filaments spiraux rigides). Rapidement, ces diffrentes formes de microorganismes sont
considres par certains scientifiques comme les reprsentants dune seule et mme espce
doue dune capacit prendre une grande varit de formes selon leur stade de vie, cest
lhypothse du plomorphisme. Cependant, vers la fin du XIX
ime
sicle, un dbat sengage entre
les partisans de cette hypothse et ceux qui soutiennent lhypothse du monomorphisme, soit que
la diversit des formes observes reprsente autant despces. La thse plomorphiste est
dfendue ardemment notamment par Pierre Bchamp (1816-1908) qui considre que toute
cellule animale ou vgtale serait constitue de petites particules capables, sous certaines
conditions, dvoluer pour former des microzymes (i.e. bactries) qui continueraient vivre
aprs la mort de la cellule dont elles proviendraient. Face eux, les tenants de lhypothse
monomorphiste comme Ferdinand Cohn (1828-1898) ou encore Louis Pasteur (1822-1895)
finirent par simposer. Parmi eux figure galement Robert Koch (1843-1910), biologiste
allemand trs attach la conception linnenne des espces qui joua un rle dterminant dans le
rglement de la controverse en rendant possible lisolation des souches bactriennes par la
technique de culture sur milieu solide. En 1876, Koch a galement mis en vidence que lagent
Du monde microbien et des outils danalyse de sa diversit
76

causal de la maladie de lanthrax est la bactrie Bacillus anthracis, confirmant ainsi la thorie
des germes de Pasteur, et en conclura plus tard que chaque maladie correspond une espce
bactrienne.
Laccent des recherches de Koch et Pasteur sur les maladies infectieuses a contribu jeter le
trouble dans les esprits pendant la premire moiti du sicle dernier et jusqu aujourdhui,
montrant du doigt les bactries, les microbes , comme les ennemies absolues de nos
existences et les agents impitoyables de toutes les corruptions et maladies. Nanmoins, les
observations sur les dsordres infectieux ont eu aussi pour effet de stimuler les premires
grandes recherches sur lcologie des microorganismes dans les sols ainsi que dans les milieux
aquatiques et damliorer notre comprhension de la diversit du monde microbien.
IV.1.2. La diversit du monde microbien
IV.1.2.1. La prsentation gnrale de la diversit du monde microbien
Le monde microbien, qui constitue la biomasse la plus importante de la Terre, regroupe un
grand nombre dorganismes divers ayant comme point commun leur petite taille (Tableau 2).
Tableau 2 : Tailles et organisation cellulaire des diffrents organismes constituant le monde microbien.
Organisation cellulaire Microorganisme Taille approximative
Acaryote Virus 0,01 0,25 m
Procaryote
Bactries
Arches
0,1 10 m
Eucaryote
Champignons unicellulaires
Algues unicellulaires
Protozoaires
2 1000 m

A lexception des Virus qui sont des parasites intracellulaires obligatoires constitus dune
squence dacide nuclique pouvant tre de lADN ou de lARN simple ou double brin entoure
dune coque de protines appele capside et qui pose la question de leur classification dans le
monde du vivant (Jacob 2002), ces diffrents microorganismes peuvent prsenter soit une
organisation cellulaire dite eucaryote soit une organisation cellulaire qualifie de procaryote. Ces
termes sont forms partir de la racine grecque caryon signifiant noyau et des prfixes
eu et pro qui veulent dire vrai et avant respectivement.
Les eucaryotes sont des organismes qui possdent un vrai noyau cellulaire dlimit par une
membrane nuclaire, constitu de plusieurs chromosomes et dun nuclole. Ils possdent
galement des organites impliqus dans la transformation dnergie tels que les chloroplastes ou
les mitochondries ainsi que des membranes internes complexes comme le rticulum
endoplasmique et lappareil de Golgi. Les eucaryotes peuvent tre unicellulaires, pluricellulaires
ou constitus de filaments plurinucls. La totalit des macroorganismes, vgtaux et animaux,
prsentent ce type dorganisation cellulaire. Parmi les microorganismes y figurent :

- Les champignons unicellulaires dont font parti
binaire ou par bourgeonnement donnant naissance de nouveaux individus parti
mre. Ces microorganismes sont prsents dans les sols, les dbris vgtaux, les lichens...
Certains sont galement des parasites de lhomme, danimaux et de vgtaux.
- Les Protozoaires qui regroupent un grand nombre dorganismes de taille e
diverses. Ceux-ci possdent une varit de structures inhabituelles lies la membrane externe,
par exemple les vacuoles arifres qui permettent la cellule de flotter. Dautres groupes de
Protozoaires possdent des granules spcialiss
extrusomes, impliqus dans le mouvement amibode ou dans le mouvement de glissement.
- Les algues unicellulaires phototrophes. Quelques
ou membraneuse. Elles peuvent tre
couche protino-aqueuse. De nombreuses espces sont galement flagelles. La plupart
contiennent des chloroplastes pouvant diffrer en structure
A linverse, les organismes p
ntant pas entour dune membrane nuclaire. Leur structure cellulaire interne est relativement
simple, dpourvue de mitochondries et de chloroplastes ainsi que de structures membranaires
internes comme le rticulum endoplasmique et dappareil de Golgi.
IV.1.2.2. La diversit des organismes procaryotes
Durant de nombreuses annes, la diversit des organismes procaryotes a t largement sous
estime et le terme procaryote
eucaryote. Ce nest quen 1990 que Carl Woese distingua deux phylums de procaryotes,
comportant lun des bactries vivant dans des conditions extrmes quil appela Archbacteries
ou Arches, et lautre les bactries
Kandler et al. 1990). Ainsi, le rgne du vivant ne se trouvait plus divis en deux (procaryote
versus eucaryote) mais en trois
Figure 24 : Arbre phylogntique des trois domaines du v
de vraisemblance et de parcimonie parti
domaine du vivant (daprs Woese et al., 1990).
Du monde microbien et des outils danalyse de sa diversit
Les champignons unicellulaires dont font parties les levures qui se multiplient par scission
binaire ou par bourgeonnement donnant naissance de nouveaux individus parti
mre. Ces microorganismes sont prsents dans les sols, les dbris vgtaux, les lichens...
Certains sont galement des parasites de lhomme, danimaux et de vgtaux.
Les Protozoaires qui regroupent un grand nombre dorganismes de taille e
ci possdent une varit de structures inhabituelles lies la membrane externe,
par exemple les vacuoles arifres qui permettent la cellule de flotter. Dautres groupes de
Protozoaires possdent des granules spcialiss prsents la priphrie de structures, appels
extrusomes, impliqus dans le mouvement amibode ou dans le mouvement de glissement.
Les algues unicellulaires phototrophes. Quelques-unes ont une morphologie filamenteuse
ou membraneuse. Elles peuvent tre entoures dune paroi cellulaire base de cellulose ou dune
aqueuse. De nombreuses espces sont galement flagelles. La plupart
contiennent des chloroplastes pouvant diffrer en structures et en pigments.
A linverse, les organismes procaryotes ne possdent pas de noyau cellulaire, leur ADN
ntant pas entour dune membrane nuclaire. Leur structure cellulaire interne est relativement
simple, dpourvue de mitochondries et de chloroplastes ainsi que de structures membranaires
comme le rticulum endoplasmique et dappareil de Golgi.
IV.1.2.2. La diversit des organismes procaryotes
Durant de nombreuses annes, la diversit des organismes procaryotes a t largement sous
procaryote ntait en ralit quune dfinition par dfaut pour non
eucaryote. Ce nest quen 1990 que Carl Woese distingua deux phylums de procaryotes,
comportant lun des bactries vivant dans des conditions extrmes quil appela Archbacteries
ou Arches, et lautre les bactries vraies ou Eubactries ou encore Bactries
. Ainsi, le rgne du vivant ne se trouvait plus divis en deux (procaryote
versus eucaryote) mais en trois : Bacteries, Arches et Eucaryotes (Fig. 24).
ntique des trois domaines du vivant. Cet arbre a t ralis par la mthode de maximum
de vraisemblance et de parcimonie partir du squenage dADN ribosomiques des reprsentants de chaque
domaine du vivant (daprs Woese et al., 1990).
Du monde microbien et des outils danalyse de sa diversit
77
les levures qui se multiplient par scission
binaire ou par bourgeonnement donnant naissance de nouveaux individus partir dune cellule
mre. Ces microorganismes sont prsents dans les sols, les dbris vgtaux, les lichens...
Certains sont galement des parasites de lhomme, danimaux et de vgtaux.
Les Protozoaires qui regroupent un grand nombre dorganismes de taille et de morphologie
ci possdent une varit de structures inhabituelles lies la membrane externe,
par exemple les vacuoles arifres qui permettent la cellule de flotter. Dautres groupes de
prsents la priphrie de structures, appels
extrusomes, impliqus dans le mouvement amibode ou dans le mouvement de glissement.
unes ont une morphologie filamenteuse
entoures dune paroi cellulaire base de cellulose ou dune
aqueuse. De nombreuses espces sont galement flagelles. La plupart
et en pigments.
rocaryotes ne possdent pas de noyau cellulaire, leur ADN
ntant pas entour dune membrane nuclaire. Leur structure cellulaire interne est relativement
simple, dpourvue de mitochondries et de chloroplastes ainsi que de structures membranaires
Durant de nombreuses annes, la diversit des organismes procaryotes a t largement sous-
une dfinition par dfaut pour non-
eucaryote. Ce nest quen 1990 que Carl Woese distingua deux phylums de procaryotes,
comportant lun des bactries vivant dans des conditions extrmes quil appela Archbacteries
ou Eubactries ou encore Bactries (Woese,
. Ainsi, le rgne du vivant ne se trouvait plus divis en deux (procaryote
: Bacteries, Arches et Eucaryotes (Fig. 24).

ivant. Cet arbre a t ralis par la mthode de maximum
des reprsentants de chaque
Du monde microbien et des outils danalyse de sa diversit
78

Les Arches ont t dnommes de la sorte car leur prolifration dans des conditions extrmes
telles que les sources hydrothermales laissait supposer quelles avaient pu tre les premires
formes de vie la surface du globe terrestre. Les Arches comprennent entre autres des
halophiles, des mthanognes et des thermophiles. Les halophiles supportent des concentrations
leves en sel. Certaines possdent un systme photosynthtique qui utilise un pigment li la
membrane, la bactriorhodospine. Les mthanognes vivent dans des milieux sans oxygne et
produisent du mthane par rduction du gaz carbonique. Quant aux thermophiles, elles vivent
dans des sources chaudes ou dans des fonds marins des tempratures avoisinant 80 90C. De
plus, le domaine des Arches contient galement des espces dtectes dans des environnements
arobies marins, des eaux douces et des sdiments (Bano, Ruffin et al. 2004).
Les Bactries ont, quant elles, t rparties en dix divisions majeures (Tableau 3).
Tableau 3 : Les divisions majeures du domaine des Bactries (Woese 1987).
Divisions Subdivisions Genres reprsentatifs
Protobactries
-protobactries
-protobactries
-protobactries
-protobactries
-protobactries
Nitrobacter, Agrobacterium
Nitrosomonas, Neisseria
Nitrococcus, Legionella
Nitrospina
Helicobacter
Gram-positives
Haut G+C
Bas G+C
Espces photosynthtiques
Espces gram-ngatives
Actinomyces, Streptomyces
Bacillus, Clostridium
Heliobacterium
Megasphaera, Sporomusa
Cyanobactries et apparentes Nostoc, Synechococcus
Spirochtes et apparentes
Spirochtes
Leptospiras
Treponema, Borrelia
Leptonema, Leptospira
Bactries vertes sulfureuses Chlorobium, Chloroherpeton
Bactrodes, Flavobactries,
Cytophagales et apparentes
Bactrodes
Flavobactries
Bacteroides, Fusobacterium
Flavobacterium, Cytophaga
Planctomycetes et apparentes
Groupe des Planctomyctes
Thermophiles
Planctomyces, Pasteuria
Isocystis pallida
Chlamydiales Chlamydia
Micrococcus radiorsistants et
apparents
Groupe des Deinococcus
Groupes des Thermophiles
Deinococcus
Thermus
Bactries vertes non sulfureuses
Groupe des Chloroflexus
Groupe des Thermomicrobium
Chloroflexus, Herpetosiphon
Thermomicrobium roseum
La plupart de ces groupes ne reposent que trs partiellement sur des critres phnotypiques, la
variabilit des modes de vie lintrieur des divisions est en effet trs importante. Par exemple,
la division des Protobactries, dont le nom fait rfrence la prsence chez certains de ces
microorganismes dun pigment li la photosynthse, est compose de nombreux groupes qui
contiennent tous des bactries dpourvues de ce pigment et sont donc non photosynthtiques.
Dun point de vue phylogntique, les Arches sont aussi diffrentes des Bactries que des
Eucaryotes mais de nombreuses zones dombre persistent sur la diffrenciation de ces trois
groupes qui comprennent toute la diversit du vivant (Fig. 25).
Du monde microbien et des outils danalyse de sa diversit
79


Figure 25 : Schma des grandes divergences du vivant menant la complexit actuelle. La divergence ayant
conduit la formation des Eucaryotes, entre autres, demeure incertaine notamment quant une origine
archaebactrienne ou bactrienne.
IV.1.3. La formidable odysse du monde microbien
Les protoprocaryotes (i.e. anctre commun des Bactries et des Arches qui est galement
appel LUCA pour Last Universal Cellular Ancestral) constituent les premiers organismes
apparus sur Terre il y a environ 3,5 milliards dannes. En effet, des fossiles microscopiques, qui
ressemblent aux organismes procaryotes actuels, ont t dcouverts en Australie et en Afrique du
Sud sous forme de tapis prsents dans des affleurements rocheux appels stromatolithes (Fig.
26).


Figure 26 : Photos de stromatolithes (source : wikipedia).
Ces tapis fossiliss correspondent des colonies de microorganismes enrobes de minraux
qui se seraient formes il y a environ 3,5 milliards dannes (Nagy 1974). Lune des plus
anciennes bactries-arches, Eobacterium isolatum (signifiant tymologiquement bactrie de
laube des temps ), a t trouve dans des sdiments du Transvaal (rgion du Nord-Est de
lAfrique du Sud) datant denviron 3 milliards dannes (Barghoorn and Schopf 1966). Des
colonies fossilises dune autre bactrie-arche capable doxyder le fer en prsence de traces
doxygne, Metallogenium personatum, datant de 2,8 milliards dannes ont galement t mises
en vidence en Rhodsie (rgion du Sud-Est de lAfrique) dans des sdiments contenant de
lhydroxyde de fer suggrant quil existait dj cette poque des traces doxygne (Crerar,
Fischer et al. 1980).
Une fois apparus, ces protoprocaryotes se sont progressivement complexifis. Bien que de
morphologie relativement simple, ils se sont dots de systmes enzymatiques complexes et
performants, indispensables pour les mcanismes molculaires inhrents leur division et leur
mtabolisme. Ils se sont alors rpandus et ont occup les nombreuses niches cologiques
disponibles, tant les seuls organismes vivants sur Terre durant plus de deux milliards dannes.
En effet, la rapidit de division des organismes procaryotes est prodigieuse. Par exemple, 37C
Du monde microbien et des outils danalyse de sa diversit
80

la bactrie Escherichia coli se divise toutes les 20 minutes, donnant naissances des milliards
dindividus en 24 heures. Compte tenu de la densit des tapis de bactries-arches fossilises, il
est possible de prsumer que cette facult se diviser rapidement tait galement un attribut des
procaryotes primitifs. Leur dveloppement rapide a d engendrer de la concurrence vis--vis des
composs organiques forms antrieurement, constituant leurs ressources. Il y aurait alors eu
slection de nouvelles stratgies pour se dfaire de cette dpendance alimentaire et voluer vers
lutilisation de lnergie la plus fiable et la plus abondante qui soit sur terre : le Soleil. Les
premiers organismes procaryotes photosynthtiques utilisrent probablement le pouvoir
rducteur de lhydrogne sulfur (SH
2
) pour rduire le dioxyde de carbone (CO
2
) (Olson 1970).
Il est possible, mais il ne sagit l que de spculations, que lacquisition de la photosynthse ait
conduit deux autres innovations majeures dans le monde du vivant : la mobilit et les processus
de rparation de lADN. En effet, il est possible que lvolution ait slectionn le dplacement
actif qui permet de maximiser lexposition au soleil favorisant ainsi la propagation dorganismes
flagells. Un flagelle est une sorte de fouet qui mouline sous leffet de changements de charges
lectriques et qui serait issu dune modification du systme de scrtion de protines de type III
(Cavalier-Smith 2006; Pallen and Mattzke 2006; Wong, Amidi et al. 2007). Cependant, si la
lumire devint alors un prcieux alli de la Vie, elle demeurait aussi une menace destructrice
certaine. En effet, les rayons ultraviolets dtriorent lADN en modifiant les liaisons chimiques.
Plusieurs stratgies, qui permettaient de sen prserver tout en ayant la possibilit de recevoir et
dexploiter la lumire visible par photosynthse, ont alors pu tre slectionnes, comme se
rfugier dans des niches filtres naturels (ex : dans des eaux riches en sels, par enterrement
partiel dans le sable) ou comme lacquisition de mcanismes de rparation de lADN en
rponse aux perturbations subies (Sghaier, Ghedira et al. 2008).
Par ailleurs, laugmentation considrable des communauts microbiennes entrana une
demande insatiable en hydrogne qui devenait de moins en moins disponible dans latmosphre
(il nen reste aujourdhui que de lordre de 1 ppm alors quil reprsentait plus de 90% de la
composition de latmosphre au dbut de la formation de la Terre). Cependant, une grande
source dhydrogne tait alors prsente en quantit : loxyde de dihydrogne, H
2
O, ou eau.
Nanmoins, les liaisons H-O sont trs robustes et les microorganismes ne parvenaient pas les
briser ce qui fut finalement fait par une amlioration du processus photosynthtique avec
lapparition dun deuxime centre ractionnel pour permettre dabsorber la lumire un niveau
dnergie suprieure (Vignais 2001). En absorbant de leau, ces protoprocaryotes consommaient
lhydrogne et rejetaient de loxygne qui saccumula alors dans latmosphre passant de 0,0001
21%. Le microcosme dans son ensemble dut sadapter une telle volution. Nombreux sont les
mcanismes de protection qui se firent jour ce moment. Mais celui qui fut un des plus
Du monde microbien et des outils danalyse de sa diversit
81

importants fut la respiration arobie, lassimilation de loxygne pour canaliser et exploiter sa
ractivit leve. Cette tape fondamentale serait galement lorigine dune autre tape
extrmement importante : lacquisition dune organisation pluricellulaire lintrieur de laquelle
certaines cellules ont dvelopp une spcialisation en vue daccomplir des fonctions diffrentes.
Cette transformation se serait ensuite traduite par une compartimentation intracellulaire
lorigine de tous les eucaryotes. Il existe actuellement deux hypothses sur lorigine des
eucaryotes. Selon lhypothse de lorigine autogne, les cellules eucaryotes ont volu par
spcialisation de membranes internes issues lorigine de la membrane plasmique des
organismes procaryotes. Selon ce modle, les lments du systme de membranes internes, cest-
-dire la membrane nuclaire, le rticulum endoplasmique, lappareil de Golgi et les organites
limits par une membrane simple (comme les lysosomes), proviennent de la diffrenciation de
membranes invagines. De la mme manire, les mitochondries et les chloroplastes auraient
peut-tre acquis leur double membrane par un processus dinvagination secondaire ou par un
repliement complexe des membranes. Selon une seconde hypothse, lhypothse dune origine
endosymbiotique, les cellules eucaryotes ont eu pour prcurseurs des consortiums symbiotiques
de cellules procaryotes. Cette hypothse a t plus particulirement approfondie par Lynn
Margulis sur lorigine des chloroplastes et des mitochondries (Margulis and Chapman 1998).
Selon ces travaux, les chloroplastes viendraient de procaryotes photosynthtiques qui vivaient en
tant quendosymbiontes lintrieur de cellules plus grandes. Les mitochondries quant elles,
proviendraient de bactries endosymbiotiques qui taient des htrotrophes arobies. Ce serait
sous forme de proie non-digre ou de parasites internes que de telles cellules auraient pu russir
pntrer une cellule plus grosse. Pour tayer leur hypothse, les partisans de lendosymbiose
citent les similitudes de structure et de fonction que prsentent les bactries avec les
chloroplastes et mitochondries des cellules eucaryotes. En effet, les mitochondries et les
chloroplastes se reproduisent par un processus de segmentation faisant penser la scissiparit
des bactries. De plus, ces organites possdent, comme les procaryotes, un ADN circulaire non
associ des histones ou dautres protines. Enfin, ils contiennent galement lARN de
transfert, les ribosomes et des molcules ncessaires la transcription de lADN et la
traduction de leur ARN en protines.
Ainsi, les organismes procaryotes seraient lorigine de lensemble de la complexit du
vivant. Au cours de lEvolution, ils ont su se prenniser par la slection de mcanismes
innovants et occuper la totalit des niches cologiques terrestres aussi extrmes soient-elles. Les
microorganismes affectent aujourdhui tous les domaines de la Vie. En effet, dans
lenvironnement ils assurent le recyclage du carbone, de lazote et du phosphore composants
essentiels aux organismes vivants. Ils maintiennent la fertilit des sols et peuvent tre utiliss
Du monde microbien et des outils danalyse de sa diversit
82

pour liminer les composants toxiques de lenvironnement par des techniques dites de
bioremdiation. Dans la mdecine, la capacit de certains microbes provoquer des maladies
comme la variole (Pox virus), le cholra (Vibrio cholerae) ou encore le paludisme (Plasmodium)
est bien connue. Cependant, il est noter que si les microorganismes peuvent constituer des
agents pathognes redoutables, cest galement des microorganismes qui nous ont fourni les
moyens de les contrler avec les antibiotiques. Dans lalimentation, les microorganismes sont
utiliss depuis des centaines dannes pour la fabrication du vin, du fromage, du pain Dans les
domaines de la biotechnologie, les microorganismes sont utiliss pour synthtiser de nombreux
produits chimiques importants comme lactone et lacide actique On les trouve galement
en association avec les plantes notamment pour la fixation de lazote, avec les vaches et les
termites qui ne peuvent digrer la cellulose de lherbe et du bois sans leur communaut
microbienne, de mme quavec lhomme o elle reprsente 10% du poids sec dun individu
adulte.
Aussi, compte tenu de leur rle dans le processus volutif de tous les tres vivants ainsi que
dans le fonctionnement des cosystmes, ltude des microorganismes revt une importance
toute particulire. Le dveloppement de diffrents outils danalyses de la diversit microbienne
en donne de formidables moyens.
IV.2. Les outils danalyses de la diversit du monde microbien
IV.2.1. Les outils danalyse classique de la diversit microbienne
Le microscope a constitu le premier outil danalyse de la diversit microbienne en mettant
jour la grande varit de formes de ces organismes. Cependant, sil a permis de diffrencier
certains genres de bactries, le microscope sest rapidement heurt au manque de caractres
morphologiques distinctifs chez les microorganismes. Le dveloppement des techniques de
culture en milieu solide mises au point par Koch a permis daller beaucoup plus loin dans la
distinction des diffrentes espces microbiennes. De nombreux types de milieux de culture ont
t labors pour favoriser la multiplication dun grand nombre despces diffrentes ou pour
slectionner un genre bactrien ou une famille particulire afin de ltudier de manire plus
spcifique. Parmi ces milieux peuvent tre cits :
- Les milieux minimum comportant les lments chimiques strictement ncessaires la
croissance bactrienne, sous une forme utilisable par des bactries nayant pas dexigence
particulire. Un tel milieu contient gnralement des sources de carbone et dnergie comme le
glucose, des sources de potassium, de phosphore, dazote, de souffre, de magnsium, de calcium
et de fer. Il contient galement des oligo-lments tels que du cuivre et du zinc.
Du monde microbien et des outils danalyse de sa diversit
83

- Les milieux synthtiques dont la composition chimique est parfaitement matrise tant dun
point de vue qualitatif que quantitatif. Ceux-ci sont gnralement utiliss dans ltude de
ractions enzymatiques prcises. Ainsi, par exemple, le milieu tryptophane est employ pour
rvler la prsence de lenzyme tryptophanase par la production dindole qui induit un
changement de coloration du milieu (Fig. 27).

Figure 27 : Photos de diffrentes cultures en milieux synthtiques permettant ltude de ractions enzymatiques par
changement de coloration du milieu. (Source : Entreprise AES Chemunex).
- Les milieux semi-synthtiques dont la composition exacte nest matrise que pour un
certain nombre de composants.
- Les milieux empiriques dont la composition nest pas exactement dtermine. Ainsi, les
milieux type cur-cervelle contiennent de leau strile, de lagar-agar, de lhydrolysat de cur et
de cervelle sans que les aspects qualitatifs et quantitatifs en soient parfaitement connus.
- Les milieux slectifs qui permettent la culture de certains genres de microorganismes. Pour
ce faire, des lments inhibant la croissance de bactries non dsires, comme le chlorure de
sodium, le thiosulfate de sodium ou encore le cristal violet sont ajouts dans la solution de
prparation du milieu. Parmi ceux-ci peuvent tre cits : le milieu S-S qui ne permet que la
croissance des Salmonelles et des Shigella, le milieu de Sabouraud qui slectionne les myctes
ou encore le milieu KV contenant deux antibiotiques, la Kanamycine empchant la croissance
des Entrobactries et la Vancomycine empchant la croissance des bactries gram-positives.
- Les milieux de culture enrichis qui contiennent, outre les lments de base, des composants
indispensables aux bactries mais quelles ne peuvent synthtiser. Ces milieux sont gnralement
raliss base de sang frais, riche en nutriments divers, ou avec du jaune duf.
Au-del de mieux connaitre les diffrentes espces bactriennes et de caractriser les ractions
enzymatiques, les cultures en milieux ferms ont galement permis dtudier les cintiques de
croissance de ces microorganismes. Les courbes de croissance des microorganismes sont ainsi
bien connues notamment depuis les travaux de Buchanan, Winogradsky et Monod (Fig. 28).
Du monde microbien et des outils danalyse de sa diversit
84


Figure 28 : Les diffrentes phases de la croissance bactrienne en culture sur milieu ferm. I) Phase de latence. II)
Phase de croissance exponentielle. III) Phase maximale stationnaire. IV) Phase de dcroissance (daprs Buchanan,
1918).
Ainsi, des microorganismes en culture sur milieu ferm prsentent une cintique pouvant tre
dcompose en plusieurs phases :
- La phase de latence, qui correspond une absence apparente daugmentation de la
biomasse. Cette situation reflte des situations individuelles varies : (i) Le passage brutal du
milieu carenc dans lequel se trouvent les microorganismes de linoculum un milieu neuf et
riche ncessite une premire adaptation des cellules qui doivent ajuster leur physiologie ce
nouvel environnement. Cette adaptation ncessite lactivation ou la synthse de certains
composants cellulaires, notamment de protines enzymatiques, synthse qui nest pas immdiate
mais requiert un certain temps (ii) Linoculum peut tre tellement appauvri que certaines cellules
sont incapables de restaurer leurs capacits mtaboliques. La stagnation de la biomasse reflterait
alors le temps ncessaire ce que les cellules viables, plus ou moins nombreuses, se divisent
pour compenser les pertes par mortalit cellulaire. Cest notamment en raison de cette hypothse
que certains auteurs prfrent parler de phase de latence apparente dfini par Fogg (1965).
- La phase de croissance exponentielle correspondant une augmentation de la biomasse du
fait que les cellules non-viables sont progressivement submerges par la croissance des cellules
viables.
- La phase maximale stationnaire caractrise par un taux de croissance constant et maximal.
Cest au cours de cette phase que peut tre valu le taux de croissance de lespce pour les
conditions nutritionnelles du milieu.
- La phase de dcroissance o le taux de croissance commence diminuer par la rarfaction
dun substrat limitant du milieu de culture au sens de la loi du minimum (von Liebig, 1840) : la
croissance est en effet limite par un lment dont la concentration devient infrieure une
valeur minimum en dessous de laquelle les synthses mtaboliques ne peuvent plus tre
ralises.
Les trois principales caractristiques des courbes de croissance que sont : la dure de la phase
de latence, la pente de la droite de croissance exponentielle et la concentration maximale atteinte
en fin de croissance sont toutes indpendantes les unes des autres. Elles voluent en fonction des
Du monde microbien et des outils danalyse de sa diversit
85

conditions initiales, telles que la lumire, la temprature, la concentration initiale de ce qui
deviendra le substrat limitant et des caractristiques physiologiques de la souche cultive. De
mme, pendant la dernire phase de la dynamique dune population microbienne (la phase de
dcroissance), la vitesse de croissance diminue avec la diminution du substrat limitant. Or il
savre important de quantifier la relation exacte entre la concentration en lment limitant et le
taux de croissance pour interprter les observations dans le milieu naturel. La technique de
culture en milieu ferm nest donc sans doute pas le meilleur moyen dtablir cette relation, tant
donn que, dans le milieu naturel, llment limitant peut se trouver concentration invariable
compte tenu des processus de diffusion.
De plus, malgr la grande diversit des milieux existants, il sest avr que la diversit
microbienne, qui peut tre rvle par des techniques de culture, est trs limite par rapport la
diversit relle des communauts bactriennes. En effet, des carts importants entre le
dnombrement de microorganismes par le biais de microscopes et de cultures ont t observs. Il
est estim aujourdhui que la fraction cultivable de la diversit microbienne reprsente seulement
0,001 15% de la diversit totale, cette fraction pouvant fortement varier selon les cosystmes
considrs (Tableau 4).
Tableau 4 : Pourcentage de la fraction cultivable de la diversit microbienne pour diffrents types dcosystmes.
Ce pourcentage reprsente le nombre dunits formant des colonies bactriennes par rapport au nombre de bactries
total dnombr par comptage direct au microscope (Amann, Snaidr et al. 1996).
Types dcosystme Fraction cultivable en %
Eau de mer
Eau douce
Lac msotrophique
Eaux destuaires non pollus
Boues actives
Sdiments
Sol
0,001 0,1
0,25
0,1 1
0,1 1
1 15
0,25
0,3
Les causes de cette faible fraction cultivable de la diversit microbienne sont de deux ordres :
- Des difficults reproduire les conditions permettant la croissance bactrienne, que ce soit
au niveau des paramtres physico-chimiques, environnementaux ou au niveau des relations
mutualistes ou symbiotiques qui peuvent exister dans les cosystmes naturels.
- Des phnomnes de dormance qui caractrisent des bactries ayant perdu leur capacit se
multiplier mais prsentant toujours une activit cellulaire, on parle alors dtat viable mais non
cultivable (Roszak and Colwell 1987). Il est noter que de telles bactries peuvent redevenir
cultivables, cest--dire reprendre une activit de croissance, sous certaines conditions (Roszak,
Grimes et al. 1984).
Ainsi, les techniques dcologie microbienne classique conduisent une vision trs restreinte
de la diversit des communauts microbiennes. Les techniques plus rcentes, faisant intervenir
Du monde microbien et des outils danalyse de sa diversit
86

des approches molculaires, ont permis denrichir considrablement les connaissances en
cologie microbienne.
IV.2.2. Les outils danalyse molculaire de la diversit microbienne
Les techniques dtudes des communauts microbiennes se sont considrablement
dveloppes et diversifies avec la mise la porte de nombreux laboratoires des outils de la
biologie molculaire. Ces derniers prsentent en effet lavantage de permettre ltude des
gnomes de bactries prsentes dans un milieu donn, et non pas de leurs produits dexpression,
et sont donc indpendants des conditions de culture et, parfois, de la culture mme des
microorganismes. Les techniques de biologie molculaire ncessitent donc au pralable une
tape dextraction de lADN prsent dans un chantillon donn. Diffrentes techniques
dextraction et de purification de lADN ont t testes sur diffrents types dchantillons
denvironnements naturels. Elles combinent gnralement des mthodes de lyse chimique
(dtergents, phnol) et/ou de lyse enzymatique (protinase K, lysozyme) et/ou de lyse
physique (pilon et mortier, cycles de conglation-dconglation). Des traitements sont ensuite
appliqus pour purifier les acides nucliques de matriaux contaminants potentiels, tels que les
mtaux et polymres, susceptibles dinhiber par la suite les ractions molculaires. Une fois
lADN extrait et purifi, les techniques de biologie molculaire reposent sur lemploi de quatre
outils de base :
- Des enzymes telles que des polymrases capables de copier une molcule dacide
nuclique partir dune matrice monobrin dADN ou dARN, ou telles que les enzymes de
restriction qui reconnaissent spcifiquement des squences du gnome et sont capables de le
cliver. La squence et la taille des sites de reconnaissance, allant de quelques bases plusieurs
dizaines, dfinissent le nombre de sites potentiels de coupure pour une bactrie donne. La
squence reconnue tant spcifique dune enzyme, toute modification dune base dun site de
reconnaissance se traduit par lincapacit de lenzyme reconnatre et couper la squence.
- Lhybridation qui permet lappariement de molcules dacides nucliques monobrins.
Lhybridation repose sur la complmentarit des brins qui peut tre totale ou partielle et dpend
fortement des conditions exprimentales, en particulier de la temprature et des forces ioniques
appliques (ou stringence).
- Llectrophorse qui permet la sparation des molcules dacides nucliques en fonction
de leur poids molculaire, donc de leur taille, la charge de ces molcules tant uniforme ou
encore en fonction de leur conformation secondaire (i.e. leur configuration tridimensionnelle).
- Le squenage des acides nucliques qui consiste en la dtermination des squences
dacides nucliques qui composent tout ou partie dun gnome.
Du monde microbien et des outils danalyse de sa diversit
87

Les techniques de biologie molculaire existantes peuvent tre diffrencies selon quest mise
en jeu une reconnaissance spcifique de squence cible ou non.
IV.2.2.1. Lamplification de lADN
Les techniques sattachant mettre en vidence des squences spcifiques sont trs varies et
souvent combinatoires. Nanmoins, il en est une qui eut et a toujours une grande importance en
microbiologie : lamplification en chane ou PCR (pour Polymerisation Chain Reaction) mise au
point la fin des annes 1980 et qui a permis de saffranchir, dans une certaine mesure, des
limitations lies la quantit de matrice disponible en amplifiant (i.e. photocopiant) directement
la squence cible partir dun chantillon dADN total (Fig. 29).

Figure 29 : Principe de lamplification en chane (ou PCR) dune squence cible partir dADN total.
Le cycle dnaturation-hybridations-longation tant reproduit gnralement 20 30 fois, la
technique de PCR aboutit la production en grand nombre de la squence cible pouvant tre
ensuite visualise sur un gel dagarose contenant du Bromure dEthidium (BET). Les produits de
lamplification peuvent galement tre conservs et utiliss pour des applications diverses
danalyses de la diversit microbienne telles que les inventaires molculaires et les techniques
dempreintes molculaires.
IV.2.2.2. Lanalyse de lADN ribosomique
La PCR permet galement daccder plusieurs niveaux phylogntiques des
microorganismes par lutilisation damorces diffrentes, une amorce (ou primer ) tant dfinie
comme une courte squence dARN ou dADN complmentaire du dbut dune matrice et
servant de point de dpart de la synthse du brin complmentaire de cette dernire par une ADN
polymrase. Celles-ci peuvent tre de deux types :
- Universelles : qui permettent de cibler les grands domaines microbiens.
- Spcifiques : qui visent des gnes dont la squence est plus ou moins conserve parmi le
groupe, genre ou espce cibl.
Du monde microbien et des outils danalyse de sa diversit
88

Parmi le grand nombre de squences cibles possibles, les ARN ribosomaux sont rapidement
apparus comme des marqueurs de choix (Fox, Pechman et al. 1977; Woese and Fox 1977). En
effet, ceux-ci possdent les avantages dune prsence universelle, dune fonction conserve, ainsi
que dtre constitus dune alternance de domaines variables et de domaines conservs
(Stackerbrandt and Rainey 1995). Cette dernire proprit permet davoir accs diffrents
niveaux de taxonomie car plus les squences cibles seront conserves, plus elles permettront de
diffrencier diffrents organismes. Ainsi par exemple, Raskin et al. ont, dans leur travaux,
hybrid lADN total de leurs chantillons avec des sondes dADNr 16S de spcificit croissante
ce qui leur a permis de diffrencier les microorganismes prsents depuis les grands domaines
jusqu lespce (Raskin, Poulsen et al. 1994).
Les organismes procaryotes possdent trois ADN ribosomiques classs selon leur coefficient
de sdimentation : le 5S qui compte environ 120 nuclotides, le 16S qui en contient environ
1 500 et le 23S qui prsente environ 3 000 nuclotides. Durant de nombreuses annes, lanalyse
de ces squences ribosomiques a t cantonne aux bactries cultivables. Ce nest quen 1985
que Norman Pace et ses collaborateurs ont propos lanalyse du 5S et du 16S pour dcrire la
diversit microbienne contenue dans des chantillons issus de milieux naturels (Lane, Pace et al.
1985). Ce faisant, Pace et al. ont contribu sortir la microbiologie des laboratoires et donner
une nouvelle importance lcologie microbienne. Les tudes ayant utilis ces ADN
ribosomiques ont rvolutionn la vision de la diversit microbienne et ont par la mme mis en
exergue la vision partielle que pouvaient donner les outils danalyses classiques. Cest en effet
par lanalyse de ces ADN ribosomiques que la distinction fut tablie entre les Bactries et les
Arches (Woese and Fox 1977).
Si les techniques molculaires permettent damliorer nos connaissances sur lvolution des
espces, elles constituent galement de formidables outils pour la comprhension de la
dynamique, de la diversit et de la structuration des microorganismes dans les cosystmes
complexes. Parmi la palette de ces techniques, les empreintes molculaires sont sans aucun doute
les plus efficientes pour de telles tudes.
IV.2.2.3. Les techniques dempreintes molculaires
Plusieurs techniques permettent de raliser rapidement, par le biais dune lectrophorse des
fragments dADNr pralablement amplifis par PCR, une image ou empreinte molculaire
des communauts microbiennes prsentes dans un cosystme. La variabilit de ces fragments
permettant de diffrencier les espces molculaires ou phylotypes qui ils appartiennent est
apporte soit par la taille soit par la squence des fragments amplifis selon la technique
employe.

IV.2.2.3.1. Les gels dlectrophorse gradient de dnaturation
Les gels dlectrophorse gradient de dnaturation ou DGGE (pour Denaturing Gradient Gel
Electrophoresis) sont des outils qui permettent de discriminer des fragments dADN de taille
identique ou trs proche mais de composition
base sur leurs diffrences de mobilit lectrophortique lorsquils sont mis
vertical de polyacrylamide contenant un gradient dagent dnaturant (i.e. entranant une
sparation des brins dADN) qui peut tre de la formamide et/ou de lure. Afin dviter une
dnaturation totale de lADN, une structure trs hau
comportant une succession de 40 GC, est associe lADN lors de lamplification. Les
variations de squences dans les zones faible temprature de fusion font que des squences
diffrentes stopperont leur migrati
and Cloete 2000). Une telle mthode permet dobtenir une image de la communaut microbienne
reprsente par des bandes aux intensits diffrentes. En effet, la comparaison de diffrents
profils (ou gels) permettra de d
bande dun profil de restriction correspondant un phylotype (i.e. espce au sens molculaire)
diffrent et lintensit lumineuse des bandes permettant dobtenir une indication quant
labondance relative de chacun de ces phylotypes
Figure 30 : Photo dun gel dlect
communaut microbienne par la technique DGGE. Chaque bande reprsente un phylotype diffrent et
lumineuse permet dobtenir une indication quant
Lun des avantages de cette mthode trs sensible est que les bandes individuelles dADN
peuvent ensuite tre excises du gel, ramplifies puis squences. Des variantes de la DGGE,
diffrant par leur type de gradient de dnaturation existent galement
- La TGGE (Temperature Gradient Gel Electrophoresis) o la sparation des fragments
dADN est ralise grce un gradient de temprature
- La TTGE (Temporal Temperature Gradient Gel Electrophoresis) o la migration des
fragments dADN se fait dans un gel possdant une concentration uniforme dagent dnaturant et
o la temprature augmente graduellement durant la migration
2000; Ogier, Son et al. 2002).

Du monde microbien et des outils danalyse de sa diversit
Les gels dlectrophorse gradient de dnaturation
Les gels dlectrophorse gradient de dnaturation ou DGGE (pour Denaturing Gradient Gel
is) sont des outils qui permettent de discriminer des fragments dADN de taille
identique ou trs proche mais de compositions diffrentes. La sparation des fragments est alors
base sur leurs diffrences de mobilit lectrophortique lorsquils sont mis
vertical de polyacrylamide contenant un gradient dagent dnaturant (i.e. entranant une
sparation des brins dADN) qui peut tre de la formamide et/ou de lure. Afin dviter une
dnaturation totale de lADN, une structure trs haute temprature de fusion, le
comportant une succession de 40 GC, est associe lADN lors de lamplification. Les
variations de squences dans les zones faible temprature de fusion font que des squences
diffrentes stopperont leur migration dans des zones diffrentes du gradient dnaturant
. Une telle mthode permet dobtenir une image de la communaut microbienne
reprsente par des bandes aux intensits diffrentes. En effet, la comparaison de diffrents
profils (ou gels) permettra de dcrire la diversit de la population ainsi que sa structure
bande dun profil de restriction correspondant un phylotype (i.e. espce au sens molculaire)
diffrent et lintensit lumineuse des bandes permettant dobtenir une indication quant
abondance relative de chacun de ces phylotypes (Moyer, Dobbs et al. 1994)

Photo dun gel dlectrophorse permettant lobtention dune empreinte molculaire dune
communaut microbienne par la technique DGGE. Chaque bande reprsente un phylotype diffrent et
lumineuse permet dobtenir une indication quant son abondance relative.
n des avantages de cette mthode trs sensible est que les bandes individuelles dADN
peuvent ensuite tre excises du gel, ramplifies puis squences. Des variantes de la DGGE,
diffrant par leur type de gradient de dnaturation existent galement :
TGGE (Temperature Gradient Gel Electrophoresis) o la sparation des fragments
dADN est ralise grce un gradient de temprature (Muyzer 1999).
La TTGE (Temporal Temperature Gradient Gel Electrophoresis) o la migration des
fragments dADN se fait dans un gel possdant une concentration uniforme dagent dnaturant et
ente graduellement durant la migration (Farnleitner, Kreuzinger et al.

Du monde microbien et des outils danalyse de sa diversit
89
Les gels dlectrophorse gradient de dnaturation
Les gels dlectrophorse gradient de dnaturation ou DGGE (pour Denaturing Gradient Gel
is) sont des outils qui permettent de discriminer des fragments dADN de taille
. La sparation des fragments est alors
base sur leurs diffrences de mobilit lectrophortique lorsquils sont mis migrer dans un gel
vertical de polyacrylamide contenant un gradient dagent dnaturant (i.e. entranant une
sparation des brins dADN) qui peut tre de la formamide et/ou de lure. Afin dviter une
te temprature de fusion, le GC clamp
comportant une succession de 40 GC, est associe lADN lors de lamplification. Les
variations de squences dans les zones faible temprature de fusion font que des squences
on dans des zones diffrentes du gradient dnaturant (Theron
. Une telle mthode permet dobtenir une image de la communaut microbienne
reprsente par des bandes aux intensits diffrentes. En effet, la comparaison de diffrents
crire la diversit de la population ainsi que sa structure, chaque
bande dun profil de restriction correspondant un phylotype (i.e. espce au sens molculaire)
diffrent et lintensit lumineuse des bandes permettant dobtenir une indication quant
(Moyer, Dobbs et al. 1994) (Fig. 30).
rophorse permettant lobtention dune empreinte molculaire dune
communaut microbienne par la technique DGGE. Chaque bande reprsente un phylotype diffrent et son intensit
n des avantages de cette mthode trs sensible est que les bandes individuelles dADN
peuvent ensuite tre excises du gel, ramplifies puis squences. Des variantes de la DGGE,
TGGE (Temperature Gradient Gel Electrophoresis) o la sparation des fragments
La TTGE (Temporal Temperature Gradient Gel Electrophoresis) o la migration des
fragments dADN se fait dans un gel possdant une concentration uniforme dagent dnaturant et
(Farnleitner, Kreuzinger et al.
Du monde microbien et des outils danalyse de sa diversit
90

PCR marqu Dnaturation
Profils SSCP
(Amplification
ADNr 16S)
Electrophorse capillaire
Dtecteurs Dtecteurs Dtecteurs
IV.2.2.3.2. Lanalyse de polymorphisme de conformation secondaire
La technique danalyse de polymorphisme de conformation dacides nucliques simple brin
ou SSCP (pour Single Strand Conformation Polymorphism), dveloppe pour dtecter des
mutations dans des gnes humains peut galement tre utilise en cologie microbienne (Hayashi
1991; Godon, Zumstein et al. 1997; Schwieger and Tebbe 1998; Zumstein, Moletta et al. 2000;
Godon, Duthoit et al. 2001). Aprs extraction des acides nucliques totaux et amplification par
PCR dune zone variable des ADNr 16S, ceux-ci vont tre dnaturs en ADN simple brin puis
vont faire lobjet dune migration par lectrophorse qui peut tre ralise sur un gel de
polyacrylamide ou par capillarit laide dun squenceur automatique. Dans ce dernier cas, la
PCR est dite marque par lutilisation dun fluorophore sur lune des deux amorces utilises.
Dans des conditions non-dnaturantes, la structure secondaire de lADN simple brin est affecte
par des interactions intramolculaires. La mobilit lectrophortique des ADN simple brin se
fera donc en fonction de leur masse molculaire et de leur structure secondaire (Fig. 31).








Figure 31 : Principe de la technique SSCP par lectrophorse capillaire.
De cette manire, une communaut microbienne sera reprsente par un profil de pics lorsque
llectrophorse est ralise par capillarit ou par un profil de bandes de la mme manire que
les techniques prcdemment cites lorsque llectrophorse est ralise sur gel. Chaque pic ou
bande correspond une squence et donc un phylotype. De plus, laire de chaque pic ou
lintensit lumineuse de chaque bande donne une indication sur labondance de chaque
espce au sein de la communaut.
La squence de lADNr 16S correspondant chaque pic ou bande peut galement tre
dtermine en comparant la distance de migration de squences pralablement isoles par
clonage la distance de migration du profil total. La technique de SSCP est par consquent
particulirement approprie pour effectuer des suivis de population au sein dun cosystme
comme nous le verrons de faon plus approfondie dans la suite de cette thse.
Du monde microbien et des outils danalyse de sa diversit
91

IV.2.2.3.3. Lanalyse de fragments de restriction terminaux
La technique danalyse de fragments de restriction terminaux ou T-RFLP (pour Terminal
Restriction Fragment Length Polymorphism) est une mthode qui a t dveloppe pour analyser
rapidement la diversit microbienne de diffrents environnements (Liu, Marsh et al. 1997;
Moeseneder, Arrieta et al. 1999; Lueders and Friedrich 2003). A partir dun extrait dacides
nucliques environnementaux, une PCR est ralise sur une rgion de lADNr 16S, en utilisant
une amorce marque en 5 par un fluorochrome. Aprs amplification, le produit PCR est digr
avec une ou plusieurs enzymes de restriction, gnrant des fragments de diverses longueurs selon
la squence de lADN et la spcificit de lenzyme. Seuls les fragments de restriction terminaux
marqus avec le fluorochrome seront visualiss et mesurs par un squenceur automatique
gnrant des profils assez semblables ceux obtenus par SSCP (Fig. 32).

Figure 32 : Empreinte molculaire dune communaut microbienne par la technique T-RFLP avec squenceur
automatique. Chaque pic reprsente un phylotype diffrent et lintensit de sa fluorescence permet dobtenir une
indication quant son abondance relative.
Lensemble de ces techniques dempreintes molculaires apparait comme un outil aux forts
potentiels pour ltude de la diversit microbienne dans un environnement donn et par l mme
damliorer nos connaissances et notre comprhension du lien diversit-fonctionnement des
cosystmes.



92







Du monde microbien comme modle dtude en cologie
93

V. V. V. V. DU DU DU DU MONDE MICROBIEN COMME MODLE DTUDE MONDE MICROBIEN COMME MODLE DTUDE MONDE MICROBIEN COMME MODLE DTUDE MONDE MICROBIEN COMME MODLE DTUDE
EN COLOGIE EN COLOGIE EN COLOGIE EN COLOGIE
Chaque crature vivante peut tre regarde comme un microcosme, un petit univers,
form dune lgion dorganismes se propageant par eux-mmes, inconcevablement petits
et aussi nombreux que les toiles dans le ciel
Charles Darwin.
V.1. La pertinence du monde microbien en cologie
Le dveloppement des outils danalyse de la diversit microbienne ont rcemment engendr
un intrt grandissant pour lutilisation de communauts microbiennes comme modles
biologiques pour la comprhension des cosystmes complexes et plus particulirement
concernant leur fonctionnement et leur stabilit (Jessup, Kassen et al. 2004). Nanmoins, il
convient de souligner ici que de nombreux cologues demeurent toujours sceptiques quant
lutilisation des communauts microbiennes pour la comprhension des cosystmes et que cette
dmarche demeure encore largement marginale. Ceci peut tre d au structuralisme des sciences
acadmiques qui a fait que durant de nombreuses annes, lcologie et la microbiologie
constituaient deux disciplines bien distinctes sans communications de connaissances de lune
vers lautre. Ainsi, durant tout le XX
ime
sicle, lcologie gnrale volua sans tenir compte des
tudes cologiques portant sur les microorganismes et lcologie microbienne demeura pendant
longtemps une sous-discipline de la microbiologie, isole de lcologie gnrale (Atlas and
Bartha 1998). Finalement, ce nest qu la fin du XX
ime
sicle que de vritables ponts furent
tablis entre les deux disciplines (Andrews 1991). Les critiques les plus couramment mises
contre lutilisation des microorganismes en cologie sont que ceux-ci prsentent une trop grande
simplicit et un manque de gnralit. Pour autant, cette simplicit peut constituer un indniable
atout pour mener des exprimentations qui soient plus informatives que les tudes faisant
intervenir des systmes plus complexes (Lawton 1995; Drake, Huxel et al. 1996). En effet,
comme nous lavons vu, les exprimentations sur des macroorganismes tels que les vgtaux ou
les animaux peuvent voir leurs rsultats difficiles interprter du fait de leffet de slection ou
dchantillonnage (cf. chapitre III.3.1.). De plus, les macroorganismes prsentent gnralement
des temps de gnration longs et contraignants notamment lorsquil sagit dtudier la stabilit
dun cosystme. Enfin, les travaux raliss sur des macroorganismes demandent gnralement
de grands espaces, typiquement lchelle de champs lorsquil sagit dtudes sur des
communauts vgtales, dans lesquels il est difficile de contrler les paramtres
environnementaux du milieu. Les microorganismes constituent une bonne alternative
lensemble de ces limitations. En effet, leur petite taille permet de travailler avec des millions

dindividus et des dizaines voire des centaines despces dans un volume trs restreint quil est
beaucoup plus facile de matriser en termes de paramtres abiotiques. Aussi, de plus
dtudes sont ralises en utilisant les microorganismes comme modle biologique pour rpondre
des questions dcologie gnrale. Ainsi peuvent tre cits les travaux de Kerr et al. sur la
coexistence de plusieurs espces en comptition sur un m
Ces auteurs, qui ont tudi la coexistence de trois souches d
lautre tant sensible cette toxine et la dernire y tant rsistante, ont mis en vidence
limportance de la structuration spatiale et des interactions locales dans le maintien de la
diversit. Dautres travaux ont galement t raliss sur la relation diversit
cosystmes et ont rvl une corrlation positive mme si les mcanismes s
sont encore mal dfinis (Bohannan and Lenski 2000; Travisano and Rainey 2000; Horner
Devine, Leibold et al. 2003).
Ainsi, lEcologie microbienne semble tre en mesure dapporter des lments de rponse
pertinents en Ecologie gnrale notamment par lassociation des outils danalyse molculaire de
la diversit microbienne avec les racteurs biologiques qui permettent la culture
microorganismes sur de longue
paramtres exprimentaux.
V.2. Les racteurs biologiques, des microcosmes sous contrle
V.2.1. Le principe des racteurs biologiques
Les racteurs biologiques sont des dispositifs permettant la croissance de micro
(Fig. 33). Ils constituent des microcosmes contrls dont les flux de matire lentre et la
sortie sont matriss.
Figure 33 : Schma dun racteur biologique.
Plusieurs composants peuvent tre distingus dans un racteur biologique
- Les substrats qui sont ncessaires la croissance des micro
entrant). En effet, pour soutenir la croissance, le milieu de culture contenu dans la chambre du
racteur doit contenir tous les lments ncessaires. En gnral, nombre de ces lments sont
ajouts en excs de manire ce quils ne limitent pas la croissance
Du monde microbien comme modle dtude en cologie
dindividus et des dizaines voire des centaines despces dans un volume trs restreint quil est
beaucoup plus facile de matriser en termes de paramtres abiotiques. Aussi, de plus
dtudes sont ralises en utilisant les microorganismes comme modle biologique pour rpondre
des questions dcologie gnrale. Ainsi peuvent tre cits les travaux de Kerr et al. sur la
coexistence de plusieurs espces en comptition sur un mme substrat (Kerr, Riley et al. 2002)
Ces auteurs, qui ont tudi la coexistence de trois souches dE. coli : lune produisant une toxine,
tant sensible cette toxine et la dernire y tant rsistante, ont mis en vidence
ce de la structuration spatiale et des interactions locales dans le maintien de la
diversit. Dautres travaux ont galement t raliss sur la relation diversit
cosystmes et ont rvl une corrlation positive mme si les mcanismes s
(Bohannan and Lenski 2000; Travisano and Rainey 2000; Horner
Ecologie microbienne semble tre en mesure dapporter des lments de rponse
pertinents en Ecologie gnrale notamment par lassociation des outils danalyse molculaire de
la diversit microbienne avec les racteurs biologiques qui permettent la culture
microorganismes sur de longues priodes de temps tout en assurant une trs bonne matrise des
V.2. Les racteurs biologiques, des microcosmes sous contrle
V.2.1. Le principe des racteurs biologiques
sont des dispositifs permettant la croissance de micro
Ils constituent des microcosmes contrls dont les flux de matire lentre et la
: Schma dun racteur biologique.
posants peuvent tre distingus dans un racteur biologique
Les substrats qui sont ncessaires la croissance des micro-organismes (flux de matire
entrant). En effet, pour soutenir la croissance, le milieu de culture contenu dans la chambre du
doit contenir tous les lments ncessaires. En gnral, nombre de ces lments sont
ajouts en excs de manire ce quils ne limitent pas la croissance.
comme modle dtude en cologie
94
dindividus et des dizaines voire des centaines despces dans un volume trs restreint quil est
beaucoup plus facile de matriser en termes de paramtres abiotiques. Aussi, de plus en plus
dtudes sont ralises en utilisant les microorganismes comme modle biologique pour rpondre
des questions dcologie gnrale. Ainsi peuvent tre cits les travaux de Kerr et al. sur la
(Kerr, Riley et al. 2002).
une produisant une toxine,
tant sensible cette toxine et la dernire y tant rsistante, ont mis en vidence
ce de la structuration spatiale et des interactions locales dans le maintien de la
diversit. Dautres travaux ont galement t raliss sur la relation diversit-productivit des
cosystmes et ont rvl une corrlation positive mme si les mcanismes sous-jacents ce lien
(Bohannan and Lenski 2000; Travisano and Rainey 2000; Horner-
Ecologie microbienne semble tre en mesure dapporter des lments de rponse
pertinents en Ecologie gnrale notamment par lassociation des outils danalyse molculaire de
la diversit microbienne avec les racteurs biologiques qui permettent la culture de
de temps tout en assurant une trs bonne matrise des
V.2. Les racteurs biologiques, des microcosmes sous contrle
sont des dispositifs permettant la croissance de micro-organismes
Ils constituent des microcosmes contrls dont les flux de matire lentre et la

posants peuvent tre distingus dans un racteur biologique :
organismes (flux de matire
entrant). En effet, pour soutenir la croissance, le milieu de culture contenu dans la chambre du
doit contenir tous les lments ncessaires. En gnral, nombre de ces lments sont
Du monde microbien comme modle dtude en cologie
95

- Les organismes sy dveloppant et pouvant tre de nature trs diffrente comme des
bactries, du phytoplancton, des champignons, des levures La majorit des procds
biologiques dvelopps lchelle industrielle utilisent des cultures microbiennes composes
dune seule espce de micro-organisme (culture pure). Concernant les procds de dpollution, il
sagit principalement de microorganismes issus dun cosystme complexe qui peut donc
compter jusqu plus dune centaine despces.
- Les produits des ractions biochimiques synthtiss par les micro-organismes. Ces
composs sont utiliss dans divers domaines de lindustrie : agro-alimentaire (huiles, fromage,
bires, vins), chimique (solvants, enzymes, colorants), pharmaceutique (antibiotiques,
hormones, vitamines) galement pour la production de bio-nergie (thanol, biogaz). Dans
les tudes cologiques, ces composs permettent de suivre lactivit des micro-organismes en
relation avec dautres paramtres tels que les conditions opratoires (temprature, pH) ou
encore les interactions liant les espces entre elles
- Les catalyseurs qui ne sont ni produits ni consomms au cours de la raction mais qui sont
ncessaires pour quelle puisse avoir lieu.
V.2.2. Le fonctionnement des racteurs biologiques
La chambre du racteur biologique o se dveloppent les micro-organismes est remplie par un
milieu de culture (flux de matire entrant) avec un dbit not Q
in
et se vide (flux de matire
sortant) avec un dbit not Q
out
. Ces deux dbits peuvent tre choisis par lexprimentateur ou
peuvent rsulter dune loi de contrle (auquel cas les valeurs des dbits dpendront de ltat du
systme). Trois grands modes dalimentation peuvent tre distingus.
V.2.2.1. Le fonctionnement discontinu des racteurs biologiques
En mode discontinu (ou batch ), le racteur biologique est ferm et garde un volume
constant en labsence dentre et de sortie de matire. Les espces sont introduites linstant
initial (inoculation) ainsi que les nutriments et les prcurseurs ncessaires. Lavantage de cette
approche est quelle limite la contamination par dautres micro-organismes et permet donc de
rester plus longtemps dans des conditions axniques.
Un inconvnient majeur est que les moyens daction sur de tels systmes sont limits. En
effet, labsence de renouvellement de la culture restreint les possibilits dchantillonnage
moins dutiliser des enceintes de trs grand volume qui savrent peu pratiques. De plus, les
substrats du milieu spuisant au cours du temps et engendrant des modifications physico-
chimiques, lidentification des causes de changement dmographique des espces prsentes est
rendue difficile.
Du monde microbien comme modle dtude en cologie
96

Nanmoins, du fait de sa simplicit, les racteurs biologiques en batch sont les plus utiliss
dans lindustrie notamment en vue de la production dun mtabolite ou de biomasse.
V.2.2.2. Le fonctionnement semi-discontinu des racteurs biologiques
De mme que dans le cadre des racteurs biologiques ferms (batch), la dure dune
exprience dans un racteur semi-continu est limite. En effet, la culture est ici alimente de son
volume de dpart V
0
jusqu son volume final V
f
linstant final t
f
. Ainsi, sil y a flux entrant de
matire dans les racteurs semi-continus, la sortie est nulle durant le temps de lexprience. Ce
mode de fonctionnement permet un meilleur contrle des conditions de croissance, le racteur
tant le plus souvent aliment par un dbit contrl en boucle ferme.
V.2.2.3. Le fonctionnement continu des racteurs biologiques
Le fonctionnement en continu des racteurs biologiques est le plus largement rpandu dans le
domaine de la dpollution biologique de leau. Caractris par un volume constant dans la
chambre du racteur, le soutirage de milieu ractionnel (flux de matire sortant) est rgl de
manire tre gal au flux dalimentation en matire nutritive. Ce mode de fonctionnement
laisse une grande latitude pour appliquer des techniques de contrle des procds. De plus, il est
possible de raliser des prlvements importants tout en limitant lutilisation de grands volumes
peu pratiques dun point de vue exprimental.
Les racteurs biologiques fonctionnant en rgime continu sont galement appels
chmostats dont le concepteur fut principalement Szilrd dans les annes 1950. En effet,
alors que Jacques Monod tudiait les cintiques de croissance dEscherichia coli sur un milieu
de culture contenant la fois du glucose et du lactose comme source carbone, Szilrd lui
suggra de fournir de manire continue les deux sucres la vitesse o les bactries les
consomment (Monod 1950). De cette manire, il pourrait savoir si l'utilisation de l'un des sucres
exclut l'utilisation de l'autre. C'est pour tester cette hypothse que Szilrd inventa le chmostat
dans lequel les concentrations de glucose et/ou de lactose peuvent tre maintenues constantes
(Novick and Szilard 1950).
Les racteurs biologiques en continu apparaissent comme des outils pertinents pour ltude de
la croissance des micro-organismes et de leurs interactions dautant plus que les ractions sy
produisant peuvent tre aisment modlisables.
V.3. La modlisation des systmes microbiens en chmostat
V.3.1. Limportance du schma ractionnel et du bilan de matire
Comme nous lavons vu, les chmostats sont des systmes relativement simples faits dun
flux de matires entrant, de microorganismes qui consomment le(s) substrat(s) lintrieur de la
Du monde microbien comme modle dtude en cologie
97

chambre et dun flux de matire sortant. Ainsi, la modlisation dun chmostat doit prendre en
considration deux lments : la partie physique dcrivant les flux de matire dus la circulation
du liquide, et la partie microbienne qui reprsente les processus biologiques ayant lieu
lintrieur du chmostat. Afin de garantir une certaine robustesse, le travail de modlisation dun
tel systme doit, au mme titre que tous les systmes physiques, respecter la loi de conservation
de la matire dicte par Lavoisier : Rien ne se perd, rien ne se cre, tout se transforme . Ceci
ncessite donc de bien considrer le schma ractionnel sur lequel le modle sera construit.
Le schma ractionnel dun systme biochimique est une manire synthtique de reprsenter
au niveau macroscopique lensemble des flux de matire parcourant le systme. Pour ce faire, un
formalisme semblable celui de la chimie est adopt en dfinissant simplement la transformation
de N
s
substrats S
i
entrant en N
p
produits P
i
sous la forme (Bastin and Dochain
1990) :


o Yi et Yi sont des coefficients stchiomtriques incluant les rendements. Par
convention, la vitesse laquelle la raction se ralise est dfinie par la vitesse de croissance de la
biomasse implique, biomasse qui constitue, dans le cadre dune raction biologique, un des
produits du systme.
Ainsi, un schma ractionnel est en fait une manire synthtique de rsumer au niveau
macroscopique un ensemble de ractions qui sont supposes dterminer la dynamique du
procd. A la diffrence de la chimie, tous les composs intervenant dans la raction ne sont pas
reprsents, il apparat en effet difficile de faire un bilan complet de tous les composs entrant
dans la composition du milieu de culture et ncessaires la croissance des microorganismes.
Aussi, le rseau ractionnel est donc le plus souvent fond sur des hypothses lies aux
connaissances phnomnologiques disponibles.
Le choix du nombre de ractions prendre en compte est trs important pour la pertinence du
travail de modlisation en fonction de la question que lon se pose, de lobjectif du modle ainsi
que des connaissances qualitatives et quantitatives dont on dispose sur le systme. En gnral,
trois types de situations peuvent tre distingus (Bernard 2004) :
- Le rseau ractionnel est parfaitement connu. Cest par exemple le cas de ractions
chimiques clairement identifies.
- Le rseau ractionnel est connu mais beaucoup trop compliqu par rapport aux mesures qui
peuvent tre ralises sur le systme.
- Le schma ractionnel est inconnu ou connu avec incertitude.
Du monde microbien comme modle dtude en cologie
98

Dans les deux derniers cas, il sera alors ncessaire didentifier un rseau ractionnel approch
qui synthtisera les principaux transferts de matire au sein du systme. La complexit retenue
impliquera en particulier un choix dans le nombre dlments chimiques et le nombre
d espces microbiennes considr. En gnral, ces espces sont une abstraction dans le
sens quelles reprsentent un agrgat ou communaut despces.
Ainsi, avant de commencer le travail de modlisation proprement parler, il est ncessaire de
bien penser le schma ractionnel qui va tre utilis tout en gardant lesprit les hypothses quil
induit.
V.3.2. La modlisation dune population microbienne dans un chmostat
V.3.2.1. La prsentation du modle propos par Monod
Cest Jacques Monod (1910-1976) que lon doit la premire modlisation dune population
microbienne dans un chmostat (Monod 1950).
Soit x(t) la biomasse totale en microorganismes et S(t) la concentration en substrat
linstant t , le modle de Monod, qui dcrit la dynamique de ces deux variables et qui est un
modle dterministe compos de deux quations diffrentielles, scrit de la faon suivante :


o (S) correspond au taux de croissance de la biomasse (dpendant du substrat), Y est le
coefficient de rendement de la biomasse, S
in
est la concentration de substrat entrant dans le
chemostat et D correspond au taux de dilution. On peut relever que ces quations
correspondent la modlisation dun systme proie-prdateur avec un taux de migration de
proies constant dans le systme.
D est galement appel le taux de renouvellement du milieu, il est donn par la relation :
D=Q/V o Q est le volume de milieu qui scoule dans et hors du racteur de culture par unit de
temps et V est le volume utile (i.e. volume occup par le milieu de culture) du racteur.
Y , le coefficient de rendement de la biomasse microbienne est suppos constant dans le
modle de Monod. Ce coefficient qui mesure la quantit de biomasse produite par unit de
substrat consomm, est donn par la dfinition suivante :



La vitesse de croissance de la biomasse est ici cense ne dpendre que du substrat limitant et
Monod a choisi la forme hyperbolique suivante :
Du monde microbien comme modle dtude en cologie
99




o
max
est la vitesse de croissance spcifique maximale, assimile une constante, et K
est la constante de demi-saturation pour la croissance qui traduit laffinit de la cellule pour le
substrat S . Cette fonction de croissance (S) est galement connue sous le nom de fonction
de Michaelis-Menten, introduite par ces deux auteurs au dbut du XX
ime
sicle pour reprsenter
une cintique enzymatique.
V.3.2.2. Les fonctions de croissance des microorganismes
La fonction de croissance dun organisme est un processus cl pour tout tre vivant.
Nanmoins, il semble que, mme pour des systmes extrmement simples, il nexiste pas une
fonction universelle permettant de dcrire correctement la consommation. Ainsi, si le modle de
Monod, qui utilise une fonction de croissance substrat-dpendante, savre particulirement bien
adapt la description de cultures monospcifiques sur des substrats simples, il prsente des
rsultats moins satisfaisants lorsquil sagit de dcrire les cintiques de plusieurs espces
bactriennes en croissance sur un substrat complexe. Il existe de trs nombreuses autres relations
algbriques qui ont t tablies pour dcrire les cintiques de croissance des microorganismes.
Certains modles tiennent compte de linfluence de la temprature, du pH, de la concentration en
co-mtabolite (Bailey and Ollis 1986; Dochain 1986; Bastin and Dochain 1990;
Stephanopoulos, Aristidou et al. 1998).
La fonction de croissance ratio-dpendante introduite par Contois en 1959 peut galement
constituer une alternative la fonction de croissance proie-dpendante de Monod. En effet,
Contois fut le premier suggrer que K ne soit pas une constante mais proportionnelle la
densit de population du consommateur (Contois 1959). Il sagit alors dun cas particulier dune
fonction de croissance qui dpend du ratio de substrat par organisme scrivant :
,




Plusieurs rsultats exprimentaux ont montr que le modle de Contois prsentait des rsultats
plus satisfaisants que le modle de Monod dans un contexte de cultures mixtes dans un milieu
contenant des substrats divers et varis (Jost 2000). Plusieurs hypothses peuvent tre avances
pour expliquer ces observations. Lune dentre elles est de considrer lexistence dune
htrognit locale du substrat au voisinage de la cellule conduisant une limitation de laccs
au substrat par la biomasse (Lobry and Harmand 2004). Il semble que ce soit cette premire
hypothse qui ait conduit Contois laborer sa fonction de croissance. En effet, dans son article
de 1959, Contois fait rfrence aux travaux de Pearl et Parker (1922), de Greenleaf (1926) ou
Du monde microbien comme modle dtude en cologie
100

encore de Bail (1929), qui se sont justement intresss linfluence de cette htrognit
spatiale (Pearl and Parker 1922; Greenleaf 1926; Bail 1929). Une seconde hypothse est
laccumulation dans le milieu de produits mtaboliques qui inhibent la croissance. De tels
phnomnes dinhibition, bien quils puissent tre dcrits de manire indirecte par la fonction de
Contois, ont fait lobjet dune modlisation plus particulire par lexpression de Haldane,
introduite dans le cas des ractions enzymatiques et reprise par Andrews dans le cas des
ractions biologiques (Andrews 1968) :


avec K
i
la constante dinhibition exprime en g/L.
Bien quil existe une grande quantit de fonctions de croissance diffrentes, la fonction de
Monod reste la plus utilise en microbiologie car les paramtres y intervenant sont relativement
faciles estimer par une approche exprimentale et analyser dun point de vue mathmatique.
V.3.2.3. Lanalyse du modle propos par Monod
Ltat stationnaire du systme propos par Monod est obtenu lorsque les quations du modle
sont nulles. Concernant la partie biologique, un tat stationnaire intervient donc quand :

0 soit lorsque x = 0 ou (S) = D


Le premier tat stationnaire implique donc que le chmostat soit vide de tout microorganisme.
En reprenant lquation du substrat, il est ais de constater qu cette tat stationnaire de la
biomasse correspond ltat en substrat suivant : D(Sin-S)=0 soit Sin=S. Ainsi, en labsence de
biomasse, il ny a pas de consommation de substrat, la concentration reste donc gale ce
quelle est lentre.
Le second tat stationnaire atteint pour (S)=D implique que la vitesse spcifique de
croissance des microorganismes sajuste de manire compenser le flux de sortie de la
biomasse. Ltat en substrat correspondant est dfini par :

soit


Ltat en biomasse correspondant ce second tat stationnaire est dfini, quant lui, par :

0 avec (S)=D do


Il ny a alors plus daccroissement de la biomasse en fonction du temps et la culture est
ltat dquilibre. Le chmostat est donc un moyen lgant dvaluer le taux de croissance dune
Du monde microbien comme modle dtude en cologie
101

espce en fonction de la concentration instantane en nutriment. En effet, il y a peu de chance de
se trouver ltat dquilibre au dbut de la mise en culture :
- Si <D au dbut de lexprimentation, la concentration cellulaire diminuera
progressivement dans le racteur. Dans ce cas, la concentration en nutriments dans le racteur va
augmenter ce qui va entraner une augmentation du taux de croissance jusqu sa valeur
maximale pour la concentration donne. Ainsi, va tendre se rapprocher de D .
- Si >D au dbut de lexprimentation, la concentration en substrat dans le racteur va
diminuer rapidement. Dans ce cas, la croissance va diminuer ce qui va engendrer une diminution
de jusqu galer une valeur proche de D .
- Enfin, si D est ajuste une valeur trs leve ou lgrement suprieure au maximum
de croissance possible pour lorganisme, alors la biomasse va diminuer jusqu son limination
totale dans le racteur.
V.3.3. La modlisation de plusieurs populations microbiennes dans un
chmostat
A partir du modle de Monod, il est possible de considrer un cas de comptition simple,
cest--dire de comptition entre deux populations ( x
1
et x
2
) pour un substrat limitant
unique (S), et exclusive, cest--dire o aucune autre interaction nest tablie entre ces deux
populations. Le systme dquations dcrivant une telle relation est alors le suivant :


avec
1
et
2
, Y
1
et Y
2
correspondant respectivement aux taux de croissance et aux
coefficients de rendement de x
1
et x
2
. Chacune des deux populations tant considre ici
avec une fonction de croissance de Monod soit avec un
max
et un K spcifique (
max1

et K
1
pour x
1
et
max2
; K
2
pour x
2
).
Un tel systme peut tre simplifi par lintroduction du paramtre J de la dimension dune
concentration et spcifique chaque population dfini par :

avec i=1 ou 2
Lanalyse mathmatique du comportement asymptotique du systme permet de dmontrer
quil existe deux quilibres possibles : le lessivage des deux populations et le lessivage dune
Du monde microbien comme modle dtude en cologie
102

seule des deux populations. En effet, si la concentration en substrat limitant dans le milieu de
culture est infrieure aux deux valeurs de J alors les deux populations sont lessives, sinon, la
population qui se maintiendra dans le systme sera celle qui prsente la valeur de J la plus
faible. Ainsi, par ce modle, le principe dexclusion comptitive mis en vidence par le modle
de Lotka-Volterra se vrifie de nouveau.
Il est noter que thoriquement, la coexistence des deux populations lquilibre est possible
si les deux populations ont des valeurs de J strictement gales et suprieures la valeur de la
concentration en substrat limitant dans le milieu de culture, soit lorsque :



Pour des valeurs fixes des paramtres
max
et K, le systme ci-dessus est une quation une
seule inconnue, le taux de dilution D .
- Si
max1
=
max2
et K
1
=K
2
, cest--dire si les deux populations de microorganismes ont
exactement les mmes paramtres du modle de Monod, alors lquation admet une infinit de
solutions pour D .
- Si
max1
>
max2
et K
1
>K
2
ou si
max1
<
max2
et K
1
<K
2
alors lquation nadmet aucune
solution et alors il ne peut y avoir coexistence (Fig. 34, I).
- Si
max1
<
max2
et K
1
>K
2
ou si
max1
>
max2
et K
1
<K
2
alors les deux courbes reprsentant les
deux populations par le modle de Monod se coupent en un point unique. Il existe alors une
unique valeur D* qui vrifie lquation (Fig. 34, II). Nanmoins, en pratique il est trs
difficile de maintenir un taux de dilution une valeur parfaitement constante. Aussi, ce dernier
cas de figure est-il pratiquement irralisable.


Figure 34 : Reprsentations des taux de croissance de deux populations en comptition pour un mme substrat
limitant suivant la modlisation de Monod. I. Evolution du taux de croissance en fonction du substrat quand

max1
>
max2
et K
1
>K
2
ou quand
max1
<
max2
et K
1
<K
2
. II. Evolution du taux de croissance en fonction du substrat
quand
max1
<
max2
et K
1
>K
2
ou quand
max1
>
max2
et K
1
<K
2
(Harder, Kuenen et al. 1977).
Des travaux exprimentaux ont confirm quil tait possible de faire pencher la comptition
au profit de lune ou de lautre des deux populations en fonction du taux de dilution (Meers
1971). En effet, Meers qui tudiait une culture en chmostat de Bacillus subtilis et de Candida
utilis avec du magnsium comme substrat limitant a pu modifier lissue de la comptition en
modifiant le taux de dilution. Par ailleurs, dautres auteurs sont parvenus faire coexister en
I II
Du monde microbien comme modle dtude en cologie
103

culture continue deux souches dEscherichia coli ayant des paramtres de Monod diffrents
(max et K) en choisissant une valeur du taux de dilution de manire ce que la valeur de J
1

soit gale celle de J
2
(Hansen and Hubbell 1980).
Comme nous lavons vu lors de ltude du modle de Lotka-Volterra, le principe dexclusion
comptitive est remis en question par les nombreuses observations de terrain qui font part de la
coexistence dun grand nombre despces sur un nombre limit de substrats conduisant
lexpression du paradoxe du plancton . Aussi, comme la propos Arditi, un moyen de
rconcilier les rsultats fournis par les modles avec les donnes exprimentales pourrait tre
dintroduire dans les modles de comptition les autres types dinteractions pouvant stablir
entre les populations tudies (Arditi, Michalski et al. 2005). Il sagirait donc de rendre compte
de la complexit du vivant au sein des cosystmes et non plus de considrer seulement le cas
dune comptition simple et exclusive entre deux espces. La reprsentation mathmatique de
ces interactions ncessite (i) de suivre simultanment la dynamique de plusieurs espces
assembles en une communaut et les fonctions cosystmiques exprimes (ii) de dterminer
qui fait quoi dans lcosystme parmi toutes ces espces assembles afin de pouvoir raliser
une modlisation structure de la communaut reposant sur un schma ractionnel pertinent.
Cependant, obtenir ces informations savre beaucoup moins vident dans le cadre du monde
microbien que dans celui des macrocosystmes. Cest ce quoi nous avons travaill durant
cette thse en nous appuyant sur ltude de bactries nitrifiantes en chmostat que nous
proposons daborder maintenant.



104









105


De ltude dun cosystme
microbien complexe : des
bactries nitrifiantes en
chmostat


O il sera question :



De la mise en place et du suivi de bactries nitrifiantes en
chmostat

De la dtermination du rle fonctionnel des diffrentes espces
prsentes dans un cosystme microbien complexe

De la modlisation du maillage dinteractions au sein despces
assembles dans un cosystme microbien complexe

De linfluence de perturbations biotiques sur la structure et le
fonctionnement de bactries nitrifiantes en chmostat

106




De la mise en place et du suivi de bactries nitrifiantes en chmostats
107

VI. VI. VI. VI. DE L DE L DE L DE LA MISE EN PLACE ET A MISE EN PLACE ET A MISE EN PLACE ET A MISE EN PLACE ET DU DU DU DU SUIVI DE BACTRIES SUIVI DE BACTRIES SUIVI DE BACTRIES SUIVI DE BACTRIES
NITRIFIANTES EN CHEMOSTAT NITRIFIANTES EN CHEMOSTAT NITRIFIANTES EN CHEMOSTAT NITRIFIANTES EN CHEMOSTAT
Lexprience est une connaissance empirique, cest--dire une connaissance qui
dtermine un objet par des perceptions. Elle est donc une synthse des perceptions qui
nest pas contenue elle-mme dans la perception
Emmanuel Kant.
Dans ce prsent chapitre, nous dtaillerons les caractristiques du dispositif exprimental mis
en place au cours de la thse ainsi que les mesures fonctionnelles et populationnelles ralises
sur les chemostats nitrifiants. Avant cela, nous synthtiserons les connaissances ncessaires la
comprhension de la raction biologique tudie. Nous prsenterons plus particulirement les
acteurs de cette raction que sont les bactries nitrifiantes et les fonctions quelles ralisent au
cours de la nitrification.
VI.1. La nitrification et les bactries nitrifiantes
VI.1.1. La nitrification
La nitrification est dfinie comme tant la conversion de composs azots rduits (organiques
ou inorganiques) en lments ioniques o lazote est dans un tat plus oxyd (Alexander,
Marshall et al. 1960). La nitrification sopre en deux tapes successives : une raction de
nitritation correspondant loxydation de lammonium en nitrite suivie dune raction de
nitratation correspondant loxydation du nitrite en nitrate (Fig. 35).
Figure 35 : Description des deux tapes successives de la raction de nitrification : la nitritation et la nitratation.
Tandis que 95% de lnergie libre au cours de la nitrification sont dissips sous forme de
chaleur, les 5% restants sont utiliss pour la synthse cellulaire des microorganismes ralisant la
raction (Schroeder 1985). Les ractions stchiomtriques pour chacune des deux tapes
ractionnelles sont les suivantes :
- Nitritation : 55 NH
4
+
+ 76 O
2
+ 109 HCO
3
-
C
5
H
7
NO
2
+ 54 NO
2
-
+ 57 H
2
O + 104 H
2
CO
3
.
- Nitratation : 400 NO
2
-
+ NH
4
+
+ 4H
2
CO
3
+ HCO
3
-
+ 195 O
2
C
5
H
7
NO
2
+ 3 H
2
O
+ 400 NO
3
-

NO
3
-

Nitrate
3
/
2
O
2
2 H
+
+ H
2
O O
2

Nitratation
NH
4
+

Ammonium
NO
2
-

Nitrite
Nitritation
De la mise en place et du suivi de bactries nitrifiantes en chmostats
108

Lquation globale dcrivant la nitrification est alors la suivante :
NH
4
+
+ 1,86 O
2
+ 1,98 HCO
3
-
0,021 C
5
H
7
NO
2
+ 0,98NO
3
-
+ 1,041 H
2
O + 1,88 H
2
CO
3

Loxydation d1 mg dazote ammoniacal ncessite 4,57 mg doxygne soit 3,42 mg dO
2
/mg
de N-NH
4
+
pour la nitritation et 1,14 mg dO
2
/mg de N-NO
2
-
pour la nitratation. Ainsi, la
raction de nitrification se caractrise par une consommation importante doxygne pour un
faible rendement en biomasse.
VI.1.2. Les bactries nitrifiantes
Deux types de nitrification peuvent tre distingus (Bock, Koops et al. 1991) :
- La nitrification lithotrophe caractrise par lutilisation de substrats inorganiques comme
source dnergie pour la croissance et qui concerne deux groupes de bactries spcialises dans
cette fonction.
- La nitrification htrotrophe ralise par divers groupes de bactries, de champignons et
quelques algues consistant en une cooxydation non couple une production dnergie.
VI.1.2.1. Les bactries nitrifiantes lithotrophes
Les bactries nitrifiantes lithotrophes se dcomposent en deux groupes :
- Les Bactries Oxydant lAmmonium en nitrite (ou AOB pour Ammonium Oxydizing
Bacteria), dites nitritantes et dont les noms de genres portent le prfixe nitroso .
- Les Bactries Oxydant le Nitrite en nitrate (ou NOB pour Nitrite Oxydizing Bacteria), dites
nitratantes et dont les noms de genres portent le prfixe nitro .
Il est noter quil nexiste pas dorganisme connu qui puisse compltement oxyder
lammonium en nitrate.
VI.1.2.1.1. La taxonomie des bactries nitrifiantes lithotrophes
Les bactries nitrifiantes lithotrophes sont de petite taille (de lordre du m) appartenant la
famille des Nitrobacteraceae (Watson, Bock et al. 1989). Les bactries peuvent avoir la forme de
baguette, de sphre, dellipse, de lobe et peuvent tre mobiles laide de flagelles.
Chacun des deux groupes de bactries nitrifiantes lithotrophes comporte plusieurs genres
(Bock, Koops et al. 1989). Le groupe des nitritantes runit les genres Nitrosomonas,
Nitrosococcus, Nitrosospira, Nitrosolobus et Nitrosovibrio. Le groupe des nitratantes runit les
genres Nitrobacter, Nitrospina, Nitrococcus et Nitrospira.
Cest en 1888 que Winogradsky a isol Nitrosomonas et Nitrobacter, bactries nitrifiantes les
plus importantes dans le sol (Winogradsky, 1888). Ces deux genres sont devenus des modles
pour ltude des procds nitrifiants et les bactries nitrifiantes les plus souvent cites dans la
De la mise en place et du suivi de bactries nitrifiantes en chmostats
109

littrature (Schroeder 1985). Depuis, la diversit et la taxonomie des bactries nitrifiantes ont t
largement tudies en utilisant les outils molculaires bass sur lADNr 16S et ce dautant plus
quelles reprsentent lun des rares groupes o il existe un lien phylognie-fonction (Bothe, Jost
et al. 2000; Kowalchuk, Stienstra et al. 2000). Toutes les bactries nitrifiantes lithotrophes font
partie des Protobactries, large groupe dont lanctre prsum est photosynthtique (Teske, Alm
et al. 1994). La famille des Nitrobacteraceae est polyphyltique puisque les genres la composant
se rpartissent parmi quatre des cinq subdivisions des Protobactries : alpha, beta, gamma et
delta (Fig. 36). Les espces nitritantes constituent un groupe li dans la subdivision beta
lexception dune espce du genre Nitrosococcus qui se trouve dans la subdivision gamma. Les
espces nitratantes se trouvent plus largement rparties dans les subdivisions alpha, gamma et
delta.

Figure 36 : Arbre phylogntique des espces nitrifiantes lithotrophes connues (Jetten, Logemann et al. 1997).
Lutilisation de sondes gniques pour lanalyse des communauts bactriennes dans les
stations dpuration fait apparatre que les nitritantes appartiennent au genre Nitrosomonas
(Nogueira, Melo et al. 2002; Persson, Wik et al. 2002) et seules quelques espces de
Nitrosospira ont t dtectes (Schramm, Debeer et al. 1998). Il est noter que la bactrie
Nitrosococcus mobilis retrouve galement dans les procds de traitement des eaux est mal
De la mise en place et du suivi de bactries nitrifiantes en chmostats
110

nomme et appartient en fait au genre Nitrosomonas (Juretschko, Timmermann et al. 1998;
Rowann, Moser et al. 2003). De manire similaire, les organismes nitratants dtects dans les
stations dpuration appartiennent essentiellement au genre Nitrospira mais le genre Nitrobacter
a galement t dtect (Daims, Nielsen et al. 2001; Wyffels, Boeckx et al. 2004).
VI.1.2.1.2. Le mtabolisme des bactries nitrifiantes lithotrophes
Les bactries nitrifiantes ont un mtabolisme autotrophe tirant leur nergie de loxydation de
lammonium ou du nitrite. Une grande quantit de lnergie gnre par loxydation de
lammonium ou du nitrite, environ 80%, est utilise pour gnrer du pouvoir rducteur
indispensable pour la fixation du CO
2
et seulement quelques pourcents sont utiliss pour la
croissance cellulaire, environ 2 11% chez Nitrobacter (Bock, Koops et al. 1986). Par
consquent et mme dans des conditions de culture optimales :
- Le taux de croissance spcifique des bactries nitrifiantes est faible et le temps de
gnration est trs long : de 7 24h pour les bactries nitritantes, de 10 140h pour les
nitratantes (Bock, Koops et al. 1991). Ceci explique que ces espces sont souvent malaises
isoler en culture pure car les contaminants se dveloppent plus rapidement en utilisant les traces
de matires organiques du milieu.
- Les rendements cellulaires sont faibles.
- A des taux levs doxydation dammonium et de nitrites sont associes de faibles
productions de biomasse et de faibles concentrations cellulaires.
VI.1.2.2. Les bactries nitrifiantes htrotrophes
La nitrification htrotrophe consiste en la production de nitrate partir de formes rduites,
organiques ou inorganiques, de lazote. Il sagit alors dune cooxydation non couple une
production dnergie et effectue par divers groupes taxonomiques de bactries, champignons et
mme par quelques algues (Kilham, 1986). Diffrentes voies biochimiques sont impliques dans
ce processus :
- Une voie inorganique suivant la raction : NH
4
+
NH
2
OH NOH NO
2
-
NO
3
-

- Une voie organique : RNH
2
RNHOH RNO RNO
2
NO
3
-

Aucune bactrie nitrifiante htrotrophe ne peut croitre autotrophiquement. Par rapport la
nitrification lithotrophique, seules de faibles quantits de nitrite et de nitrate sont formes, pour
autant, la nitrification htrotrophique ne doit pas tre nglige notamment si les conditions
environnementales sont telles quelles peuvent entraner une inhibition de la nitrification
autotrophe. Parmi les htrotrophes capables de nitrification, les champignons sont considrs
comme les plus nombreux et les plus efficaces et ont fait lobjet de plusieurs tudes plus
De la mise en place et du suivi de bactries nitrifiantes en chmostats
111

particulirement concernant Aspergillus flavus (Killham 1986). En milieu aquatique, la
nitrification htrotrophe est souvent le fait de bactries dnitrifiantes trs abondantes dans les
sdiments (Hall 1986). Loxydation du nitrite par des bactries htrotrophes comme
Arthrobacter, Bacillus, Pseudomonas (bactries prsentes dans les stations dpuration)
semble galement frquente sous des conditions nutritionnelles et doxydation convenables
(Sarkai, Ikehata et al. 1996). La nitrification htrotrophe ne peut tre value par des mesures
daccumulation de nitrite et nitrate car souvent une dnitrification a lieu simultanment. Les taux
de nitrification htrotrophe publis (gnralement 10
4
10
5
fois infrieurs la nitrification
autotrophe) sont donc vraisemblablement souvent sous-estims (Van Niel, Arts et al. 1993). Des
calculs de nitrification htrotrophe bass sur la disparition de lammonium ont rvl que ce
taux tait en fait de 102 103 fois infrieur par unit de biomasse (Kuenen and Robertson 1988).
Ainsi, dans les situations o les htrotrophes surnombrent abondamment les autotrophes,
comme dans les boues ou dans le sol, la part de nitrification due ces deux types de nitrifiants
peut tre comparable. Dans certaines conditions, comme un pH bas, un rapport C/N lev (i.e. >
10), ou de faibles concentrations en oxygne (< 25M), la nitrification htrotrophe pourrait
jouer un rle significatif par rapport la nitrification autotrophe (Van Niel, Arts et al. 1993).
VI.1.3. Les facteurs influant le processus de nitrification
VI.1.3.1. Le taux doxygne dissous
Loxygne dissous est utilis comme accepteur final dlectrons par les bactries nitrifiantes.
La constante de demi-saturation KO
2
est cependant faible pour les AOB comme pour les NOB ce
qui indique quil nest pas ncessaire de maintenir des concentrations en oxygne dissous leves
dans les systmes nitrifiants (Poduska and Andrews 1975; Sorensen and Jorgensen 1993). Les
constantes de demi-saturation font galement apparatre des diffrences daffinit importantes
pour loxygne suivant les espces. Ainsi, pour de faibles concentrations, Nitrobacter semble
prsenter une plus grande sensibilit puisque aucune oxydation nest observe en de de 0,2
mg.l
-1
ce qui se traduit par une accumulation de nitrite dans le milieu de culture (Painter 1970).
Ces rsultats sont confirms par les travaux dHanaki et al (1990) qui ont observ une
accumulation de nitrite et une augmentation du taux de croissance de Nitrosomonas pour des
concentrations en oxygne dissous denviron 0,5 mg.L
-1
(Hanaki, Wantawin et al. 1990).
Nitrobacter prsente donc une plus grande sensibilit des faibles concentrations doxygne
dissous que Nitrosomonas.
VI.1.3.2. Le pH
Le pH optimal donn dans la littrature pour la nitrification varie entre 7 et 9. La cintique de la
raction diminue avec la diminution du pH. En effet, le pH agit via lammoniac (NH
3
) et lacide
De la mise en place et du suivi de bactries nitrifiantes en chmostats
112

nitreux (HNO
2
) toxiques pour les micro-organismes nitrifiants et dont les concentrations sous
forme libre sont dpendantes du pH (Anthonisen, Loehr et al. 1976). Ainsi un pH lev, la
teneur en NH
3
est relativement importante du fait du dplacement de lquilibre NH
3
/NH
4
+
.
Inversement pH faible, la teneur en HNO
2
devient forte du fait du dplacement de lquilibre
NO
2
-
/HNO
2
. Des travaux ont permis dtablir des zones de concentrations limites supportables
par les micro-organismes pour les cultures en suspension (Fig. 37) (Anthonisen, Loehr et al.
1976).









Figure 37 : Zones dinhibitions des bactries nitrifiantes en fonction du pH (Daprs Anthonisen et al., 1976).
Il apparat que les Nitrobacter sont inhibes pour des taux allant de 0,1 1 mg de N-NH
3
.L
-1

tandis que les Nitrosomonas supportent de 10 jusqu 150 mg N-NH
3
.L
-1
. Les deux genres sont
totalement inactivs par des concentrations comprises entre 0,22 et 2,8 mg N-HNO
2
.L
-1
.
VI.1.3.3. La temprature
La temprature optimale de croissance de Nitrosomonas se situe entre 30 et 36C tandis que
celle de Nitrobacter se situe entre 28 et 36C (Knowles, Downing et al. 1965). Le taux de
croissance () et la constante daffinit pour le substrat (Ks) dpendent fortement de la
temprature. Entre 23 et 30C, le taux de croissance maximal est multipli par quatre pour
Nitrosomonas. Pour les deux espces, la vitesse maximale de croissance et laffinit pour le
substrat augmentent avec la temprature. Cependant, au-del de 20C, la vitesse maximale de
croissance de Nitrosomonas devient suprieure celle de Nitrobacter. La temprature influe
galement sur lquilibre NH
3
/NH
4
+
: pour une mme valeur de pH, la concentration en NH
3

libre est plus leve 35C qu 30C.
VI.2. La mise en place de chmostats nitrifiants
Au cours de la thse, des systmes nitrifiants ont t choisis comme sujets dtude car ceux-ci
font intervenir une biodiversit lisible (i.e. suffisante pour tre considre comme complexe

mais insuffisante pour saturer l
et les paramtres abiotiques linfluant sont relativement faciles matriser.
VI.2.1. Les caractristiques physiques des chmostats nitrifiants
Le dispositif exprimental mis en place
D, E) fonctionnant en continu ralisant le processus de nitrification
Figure 38 : Photo du dispositif exprimental comprenant cinq chmostats nitrification.
Les cinq chmostats exprimentaux prsentent une chambre dun volume utile de 6 litres dont
le contenu est maintenu temprature constante par le biais de bains thermostats. Chacun de
ces cinq chmostats est quip
- Dune pompe pristaltique (Bioblock
- Dune pompe pristaltique de soutirage permettant le maintien dun volume constant
- Dun pH-mtre commandant deux pompes pristaltiques
de baisse du pH en dessous de 7 et une pour a
dessus de 8.
- Dune pompe air (Bioblock, Montpellier) relie un bulleur plong au cur de la
chambre.
- Dun agitateur magntique permettant une bonne homognisation du milieu de culture
Les chmostats A et B (Fig. 38, gauche) sont des racteurs jumeaux car soumis exactement
aux mmes conditions environnementales et partageant la mme alimentation. Dans la suite de
notre tude, ils constitueront le cur du dispositif exprimental et feront lobjet dune
toute particulire. Le chmostat C (Fig. 38, au centre) est considr comme un racteur de
rserve dans la mesure o il ne sera pas tudi de manire approfondie. Il permettra nanmoins
de tenir disposition de la biomasse nitrifiante en cas de
racteurs A et B. Enfin, les racteurs E et F (Fig. 38, droite) feront offices de chmostats
tmoins. En effet, ceux-ci ne subiront pas de modifications des paramtres environnementaux,
A B
De la mise en place et du suivi de bactries nitrifiantes en chmostats
mais insuffisante pour saturer les mesures). De plus, la nitrification est un processus bien connu
linfluant sont relativement faciles matriser.
VI.2.1. Les caractristiques physiques des chmostats nitrifiants
Le dispositif exprimental mis en place consiste en cinq racteurs biologiques (nots A, B, C,
D, E) fonctionnant en continu ralisant le processus de nitrification (fig. 38
Photo du dispositif exprimental comprenant cinq chmostats nitrification.
Les cinq chmostats exprimentaux prsentent une chambre dun volume utile de 6 litres dont
le contenu est maintenu temprature constante par le biais de bains thermostats. Chacun de
ces cinq chmostats est quip :
Dune pompe pristaltique (Bioblock, Montpellier) dentre dalimentation
Dune pompe pristaltique de soutirage permettant le maintien dun volume constant
mtre commandant deux pompes pristaltiques : une pour addition de base en cas
de baisse du pH en dessous de 7 et une pour addition dacide en cas daugmentation du pH au
Dune pompe air (Bioblock, Montpellier) relie un bulleur plong au cur de la
Dun agitateur magntique permettant une bonne homognisation du milieu de culture
et B (Fig. 38, gauche) sont des racteurs jumeaux car soumis exactement
aux mmes conditions environnementales et partageant la mme alimentation. Dans la suite de
notre tude, ils constitueront le cur du dispositif exprimental et feront lobjet dune
toute particulire. Le chmostat C (Fig. 38, au centre) est considr comme un racteur de
rserve dans la mesure o il ne sera pas tudi de manire approfondie. Il permettra nanmoins
de tenir disposition de la biomasse nitrifiante en cas de problme, tel que les lessivages, des
racteurs A et B. Enfin, les racteurs E et F (Fig. 38, droite) feront offices de chmostats
ci ne subiront pas de modifications des paramtres environnementaux,
C D E
suivi de bactries nitrifiantes en chmostats
113
es mesures). De plus, la nitrification est un processus bien connu

VI.2.1. Les caractristiques physiques des chmostats nitrifiants
consiste en cinq racteurs biologiques (nots A, B, C,
. 38).






Les cinq chmostats exprimentaux prsentent une chambre dun volume utile de 6 litres dont
le contenu est maintenu temprature constante par le biais de bains thermostats. Chacun de
, Montpellier) dentre dalimentation.
Dune pompe pristaltique de soutirage permettant le maintien dun volume constant.
: une pour addition de base en cas
ddition dacide en cas daugmentation du pH au
Dune pompe air (Bioblock, Montpellier) relie un bulleur plong au cur de la
Dun agitateur magntique permettant une bonne homognisation du milieu de culture.
et B (Fig. 38, gauche) sont des racteurs jumeaux car soumis exactement
aux mmes conditions environnementales et partageant la mme alimentation. Dans la suite de
notre tude, ils constitueront le cur du dispositif exprimental et feront lobjet dune attention
toute particulire. Le chmostat C (Fig. 38, au centre) est considr comme un racteur de
rserve dans la mesure o il ne sera pas tudi de manire approfondie. Il permettra nanmoins
problme, tel que les lessivages, des
racteurs A et B. Enfin, les racteurs E et F (Fig. 38, droite) feront offices de chmostats
ci ne subiront pas de modifications des paramtres environnementaux,
Pompes rgulation pH
Racteur biologique
Bain thermostat
Rserves acide et base
pH-mtre
Pompes de soutirage
Pompes dalimentation

De la mise en place et du suivi de bactries nitrifiantes en chmostats
114

contrairement A et B, et permettront ainsi de comparer leffet de ces perturbations sur le
processus de nitrification ainsi que sur la dynamique des populations.
VI.2.2. Le milieu de culture des chmostats nitrifiants
Le milieu de culture utilis consiste en une solution synthtique minrale fortement charge en
azote ammoniacal avec des concentrations variant de 0,5 2 g N.L
-1
(Tableau 5 et 6).

Concentrations
(g.L
-1
)
CaCl
2
, 2 H
2
O
MgSO
4
, 7 H
2
O
FeCl
3
, 6 H
2
O
MnCl
2
, 4 H
2
O
ZnSO
4
, 7 H
2
O
CuCl
2
, 2 H
2
O
NaMoO
4
, 2 H
2
O
7,3400
30,3920
4,8000
1,0300
0,0200
0,1120
0,0025
Les diffrents composs du milieu sont dissous avec de leau dminralise dans des bidons
de 30 litres. La solution obtenue est tamponne par des bicarbonates afin de minimiser les
variations de pH ncessitant lajout dacide et de base et pouvant modifier le Temps de Sjour
Hydraulique. Les bidons dalimentation sont maintenus basse temprature dans des frigos do
seuls sortent les tuyaux qui assurent lacheminement dans les racteurs via les pompes dentres
dbit constant.
VI.2.3. Le choix du temps de sjour hydraulique
Le dbit de lalimentation (Q) ainsi que le volume utile (V
U
) des racteurs ont une influence
directe sur le Temps de Sjour Hydraulique (TSH) des micro-organismes. Le TSH (ou Temps de
sjour thorique, ou bien encore Temps de passage) est dfini comme la dure pendant laquelle
une bactrie va tre en contact du milieu de culture au sein du racteur avant dtre limine via
la pompe de soutirage. Le TSH sexprime en heures ou jours et correspond au rapport du volume
utile sur le dbit.
Le choix du TSH appliquer dans les racteurs savre particulirement important dans le
cadre dun procd. En effet, si on considre la communaut complexe prsente dans un racteur
comme une somme de populations indpendantes, les populations temps de croissance lent
seront lessives au profit des populations croissance rapide si le TSH est trop faible. Ce
phnomne est dautant plus rapide que lcart entre les taux de croissance est grand et le dbit
lev. Or dans la raction de nitrification, une telle diffrence de cintique existe entre les
espces ammoniaques oxydantes (relativement rapides) et les espces nitrites oxydantes (fort
lentes) comme nous le verrons par la suite. Ainsi, afin de ne pas risquer de lessiver trop


Concentrations
(par g N.L
-1
en
charge)
(NH
4
)
2
SO
4
(g.L
-1
)
K
2
HPO
4
(g.L
-1
)
Na
2
HPO
4
(g.L
-1
)
KHCO
3
(g.L
-1
)
Solution minrale (mL.L
-1
)
4,717
1,4
1,4
8
1
Tableau 5 : Composition de lalimentation des
racteurs nitrification
Tableau 6 : Composition de la solution minrale
De la mise en place et du suivi de bactries nitrifiantes en chmostats
115

rapidement les bactries nitratantes et permettre le droulement des deux tapes de la
nitrification, un TSH de huit jours a t mis en place pour chacun des cinq racteurs. Etant donn
que le volume utile (V
U
) est de 6 litres, cela se traduit par : TSH = V
U
/Q soit Q=V
U
/TSH soit Q =
6/8 soit la mise en place dun dbit de 0,75 L dalimentation par jour.
VI.2.4. Linoculation des chmostats nitrifiants
Afin dinoculer les chmostats du dispositif exprimental, des boues actives ont t
pralablement prleves dans un bassin de la station dpuration de Coursan (Aude, 11) qui traite
lazote par nitrification-dnitrification. Durant 10 mois, ces bactries ont t mises en culture
dans un racteur arobie biomasse libre aliment par leffluent synthtique minral une
charge en azote ammoniacal de 0,5 g N.L-1. Cette opration a eu pour but de slectionner et
denrichir la flore nitrifiante. La biomasse issue de ce premier racteur a ensuite t utilise pour
inoculer un racteur lit turbul inverse contenant de petites billes en verre servant de support de
croissance aux bactries. Le milieu de culture consistait toujours en la solution synthtique
minrale mais avec une charge en azote successivement amene 2 g.L
-1
. Cest la phase liquide
de ce dernier racteur qui a constitu linoculum de dpart de nos chmostats.
VI.3. Le suivi fonctionnel et populationnel des chmostats nitrifiants
VI.3.1. Le suivi fonctionnel des chmostats nitrifiants
Des analyses chimiques ont t ralises trois fois par TSH, soit environ tous les deux jours,
afin de suivre lvolution des deux tapes de la raction de nitrification au sein des chmostats.
Ces analyses ont consist en des dosages de la concentration : en azote ammoniacal prsent dans
lalimentation et rsiduel dans les racteurs ainsi que des nitrites, nitrates, phosphates, chlorures
et sulfates. Pour doser ces diffrents anions un chromatographe DIONEX DX 100 qui permet la
sparation des ions par chromatographie ionique a t utilis. Ce dernier est quip dune
membrane de suppression amliore par un systme dlectrolyse avec dgagement en sortie de
H
2
et dO
2
. La dtection se fait par conductimtrie.
Le chromatographe est quip dun passeur automatique dchantillons et dun ordinateur,
une interface permet de faire la liaison entre les trois systmes. Les colonnes utilises sont, dans
lordre de passage :
- NG 1, pour piger les matires organiques et ainsi limiter la contamination de la colonne.
- AG 12A (4 mm), qui constitue la pr-colonne.
- AS 12A (4mm), qui constitue la colonne.
La colonne et la pr-colonne sont constitues de rsines base de polymres de type
polystyrne qui sont sulfonates en surface et portent une couche de micro-billes poreuses de
De la mise en place et du suivi de bactries nitrifiantes en chmostats
116

latex fonctionnalis par des groupements amins (ammonium quaternaire). Les colonnes sont
suivies dune membrane de suppression de cations (ASRS Ultra). Lluant utilis est un mlange
carbonate-bicarbonate. Un tel systme permet donc dobtenir la concentration des diffrents
composs forms au cours de la nitrification et permettra ainsi de rendre compte de lactivit des
bactries nitrifiantes prsentes dans les chmostats.
VI.3.2. Le suivi populationnel des chmostats nitrifiants
Paralllement aux analyses chimiques, des analyses microbiologiques et de biologie
molculaire ont t menes afin de connatre au mieux les espces nitrifiantes prsentes dans les
chmostats ainsi que leur quantification relative. Les donnes issues des tudes molculaires ont
ensuite t analyses laide dun logiciel spcifiquement dvelopp cet effet.
VI.3.2.1. La quantification de la biomasse totale des chmostats
La quantification de la biomasse totale prsente dans les chmostats a t ralise par la
technique de mesure de la masse sche. Un volume (Ve) dchantillon liquide est prlev dans
chaque racteur avant dtre filtr sous vide travers une membrane, pralablement tare (P
1
),
faite en nitrate de cellulose et dune maille de 0,2m. La membrane est ensuite place dans une
capsule en porcelaine puis mise dans une tuve 105C durant 24h. A la sortie, la capsule est
refroidie dans un dessiccateur afin dassurer un retour temprature ambiante sans reprise
dhumidit par la membrane. Celle-ci est enfin pese (P
2
) et permet dobtenir lExtrait Sec Total
(EST) exprim en g.L
-1
selon la formule :


NB : Afin doptimiser la prcision de la mesure et de sassurer de mesurer au mieux la biomasse
totale, une EST est galement effectue rgulirement sur les alimentations des racteurs afin
dtre dduite des valeurs dEST obtenues partir des chantillons des racteurs.
VI.3.2.2. La dtermination des phylotypes composant la biomasse totale
La dtermination et la quantification des espces molculaires (ou phylotypes) composant la
biomasse totale met en jeux une srie dtapes : chantillonnage et conservation, extraction de
lADN, amplification par Polymrase Chain Reaction (PCR) et Single Strand Conformation
Polymorphism (SSCP).
VI.3.2.2.1. La mthode de prlvement et de conservation des chantillons
Trois fois par TSH, soit trois fois par semaine, 50 mL de milieu de culture ont t prlevs
dans chacun des chmostats avant dtre centrifugs 15 minutes 13 000 rpm. Tandis que les
surnageants sont prservs pour tre utiliss dans le cadre des mesures relatives la fonction de
De la mise en place et du suivi de bactries nitrifiantes en chmostats
117

nitrification, les culots sont repris dans une solution de guanidine thiocyanate qui permet la
dnaturation des protines et de N-lauryol sarcosine 10% utilis comme dtergent ionique
(Tableau 7).
Tableau 7 : Composition des solutions de conservation des prlvements issus des chmostats en vue de l'extraction
de l'ADN total.
Solution de guanidine Solution de Tris-Cl Solution de N-lauryol sarcosine
Guanidine thiocyanate : 472 g/L
Solution de Tris-Cl : 100 mL/L
Solution autoclaver
TrizmaHCl : 127 g/L
Trizmabase : 23,6 g/L
pH talonner 7,5
Eau autoclave
N-lauryol sarcosine
Solution ne pas autoclaver
La suspension ainsi obtenue est aliquote dans des tubes vis de 2 mL puis conserve -
20C.
VI.3.2.2.2. La mthode dextraction des ADN totaux
Le protocole dtaill de lextraction et purification des ADN totaux est donn dans Godon et
al. (1997). La lyse cellulaire est ralise par chauffage (70C durant 1 heure) puis par action
mcanique de micro-billes de zirconium dans un vibro-broyeur (10 min). Les inhibiteurs
damplification par PCR (notamment les acides humiques) sont limins par ajout de
PolyVynilPolyPyrrolidone (PVPP). LADN est ensuite prcipit par de lisopropanol puis purifi
sur micro-colonne du kit QIAamp (Quiagen). LADN ainsi extrait est conserv -20C. Une
estimation de la qualit et de la quantit dADN est effectue par lectrophorse sur gel
dagarose 0,7% - TBE 1X en prsence de bromure dthidium (BET) permettant la
visualisation de lADN sous UV. Le marqueur de taille Lambda DNA/Hin dIII est utilis comme
rfrence.
VI.3.2.2.3. Lamplification de la rgion V3 de lADNr 16S
Le principe de la Polymerase Chain Reaction (PCR) est utilis pour amplifier spcifiquement
un fragment dADN de 200 pb correspondant la rgion V3 du gne de lARN ribosomique 16S
(ADNr 16S). Pour ce faire, les amorces universelles bactriennes w49 et w104 (Tableau 8) ont
t slectionnes car situes dans des rgions conserves encadrant la zone V3.
Tableau 8 : Squences des amorces utilises pour l'amplification de l'ADN (F=Forward=sens ;
R=Reverse=antisens).
Noms des amorces Squences nuclotidiques Position dans E. coli
W49
W104 (marque)
5- ACGGTCCAGACTCCTACGGG - 3
5- TTACCGCGGCTGCTGGCAC 3
F330
R533
Lamorce w104 est marque par une molcule fluorescente son extrmit 5 afin de
permettre la dtection des brins dADN lors du passage en SSCP. Ces amorces sont associes
diffrents produits constituant le mix PCR (Tableau 9).

De la mise en place et du suivi de bactries nitrifiantes en chmostats
118

Tableau 9 : Constitution du mix PCR.
Produits PCR-SSCP
Enzyme polymrase
Eau ultrapure
Tampon 10X
dNTP 2,5 mM
Amorce sens w104 (100 ng.L
-1
)
Amorce antisens w49 (100 ng.L
-1
)
ADN extrait
Pfu Turbo 0,5 L 2,5 U.L
-1

36,9 L
5 L
4L
1,3L
1,3L
1 L
Le mix contenant lADN extrait est ensuite dpos dans de petits tubes eppendorf de 0,5mL
eux-mmes disposs dans un amplificateur dont les conditions opratoires sont pralablement
rgles (Tableau 10).
Tableau 10 : Conditions opratoires de la PCR-SSCP.
Etapes Tempratures Dures
Dnaturation initiale
Dnaturation
Hybridation
Elongation
Elongation finale
94C
94C
61C
72C
72C
2 min
30 s
30 s
30 s
10 min
Nombre total de cycles 25
Le bon droulement de lamplification est vrifi par une lectrophorse sur un gel
dagarose 2%. Les produits issus de la PCR sont conservs -20C avant SSCP.
VI.3.2.2.4. La discrimination par SSCP des brins dADN amplifis
La discrimination des brins dADN amplifis est ralise par SSCP. Avant analyse, les
fragments dADNr 16S, mlangs de la formamide (Applera) et un talon interne (400 HD-
rox, Applera), sont dnaturs par chauffage (5 min 95C) puis refroidis rapidement (10 min
dans de leau glace). Aprs cette renaturation soudaine, les fragments dADN simple brin
adoptent une conformation secondaire stable qui sera la base de leur discrimination par
lectrophorse capillaire. En effet, le temps de passage devant le dtecteur de la machine se
ralise en fonction de cette conformation. La dtection se fait grce au marquage fluorescent de
lamorce w104. Llectrophorse est ralise dans un squenceur automatique (Hitachi Applied
Biosystem 3130 Genetic Analyser) tandis que lanalyse des rsultats se fait avec le logiciel
GeneScan 3.1.
La SSCP fournit un profil lectrophortique o chaque pic correspond un phylotype. Laire
des pics observs reflte le niveau damplification de lADN des micro-organismes
correspondants. Lvaluation de laire de chaque pic par rapport laire totale du profil permet
destimer la proportion de la population microbienne correspondante (pic) au sein de la
communaut (profil). Un programme informatique a t labor sous Matlab 6.5 spcifiquement
De la mise en place et du suivi de bactries nitrifiantes en chmostats
119

pour dtecter et mesurer ces paramtres dans nos conditions exprimentales. Ainsi, par
recoupement des donnes issues de la quantification de la biomasse totale et de la SSCP, il nous
est possible de suivre la cintique de chaque espce prsente au sein de nos racteurs.
VI.4. La perturbation des chmostats nitrifiants
Aprs inoculation et conditions environnementales fixes, une communaut nitrifiante se
stabilise tant dun point de vue populationnel que fonctionnel dans chacun des chmostats. Une
fois cet quilibre macroscopique atteint (i.e. stabilisation des concentrations en nitrites,
nitrates ainsi que de la biomasse totale), des perturbations ont t appliques aux chmostats A et
B selon deux stratgies diffrentes : abiotique et biotique (Fig. 39).

Figure 39 : Schma reprsentant les diffrentes phases du protocole exprimental comprenant des perturbations
cibles ainsi que des perturbations globales biotiques et abiotiques.
VI.4.1. Les perturbations abiotiques des chmostats nitrifiants
Deux sessions de perturbations abiotiques ont t ralises durant la cintique exprimentale
qui a dur 525 jours. Celles-ci ont consist en des variations du dbit dalimentation, de la
concentration en azote ammoniacal en entre des chmostats, de la temprature, du temps de
sjour hydraulique.
VI.4.2. Les perturbations biotiques des chmostats nitrifiants
VI.4.2.1. La perturbation biotique globale des chmostats nitrifiants
A t = 121 (soit 121 jours aprs inoculation), une perturbation biotique globale a t applique
sur les deux chmostats exprimentaux A et B qui prsentaient alors une stabilit fonctionnelle et
populationnelle semblable. La perturbation a consist en lintroduction dune biomasse issue du
racteur de rserve C quantitativement proche (de lordre de 20 x 10
11
bactries) de celle
prsente dans A et B mais prsentant une diversit biologique fortement diffrente (Tableau 11).
De la mise en place et du suivi de bactries nitrifiantes en chmostats
120

Tableau 11 : Rcapitulatif des conditions environnementales, de la communaut installe ainsi que des fonctions
exprimes pour les chmostats A, B et C juste avant perturbation globale effectue t = 121 j.
Chmostat A Chmostat B Chmostat C

Environnement
TC = 30C
pH 7,00
S
in
= 1 g N.L
-1

TC = 30C
pH 7,00
S
in
= 1 g N.L
-1

TC = 30C
pH 8,00
S
in
= 1 g N.L
-1

Population






Fonction exprime Nitrite Nitrite Nitrite et nitrate
Au cours de cette perturbation biotique globale, 20% de la biomasse totale de chacun des
racteurs exprimentaux A et B ont t remplacs par une quantit quivalente de la biomasse du
racteur de rserve.
VI.4.2.2. La perturbation biotique cible des chmostats nitrifiants
A t=502 j, une perturbation cible des populations tablies a t ralise. Celle-ci a consist en
lintroduction dans les chmostats exprimentaux A et B dune biomasse de Nitrobacter
hamburgensis, bactrie nitratante.
A partir dun inoculum de N. hamburgensis aimablement fourni par le laboratoire dEcologie
microbienne de luniversit de Lyon 1 (Rhne-Alpes, 69) et maintenu dans un milieu mixotrophe
(i.e. qui permet aux microorganismes de subvenir aux besoins de leur mtabolisme par
photosynthse et par assimilation des composs organiques prsents), un repiquage t effectu
en conditions aseptiques dans trois erlenmeyers de 500 mL avec un milieu identique. Aprs une
priode de croissance dun mois, un nouveau repiquage a t ralis dans trois erlenmeyers de
1000 mL cette fois-ci dans un milieu autotrophe (Tableau 12).
Tableau 12 : Milieux de culture pour Nitrobacter (d'aprs Bock et al, 1983 ; Schimdt et al, 1973)


Solution Fer-EDTA
FeSO
4
, 7H
2
O
EDTA
H
2
O
77 mg
103 mg
qsp 50 mL
Milieu mixotrophe Milieu autotrophe
NaNO
2

Na
2
HPO
4

KH
2
PO
4

Solution Fer-EDTA
Solution A
Solution B
Extrait de levure
Bactopeptone
Pyruvate de sodium
H
2
O
1 g
5 g
0,5 g
5 mL
1 mL
10 mL
1,5 g
1,5 g
0,55 g
qsp 1000 mL
2 g
5 g
0,5 g
5 mL
1 mL
10 mL
-
-
-
qsp 1000 mL
De la mise en place et du suivi de bactries nitrifiantes en chmostats
121

Solution A
ZnSO4, 7 H2O
CuSO4, 5 H2O
Na2Mo4, 7H2O
H2O
2 mg
2 mg
2 mg
qsp 100 mL
Solution B
MgSO4, 7 H2O 0,2 %
De tels repiquages ont permis lobtention dune quantit de biomasse suffisamment importante
pour effectuer des perturbations biotiques significatives des communauts installes et
dacclimater la souche des conditions de croissance libre en milieu agit. Au cours de cette
perturbation, 10% de la biomasse totale de chacun des racteurs exprimentaux ont t
remplacs par une quantit quivalente de N. hamburgensis.
Un tel dispositif exprimental avec les mesures fonctionnelles et populationnelles ralises
permet de suivre simultanment la dynamique de plusieurs espces assembles en une
communaut et les fonctions cosystmiques exprimes. Ceci nous permettra de raliser une
modlisation structure de la communaut reposant sur un schma ractionnel pertinent et tenant
compte des interactions pouvant stablir entre les diffrentes espces assembles. Nanmoins,
avant cela, une tape importante est de parvenir dterminer le rle fonctionnel des diffrents
phylotypes qui ont pu tre dtects par SSCP.


122








De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
123

VII. VII. VII. VII. DE L DE L DE L DE LA DTERMINATION DU RLE FONCTIONNEL A DTERMINATION DU RLE FONCTIONNEL A DTERMINATION DU RLE FONCTIONNEL A DTERMINATION DU RLE FONCTIONNEL
DE DIFFRENTES ESPCES PRSENTES DANS UN DE DIFFRENTES ESPCES PRSENTES DANS UN DE DIFFRENTES ESPCES PRSENTES DANS UN DE DIFFRENTES ESPCES PRSENTES DANS UN
COSYSTME MICROBIEN COMPLEXE COSYSTME MICROBIEN COMPLEXE COSYSTME MICROBIEN COMPLEXE COSYSTME MICROBIEN COMPLEXE
La simplification du problme exprimental ne doit pas crer lillusion que les
phnomnes eux-mmes soient simplifis.
Jacques Monod.
VII.1. Rsum de la problmatique et de lapproche mise en uvre pour y
rpondre
Si les microorganismes peuvent constituer des modles biologiques pertinents pour rpondre
des questions dcologie gnrale notamment depuis lavnement des outils danalyse de la
diversit microbienne, une limitation majeure de leur utilisation est la difficult dterminer le
rle fonctionnel des diffrentes espces prsentes dans un cosystme microbien complexe. En
effet, une telle dtermination savre ncessaire pour procder une modlisation structure
dune communaut assemble tenant compte des interactions trophiques et non-trophiques
pouvant stablir entre les espces. Cette prise en compte de la diversit des interactions pourra
alors ventuellement permettre de rconcilier les rsultats thoriques avec les observations
exprimentales et ainsi de mieux comprendre le principe dexclusion comptitive et le paradoxe
du plancton et plus gnralement de mieux apprcier linfluence de la diversit sur le
fonctionnement et la stabilit des cosystmes. Pour rpondre cette problmatique, nous avons
labor une approche gnrique faisant intervenir des outils mathmatiques et les techniques
dempreinte molculaire en nous appuyant sur ltude des bactries nitrifiantes en chmostat.
En effet, le suivi fonctionnel et populationnel des deux chmostats nitrifiants A et B par des
analyses physico-chimiques frquentes a permis lobtention de la dynamique prcise de la
biomasse totale en microorganismes prsente dans chaque racteur ainsi que la dynamique de
chacun des composants intervenant au cours du processus de nitrification (i.e. azote rsiduel,
nitrite et nitrate). A partir de ces cintiques, un premier travail de modlisation a pu tre ralis.
Cette modlisation dite macroscopique , base sur le modle de Monod, a consist en
llaboration dun modle dynamique de type bilan de matire reprsentant la raction tudie
selon son schma ractionnel simplifi faisant intervenir autant de communauts microbiennes
fonctionnelles que de fonctions exprimes au niveau de lcosystme. Dans notre cas, un tel
modle dcrit donc loxydation de lazote ammoniacal en nitrite par la communaut des bactries
ammonium-oxydantes (AOB) et loxydation du nitrite en nitrate par la communaut des
bactries nitrite-oxydantes (NOB) dans des conditions o loxygne a t considr comme non
limitant. A partir de ce modle, un couple dobservateurs a pu tre synthtis permettant
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
124

destimer la concentration en biomasse de chacune des communauts microbiennes
fonctionnelles, concentrations quil nest pas possible dobtenir, ou de rares exceptions prs,
par des outils danalyses molculaires. En effet, les observateurs sont des outils
mathmatiques issus de la thorie des systmes dynamiques qui permettent destimer des
variables non-mesures partir de variables mesures. Le dveloppement dobservateurs ralis
au cours de cette thse pour gnrer les concentrations des diffrentes communauts
fonctionnelles en chmostat a fait lobjet dune valorisation par un article spcifique (cf.
Annexe). Paralllement, la technique dempreinte molculaire par SSCP a permis dobtenir la
dynamique des concentrations des diffrentes espces (au sens molculaire, ou phylotypes)
prsentes dans chacun des racteurs. Aussi, la question de la discrimination du rle fonctionnel
de ces phylotypes revenait chercher la combinaison des phylotypes dont la somme des
concentrations approxime le mieux la concentration en AOB gnre par lobservateur et dans le
mme temps, la combinaison des phylotypes dont la somme des concentrations approxime le
mieux la concentration estime en NOB. Plusieurs stratgies peuvent tre envisages pour
rsoudre ce problme de distribution statistique des phylotypes dans AOB et NOB. La plus
efficace aurait t de tester toutes les combinaisons possibles avec lensemble des phylotypes
dtects pour ne garder que la meilleure. Nanmoins, compte tenu du fait que 42 phylotypes ont
t dtects dans le chmostat A et 41 dans le chmostat B, cela reprsentait respectivement 2
42

et 2
41
combinaisons tester ce qui sest avr irralisable en termes de temps de calcul
ncessaire. Aussi, une stratgie de tirage alatoire dun nombre limit de phylotypes a t
ralise pour chaque chmostat sparment. Celle-ci a consist tirer au hasard 10 phylotypes
parmi tous ceux dtects dans un chmostat, tester toutes les combinaisons de distribution
possibles en AOB et NOB avec ces 10 phylotypes et au final ne garder que la meilleure
combinaison (i.e. celle approximant le mieux les concentrations en AOB et NOB au sens des
moindres carrs). Ce processus de tirage alatoire ayant t ralis un grand nombre de fois
(10 000 tirages soit 10 000 x 2
10
combinaisons testes au total), il sensuit que pour chaque
phylotype une probabilit dappartenir la communaut nitritante (AOB) et une probabilit
dappartenir la communaut nitratante (NOB) ont t obtenues. Les rsultats obtenus par cette
mthode mathmatique ont fait lobjet dune validation exprimentale puis dune valorisation par
lcriture dun article soumis Environmental Microbiology.




De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
125

VII.1. Toward functional molecular fingerprints



Maxime Dumont
1
, Jrme Harmand
12
, Alain Rapaport
2
, Jean-Jacques Godon
1


1
Laboratoire de Biotechnologie de lEnvironnement, INRA UR050, Avenue des Etangs,
Narbonne, France
2
INRA-INRIA MERE Research Team, UMR-ASB, 2 place Viala, Montpellier, France



Submitted to Environmental Microbiology











Corresponding author:
Maxime Dumont
Laboratoire de Biotechnologie de lEnvironnement
Avenue des Etangs
F-11100 Narbonne
France
Telephone number: +33 (0) 468 425 179
Facsimile number: +33 (0) 468 425 160
E-mail address: dumont@supagro.inra.fr
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
126

Abstract


One of the most important challenges in microbial ecology is to determine the ecological
function of dominant microbial populations in their environment. In this paper we propose a
generic method coupling fingerprinting and mathematical tools to achieve the functional
assigning of bacteria detected in microbial consortia. This approach was tested on a nitrification
bioprocess where two functions carried out by two different communities could be clearly
distinguished. The mathematical theory of observers of dynamical systems has been used to
design a dynamic estimator of the active biomass concentration of each functional community
from the available measurements on nitrifying performance. Then, the combination of
phylotypes obtained by fingerprinting that best approximated the estimated trajectories of each
functional biomass was selected through a random optimization method. By this way, a
nitritation or nitratation function was assigned to each phylotype detected in the ecosystem by
means of functional molecular fingerprints. The results obtained by this approach were
successfully compared to the information obtained from 16S rDNA identification. This original
approach can be used on any biosystem involving n successive cascading bioreactions performed
by n communities.









Keywords
Microbial ecology,
Functional assignation,
Nitrifying process,
Molecular fingerprinting,
Mathematical modeling,
Dynamic systems.
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
127

Introduction
In recent years, the use of molecular tools for a better understanding of microbial
communities has been steadily on the increase. Fingerprint pattern analysis, mostly based on 16S
rDNA sequences, appears to be one of the best established molecular tools in microbial ecology.
The fingerprints, obtained by several techniques such as Denaturing Gradient Gel
Electrophoresis (DGGE) or Single Strand Conformation Polymorphism (SSCP), can be
considered as giving an overall picture of the whole microbial ecosystem. In such pictures,
bacterial communities appear as discrete bands through DGGE or as discrete peaks through
SSCP, both of which emerge from the background signal. Progress in the analysis of molecular
fingerprints has enabled researchers to extract increasing amounts of information about microbial
ecosystems (Marzorati, Wittebolle et al. 2008). First, peaks or bands detected on these
fingerprints were used to estimate and analyse the species richness, structure and dynamics of
microbial communities (Muyzer and Smalla 1998; Loisel, Harmand et al. 2005). Secondly,
statistical analyses were carried out to determine the influence of environmental parameters on
microbial community structure (Fromin, Hamelin et al. 2002). Subsequently, the range-weighted
richness reflecting the carrying capacity of an ecosystem was determined (Marzorati, Wittebolle
et al. 2008). Recently, a newly-defined ecological index based on information given by
molecular fingerprinting has also been proposed for characterizing microbial ecosystems
(Marzorati, Wittebolle et al. 2008). Nevertheless, the information coded in the fingerprints have
not yet been exploited for possibly determining the ecological function(s) of dominant microbial
populations in their environment: in other words, who does what, which now represents one of
the most important challenges in microbial ecology.
In this paper, we present a new generic method, coupling molecular fingerprints and
mathematical tools, for allocating such functional roles to bacteria in their environment. To test
this original approach, we have conducted experiments on a nitrifying ecosystem in which two
functions (i.e. nitritation and nitratation) carried out by two specific microbial communities (the
Ammonium-Oxidizing Bacteria community for nitritation and the Nitrite-Oxidizing Bacteria
community for nitratation) could be clearly distinguished. Moreover, nitrifying bacteria present a
strong link between their phylogeny and biological functions, which enabled us to confront
results obtained by our mathematical method with the results given by 16S rDNA identification.




De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
128


Results
Applied strategy
The procedure applied in the present study is presented in Figure 40.

Figure 40: Theoretical scheme of the methodology used for functional community assigning of bacteria in their
environment using observers and molecular fingerprinting. (I) Bioreactions in a given microbial ecosystem (II)
Mathematical modeling of the bioreactions (III) Estimate of functional biomasses using a mathematical observer
(IV) Functional assigning of molecular species present in the microbial ecosystem.
First, in a given microbial ecosystem, bioreactions were described on the basis of
measurements of physical inputs (input substrate concentrations and flow rates) and outputs (the
substrate and the total biomass concentrations) (Fig. 40. I).
Secondly, thanks to an understanding of the bioreaction under consideration, a mass-balance
model of the system was built up (here, two reactions were studied, nitritation and nitratation,
each one carried out by a different microbial community: the AOB community for nitritation and
the NOB community for nitratation) that describes the time evolution of the concentrations of
each population (Fig. 40. II).
Thirdly, the establishment of this dynamical model has allowed us to design a dynamical
estimator based on the theory of observers. More precisely, the goal of an observer is to
reconstruct or estimate the unmeasured variables of the model from the knowledge of inputs and
online measurements of the system, which are here the biomass concentrations of each
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
129

functional community in the system (i.e., in the present case, the AOB and NOB concentrations)
(Fig. 40. III).
Finally, from the estimates of the functional biomasses delivered by the observer, along with
the dynamics of phylotype abundance revealed by molecular fingerprinting, functional assigning
for each phylotype was performed by way of an optimization method. Functional molecular
fingerprints were the final result of this approach (Fig. 40. IV).
This strategy was applied to data obtained from twin nitrifying chemostats (denoted A and B)
which were maintained for 525 days under disturbed environmental parameters.
Dynamics of nitritation and nitratation functions
Nitrification is a cascading bioreaction where two functions are involved: nitritation, consisting
in the oxidation of ammonium nitrogen into nitrites, and nitratation, the oxidation of nitrites into
nitrates. Due to regular disturbances such as changes in operating temperature, variations in input
substrate concentration, changes in the flow rate or biotic perturbations resulting from the
addition of biomass, these two functions were fulfilled differently throughout the experimental
period in the chemostats (Fig. 41).

Figure 41: Nitrifying performances in the two regularly disturbed chemostats A and B. Black continuous line with
diamond-shaped signs represents nitrite, dotted black line with round signs represents nitrates and dotted grey line
with triangular signs represents residual ammonium concentrations expressed in g N.L
-1
throughout the duration of
experiments (in days). Disturbances introduced during the kinetics in both reactors are indicated as follows: circle
with arrow represents increasing or decreasing flow rate, black arrow represents biotic disturbance, a black
triangular sign represents increasing or decreasing substrate concentration and black star represents a decreased in
operating temperature from 30C to 25C.
From their inoculation up to day 183, only nitrite production was performed with high
efficiency in both chemostats. A start of the nitratation function was obtained after modification
of the operating temperature from 30C to 25C on day 183. At this time, both chemostats
displayed differences in nitrifying performance. In chemostat A, nitrate production at first
followed the increase in input substrate concentration applied on day 198.
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
130

After this initial increase, however, nitrate production quickly decreased, its total collapse
leading to nitrite accumulation. In chemostat B, nitrate production seemed to be inhibited by the
increase of input substrate concentration but was maintained, in contrast to chemostat A. In
addition, the nitratation function in B followed the increase in input substrate concentration made
on day 198 and was lost only after a major increase in the flow rate introduced on day 337. After
restoration of this environmental parameter on day 372, the twin chemostats stopped showing
functional divergence. Effectively, the nitratation function reappeared in both chemostats,
maintaining high performance right to the end of the experimental procedure (day 525).
Dynamics of microbial communities estimated by the mathematical observer
In a nitrifying process, each effective function (i.e nitritation and nitratation) is carried out by
a specific microbial community. The nitritation reaction is done by Ammonium Oxidizing
Bacteria (AOB) whereas the nitratation reaction is done by Nitrite Oxidizing Bacteria (NOB).
The AOB and NOB concentrations, which best explain the nitrifying performances, were
estimated using dedicated observers as described in Dumont et al. (2008) (Refer to Experimental
procedures for details) taking into account the total biomass measurements (Fig. 42).

Figure 42: Evolution of functional communities and total biomass concentrations in both chemostats A and B. Grey
continuous line with round signs represents dynamics of total biomass obtained by measurements, dotted black line
with diamond-shaped signs represents active biomass of AOB community generated by observers, and dotted black
line with triangular signs represents active biomass of NOB communities generated by observers expressed in g.L
-1
.
Disturbances made during the kinetics in both reactors are indicated as described in figure 41.
Estimated active AOB and NOB biomass showed evolutions similar to those of nitrite and
nitrate concentrations, respectively. During the first period of the process, where only the
nitritation function was observed in both chemostats, the estimated AOB concentration displayed
equivalent values to total biomass measurements whereas the concentration of NOB appeared to
be nil. During the period when nitrates were produced, NOB biomass registered relatively weak
values in comparison to AOB biomass.

De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
131

Dynamics of phylotypes detected by molecular fingerprints
During the experiment, 42 phylotypes were detected in chemostat A whereas 41 were
detected in chemostat B, from 132 and 136 SSCP profiles, respectively (Fig. 43).

Figure 43: Relative abundance dynamics of the phylotypes detected by fingerprints. Disturbances created during the
kinetics in both reactors are indicated as described in figure 2. Molecular fingerprints in boxed insert corresponding
to samples from which 16S rDNA sequencing was carried out. The numbers under some peaks refer to
identifications obtained by the method presented in tables 13 and 14.
After inoculation, the same phylotype in chemostats A and B was dominant with high relative
abundance (70% of total biomass on average). For a short period of time, coexistence with
another dominant phylotype (the same in both chemostats) was observed in response to a
temporary break in the flow rate corresponding to the first disturbance (Fig. 43). The biotic
disturbance made on day 121, consisting in the addition of nitrifying biomass (AOB and NOB)
and which led to a light decrease in nitritation performance, had a major effect on the relative
abundance of the dominant phylotype in both chemostats. Whereas in chemostat A this
phylotype showed very responsive structural resilience, in chemostat B the phylotype continued
to decrease slowly but remained dominant despite its weak relative abundance (above 20% of
total biomass). Modification of the operating temperature from 30C to 25C on day 181 led to
the emergence from the background of another phylotype which decreased quickly, probably due
to the increase of the input substrate concentration on day 198. After this modification, the
microbial structures of chemostats A and B diverged. In chemostat A, the initial dominant
phylotype remained so, with high relative abundance; whereas in chemostat B, a marked
successive alternation of major phylotypes was observed. These differences in the dynamics of
microbial diversity might explain the differences in nitrification performance observed in both
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
132

chemostats at this time. After this period of divergence, both chemostats presented the same
structural pattern as after inoculation, with an important domination of the same phylotypes. This
domination was nevertheless upset after the last modification to input substrate concentration,
carried out on day 432, when coexistence between several major phylotypes was observed.
Finally, the second biotic disturbance, made on day 503 and consisting in the addition of NOB
biomass, engendered a switch in the major phylotype in both chemostats.
Statistical assigning of phylotypes to a functional community
The combination of phylotype concentrations detected by SSCP which best approximated the
estimated concentrations of functional communities were looked for by means of a random
optimization method. Thus, the probability for each phylotype of belonging to the nitritation or
the nitratation community was obtained and the phylotypes regrouped into three classes: AOB
community, NOB community or not determined (Table 13).























De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
133

Table 13: Statistical assigning of phylotypes to the AOB or the NOB community. Mean relative abundance was
calculated for each phylotype during its period (in days) of presence. Phylotypes highlighted in black represent the
AOB community, phylotypes highlighted in grey represent the NOB community and phylotypes highlighted in
white represent no AOB and no NOB functional community. Bold peak numbers with an asterisk refer to assigned
peaks (Figure 43 and Table 14).
Chemostat A Chemostat B
Peaks
Presence
along the
kinetic (%)
Relative abundance
(%)
Functional
assignation (%)
Presence along
the kinetic (%)
Relative abundance
(%)
Functional
assignation (%)
Mean Max AOB NOB
Mean Max AOB NOB
1 17 0.8 2.5 87 13 15 1.1 2.6 98 2
2* 32 1.4 6.3 14 86 24 0.9 2.2 43 57
3 14 1.2 2.9 34 66 13 1.0 3.4 72 28
4 - - - - - 27 1.2 4.5 90 10
5* 62 2.2 11.2 0 100 89 4.1 26.7 0 100
6 39 3.2 15.0 2 98 37 2.8 6.8 0 100
7 14 2.5 4.3 100 0 22 2.8 5.4 56 44
8 76 4.0 18.4 84 16 26 2.4 10.8 100 0
9* 27 2.4 5.8 34 66 42 2.1 7.7 26 74
10 18 2.8 9.1 95 5 20 1.7 4.7 6 94
11 20 2.4 12.7 100 0 14 1.7 6.9 52 48
12 23 4.3 8.4 99 1 9 3.1 8.5 100 0
13 34 3.4 11.8 12 88 92 2.5 7.5 1 99
14* 35 2.2 9.5 30 70 22 2.1 8.8 15 85
15 36 2.9 12.3 0 100 42 2.3 8.1 25 75
16 49 1.7 4.4 34 66 92 2.4 5.8 1 99
17 34 1.9 4.2 0 100 35 2.1 8.2 24 76
18 36 3.3 9.9 0 100 - - - - -
19* 18 1.8 4.1 0 100 29 1.5 3.3 21 79
20 21 1.7 3.4 6 94 35 1.5 4.6 82 18
21 45 1.7 6.1 1 99 22 1.4 3.5 45 55
22 25 1.0 2.0 0 100 36 1.8 6.6 0 100
23* 77 2.6 8.1 100 0 84 3.0 8.2 92 8
24 36 1.9 3.6 94 6 20 1.6 4.6 26 74
25* 64 3.2 11.3 95 5 92 3.4 18.1 90 10
26 38 2.4 4.6 4 96 20 1.6 4.0 100 0
27 19 7.2 11.8 14 86 42 6.5 23.2 40 60
28 48 2.9 7.4 92 8 36 2.9 13.3 98 2
29* 52 2.7 5.8 73 27 20 2.6 4.6 100 0
30* 18 4.4 11.5 6 94 78 2.6 10.3 9 91
31 27 1.8 4.6 6 94 30 2.6 13.2 20 80
32 62 3.0 17.5 2 98 58 2.4 6.4 0 100
33 49 4.0 36.4 90 10 99 5.0 49.0 100 0
34 10 2.5 6.9 45 55 - - - - -
35* 96 10.8 40.9 100 0 93 8.6 38.5 86 14
36 59 4.7 26.4 100 0 61 7.3 25.6 100 0
37* 100 5.6 37.3 100 0 98 5.0 27.9 100 0
38* 100 40.4 77.4 100 0 100 36.0 65.2 100 0
39 36 3.6 12.8 100 0 48 4.2 20.5 62 38
40 - - - - - 61 2.9 11.4 0 100
41 31 1.7 4.9 66 34 13 5.2 28.2 96 4
42 19 2.8 12.7 78 2 14 2.4 12.2 100 0
43 94 5.5 30.3 100 0 95 5.1 28.2 65 35
44 14 4.4 20.9 100 0 - - - - -
For chemostat A, functional community allocation was performed for 35 phylotypes.
Nineteen molecular species, representing around 65 % of total biomass, were regrouped in the
AOB community. These phylotypes were the major phylotypes detected in this chemostat, in
terms of maximum relative abundance and length of presence during the lifetime of the
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
134

experiments. Sixteen, representing around 26 %, were regrouped in the NOB community and
seven phylotypes, representing around 9 % of total biomass, were not assigned to either the AOB
or the NOB community.
The results obtained for chemostat B were similar to those obtained for chemostat A.
Functional allocation was performed for 33 phylotypes. Seventeen phylotypes representing
around 60 % of the total biomass were regrouped in the AOB community; sixteen representing
around 24 % were regrouped in the NOB community; and eight phylotypes representing around
15 % of total biomass were not assigned to either the AOB or the NOB community.
Molecular assigning of phylotypes to bacterial species
Assigning phylotypes detected by molecular fingerprinting to bacterial species was carried
out by the sequencing of 16S rDNA of clones coming from two samples: one from chemostat A
on day 153, the second from chemostat B on day 273 (Fig. 4). Thirteen phylotypes, observed in
both chemostats through their SSCP peak migration, were identified (Table 14).
Table 14: Results of 16S rDNA sequencing identification carried out for thirteen phylotypes present in both
chemostats and their functional assigning obtained by the mathematical approach. *, indicates the number of clones
identified under the same name in the database, compared to the total number of clones obtained for each peak.
Phylotypes highlighted in black represent the AOB community, phylotypes highlighted in grey represent the NOB
community and phylotypes highlighted in white represent no AOB and no NOB functional community.
N of
peaks
Chem-
ostat
Blast information Nitrification function
Phylogenetic Identification
% of
similarity
Accession
number
Clones*
From 16S
rDNA
From Observer
2
A Uncultured Nitrospirae sp.
-
90%
-
EF490095
-
1/1 NOB NOB
B - - ND
5
A -
Uncultured Nitrobacter sp.
-
100%
-
AM286398
- -
NOB
NOB
B 1/1 NOB
9
A Nitrobacter vulgaris
-
98%
-
EU041734
-
1/3 NOB ND
B - - NOB
11
A Bradyrhizobium sp.
-
99%
-
AB367691
-
1/1 ND
-
AOB
B - ND
14
A Uncultured Sphingomonas sp
-
100%
-
AB372255
-
1/1 ND
-
ND
B - NOB
19
A Cyanobacter
-
84%
-
EF150793
-
1/1 ND
-
NOB
B - NOB
23
A Bacteroidetes
-
93%
-
DQ167101
-
1/1 ND
-
AOB
B - AOB
25
A Uncultured Flexibacter sp.
-
97%
-
AB076886
-
4/5 ND
-
AOB
B - AOB
29
A Uncultured Flexibacter sp.
-
98%
-
AB076886
-
1/1 ND
-
AOB
B - AOB
30
A -
Bacteroidetes
-
97%
-
AJ318191
- -
ND
NOB
B 1/1 NOB
35
A Bacteroidetes
Bacteroidetes
97%
98%
EF179859
EF179859
1/1 ND
ND
AOB
B 1/1 AOB
37
A Variovorax paradoxus
-
98%
-
EF203908
-
1/1 ND
-
AOB
B - AOB
38
A Nitrosomonas eutropha
Nitrosomonas eutropha
100%
100%
CP000450
CP000450
2/3 AOB
AOB
AOB
B 3/4 AOB
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
135

These phylotypes represented 64% and 61.5% of the total fingerprint area in samples A and
B, respectively. Among these thirteen phylotypes, only four were clearly associated with a
nitrification function. One of the phylotypes was identified as a Nitrosomonas sp. (Table 14:
peak number 13) corresponding to an autotrophic nitritation species (AOB community) and three
were identified as autotophic nitratation species (NOB community): a Nitrospirae sp. and two
Nitrobacter sp.
Comparison between statistical and molecular assigning
The results given by 16S rDNA sequencing for these phylotypes are in accordance with the
results obtained by our mathematical technique (Table 14). Nitrosomonas was assigned to the
AOB community with a probability of 100% in both chemostats whereas Nitrospirae and the
two Nitrobacter were assigned to the NOB community with a probability of 86%, 100% and
66% in chemostat A and 57%, 100% and 74% in chemostat B, respectively.
Nine other phylotypes identified by 16S rDNA appeared to be heterotrophic bacteria but their
function in the nitrifying ecosystem was not ascertained. So mathematical functional assigning
obtained by our approach cannot be compared to 16S rDNA for these heterotrophic bacteria.
Discussion
The functional assigning of molecular fingerprints was obtained with the help of dedicated
mathematical observers. This method required only the results of functional measurements along
with the dynamics of the microbial community obtained by molecular fingerprinting. This
method was tested on a nitrifying microbial community where two functions performed by two
different communities could be clearly distinguished. Taking into account the link for nitrifying
bacteria between phylogeny and biological function, the results obtained by our mathematical
approach were confronted with those obtained by 16S rDNA identification. These results can be
assessed at different levels.
At the community level, the results showed on average a total relative abundance of 65% and
60% for AOB and of 26 and 24% for NOB, in chemostats A and B respectively (Table 13).
These results appear to be in the same range for each community, generally estimated at 2/3
1/3 for AOB and NOB respectively, in the nitrogen removal process (Li, Irvin et al. 2007).
At the phylotype level, a nitrifying ecosystem was chosen due to the strong link between
phylogeny and biological functions which characterizes nitrifying bacteria (Purkhold,
Pommerening-Roser et al. 2000) and which has permitted an experimental validation of our
mathematical approach. Despite this assertion, only four of the phylotypes could be assigned
unambiguously to a functional group by 16S rRNA gene sequence analysis and the same results
were obtained for them using our mathematical approaches. This small number of phylotypes
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
136

clearly associated with a nitrification function highlights the limitations of this standard
molecular method in addressing the question of who does what, even in such a favorable case
as nitrification. The four assigned bacteria: a Nitrosomonas (AOB), a Nitrospirae and two
Nitrobacter (NOB) were those most often cited in the bibliography concerning nitrification
bioprocess (Schroeder 1985). The dynamics of these phylotypes throughout the 523 days
corresponded to the dynamics of functional measurements. Effectively, the phylotype identified
as a Nitrospirae (Table 14: peak number 2) showed maximal abundance in both chemostats just
after the modification of operating temperature, corresponding to the start of nitrate production.
In the same way, the first identified Nitrobacter (table 14: peak number 5) displayed high
maximum relative abundance, with 11.2% in chemostat A and 26.7% in chemostat B, maxima
which were reached during the final period when environmental parameters corresponded to a
stabilization of nitrate production in both chemostats. The other phylotype can be
phylogenetically identified by sequencing but cannot be related to functional groups, as previous
studies have already shown (Egli, Langer et al. 2003; Bougard, Bernet et al. 2006). These
undetermined phylotypes can be considered as AOB, NOB or associated with either AOB or
NOB. The example of peak number 35 (Table 14), which had been identified as a Bacteroidetes
sp., is interesting (Fig. 43.). This phylotype grew after the first environmental modification
(when the flow rate was temporarily stopped) and replaced as dominant the phylotype identified
as Nitrosomonas sp. (AOB) without any consequences on nitrite production. Bacteroides were
never found as AOB whereas our mathematical approach predicted that this phylotype belongs to
an AOB community with a 100% probability. Nevertheless, different strains of bacteria such as
Pseudomonas, Bacillus, Diaphorobacter, Alcaligenes, Tiosphaera, Comamonas were already
identified as heterotrophic AOB (Su, Yeh et al. 2006; Lin, Kong et al. 2007; Ahmad, Xu et al.
2008; Hayatsu, Tago et al. 2008). These bacteria have the same capability for degrading nitrogen
as autotrophic AOB (Kim, Park et al. 2005). In the same way, heterotrophic NOB were also
described (Kardenavis, Kapley et al. 2007).
Another assumption to explain the results obtained for these heterotrophic bacteria is to
consider that these different phylotypes have no nitrification function but were in close
interaction with the AOB or NOB phylotypes. That is why, in the present study, it seems to be
more appropriate to talk about functional community assigning rather than functional assigning.
Effectively, through the mathematical method presented here, we cannot determine exactly who
does what (i.e. functional assigning), corresponding to which species performed nitrite or nitrate
production. Nevertheless, we can determine who is involved in what (i.e. functional
community assigning), or, in other words, which species interact to perform a given function in
the ecosystem. Moreover, molecular techniques can be coupled advantageously with our
mathematical approach. Effectively, these techniques, such as cloning-sequencing used here to
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
137

valid the results or Stable Isotope Probing (SIP) make it possible to determine who does what
in an ecosystem whereas our method, enabled us to determine who is involved in what. So,
coupling both approaches can be used to determine which species interact to perform a given
function in an ecosystem and, among these species, which are directly active in a given function.
Functional community assigning by mathematical approach could be applied to many other
microbial ecosystems but this method, coupling mathematical observers and various molecular
fingerprints, nevertheless shows certain limitations. The first is the requirement of clearly-
defined functions which can be measured by chemical, enzymatic, physical, mechanical or other
means. The second limitation is due to molecular fingerprint saturation. In high diversity
ecosystems, sequence co-migrations arise. These co-migration events make molecular
fingerprinting useless for ascertaining the dynamics of the phylotypes detected (Loisel, Harmand
et al. 2005; Jossi, Fromin et al. 2006).
The main advantage of functional community assigning is that mathematical observers are
independent of the kinetics of the process (e.g. growth rate, temperature). These types of
mathematical observers have proved to be suitable for various biological processes (Alcaraz-
Gonzalez, Salazar-Pena et al. 2005). Another interesting advantage of this technique, compared
to standard fitting methods such as the least-square one, is to obtain a filtering of the data. The
estimation is provided recursively with time, guaranteeing that the estimation error converges
toward zero, despite measurement noise or some uncertainties on the model. This leads to good
robustness properties.
Moreover, only direct functional measurements and yield coefficients, which can be quite
easily evaluated from experiments or from the literature, are needed to generate the active
biomass of each functional community using these observers.
The other advantage of this approach is the possibility it gives of assigning an observed
function to a known or unknown phylotype directly within a complex microbial community.
Moreover, such assigning of functions in situ can be carried out for given environmental
parameters or for biotic interactions. In microbial ecology, such assigning opens the door to
interactive models and, thus, to a better understanding of the links between structural diversity
and ecosystem functioning. In ecosystem engineering, it could be used to control the
optimization of bioprocesses by testing different environmental conditions or assembled
communities.
Thus, this approach can easily be used for all bioprocesses which function on a general mass-
balance model of n successive cascading bioreactions carried out by n communities (i.e. in which
the product of the i
th
reaction is the substrate of the i+1
th
reaction). Such processes include
anaerobic digestion, cheese ecosystems, wastewater treatment, digestive tract activity...etc.
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
138

Experimental procedures
Bioreactor conditions and macroscopic measurements
The experimental set-up consisted of two continuously-mixed 6.5 L (working volume) all-
glass chemostats inoculated beforehand with activated sludge from the municipal sewage
treatment plant at Coursan (Aude, France). Both chemostats (A and B) were operated in strictly
identical conditions over two years. Air flowrate was maximum to ensure good fluidization and
provide enough oxygen for the nitrification process whereas pH was measured and maintained
around 7 by the automatic addition of an alkaline solution. Chemostats A and B were fueled by
the same synthetic mineral medium composed of ammonium sulfate (with concentration varying
from 0.5 to 2 g.L
-1
) as the nitrogen source and a mineral solution.
The total biomass was measured by calculating the weight of 50 mL of sample after drying
24h at 105C, minus the weight of the synthetic medium dried under the same conditions and the
weights of nitrite and nitrate.
Chemical analysis consisted of off-line quantification of residual ammonium, nitrites and nitrates
by an ion chromatography system (Dionex 100) using conductivity detection.
Sampling and extraction of total genomic DNA
Twenty milliliter samples were collected from the middle of each chemostat three times per
hydraulic retention time. The samples were centrifuged at 13,000 rpm (10 min, 20C).
Supernatants were collected for chemical analysis whereas pellets were re-suspended in 1 mL of
4 M guanidine thiocyanate Tris-HCl 0.1 M at pH 7.5 and 300 L of 10% N-lauroyl sarcosine.
Aliquots of 500 L were placed in 2 mL screw-cap microcentrifuge tubes and stored at -20C
before DNA extraction. The extraction and purification of total genomic DNA were performed
with the Qiagen DNA stool mini kit, following the manufacturers instructions.
SSCP analysis and 16S rDNA identification
For SSCP analysis, a short fragment (200 bp) of the V3 region of the 16S rDNA gene was
PCR amplified using the universal bacterial primers W49 (ACGGTCCAGACTCCTACGGG)
and 6-FAM labelled W104 (TTACCGCGGCTGCTGGCAC) (Eurogentec, Belgium), and Pfu
Turbo DNA polymerase (Stratagene, Holland), as described by Wery et al. (2008). SSCP
capillary electrophoresis with an ABI 3100 genetic analyzer (Applied Biosystems) was done
using the protocol described by Wery et al. (2008). SSCP raw data were exported into the easy-
to-handle csv format using the Chromagna shareware (developed by Dr. Mark J. Miller at the US
National Institute of Health) and statistics were performed using SAFUM (Zemb et al., 2007)
and the Matlab 6.5 software (MathWorks). The dynamics of each phylotype were obtained from
the kinetics of molecular fingerprints using SAFUM (Zemb, Haegeman et al. 2007). Using the
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
139

internal SSCP standard (Rox), this open-source program first aligns all the fingerprints of the
kinetics. Then it calculates the area under each peak for each fingerprint. The total area generated
by the signal is normalized to 1 so that the relative abundance of a peak can be compared from
one fingerprint to another and in this way the dynamics of the abundance of each peak (i.e.
phylotype) can be obtained. Finally, the proportion of the background (i.e. difference between
total area and area of all peaks) was subtracted from the total biomass measurement; then the
abundance of each peak was multiplied by the total biomass remaining in order to obtain the
dynamics of the concentration of each phylotype. Identification of bacterial peaks revealed on
the SSCP profiles was obtained as described in Dabert et al. (2001). Each sequence was
identified by correlation to the closest species in the sequence database (Genbank), using the
BLAST algorithm. (Dabert, Sialve et al. 2001; Dumont, Rapaport et al. 2008; Wery, Bru-Adam et al. 2008)
Mathematics tools
Macroscopic model used
Bioreactions were considered as dynamic systems with defined inputs (flow rate, substrate
concentrations) and outputs (concentrations of reaction components). From such a systemic
point of view, a macroscopic mass-balance model can be developed as follows:


where: X
A
and X
B
represent the concentrations of AOB and NOB, S
in
, S
1
, S
2
and S
3
are
respectively the ammonium input, residual ammonium, nitrites and nitrates measured
concentrations, Y
A
and Y
B
are the yield coefficients of AOB and NOB,
A
and
B
are the growth
rates of AOB and NOB, D is the dilution rate (ratio of the input flow rate and the volume).
Design of the observers
The macroscopic model used can generate AOB and NOB concentrations from functional
measurements (S
in
, S
1
, S
2
and S
3
) but requires unknown bioreaction kinetics,
A
and
B
. To
counter this drawback, a new system called an observer was designed based on the
macroscopic model in order to estimate X
A
and X
B
without prior knowledge of the growth rates

A
and
B
.
[1]
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
140

An observer (Bastin and Dochain 1990) is a mathematical entity originating from the theory
of dynamical systems. In the present case, it was built up using the macroscopic mass-balance
model [1]. We used the mass invariance property of the model [1] in considering the following
changes of variables:

and


The derivatives of these new variables permit to obtain the two independent following
systems:

and


From these two systems, two independent observers can be derive which guarantees the
convergence of the estimation: that lim

0 and lim

0. These two
observers use the available inputs S
1
and S
2
to obtain

and

estimates X
A
and X
B

independently of
A
and
B
as follows:

and


and


Indeed, it can be shown that

and

converge toward X
A
and X
B
. Because of this
property, such systems were called observer or sometime software sensor. In addition,
taking advantage that we measure the total biomass: X
T
=X
A
+X
B
, the robustness and the
performance of these observers can be improved in coupling them in the following way:


where: G
1
and G
2
are tuning parameters (See Dumont et al., 2008 for more details).
Optimization procedure
The final step in the procedure consisted in an optimization procedure to find the combination
of phylotypes detected by SSCP which best explained the biomass trajectories generated by the
observer. The total number of possible combinaisons of assignments being too high to test all of
them, instead a random selection method has been used. A random lot of 10 phylotypes was
taken from the total number of detected phylotypes and this sampling process was repeated
10,000 times. This proportion was chosen after a preliminary study had shown such values were
sufficient to approximate the functional community without any loss of information and, also,
because random optimization with these values appeared to be feasible in terms of computer
De la dtermination du rle fonctionnel de diffrentes espces prsentes dans un cosystme microbien complexe
141

calculation time. For each random lot, the combination of these 10 molecular species, which best
approximated the active biomass of the functional communities, enabled us to assign them to
either the NOB or the AOB community. After 10,000 repetitions of random selection of lots of
10 phylotypes, the probability of each phylotype belonging to the AOB or the NOB community
was ascertained. A statistical analysis of these probabilities in the form of a K mean analysis
(XLSTAT) was carried out to obtain the three functional assignation groups: AOB community,
NOB community, not determined.
Acknowledgements
The authors gratefully acknowledge the help of, Nicolas Bernet, Valrie Bru, Bart Haegeman,
Jrme Hamelin, Claude Lobry and Frank Poly whose support that made this study possible.



142









De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
143

VIII. VIII. VIII. VIII. DE DE DE DE LA MODLISATION D LA MODLISATION D LA MODLISATION D LA MODLISATION DU MAILLAGE U MAILLAGE U MAILLAGE U MAILLAGE
D D D DINTERACTIONS INTERACTIONS INTERACTIONS INTERACTIONS ENTRE ENTRE ENTRE ENTRE LES ESPCES LES ESPCES LES ESPCES LES ESPCES PRSENT PRSENT PRSENT PRSENTES ES ES ES
DANS UN COSYSTME DANS UN COSYSTME DANS UN COSYSTME DANS UN COSYSTME MICROBIEN MICROBIEN MICROBIEN MICROBIEN COMPLEXE COMPLEXE COMPLEXE COMPLEXE
Les composantes essentielles dune communaut ne sont pas les individus mais les
relations qui existent entre eux.
Arnold Toynbee.
VIII.1. Rsum de la problmatique et de lapproche mise en uvre pour y
rpondre
Le principe dexclusion comptitive stipule que, lquilibre et pour des conditions
environnementales fixes, le nombre despces pouvant coexister dans un milieu donn ne peut
dpasser le nombre de substrats limitants. Ce principe a t mis en vidence la fois par la
modlisation de relations proies-prdateurs en cologie gnrale (modle de Lotka-Volterra) et
par la modlisation des cosystmes microbiens en chmostats (modle de Monod). Nanmoins,
ce principe est largement remis en question par les observations exprimentales ainsi que par les
observations en milieu naturel faisant part de la coexistence dun grand nombre despces,
suprieur au nombre de substrats limitants disponibles ce qui a conduit lexpression du
paradoxe du plancton .
Afin de rconcilier les rsultats thoriques avec les phnomnes observs, une grande varit
de nouveaux modles de chmostats a t propose consistant gnralement en lincorporation
de fluctuations dans les paramtres environnementaux et notamment dans la concentration en
flux de matire entrant dans le systme. De tels modles, sils permettent dexpliquer la
coexistence de plusieurs espces, modifient donc les proprits idales des chmostats stipulant
que le flux de matire entrant est constant au cours du temps. Peu dtudes se sont intresses
la possibilit que les interactions non-trophiques, telles que le mutualisme ou la facilitation,
puissent tre un moteur de la coexistence dans le cadre des proprits idales du chmostat.
Au cours de la thse, nous avons labor un modle bas sur les quations de Monod
intgrant toutes les interactions (i.e. trophiques et non-trophiques, inter et intra-spcifiques)
pouvant stablir entre diffrentes espces assembles dans une communaut. Ce travail a t
ralis en sappuyant sur les donnes issues du suivi des chmostats nitrifiants en considrant
quatre espces dont les fonctions dans lcosystme ont t pralablement tablies par notre
approche mathmatique et valides par des outils molculaires. Ainsi, la modlisation des
interactions a concern une communaut constitue de deux populations de bactries nitritantes
et de deux populations de bactries nitratantes soit 2+2 espces coexistant sur 1+1
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
144

substrats limitants. Il sagit l, notre connaissance, de la premire tentative visant confronter
des donnes exprimentales issues dempreintes molculaires aux simulations dlivres par un
modle de type bilan de matire comprenant davantage de biomasses que de fonctions
exprimes. La comparaison des sorties du modle de chmostat classique sans et avec la
considration des interactions biotiques vis--vis des donnes fonctionnelles et populationnelles
mesures a permis de mettre en vidence que les interactions pouvant stablir entre les espces
peuvent expliquer la coexistence de plus despces que le nombre de substrats limitants
identifis. En effet, tandis que le modle sans interactions ne permet pas, ou alors trs
ponctuellement, la coexistence des deux populations nitritantes dune part et des deux
populations nitratantes dautre part comme cela a t observ, le modle avec interactions
prsente une trs bonne corrlation avec les donnes mesures. De plus, il apparat galement
que les fonctions exprimes par lcosystme considr (i.e. la nitritation et la nitratation dans
notre modle dtude) sont fortement influences par le rseau dinteractions biotiques. En effet,
tandis que le modle sans interactions gnre la production de nitrite uniquement et donc
prvoyait lexpression dune seule des deux fonctions possibles, le modle avec interactions
gnre la production de nitrite et de nitrate prsentant ainsi une bonne capacit de prdiction
lorsque compar aux donnes mesures. Enfin, ce travail de modlisation a conduit lobtention
dun rseau virtuel dinteractions permettant de mieux comprendre les relations entre les quatre
espces considres. Ce rseau virtuel prsente une majorit dinteractions positives. Il apparat
notamment que les deux espces nitritantes entretiennent une relation mutualiste et de facilitation
chacune envers les deux espces nitratantes. Ces dernires prsentent une relation bilatrale de
sens oppos entre elles et chacune des deux espces nitratantes entretient une relation positive
avec lune des espces nitritantes et ngative avec lautre de faon inverse. En ce qui concerne
les interactions intra-spcifiques, les quatre espces prsentent une forte densit-dpendance
ngative lexception dune des deux espces nitratantes prsentant une forte densit-
dpendance positive.
Cette modlisation des interactions pouvant stablir entre diffrentes espces assembles
dans une communaut fait lobjet dun travail de publication, en cours, afin dtre soumise dans
Journal of Microbial Ecology.



De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
145

VIII.2. Coexistence in a nitrifying chemostat: a model of microbial
interaction



Maxime Dumont
1
, Jean-Jacques Godon
1
, Roger Arditi
2
, Jrme Harmand
13






1
Laboratoire de Biotechnologie de lEnvironnement, INRA UR050, Avenue des Etangs,
Narbonne, France
2
Ecologie des Populations et Communauts, AgroParisTech, Paris, France
3
INRA-INRIA MERE Research Team, UMR-ASB, 2 place Viala, Montpellier, France



In preparation to submission to Microbial Ecology







Corresponding author:
Maxime Dumont
Laboratoire de Biotechnologie de lEnvironnement
Avenue des Etangs
F-11100 Narbonne
France
Telephone number: +33 (0) 468 425 179
Facsimile number: +33 (0) 468 425 160
E-mail address: dumont@supagro.inra.fr
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
146

ABSTRACT

For several species in competition for a single substrate, the well-known competitive
exclusion principle states that no more than one species can be present at steady state in a
chemostat. However, this theoretical principle is very often given the lie by experimental and
natural observations where numerous species live together. To bridge the gap between
mathematical theory and observed phenomena, a variety of mathematical models has been
developed over the last decades. Nevertheless, for the most part, these models have explained
coexistence by variations in abiotic parameters over time while biotic interactions have been
largely ignored. Moreover, the few studies which have concerned biotic interactions have often
remained purely theoretical and seldom been confronted with real data. In the present study, we
have developed a model of classic chemostat taking into account inter- and intra-species
microbial interaction. The model was then optimized on the basis of functional and population
data obtained from a nitrifying chemostat operated over two years in fluctuating environmental
conditions. Comparison of the optimization obtained for the model with and without interactions
shows that interactions can lead to the coexistence of two ammonium-oxidizing bacteria and two
nitrite-oxidizing bacteria in competition for ammonium and nitrite respectively. Additionally, not
only coexistence but also ecosystem functions might be strongly mediated by the network of
microbial interactions. Effectively, only one (nitritation) of the two functions (nitritation and
nitratation) carried out by the nitrifying chemostat was performed by the virtual nitrifying
community considered in the model without interactions whereas both were performed with the
interaction model. Finally, the virtual network of interactions we obtained is also discussed.

Keywords
Competitive exclusion
Microbial interactions
Nitrifying bacteria
Coexistence
Chemostat model
Ecosystem functions

De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
147

INTRODUCTION
The well-known competitive exclusion principle stipulates that, at equilibrium, the number
of coexisting competing species cannot exceed the number of growth-limiting resources
available to them (Lotka and Volterra). However, in naturally systems, the number of coexisting
species frequently exceeds the number of limiting resources. This phenomenon is often called
the paradox of the plankton (Schippers, Verschoor et al. 2001).
Several mathematical models have been developed to describe the effect of competitive
exclusion on the coexistence of different species and, thus, on species diversity in natural
ecosystems and chemostat-type bioreactors (Saikaly and Oerther 2003; Sree Hari Rao and
Raja Sekhara Rao 2005). Theoretical and experimental studies of a chemostat with time-constant
operating conditions have shown that two microbial populations in competition for a single
substrate cannot coexist. The slower-growing species in the given operating conditions will be
washed out. In such a case, coexistence is predicted theoretically for discrete values of the
chemostat dilution rate only when the curves of species specific growth rates as a function of a
limiting nutrient concentration intersect. The dilution rate must have exactly the value at which
the specific growth rates of the two populations in the chemostat are identical. However, this
type of coexistence is structurally unstable and cannot be obtained in practice because of random
fluctuations in the chemostat dilution rate. To bridge the gap between mathematical theory and
observed phenomena in chemostats and in nature, a variety of mathematical models has been
developed over the last decades. In all such models, the idealized assumptions chemostat have
been modified (Hebeler, Schmidt et al. 2006). Some studies rely upon nonequilibrium conditions
to promote species diversity by preventing competitive equilibrium. One such example is the
variability in resource supply ratios. When nutrients were supplied to the chemostat in pulses,
oscillations in the abundance of species prevented competitive equilibrium from occurring and
permitted the coexistence of a greater number of species that the number of growth-limiting
resources (Sommer 1985; Huisman and Weissing 2000). In the same way, some studies explain
coexistence in chemostat by variation of solids retention times (Saikaly and Oerther 2003). But
only a very limited number of studies have pointed out that other microbial interactions than
competition can also lead to steady-state coexistence. The potential significance of non-trophic
interactions such as facilitation and biotic disturbance has been largely overlooked by the food
web scientific community (Berlow, Neutel et al. 2004).
In this paper, we present a modification of the classic model of a chemostat taking into
account biotic interactions which can occur between species in a microbial community (i.e.
which represent inter- and intra-species interactions). This model was compared to data recorded
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
148

from a nitrifying chemostat operated over two years with variable inputs. Nitrification is an
aerobic two-step microbial process in which ammonium is oxidized to nitrate by two distinct
groups of chemolithoautotrophic bacteria. Aerobic ammonium-oxidizing bacteria (AOB), such
as Nitrosospira and Nitrosomonas, oxidize ammonium to nitrite, and aerobic nitrite-oxidizing
bacteria (NOB), such as Nitrospira and Nitrobacter, oxidize the nitrite further to nitrate (Bock
and Wagner 2001; Koops and Pommerening-Rser 2001). During the two year period of the
experiment, two kinds of measurement were made: functional (i.e. residual ammonium, nitrite
and nitrate measurements) and populational (i.e. total biomass measurements and determination
by Single Strand Conformation Polymorphism of the abundance of bacteria present in the
chemostat). Using an original mathematical approach, a functional community assignation (i.e.
in AOB or NOB community) was performed for each phylotype detected in the chemostat
(Dumont, Rapaport et al. 2008). The model of microbial interaction was optimized on the basis
of the two most abundant phylotypes of each functional community. In this way, we obtained a
network of virtual interactions linking the four different species present in the nitrifying
community. Moreover, this web of interactions can prevent competitive exclusion and explains
the coexistence of the phylotypes as observed in the nitrifying chemostat. In addition, not only
coexistence but also ecosystem functions is strongly mediated by the microbial interactions web.
METHODS
Nitrifying chemostat conditions
The experimental set-up consisted of a continuously-mixed 6.5 L (working volume) all-glass
chemostat inoculated beforehand with activated sludge from the municipal sewage treatment
plant of Coursan (Aude, France), operated over two years. The air flow-rate was maximum to
ensure good fluidization and provide enough oxygen for the nitrification process. pH was
monitored and maintained around 7 by the automatic addition of an alkaline solution. The
chemostat was fueled by a synthetic mineral medium composed of ammonium sulfate as the
nitrogen source (with a concentration varying from 0.5 to 2 g.L
-1
) and a mineral solution.
Nitrifying performance measurements
Functional measurements were carried out by chemical analyze consisting of off-line
quantification of residual ammonium, nitrites and nitrates using an ion chromatography system
(Dionex 100) based on the detection of conductivity.
Microbial community measurements
During the experiment, two kinds of population measurement were made. The first consisted
in determinating the total biomass present in the chemostat by calculating the weight of 50 mL of
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
149

sample after drying 24h at 105C, minus the weight of the synthetic medium dried under the
same conditions and minus the weight of nitrite and nitrate. The second kind of population
measurement determinated the abundance of the different species contained in the total biomass
by Single Strand Conformation Polymorphism (SSCP). Twenty millimeter samples were
collected from the middle of the chemostat three times per hydraulic retention time. The samples
were centrifuged at 13,000 rpm (10 min, 20C). Supernatants were collected for chemical
analysis whereas pellets were re-suspended in 1 mL of 4 M guanidine thiocyanate Tris-HCl 0.1
M at pH 7.5 and 300 L of 10% N-lauroyl sarcosine. Aliquots of 500 L were placed in 2 mL
screw-cap microcentrifuge tubes and stored at -20C before DNA extraction. The extraction and
purification of total genomic DNA were performed with the Qiagen DNA stool mini kit,
following the manufacturers instructions. For SSCP analysis, a short fragment (200 bp) of the
V3 region of the 16S rDNA gene was PCR-amplified using the universal bacterial primers W49
(ACGGTCCAGACTCCTACGGG) and 6-FAM labelled W104
(TTACCGCGGCTGCTGGCAC) (Eurogentec, Belgium), and Pfu Turbo DNA polymerase
(Stratagene, Holland), as described by Wery et al. (2008). SSCP capillary electrophoresis with
an ABI 3100 genetic analyzer (Applied Biosystems) was done using the protocol described by
Wery et al. (2008). SSCP raw data were exported into the easy-to-handle csv format using the
Chromagna shareware (developed by Dr. Mark J. Miller at the US National Institute of Health)
and statistics were performed using the Matlab 6.5 software (MathWorks).
Model development
The model developed in this study is based on mass balance equations for a conventional,
completely-mixed chemostat derived from the pioneer work of Monod, Novick and Szilard and
given by the following set of differential equations (Monod 1950; Novick and Szilard 1950) :

where S and X represent the concentrations of nutrient (or substrate) and biomass. S
in
denotes the
concentration of nutrient in the input flow, and D the dilution rate. The function (S) is the
growth rate of the population (for instance a Monod function). The yield factor of the reaction is
kept equal to one, as this can be done using a suitable choice of units. One can easily check that
the concentrations of substrate and biomass at equilibrium are either (Sin, 0), in which case the
chemostat is said to be washed out, or the equilibrium (S*, S*
in
-S*) that fulfills (S*)=D*.
This standard dynamic model of chemostat can easily be adapted to a nitrifying bioprocess, as
follows:
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
150


With



where X
A
and X
B
represent the concentrations of AOB and NOB respectively. This nitrifying
chemostat model can be modified to consider microbial interactions between two AOB and two
NOB, as follows:

; 1,2

; 3,4


where
ij
represents the influence of the species j on the growth rate of species i. This influence
can be positive, negative or nil according to the sign and the value of
ij
. In this model, the
interactions are assumed to be constant for the abundance of a given species j. The growth of a
phylotype is made possible even in the absence of substrate, reflecting the possible use of cell
rubbish as resource. Notice that if
ij
=0 ;
1
=
2
=
A
;
3
=
4
=
B
and X
1
(0)+X
2
(0)=X
A
(0) ;
X
3
(0)+X
4
(0)=X
B
(0) it is exactly the standard dynamical model of nitrifying reaction in
chemostat.
Optimization of the model on the experimental data
A generic method coupling universal fingerprinting and mathematical tools was performed on
the phylotypes detected by SSCP to achieve a functional assigning of these phylotypes to one of
the two nitrifying functions (Dumont et al., submitted). Finally, the microbial interactions model
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
151

mentioned below was optimized on the kinetic of the two more abundant species (in term of
concentration and time of presence along the two years experiments) of each functional
community. Thus, two phylotypes in competition for the same substrate was studied for each of
the two nitrifying functions. Parameters of the model - growth rate and half constant saturation
for each phylotype along with yield coefficient for each functional community - were obtained
beforehand by optimization on the experimental data of the nitrifying chemostat model without
interactions (Table. 15).
Table 15: Kinetic parameters of the microbial interactions model
AOB
1
AOB
2
NOB
1
NOB
2

Maximum growth rate, max (h
-1
)
Half saturation constant, Ks (mg/L)
0.45
0.30
0.50
0.48
0.27
0.65
0.27
0.70
Yield coefficient, Y 0.18 0.10
Then, the estimation of the parameters was manually refined taking into account the microbial
interactions by means of ij coefficients having values between [-1,1]. These model parameters
appear to be in accordance with bibliographic references (Bougard 2004).
RESULTS
Nitrifying performance
Due to regular disturbances which included changes in operating temperature, variations in
input substrate concentration, changes in the flow rate or biotic perturbations resulting from the
addition of biomass, the two nitrifying functions (i.e. nitritation and nitratation) were carried out
differently throughout the experimental period in the chemostat (Fig. 44).

Figure 44: Nitrifying performances in the regularly disturbed chemostat. Black continuous line with diamond-
shaped signs represents nitrite, dotted black line with round signs represents nitrates and dotted grey line with
triangular signs represents residual ammonium concentrations expressed in g N.L
-1
throughout the duration of
experiments (in days). Disturbances introduced during the kinetics in both reactors are indicated as follows: circle
with arrow represents increasing or decreasing flow rate, black arrow represents biotic disturbance, a black
triangular sign represents increasing or decreasing substrate concentration and black star represents a decreased in
operating temperature from 30C to 25C.
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
152

From its inoculation up to day 183, only nitrite production was performed with high
efficiency. A start of the nitratation function was obtained only after the modification of the
operating temperature which was cooled from 30C to 25C on day 183. Though nitrate
production seemed to be inhibited by the increase of input substrate concentration, the function
was maintained and followed the increase in input substrate concentration made on day 198.
Nitratation was lost only after a major increase in the flow rate introduced on day 337. After
restoration of this environmental parameter on day 372, the nitratation function reappeared in the
chemostat, maintaining high performance right to the end of the experimental procedure (day
525).
Microbial community
Total biomass present in the chemostat was measured throughout the experiment (Fig. 45).
Results obtained show a good correlation with the dynamics of the ammonium concentration
input except after the major increase in the flow rate (Fig. 44). Forty-one phylotypes were
detected in the chemostat from a kinetic of 136 SSCP profiles. Relative abundance given by
SSCP for each of them was transformed into concentration by multiplication with the values of
total biomass (Fig. 45).

Figure 45: Microbial community in the chemostat. Dotted black line with diamond-shaped signs represents the total
biomass, others continuous grey level lines represents the dynamics of the 41 phylotypes detected by fingerprints in
the nitrifying chemostat expressed in g.L-1 throughout the duration of experiments (in days). Disturbances created
during the kinetics in the chemostat are indicated as described in figure 44.
After inoculation, a phylotype was dominant with high relative abundance (60% of total
biomass on average). For a short period of time, coexistence with another dominant phylotype
was observed in response to a temporary break in the flow rate corresponding to the first
disturbance. The biotic disturbance made on day 121, consisting in the addition of nitrifying
biomass (AOB and NOB) and which led to a slight decrease in nitritation performance, had a
major effect on the relative abundance of the dominant phylotype in the chemostat. Modification
of the operating temperature from 30C to 25C on day 181 led to the emergence from the
background of another phylotype which decreased quickly, probably due to the increase of the
input substrate concentration on day 198. After this modification, a marked successive
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
153

alternation of major phylotypes was observed. After this period, the chemostats presented the
same structural pattern as after inoculation, with important domination by the same phylotypes.
This domination was nevertheless upset after the last modification to input substrate
concentration, took place on day 432, when coexistence between several major phylotypes was
observed. Finally, the second biotic disturbance, made on day 503 and consisting in the addition
of NOB biomass, engendered a switch in the main phylotype in the chemostat.
Coexistence of 2+2 species on 1+1 growth-limiting resources by microbial interactions
The results of the microbial interactions model optimized on the basis of experimental data
are presented in figure 46.

Figure 46: Optimization of the microbial interactions model on the experimental data. Cross signs represent the
experimental data, continuous black line represents results of the optimization of the microbial interactions model,
and dotted black line represents results of the optimization of the model without interactions.
In comparison with the experimental dynamics, the interaction model presented was a good
match with the measurement data and was always better than the model without interactions.
Effectively, for population data, the model with interactions presented a good correlation with
experimental bacterial kinetics for all of the four phylotypes studied. The divergence occurring
from d=375 and d=430 between the experimental data and estimates of the model for the two
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
154

AOB can be explained by a washing-out of the chemostat in response to the increase in the flow
rate made on d=337. For functional data, the model with interactions presented satisfactory
estimates for residual ammonium, nitrites or nitrates. On the other hand, though the model
without interactions correlates well with the kinetics acquired by SSCP for the first AOB, it did
not do so for the second AOB. For NOB, the model without correlations gave poor results. In
effect, model estimates were not satisfactory for either of the two phylotypes. This poor
approximation of the population dynamics was also revealed by a shunt of the nitrate and an
accumulation of nitrites in almost all the experimental kinetics.
It is clear that, when microbial interactions were not taking into account, the model does not
predict the coexistence of 2+2 species on 1+1 growth-limiting resources. Moreover, microbial
interactions having important effects on the growth rate of both AOB and NOB community (Fig.
47).

Figure 47: Growth rate (in H
-1
) of AOB and NOB functional communities composed of two phylotypes for each
one. At the top, continuous black line represents the growth rate of AOB community when interactions were
considered and dotted black line represents the growth rate when interactions were not taking account. At the
bottom, continuous black line represents the growth rate of NOB community when interactions were considered and
dotted black line represents the growth rate when interactions were not taking account.
Effectively, biotic interactions decrease the growth rate of AOB community and increase the
growth rate of NOB community in comparison of results obtains without considering
interactions.
Virtual interactions web
By using microbial interactions model, we can obtain a web of virtual interactions linking the
different phylotypes with the values, corresponding to the intensity, of each of the interactions
(Fig. 47 and Table 16).
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
155


Figure 48: Virtual interactions web between nitrifying bacteria obtained by the model. Continuous black line
represents positive interaction and dotted black line represents negative interaction between two phylotypes.
Table 16: Interactions coefficients (ij) of the microbial interactions model.
X
j

AOB
1
AOB
2
NOB
1
NOB
2

X
i

AOB
1

AOB
2

NOB
1

NOB
2

-0.54 0.98 -0.75 0.68
0.29 -0.78 0.98 -0.57
0.81 0.40 0.97 0.46
0.46 0.99 -0.99 -0.99

In the network of 16 interactions contained in the model, only 6 appear as negative
interactions. The 10 other interactions all proved to be positive. No nil interaction was revealed.
Concerning interactions between both AOBs, no competition appeared but, in opposite, strong
facilitation notably of the second AOB on the first one (=0.998). However, strong intra-specific
competition appeared for each of both AOB with =-0.54 and =-0.78 respectively. These two
ammonium-oxidizing phylotypes exercise interactions of facilitation with both nitrite-oxidizing
phylotypes. However, they can point out that every AOB exercise a stronger facilitation on one
of both NOB in a supplementary way. Effectively, AOB
1
present a high facilitation against
NOB
1
(=0.81) and a medium one against NOB
2
(=0.46) while AOB
2
present a medium
facilitation against NOB
1
(=0.40) and a high one against NOB
2
(=0.99). Concerning
interactions between the two nitrite-oxidizing phylotypes, NOB
1
had a high negative impact on
NOB
2
(=-0.99) while NOB
2
exercise a moderate facilitating impact on NOB
1
(=0.46). High
intra-specific facilitation appear for NOB
1
(=0.97) whereas strong intra-specific competition
appeared for NOB
2
(=-0.99). Concerning the type of interaction which maintains NOB in
relation to AOB, a supplementary structure appeared. Effectively, each NOB exercised a positive
and a negative effect on both AOBs. Whereas NOB
1
had a negative impact on AOB
1
(=-0.75)
and a positive one on AOB
2
(=0.99), for NOB
2
it was the opposite: positive impact on AOB
1

(=0.68) and negative on AOB
2
(=-0.57).


De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
156

DISCUSSION
A populationnal and functional monitoring for two years of a nitrifying chemostat with
time-varying environmental conditions put in an obvious place the coexistence of numerous
species in the middle of culture fed by ammonium as source of nitrogen. Effectively, the data
indicates that, throughout the period of the study, rapid significant changes occurred in the
species composition of the bacterial community (Fig. 45). Some mathematical results predict that
there are situations where dynamic microbial communities are the norm and steady-state
conditions do not exist (Saikaly and Oerther 2004). This theoretical observation is supported by
several recent studies which have shown experimentally that the composition of a microbial
community is dynamic. One such example is the study carried out by Kaeplpat and Grady (2002)
in which they examined, using denaturing gradient gel electrophoresis (DGGE) targeting 16S
ribosomal RNA, the structure of the bacterial community in a laboratory-scale sequencing batch
reactor (Kaewplpat and Grady 2002). The DGGE data showed that the bacterial community was
highly dynamic and this dynamic behavior was observed during the initial 17 days of reactor
operation and continued throughout the experiment. Studies using anaerobic reactors have also
shown that the structure of bacterial communities is dynamic. Fernandez et al. (1999) studied
community dynamics in a functionally stable methanogenic reactor over a period of 605 days
(Fernandez, Huang et al. 1999). The results of this study showed that the bacterial community
structure was dynamic, following a chaotic behavior pattern even though the reactor was
operated under stable conditions. In a similar study, Zumstein et al. (2000) showed that the
bacterial community structure in an anaerobic digester operating under constant environmental
conditions (feeding, temperature and pH) over a two-year period was also dynamic (Zumstein,
Moletta et al. 2000). In the present study, we have similarly observed a dynamic structure in the
bacterial community. However, in our case, we cannot test the chaotic nature of these dynamics:
because environmental conditions fluctuate, the Liapunov exponents do not enable us to draw
conclusions (Tempkin and Yorke 2007).
So both the theoretical and experimental studies discussed above suggest that microbial
communities in aerobic and anaerobic bioreactors are dynamic. We speculate that this dynamic
behavior could be caused, in part, by the microbial interactions linking the different species
in a community. In macrosystem ecology, several models have been established that represent
intra- and inter-species interactions in food webs (Berlow, Neutel et al. 2004). The most widely-
used model has been the multispecies Lotka-Volterra model which is a simple model for
measuring interaction, based on a linear relationship for a given species between its growth rate
and the population of each member species in the community. This model has already been used
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
157

to describe microbial interactions within a cheese microbial community (Mounier, Monnet et al.
2008). In the present study, we applied this interaction coefficient structure (
ij
) to the classic
nitrifying chemostat model. Comparisons of the optimization on the experimental data
obtained for the classic nitrifying chemostat model with and without microbial interactions
show that microbial interactions can lead coexistence. The prime focus on predator-prey links
in much of the research to date on interactions strengths in food webs has meant that the
potential significance of non-trophic interactions such as competition, facilitation and biotic
disturbance, has been largely ignored (Berlow, Neutel et al. 2004). Effectively, because food
web models focus by definition exclusively on trophic interactions, they implicitly assume that
predation is the most important process regulating community structure and dynamics.
Moreover, while models of complex food webs implicitely incorporate exploitative competition
among most species, they generally ignore any form of resource competition among the basic
species (Williams and Martinez 2000; Drossel and MacKane 2003). This can be explained by the
fact that, in food networks, nutrients flow via trophic links and, for this reason, trophic
interactions have a fundamental character due to the principle of mass conservation. Concerning
the competitive exclusion principle and the paradox of the plankton in chemostats, a variety
of mathematical models has been developed over the last decades. But in the same way,
microbial interactions were ignored and in all such models the idealized chemostat assumptions
have been modified (Hebeler, Schmidt et al. 2006). Some studies rely upon nonequilibrium
conditions to promote species diversity by preventing competitive equilibrium. One such
example is the variability in resource supply ratios. When nutrients were supplied to the
chemostat in pulses, oscillations in the abundance of species prevented competitive equilibrium
from occurring and permitted the coexistence of a number of species greater than the number of
growth-limiting resources (Sommer 1985; Huisman and Weissing 2000). In the same way, some
studies explain coexistence in chemostats by a variation in solids retention times (Saikaly and
Oerther 2003). Only a very limited number of studies have shown interest in microbial
interactions. Hebeler et al. (2006) explained coexistence in a chemostat as a result of metabolic
by-products (Hebeler, Schmidt et al. 2006). In their study, they found experimental evidence for
a specific metabolic property of Staphylococcus aureus which produced acetate (a by-product).
In a mixed culture, this can have an activating effect (as a secondary substrate) as well as an
inhibiting effect on the other species (by reducing pH value). Huisman and Weissing (2000)
showed, in a study based on modeling, that the number of coexisting species may exceed the
number of limiting resources when internal system feedback indices oscillations and chaos
which occurs if the species displace each other in a cyclic fashion (Huisman and Weissing 2000).
However, this appears to be a rare phenomenon in parameter space, requires a very precise
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
158

parameterization of the community members and is sensitive to the introduction of new species
and the removal of species already present (Schippers, Verschoor et al. 2001). Nevertheless, in
microbial ecology few authors have considered interactions empirically and directly whereas a
long history experimental and theoretical ecology, with its much longer has elucidated how
predation interacts with other non-trophic processes such as interference competition,
facilitation, disturbance, environmental stress, productivity and recruitment, to regulate species
distribution and abundance (Chase, Abram et al. 2002; Fox and MacGrady-Steed 2002; Post
2002; Montoya and Sol 2003).
Additionally, not only coexistence but also ecosystem functions might be strongly
mediated by the network of microbial interactions. Effectively, when interactions have been
taking into account, the optimization model has matched well the functional experimental data.
In contrast, without interactions, only one of the two functions performed in the nitrifying
chemostat was carried out by the virtual nitrifying community present in the model.
Understanding links between biotic interactions, biodiversity structure and the functioning of an
ecosystem remains one of the main challenges in ecology. Nevertheless, increasing numbers of
studies conclude that the network of biotic interactions plays an important role in the efficiency
of an ecosystem or bioprocess (Duffy 2002; Montoya and Sol 2003). In the same way, Arditi et
al. (2005) have modeled non-trophic effects in food webs by the incorporation in the model of
the possibility of a functional change in the trophic interaction between two species caused by a
third species (Arditi, Michalski et al. 2005). Their results have shown that the probability of
obtaining a super-efficient ecosystem (i.e. in which 90% or more of the nutrients are
concentrated in the biomass) increases with the number of non-trophic interactions. In microbial
ecology, studies interesting to bio-augmentation have generally shown that in bio-augmented
chemostat, in which we can assume there is a higher number of interactions than in unaugmented
chemostat, there is a better level of recovery of functions and activity (Boon, Top et al. 2003;
Qu, Zhou et al. 2005).
Finally, the model integrating microbial interactions make it possible to obtain a
network of virtual interactions linking the different species present in our system. There is a
higher number of positive interactions (62%) than negative. In particular, we can note that no
competition occurred between Nitrosomonas eutropha and Bacteroidetes (AOB
1
and AOB
2
,
respectively) but, on the contrary, there was mutualism or facilitation. This can be explained by
the production of dual by-products from N. eutropha to Bacteroidetes and Bacteroidetes to N.
eutropha, as proposed by Hebeler et al. (2006). Another explanation might to assume be the
strong intra-species competition in both AOB populations, which can be compared to the study
De la modlisation du maillage dinteractions entre les espces prsentes dans un cosystme microbien complexe
159

of Ruan et al. (2007). This author considered a two-competitor/one prey model and explained the
coexistence of the two competitors by density-dependent mortality for one of the two species
(Ruan, Ardito et al. 2007). This assumption would also explain the coexistence of both NOBs.
The dependence of the NOB on the nitrites produced by the AOBs is reflected in the results of
the model by positive effects of both AOBs on both NOBs. In contrast, the negative effect of
each NOB on one of the two AOBs seems to be more difficult to explain. One hypothesis is the
competition for oxygen between the two functional communities but it was shown that reducing
oxygen leads to the formation of nitrite instead of nitrate (Sliekers, Haaijer et al. 2005).
Moreover, nitrite-oxidizing bacteria appear to be poor competitors for oxygen compared with
pure cultures of AOB (Laanbroek and Gerards 1993). Another hypothesis is that there may be a
negative density effect from the NOB to the AOB.
To sum up, we have developed a model of a classic nitrifying chemostat to study the
interaction of four species within two functional groups: two AOBs and two NOBs. The network
of virtual interactions obtained explains the coexistence of these 2+2 species on 1+1 growth-
limiting resources. Therefore, a more complete model should include multi-functional groups of
organisms, including nitrifying and denitrifying heterotrophs, phosphorus-accumulating
organisms In addition, this study focused on the impact of interactions within a single trophic
level (bacteria). The effects of the presence of higher trophic levels such as ciliates (predators)
and carnivores (top predators) should also be considered.


160









De linfluence de perturbations biotiques sur la diversit et le fonctionnement de bactries nitrifiantes en chmostats
161

IX. IX. IX. IX. DE DE DE DE LINFLUENCE DE PERTURBATIONS BIOTIQUES LINFLUENCE DE PERTURBATIONS BIOTIQUES LINFLUENCE DE PERTURBATIONS BIOTIQUES LINFLUENCE DE PERTURBATIONS BIOTIQUES
SUR L SUR L SUR L SUR LA DIVERSIT ET LE FONCTIONNEMENT A DIVERSIT ET LE FONCTIONNEMENT A DIVERSIT ET LE FONCTIONNEMENT A DIVERSIT ET LE FONCTIONNEMENT DE DE DE DE
BACTRIES NITRIFIANTES EN CH BACTRIES NITRIFIANTES EN CH BACTRIES NITRIFIANTES EN CH BACTRIES NITRIFIANTES EN CHMOSTATS MOSTATS MOSTATS MOSTATS
Du bout de lhorizon accourt avec furie le plus terrible des enfants que le Nord et port
jusque-l dans ses flancs. LArbre tient bon ; le Roseau plie...
Jean de la Fontaine.
Au cours de notre suivi des chmostats nitrifiants, deux perturbations biotiques ont t
appliques aux communauts nitrifiantes installes dans les chmostats exprimentaux : une
perturbation globale et une cible. Lanalyse de linfluence de ces perturbations sur la diversit et
le fonctionnement des bactries nitrifiantes, prsente ci-dessous, constitue des rsultats
complmentaires au travail de modlisation des interactions.
IX.1. Linfluence de la perturbation biotique globale
La perturbation globale, ralise t=121 jours aprs inoculation a consist en le
renouvellement de 10% de la biomasse des chmostats A et B par une biomasse issue du racteur
de rserve prsentant une structure de communaut diffrente (cf. chapitre VI.4.2.1.).
IX.1.1. Linfluence populationnelle de la perturbation biotique globale
Du point de vue populationnel, les effets de la perturbation biotique globale peuvent tre
suivis par lanalyse de la distance euclidienne entre les profils SSCP obtenus juste avant le
renouvellement de biomasse et les profils obtenus aprs. En effet, la distance euclidienne permet
dapprcier la diffrence de structure de communaut entre deux profils, dfinis par deux
vecteurs x
1,n
et y
1,n
, par la relation :
|


avec x et y correspondant laire des pics dun profil
Suivant cette distance euclidienne, il apparait que la perturbation a bien engendr une
augmentation de la diversit dans les deux communauts microbiennes. Nanmoins, les deux
chmostats prsentent des rponses quelque peu diffrentes (Fig. 49).
De linfluence de perturbations biotiques sur la diversit et le fonctionnement de bactries nitrifiantes en chmostats
162



Figure 49 : Evolution de la distance euclidienne entre le profil SSCP obtenu juste avant la perturbation biotique
globale consistant en le renouvellement de 10% de la biomasse prsente dans chaque chmostat par une biomasse
nitrifiante plus diverse issue dun racteur de rserve.
Dans le chmostat A, leffet de la perturbation semble intervenir relativement tard aprs son
application. En effet, ce nest que huit jours aprs renouvellement de la biomasse quune
augmentation importante de la distance euclidienne est releve (Fig. 40, A) tandis que la raction
semble quasi-instantane dans le racteur B (Fig. 40, B). De plus, la communaut A prsente une
rsilience relativement longue, car il faut attendre plus de 30 jours avant de noter un retour
ltat initial contre seulement environ 20 jours pour la communaut B. Ainsi, le chmostat A
prsenterait une meilleur rsistance au choc mais une rsilience plus lente que le chmostat B.
Une telle diffrence de comportement pourrait ventuellement sexpliquer par des diffrences
dans le maillage dinteractions liant les espces dj assembles dans les communauts avant la
perturbation. La modlisation de ces interactions pour les deux systmes pourrait permettre de
tester cette hypothse.
IX.1.2. Linfluence fonctionnelle de la perturbation biotique globale
La perturbation biotique globale semble galement avoir eu des effets sur le fonctionnement
des chmostats. En effet, les mesures chimiques montrent une baisse de la production de nitrite
dans les deux chmostats immdiatement aprs la perturbation (Fig. 50).

Figure 50 : Suivi des concentration en nitrite (courbe noire continue), nitrates (courbe noire en pointill) et de
lazote rsiduel (courbe crise en pointill) en g N.L-1 aprs application de la perturbation biotique globale consistant
en le renouvellement de 10% de la biomasse prsente dans chaque chmostat par une biomasse nitrifiante plus
diverse issue dun racteur de rserve.
Cette baisse de la production de nitrite seffectue sans augmentation dans la concentration des
autres composants de la raction de nitrification conduisant un bilan de matire incomplet pour
les deux chmostats. Ce rsultat pourrait sexpliquer par la comptition entre bactries nitritantes
De linfluence de perturbations biotiques sur la diversit et le fonctionnement de bactries nitrifiantes en chmostats
163

avec une accaparation de lazote par les espces invasives qui sen serviraient pour leur
croissance et leur maintenance dans les chmostats. Par ailleurs, il est noter que malgr le fait
que la biomasse introduite exprimait les deux fonctions, nitritante et nitratante, dans le racteur
de rserve do elle est issue, la production de nitrate reste totalement nulle dans les deux
chmostats aprs perturbation.
IX.2. Linfluence de la perturbation biotique cible
La perturbation cible, ralise t=502 jours aprs inoculation a consist en le
renouvellement de 20% de la biomasse des chmostats A et B par une biomasse de la bactrie
nitratante Nitrobacter hamburgensis pralablement cultive en condition de souche pure (cf.
chapitre VI.5.2.2.).
IX.2.1. Linfluence populationnelle de la perturbation biotique cible
Du point de vue populationnel, les effets de la perturbation biotique cible peuvent tre suivis
par lanalyse de la distance euclidienne de la mme manire que prcdemment (Fig. 51).

Figure 51 : Evolution de la distance euclidienne entre le profil SSCP obtenu juste avant la perturbation biotique
cible consistant en le renouvellement de 20% de la biomasse prsente dans chaque chmostat par une biomasse de
la bactrie nitratante Nitrobacter hamburgensis.
Suite la perturbation, la distance euclidienne croit progressivement pour les deux
communauts nitrifiantes A et B. De plus, cette divergence par rapport ltat initial
saccompagne dune diminution de la diversit microbienne. En effet, tandis que les chmostats
A et B prsentaient un indice de Simpson dune valeur respective de 2,65 et 2,45 avant
lintroduction de la culture de Nitrobacter, celle-ci diminue 1,79 et 2,03 respectivement. Ainsi,
suite cette perturbation, aucun des chmostats ne rsilie mais au contraire chacun voit sa
structure de communaut grandement modifie se traduisant notamment par lmergence dune
nouvelle espce nitritante majoritaire. Cette dernire correspond Bacteroidetes prise en compte
dans la modlisation des interactions ralise pour le chmostat B sous la dnomination AOB
2
.
De plus, Nitrobacter hamburgensis prsente une abscisse de migration en SSCP correspondant
au pic numro 5 des profils soit la squence identifie comme Nitrobacter sp par clonage-
squenage (cf Tableau 2, page 13). Ce phylotype a galement t considr dans la
De linfluence de perturbations biotiques sur la diversit et le fonctionnement de bactries nitrifiantes en chmostats
164

modlisation des interactions sous la dnomination NOB
1
. Or la modlisation a tabli que NOB
1

entretenait une forte relation mutualiste avec AOB
2
(=0,9) et une forte relation ngative avec
AOB
1
(=-0,9) correspondant Nitrosomonas eutropha, soit le phylotype majoritaire avant la
perturbation. Ainsi, laugmentation du nombre dindividus de la population de Nitrobacter aurait
fortement avantag la population de Bacteroidetes aux dpens de celle de Nitrosomonas
conduisant au switch populationnel observ.
IX.2.2. Linfluence fonctionnelle de la perturbation biotique cible
Du point de vue fonctionnel, aucune modification na t observe que ce soit au niveau de la
production de nitrite ou de celle de nitrate (Fig. 52).


Figure 52 : Suivi des concentration en nitrite (courbe noire continue), nitrate (courbe noire en pointills) et de
lazote rsiduel (courbe crise en pointills) en g N.L-1 aprs application de la perturbation biotique globale
consistant en le renouvellement de 10% de la biomasse prsente dans chaque chmostat par une biomasse nitrifiante
plus diverse issue dun racteur de rserve.
Ainsi, le switch populationnel observ conscutif la perturbation cible sest ralis sans
influence sur le fonctionnement macroscopique des chmostats.






165


Discussion gnrale,
Conclusion et perspectives


O il sera question :



Du potentiel des chmostats en cologie microbienne

De la difficult de la modlisation des systmes microbiens

De la pertinence des approches transdisciplinaires


166







Discussion gnrale, conclusion et perspectives
167

Dans la premire partie de cette thse consacre lEcologie gnrale, nous avons synthtis
les connaissances relatives la complexit du vivant et au fonctionnement des cosystmes.
Nous avons soulign les barrires subsistant entre les biologistes et les mathmaticiens
conduisant la production de nombreux jeux de donnes nayant pas fait lobjet danalyses
mathmatiques ainsi qu la production dun grand nombre de modles purement thoriques,
jamais confronts des mesures relles et qui par l mme peuvent savrer biologiquement
fantaisistes. Nous avons montr quune telle dichotomie pouvait conduire des rsultats
contradictoires lorsquil sagit dtudier le lien entre la diversit biologique et la stabilit et/ou la
productivit des cosystmes ainsi que lorsquil sagit dtudier la coexistence despces
diffrentes dans un milieu prsentant un nombre limit de ressources disponibles. Dans la
seconde partie de ce manuscrit, consacre plus spcifiquement lEcologie microbienne, nous
avons soulign que les caractristiques des cosystmes microbiens en font des modles d'tude
pertinents pour aborder ces questions importantes de l'cologie gnrale par une approche
exprimentale et thorique. Nanmoins lutilisation de ceux-ci demeure marginale notamment du
fait de la difficult extraire certaines informations cls telles que le rle fonctionnel des
diffrentes espces prsentes dans un cosystme microbien donn. Au cours de cette thse,
nous avons propos une mthode gnrique sans a priori faisant intervenir des empreintes
molculaires et des outils de lautomatique, des observateurs, pour assigner une des
fonctions tudies dun cosystme donn chacun des diffrents phylotypes dtects. Cette
mthode de traitement a t applique des donnes exprimentales issues du suivi de bactries
nitrifiantes en chmostats. Les rsultats obtenus par cette approche ont t valids par le clonage-
squenage de lADNr 16S des phylotypes, les bactries nitrifiantes tant caractrises par un
fort lien phylognie-fonction (Purkhold, Pommerening-Roser et al. 2000). Cette mthode
dassignation fonctionnelle prsente lavantage dtre indpendante des cintiques de la raction
tudie telles que le taux de croissance, la temprature, le pH... Seuls les coefficients de
rendement de chaque communaut fonctionnelle sont ncessaires pour permettre lestimation de
leur biomasse respective par les observateurs que nous avons labors. Ainsi, cette approche peut
facilement tre transposable tout cosystme pour lequel il est possible de raliser des mesures
permettant dtablir un schma ractionnel et pour lequel la diversit biologique est lisible
cest--dire qui ne sature pas les empreintes molculaires, de manire bien discriminer les
diffrents phylotypes. Cette mthode gnrique permettant de dterminer qui est impliqu dans
quelle fonction peut avantageusement tre couple avec les mthodes molculaires classiques
permettant de dterminer qui fait quoi dans un cosystme comme par exemple les
techniques de SIP, pour Stable Isotope Probing (Neufeld, Dumont et al. 2007), ou de FISH-
MAR, pour Fluorescence In Situ hybridization avec Microautoradiography (Lee, Nielsen et al.
Discussion gnrale, conclusion et perspectives
168

1999; Ouverney and Fuhrman 1999). Un tel couplage permettrait (i) de discriminer, par notre
approche, les diffrentes communauts fonctionnelles cest--dire les diffrents phylotypes en
interactions pour une fonction donne (ii) de dterminer, par les approches classiques, les
phylotypes qui dans chaque communaut contribuent activement la fonction considre. Ainsi,
cela permettrait de diffrencier les interactions trophiques des interactions rhagogiques, telles
que dfinies par Arditi et al. (2005), dans un cosystme microbien donn.
Les empreintes molculaires apparaissent comme des outils pertinents en cologie
microbienne. En effet, elles permettent, par une mme mesure, davoir accs la dynamique des
phylotypes, la structure et la richesse spcifique de la communaut assemble dans un
cosystme donn (Muyzer and Smalla 1998; Loisel, Harmand et al. 2005), caractriser le flux
nergtique qui le parcours par un nouvel indice cologique (Marzorati, Wittebolle et al. 2008) et
dsormais avoir accs au rle fonctionnel des diffrents phylotypes. Il ne fait pas de doute que
dautres informations se cachent encore sous ces profils de pics et/ou de bandes et seront
progressivement mises au jour, permettant damliorer notre connaissance du monde microbien.
Ces informations seront dautant plus pertinentes en tant utilises comme des entres de modle
dinteractions permettant dapporter des lments de rponse quant des questions centrales de
lcologie gnrale.
Au cours de notre thse, nous avons ralis une telle modlisation des interactions intra et
interspcifiques, trophiques et non-trophiques pouvant stablir entre diffrents phylotypes
assembls. Ce travail, qui est notre connaissance la premire tentative visant confronter des
donnes exprimentales aux simulations dlivres par un modle de type bilan de matire
comprenant plus de biomasses que de fonctions exprimes, a permis de mettre en vidence
limportance de considrer les diffrents types dinteractions pour une meilleure comprhension
du lien diversit-fonctionnement dun cosystme. En effet, les rsultats que nous avons obtenus
montrent que le maillage dinteractions peut expliquer la coexistence de plusieurs espces qui
semblent en comptition pour un mme substrat limitant. De plus, il apparat que les fonctions
exprimes par lcosystme sont fortement influences par le rseau dinteractions biotiques.
Cette modlisation nous a galement conduit lobtention dun rseau virtuel dinteractions
permettant de mieux comprendre les relations entre les quatre phylotypes, deux nitritants et deux
nitratants, que nous avons considrs. Ce rseau nous a fourni des informations pertinentes pour
analyser la dynamique des phylotypes en rponse aux perturbations biotiques globales et cibles
que nous avons appliques nos chmostats exprimentaux. Ces derniers, associs aux outils
danalyses molculaires et dautomatique se sont ainsi rvls tre des outils intressants pour
des tudes dcologie microbienne.

Discussion gnrale, conclusion et perspectives
169

X.1. Le potentiel des chmostats en cologie microbienne
Les chmostats fournissent des modles exprimentaux qui sont dautant plus intressants
quils permettent dtudier de faon prcise un certain nombre de facteurs pouvant influencer le
maintien de la diversit et le fonctionnement de la communaut qui y est assemble. Ainsi, nous
avons pu tester les effets de perturbations abiotiques et biotiques sur la rsistante et/ou rsilience
des espces prsentes. Il serait notamment intressant dapprofondir linfluence des perturbations
biotiques sur la structure de la communaut ainsi que sur les fonctions exprimes au niveau de
lcosystme. Des perturbations globales et cibles pourraient ainsi tre renouveles avec des
intensits graduelles qui permettraient de mieux caractriser les capacits de rsistance et/ou de
rsilience. Les perturbations globales pourraient tre effectues avec des biomasses encore plus
diverses et acclimates ou non aux conditions opratoires en chmostats par exemple en
introduisant de la boue active issue dune station dpuration ou encore avec une biomasse issue
du sol. Les perturbations cibles pourraient galement tre ralises avec dautres souches de
bactries nitratantes ainsi quavec des bactries nitritantes. Un autre aspect qui serait galement
intressant dtudier vis--vis de ces perturbations est linfluence de lhistoire des communauts
assembles sur leur capacit de rsilience et rsistance. En effet, des tudes rcentes ont mis en
vidence quun cosystme garderait en mmoire les vnements passs (Zemb 2006). Dans
le cadre de notre dispositif exprimental, une mme perturbation pourrait tre mise en place sur
les chmostats A et B ayant dj fait lobjet de nombreuses perturbations et sur les chmostats D
et E qui ont t maintenus dans des conditions constantes. Il pourrait tre galement intressant
de raliser les mmes perturbations biotiques sur des chmostats maintenus strictement dans les
mmes conditions opratoires et environnementales mais inoculs avec des biomasses
diffrentes.
Par ailleurs, au cours de notre thse, nous avons pu constater que deux chmostats oprs de
faon strictement identiques et inoculs avec la mme biomasse microbienne pouvaient diverger
fonctionnellement et populationnellement. En effet, tandis que le chmostat A perdait la fonction
nitratante t=240 jours et prsentait une faible diversit microbienne, le chmostat B conservait
lexpression des deux fonctions de la nitrification et prsentait une diversit microbienne plus
importante. Une hypothse qui peut tre mise pour expliquer ces rsultats est lhypothse virus.
Les virus, qui sont une cause majeure de la mortalit des bactries, sont de plus en plus
considrs comme des acteurs importants de lactivit et de la structuration de communauts
microbiennes aquatiques (Wommack and Colwell 2000). En effet, il apparat que les virus
peuvent rguler la diversit bactrienne dans la mesure o une bactrie qui viendrait dominer
dans un cosystme et donc augmenter la taille de sa population, augmenterait du mme coup
Discussion gnrale, conclusion et perspectives
170

les probabilits de rencontrer et de se faire infester par un virus (Thingstad and Lignell 1997).
Cette assertion constitue lhypothse virus galement connu sous la dnomination killing
the winner (littralement : tuer le meilleur tant sous entendu que le meilleur est le
vainqueur de la slection naturelle). Aprs infestation et lyse de la cellule hte par le virus, les
dbris cellulaires seraient relargus dans le milieu contribuant ainsi au pool de matire organique
disponible pour les autres bactries prsentes dans lcosystme (Fuhrman 1999). Quelques rares
tudes exprimentales ont t ralises pour tenter de mieux caractriser linfluence de ces virus
sur le fonctionnement et la structure des communauts. Il a ainsi pu tre mis en vidence une
corrlation positive entre le nombre de virus et la quantit de biomasse microbienne dans un
milieu donn (Heldal and Bratbak 1991; Maranger and Bird 1995). Dautres tudes, portant sur
lactivit des bactries ont rvl que la rgion o la production bactrienne tait la plus leve
correspondait celle o se trouvait le plus grand nombre de virus (Maranger, Bird et al. 1994).
Ainsi, dans le cadre de nos chmostats nitrifiants, nous pourrions envisager quun virus puisse
tre lorigine de la plus grande diversit mesure dans le chmostat B en engendrant une
diminution de lespce majoritaire, qui se trouvait tre la bactrie nitritante Nitrosomonas
eutropha juste avant la divergence observe, favorisant du mme coup les bactries nitratantes et
donc le maintient des deux fonctions. Il existe quelques protocoles exprimentaux permettant
lisolement et lindentification de virus partir dchantillons liquides (Alonso, Rodriguez et al.
1999; Jiang, Fu et al. 2003; Zemb, Urios et al. 2008). Aussi, il serait possible de suivre,
paralllement la dynamique des phylotypes et des fonctions exprimes, la dynamique des virus
prsents dans les chmostats afin de mieux caractriser leur rle potentiel dans la divergence de
chmostats jumeaux. Par ailleurs, cette divergence observe soulve des interrogations quant
lapproche mise en uvre pour la modlisation des systmes microbiens.
X.2. La difficult de la modlisation des systmes microbiens
X.2.1. La question du chaos dterministe
Comme nous lavons vu prcdemment (chapitre II.2.2.3), certains systmes dynamiques
peuvent savrer trs sensibles aux petites variations de leurs conditions initiales telles que le
nombre dindividus dans les populations considres ou encore la prsence ou non de virus dans
la communaut. Ces variations peuvent ensuite prendre dnormes proportions, gnrant des
trajectoires imprvisibles et conduisant la dfinition du chaos dterministe. Le
mathmaticien russe Alexander Lyapunov (1857-1918) a particulirement tudi ce phnomne
et a dvelopp un outil permettant de mesurer la vitesse laquelle ces petites variations peuvent
samplifier. Cet outil, appel exposant de Lyapunov (not LE), mesure en fait le degr de
Discussion gnrale, conclusion et perspectives
171

sensibilit dun systme dynamique une variation infinitsimale de ses conditions initiales. Son
expression mathmatique est la suivante :
lim

ln|


avec n correspondant au nombre ditrations et X au nombre dindividus dans la
population.
Selon lexposant de Lyapunov, un systme sensible de trs petites variations des conditions
initiales aura une valeur positive tandis quelle sera ngative si ces variations nont pas deffets
long terme sur le systme. Pour illustrer simplement ce propos, les rsultats obtenus avec le
modle logistique dfini par

et sa reprsentation sous forme du diagramme


de Feigenbaum peuvent tre utiliss (Fig. 53).

Figure 53 : Dynamiques dune population selon le modle logistique, ou de Verhulst, en fonction de la valeur des
paramtres X
0
et r. En vert, reprsentation sous forme du diagramme de Feigenbaum. En bleu, valeurs de lexposant
de Lyapunov correspondant.
Il apparat bien que les valeurs ngatives de lexposant de Lyapunov correspondent aux
valeurs du taux de croissance () pour lesquelles le systme se stabilise avec le temps. De plus,
plus la valeur de lexposant de Lyapunov est grande et ngative, plus le systme est stable.
Inversement, lorsque le systme passe la porte dentre sur le chaos, les valeurs de lexposant
deviennent positives.
Rcemment, une tude a mis en vidence, en utilisant lexposant de Lyapunov, que des
bactries nitritantes et nitratantes en chmostat pouvaient prsenter une dynamique chaotique
(Graham, Knapp et al. 2007). Ces auteurs ont suivi par PCR quantitative lvolution des AOB et
de deux NOB (Nitrospira et Nitrobacter) dans trois chmostats diffrant par leur taux de
dilution. Ils ont ainsi montr que plus la valeur du taux de dilution est forte, plus la dynamique
des bactries nitrifiantes est chaotique. Nanmoins, une critique qui peut tre faite leur tude
est davoir test lexposant sur les cintiques obtenues pendant 200 jours immdiatement aprs
linoculation des racteurs par une forte quantit de boue active issue dune station dpuration.
Discussion gnrale, conclusion et perspectives
172

En effet, ces auteurs ont rempli leurs racteurs avec 33% de boues actives et 67% dun milieu
synthtique minral comparable au notre, avant de les alimenter uniquement avec du milieu
synthtique. Ce faisant, Graham et al. ont donc fortement perturb les populations bactriennes
prsentes dans les boues en modifiant radicalement et rapidement leur environnement. Ainsi,
laspect chaotique des dynamiques des AOB et des NOB pourrait tre d cette importante
perturbation.
En ce qui nous concerne, linoculum a fait lobjet dune longue acclimatation de 10 mois
avant que le suivi des chmostats ne commence rellement. De plus, le taux de dilution que nous
avions fix tait trs faible. Nous navons pas pu tester lexposant de Lyapunov sur la dynamique
des phylotypes que nous avons obtenue par SSCP pour les chmostats A et B du fait des
nombreuses perturbations ralises. Lexposant pourrait nanmoins tre test pour les racteurs
stables D et E mais nous ne disposons pas dun nombre suffisant de points dans les cintiques
populationnelles, une grande partie des analyses molculaires nayant pas encore t ralise.
Bien que cette hypothse du chaos dterministe ne doive pas tre nglige et mriterait
effectivement dtre teste, il ne semble pas que les chmostats A et B prsentent une telle
dynamique. En effet, en dehors de la phase de divergence, les deux chmostats sont trs
semblables en ce qui concerne la structure de la population avec la mme espce majoritaire, et
les mmes phases de coexistence entre plusieurs espces majoritaires. La divergence des
chmostats jumeaux telle que nous lavons observe pourrait davantage sexpliquer par un
comportement neutre de la dynamique des phylotypes dtects par SSCP.
X.2.2. La question de la neutralit
Au cours du chapitre II.1. nous avons dcrit sommairement les deux grandes approches qui
peuvent tre utilises pour la modlisation des systmes dynamiques : lapproche stochastique et
lapproche dterministe. Dans le cadre de notre tude, nous avons opt pour une approche
dterministe en reprsentant le schma ractionnel de la raction de nitrification par des
quations diffrentielles, cette approche tant de loin la plus utilise en Ecologie car respectant
les principes de slection naturelle et notamment le concept de fitness (i.e. ou davantage
slectif ce qui revient dire que des individus mieux adapts des conditions donnes auront
une capacit plus importante avoir une descendance et donc transmettre leurs gnes). Le
modle neutre soppose au concept de fitness en considrant quaucune espce ne possde
davantages slectifs et donc que seul le hasard dtermine la structure de la communaut.
Cette volution alatoire peut se concevoir chaque temps lmentaire en suivant les pas
suivants (Volkov, Banavar et al. 2003) :
Discussion gnrale, conclusion et perspectives
173

- Avec une probabilit 1-m, deux individus sont tirs alatoirement parmi la communaut
assemble. Sil savre que ces deux individus sont identiques alors aucun changement nest
apport. Sils sont diffrents, lun deux est retir tandis que lautre est ddoubl. Cela
correspond donc la mortalit dun individu et au renouvellement de celui-ci par une naissance.
- Avec une probabilit m, un individu de la communaut assemble est tir alatoirement et est
remplac par un individu extrieur la communaut (i.e. issu de la mtacommunaut par un flux
de migration).
Le modle neutre de Hubbell simule lvolution dune communaut suivant les rgles
voques ci-dessus par un systme dquations de probabilit. Ainsi, la divergence observe
entre nos deux chmostats exprimentaux A et B pourrait tre tudie la lumire dun tel
modle. Il apparat que les jeux de donnes que nous avons obtenus au cours de notre thse sont
pertinents pour ce travail de modlisation venir (cf. Poster, Microbial diversity and neutral
chemostat figurant en annexe). En particulier, le modle neutre suggre que les groupes rares
nvoluent pas la mme vitesse que les groupes plus abondants. Dans le cas de nos systmes
nitrifiants, il serait alors possible de mettre en rapport les vitesses de divergence et les
abondances relatives des bactries nitritantes et des bactries nitratantes obtenues par
fingerprints. Nanmoins, dans la mesure o cette approche neutre contredit le principe
philosophique de causalit qui nest pas contredit par les lois de la physique, on peut se
demander sil existe rellement des systmes stochastiques et si une telle approche est pertinente
en cologie de faon gnrale et en cologie microbienne plus particulirement. Emile Borel,
qui lon doit la dfinition rigoureuse de la notion de probabilit, notait non sans humour : La
caractristique des phnomnes que nous appelons fortuits ou dus au hasard (ou stochastiques),
cest de dpendre de causes trop complexes pour que nous puissions les connaitre toutes et les
tudier . Aussi, utiliser des modles dterministes permettant de tester pas pas diffrentes
hypothses quant la structuration et au fonctionnement des cosystmes semble plus en
conformit avec nos connaissances de lcologie et de lvolution des espces. Nanmoins, un
problme qui se pose alors et que nous avons rencontr au cours de notre travail de modlisation
dterministe est la question du niveau dintgration de la diversit biologique dans les modles
mathmatiques.
X.2.3. La question du niveau dintgration de la diversit biologique dans
les modles mathmatiques
X.2.3.1. Le niveau de diversit spcifique
Au cours de notre thse, lespce a constitu le niveau dtude de la diversit du monde
microbien. Il a pu tre remarqu que le terme espce tait nanmoins employ sous certaines
Discussion gnrale, conclusion et perspectives
174

conditions par la prcision : au sens molculaire , conduisant sa substitution par le terme
phylotype . Cette prcision rend compte de la difficult des microbiologistes dfinir
clairement une espce. En effet, la dfinition classique dune espce biologique (i.e.
Communaut dtres vivants reconnaissables par leurs caractres et capables de se reproduire
sexuellement entre eux en donnant naissance une progniture fertile (Lherminer and Solignac
2000)) ne peut tre applique aux bactries du fait de labsence de reproduction sexue et des
phnomnes de transferts horizontaux de gnes. Par ces changes gntiques, une bactrie peut
recevoir des gnes dune autre bactrie, issus de virus, ou mme prsent dans leur milieu, et
renouveler ainsi 10, 20 ou mme 90% de ses gnes (Margulis and Sagan 2002). Ceci conduit
donc la possibilit de sexualit sans reproduction, la sexualit tant dfinie comme un
processus de mlange ou dunion de gnes (i.e. de morceaux dADN) de sources distinctes . Si
toutes les souches de bactries peuvent mettre en commun tous leurs gnes alors il nexiste pas,
au sens strict, de vritables espces dans le monde des bactries. Aussi, selon les termes des
bactriologistes canadiens Sorin Sonea et Maurice Panisset, les bactries formeraient un
organisme unique, une entit capable de gnie gntique lchelle de la plante. Il sagirait
donc dun seul et unique clone, complexe, compos de cellules hautement diffrencies (Sonea
and Panisset 1983).
Il apparat donc que la notion despce en cologie microbienne na que peu de lgitimit si
ce nest justement comme rfrenciel du niveau dtude de la diversit, quil est malgr tout
ncessaire de dfinir clairement. En 1987, un comit spcialis, nomm par lInternational
Committee on Systematic Bacteriology (ICSB) a donn une premire dfinition phylogntique
de lespce bactrienne qui se base sur les homologies dADN. Ainsi, selon ce comit, une
espce est dfinie gntiquement comme le rassemblement de souches ayant des homologies
dADN suffisamment importantes pour que la valeur dhybridation atteigne plus de 70% et que
la diffrence de temprature de dnaturation soit infrieure 5C (Stackerbrandt and Goebel
1994). Compte tenu des progrs effectus dans ltude de la systmatique bactrienne,
Linternational Committee on Systematics of Prokaryotes (ICSP) a dsign un nouveau comit
pour rvaluer la notion despce bactrienne. Ce nouveau comit sest runi en fvrier 2002
luniversit de Gand (Belgique) et a formul des propositions supplmentaires tout en conservant
ltude des pourcentages dhybridation et la stabilit thermique comme rfrence (Stackerbrandt,
Frederiksen et al. 2002). Nanmoins, ces dfinitions ne prsentent que peu dintrt lorsquil
sagit dtudier la diversit microbienne dans un chantillon naturel ou plus gnralement issu
dun cosystme complexe car elles ne sont pas applicables et nont pas ncessairement de
ralit biologique.
Discussion gnrale, conclusion et perspectives
175

Dans le cadre de notre tude, cest la technique dempreinte molculaire SSCP base sur la
rgion V3 de lADNr 16S qui nous a permis de dfinir des espces bactriennes. En effet,
comme nous lavons vu, les fingerprints constituent de bons outils pour tudier les communauts
microbiennes dans la mesure o il sagit de techniques parfaitement reproductibles qui
permettent davoir accs une diversit spcifique dfinie de manire constante dun chantillon
un autre mme si cette dfinition na pas ncessairement de sens biologique. Nanmoins, si les
dynamiques de phylotypes obtenues par ces techniques de fingerprints peuvent constituer des
entres de modles dinteractions inter- et intra-spcifiques, leurs utilisations sont limites du fait
du nombre de paramtres importants des modles mathmatiques correspondants. De plus,
loptimisation de tels modles partir de donnes mesures require une grande puissance de
calcul ce qui se traduit par des temps de calcul extrmement long. Ainsi, alors que nous avions
dtect plus dune quarantaine de phylotypes dans chacun de nos deux racteurs exprimentaux,
ces limitations nous ont contraint ne considrer que quatre espces en interactions (deux
nitritantes et deux nitratantes dont les rles fonctionnels ont pralablement t identifis par
notre mthode de discrimination mathmatique et valides par clonage-squenage) et ne
pouvoir raliser loptimisation de ce modle que sur les donnes issues du racteur B. Bien que
lon puisse supposer que la puissance de calcul des ordinateurs dont nous disposons ne cessera
daugmenter dans les annes qui viennent et que la modlisation des interactions est la plus
mme de permettre une meilleure comprhension du lien diversit-fonctionnement des
cosystmes, dautres niveaux dintgration de la diversit biologique dans la modlisation
mathmatique peuvent tre envisags.
X.2.3.2. Le niveau de diversit mtabolique
La limitation en nombre de paramtres des modles mathmatiques, de la capacit de calcul
des ordinateurs ainsi que la difficult dtablir une dfinition robuste du concept despce en
microbiologie soulvent effectivement le problme de la mthode dobservation de diffrentes
bactries assembles dans une communaut. Aussi, plutt que de chercher discriminer
diffrents phylotypes par une analyse de la rgion V3 de lADNr 16S comme nous lavons
fait au cours de nos travaux, il serait possible de considrer uniquement les gnes fonctionnels
responsables des fonctions exprimes par les microorganismes. De cette manire, il serait
possible de caractriser une communaut microbienne non plus en relation avec le concept
despce dont la dfinition prte polmique en cologie microbienne mais en relation avec les
voies nergtiques traversant le compartiment biologique des cosystmes. Il sagirait donc de
dcrire un cosystme en termes de rseau de mtabolismes sans dtailler le contexte cellulaire
dans lequel ils seffectuent. Nanmoins, une telle approche prsente deux inconvnients. Le
Discussion gnrale, conclusion et perspectives
176

premier est que les outils molculaires permettant de cibler un gne fonctionnel particulier sont
trs limits et concernent gnralement uniquement les fonctions majeures exprimes par un
cosystme. Ceci conduit donc en quelque sorte ne voir que ce que lon connait dj ainsi
qu ne pas tenir compte dune grande partie de la diversit microbienne et donc des interactions
pouvant stablir au sein dune communaut fonctionnelle (cf who does what versus who is
involved in what dans la discussion de larticle Toward functional molecular fingerprint ,
chapitre VI.2.). Par ailleurs, la prsence dun gne fonctionnel dans un environnement donn ne
veut pas forcment dire que ce gne est actif linstant considr. Pour viter ces cueils, il
serait possible dutiliser une mthode analogue celle nous ayant permis de discriminer le rle
fonctionnel des microorganismes dans un cosystme complexe. En effet, partir de donnes
fonctionnelles, de la mesure de la biomasse totale et dun schma ractionnel bien adapt, il
serait possible de gnrer la biomasse fonctionnelle active pour chacune des fonctions exprimes
laide dun observateur mathmatique et dutiliser ces donnes simules comme des entres de
modle. Ce dernier pourrait galement tenir compte des interactions pouvant stablir entre les
diffrentes biomasses actives. Nanmoins, une telle approche ne permettrait pas de tenir compte
de la diversit et de la structuration des espces microbiennes au sein de chaque communaut
fonctionnelle active. Aussi, il serait intressant dexprimer la dynamique des communauts non
pas en termes de concentrations en individus (i.e. biomasse) mais en termes dun indice de
diversit, tel que lindice de Simpson, qui permettrait de reflter la richesse spcifique et
labondance de la population de chaque espce au sein de chaque communaut. Il est noter
quun tel travail a rcemment t entrepris au Laboratoire de Biotechnologies de
lEnvironnement de Narbonne dans le cadre dune approche de modlisation stochastique
(VanPeteghem, Zemb et al. 2008). Concernant lapproche dterministe, ce travail savre plus
dlicat car contrairement au modle neutre o chaque espce est considre comme quivalente
et prsente donc le mme taux de croissance, la notion de fitness est respecte ce qui conduit
un ensemble de combinaisons de variables (i.e. de taux de croissance diffrents notamment) pour
dcrire lvolution des diffrentes fonctions exprimes.
Ainsi, le choix du niveau dintgration de la diversit biologique dans les modles dpendra
des outils danalyse du monde microbien, des connaissances et possibilits dans laspect
mathmatique ainsi que de lobjectif du travail de modlisation qui lui-mme dfinira le type de
modle pertinent pour y rpondre.
X.2.4. La question du type de modlisation
Comme nous lavons vu prcdemment (chapitre III.3.2.), il existe un grand nombre de
modles diffrents ce quIsrael qualifie de vritable zoo (Israel 1996). Compte tenu de la
Discussion gnrale, conclusion et perspectives
177

grande diversit quils reprsentent, il est difficilement envisageable de procder une
classification exhaustive de ces modles. Nanmoins, plusieurs catgories peuvent y tre
distingues parmi lesquelles nous retiendrons particulirement :
- Les modles explicatifs qui servent expliquer des phnomnes complexes par des
mcanismes plus fondamentaux, plus lmentaires (Gouz 1995). De tels modles peuvent tre
utiliss pour tester des hypothses permettant dexpliquer un comportement observ. Ainsi, le
modle de Lotka-Volterra peut tre considr comme un modle explicatif dans la mesure o il
permet dexpliquer les oscillations dcales dune population de proies et dune population de
prdateurs. De la mme manire, le modle dinteractions que nous avons labor au cours de
notre travail de thse entre dans cette catgorie en expliquant la coexistence de plusieurs espces
en comptition pour un mme substrat limitant. De tels modles constituent des moteurs de
rflexion ou encore ce quIsrael qualifie de sonde conceptuelle que lon plonge dans la ralit
(Israel 1996).
- Les modles dautomatique qui sont construits pour tre ensuite intgrs dans un
algorithme dont lobjectif global peut tre de nature assez varie. Il peut sagir en effet de
dvelopper une loi de commande pour rguler le systme tudi ou lamener vers un certain tat
auquel cas on parlera de contrleur, destimer des variables ou des flux du systme qui ne
peuvent tre mesurs par lintermdiaire dobservateurs, de dtecter et/ou de diagnostiquer une
anomalie dans le fonctionnement du systme. En gnral, les analyses ncessaires pour laborer
de tels algorithmes ne sont envisageables que pour une complexit du modle relativement
simple.
Ces diffrentes catgories de modles sont difficilement conciliables, mais ne sont pas
totalement dconnectes pour autant. En effet, la formalisation dun modle multi-objectif
permettant tout la fois dexpliquer, de prdire et de contrler demeure un idal qui parat
impossible atteindre. Nanmoins, les travaux portant sur la croissance de microorganismes en
chmostats faisant intervenir des outils molculaires et physico-chimiques pour le suivi
populationnel et fonctionnel peuvent constituer un point de convergence de ces diffrents types
de modlisation. En effet, la complexit de la diversit biologique peut, dans une certaine
mesure, tre contrle en chmostats et il existe un corpus de lois assez bien tabli pour la
modlisation de ces bioprocds (schma ractionnel, bilan de matire, modle de Monod). Par
ailleurs, le chmostat prsente lavantage de pouvoir servir de modle dtude pour la
comprhension des cosystmes complexes ce qui implique un travail de modlisation explicatif
(et ventuellement prdictif) mais constitue galement un outil pour la dpollution des eaux
urbaines ou la production de produits alimentaires ce qui implique un travail de modlisation
Discussion gnrale, conclusion et perspectives
178

afin de mieux contrler la bioraction qui sy produit et ainsi en augmenter le rendement. Ainsi,
une approche transdisciplinaire savre pertinente pour ltude et la modlisation de tels
systmes.
X.3. La pertinence des approches transdisciplinaires
En adoptant une dmarche transdisciplinaire au cours de notre travail, nous avons montr
quil tait possible damener des lments de rponse pertinents des questions importantes en
Ecologie. Ainsi, la dtermination du rle des diffrentes bactries assembles dans les fonctions
exprimes au niveau de lcosystme a pu tre propose grce la combinaison des
connaissances issues de la microbiologie, des mathmatiques, du gnie des procds et de
lautomatisme. Il est vident quaucune de ces sphres de comptences prise sparment naurait
t en mesure de proposer une mthode aussi gnrique. Une telle collaboration ncessite une
bonne dfinition des problmes poss ainsi quune certaine convergence de points de vue. En
effet, si nous considrons le schma ractionnel de la nitrification en chmostat telle que nous
lavons tudie, diffrentes reprsentations peuvent tre effectues :
- Une reprsentation trs simplifie courante dans le gnie des procds et lautomatique
notamment et qui conoit le compartiment biologique comme une bote noire. Ceci reflte le fait
que dans ces domaines il sagit surtout de contrler et/ou doptimiser un bioprocd en jouant sur
les paramtres biotiques. Les connaissances biologiques napparaissent alors pas fondamentales
dans la mesure o les effets de variations des paramtres de contrle sont apprcis directement
sur les fonctions exprimes.
- Une reprsentation trs complexe tenant compte des diffrents groupes fonctionnels, des
bactries lithotrophes, htrotrophes, qui peut galement considrer les bactries et les Archaea,
les diffrents produits co-mtabolissetc. Une telle reprsentation sera plutt lapanage des
microbiologistes et des biochimistes dsireux de dcrire la complexit du bioprocd.
La ncessit de trouver un compromis alliant simplicit pour permettre lanalyse
mathmatique et complexit pour une bonne reprsentation du vivant constitue un apport
bnfique mutuel aux diffrents champs disciplinaires. De la mme faon, la modlisation dun
systme biologique ncessite une dmarche progressive qui nest pas forcment vidente pour un
microbiologiste de formation qui aura tendance vouloir aller directement vers un modle
complexe considrant beaucoup despces en interactions. Des collaborations avec des
modlisateurs permettent dviter de tels cueils et de vrifier la pertinence du modle et de
loptimisation de celui-ci sur les donnes exprimentales chaque tape.
Ainsi, le monde microbien, ses outils de culture tels que le chmostat et les outils danalyse
de sa diversit telles que les empreintes molculaires constituent un ensemble trs intressant
Discussion gnrale, conclusion et perspectives
179

tant pour amliorer nos connaissances en cologie que pour rpondre des objectifs concrets
comme la dpollution de leau ou la production dnergies alternatives (i.e. biogaz,
biocarburants). Il ne fait aucun doute que lutilisation de ce formidable potentiel sera dautant
plus pertinente que les projets de recherche seront transdisciplinaires.


180












181






Rfrences bibliographiques,
liste des illustrations,
liste des tableaux



182







Rfrences bibliographiques
183

RFRENCES BIB RFRENCES BIB RFRENCES BIB RFRENCES BIBLIOGRAPHIQUES LIOGRAPHIQUES LIOGRAPHIQUES LIOGRAPHIQUES
A
Aarssen, L. W. (1997). "High productivity in grassland ecosystems: effected by species diversity
or productive species." OIKOS 80: 183-184.

Ahmad, N., H. Xu, et al. (2008). "Enhanced biological nutrient removal by the alliance of a
heterotrophic nitrifying strain with a nitrogen removing ecosystem." Journal of Environmental
Sciences 20: 216-223.

Alcaraz-Gonzalez, V., R. Salazar-Pena, et al. (2005). "A tunable multivariable nonlinear robust
observer for biological systems." Biological modelling 328: 317-325.

Alexander, M., K. C. Marshall, et al. (1960). "Autotrophy and heterotrophy in nitrification."
Translation of International Congress in Soil Science 7th. Madison, Wisconsin, United State of
America: 586-591.

Alonso, M. C., J. Rodriguez, et al. (1999). "Enumeration and isolation of viral particles from
oligotrophic marine environments by tangential flow filtration." International Microbiology 2:
227-232.

Amann, R., J. Snaidr, et al. (1996). "In situ visualization of high genetic diversity in a natural
microbial community." Journal of bacteriology 178(12): 3496-3500.

Andrews, J. (1968). "A mathematical model for the continuous culture of microorganisms
utilizing inhibitory substrate." Biotechnology and bioengeenering 10: 707-723.

Andrews, J. H. (1991). "Comparative Ecology of microorganisms and macroorganisms."
Editions of Springer-Verlag, Berlin, Germany.

Anthonisen, A. C., R. C. Loehr, et al. (1976). "Inhibition of nitrification by ammonia and nitrous
acid." Journal of the Water Pollution Control Federation 48(5): 835-852.

Arditi, R., J. Michalski, et al. (2005). "Rheagogies : modelling non-trophic effects in food webs."
Ecological Complexity 2: 249-258.

Atlas, R. M. and R. Bartha (1998). "Microbial Ecology: Fundamentals and Applications."
Editions Benjamin Cummings, London, England Vol. 4.
B

Bail, O. (1929). "Ergebnisse experimenteller populationsforschung." Zeitung Immun-Forsch 60:
10-15.

Bailey, J. E. and D. F. Ollis (1986). "Biochemical engineering fundamentals." McGraw-Hill.

Bano, N., S. Ruffin, et al. (2004). "Phylogenetic composition of Arctic Ocean archaeal
assemblages and comparison with Antarctic assemblages." Applied and Environmental
Microbiology 70: 781-789.

Rfrences bibliographiques
184

Barghoorn, E. S. and J. W. Schopf (1966). "Microorganisms three billion years old from the
Precambrian of South Africa." Science 152(3723): 758-763.

Bastin, G. and D. Dochain (1990). "On-line estimation and adaptative control of bioreactors."
Elsevier.

Bell, G. (2001). "Neutral macroecology." Science 293: 2413-2418.

Berlow, E. L., A. M. Neutel, et al. (2004). "Interaction strengths in food webs: issues and
opportunities." Journal of Animal Ecology 73: 585-598.

Bernard, O. (2004). "La modlisation des systmes biologiques : Allers-retours le long des
fleuves qui circulent entre l'ocan du rel et le lac des modles." Habilitation diriger des
recherches: 1-95.

Bertness, M. D., G. H. Leonard, et al. (1999). "Testing the relative contribution of positive and
negative interactions in rocky intertidal communities." Ecology 80: 2711-2726.

Bock, E., H. P. Koops, et al. (1986). "Cell biology of nitrifying bacteria." In: Nitrification, pp.
17-38. Prosser J.I. (ed), IRL Press, Oxford.

Bock, E., H. P. Koops, et al. (1989). "Nitrifying bacteria." In Autotrophic bacteria Schlegel H.G.
and Bowien B. editions Springer-Verlag, Berlin: 81-96.

Bock, E., H. P. Koops, et al. (1991). "The biochemistry of nitrifying microorganisms." Shively
J.M. and Barton L.L. editions, Academic Press, London, England: 171-200.

Bock, E. and M. Wagner (2001). "Oxidation of inorganic nitrogen compounds as an energy
source." In: Dworkin M. et al (eds). The prokaryotes: an evolving electronic resource for the
microbiological community. Springer, Berlin, Heidelberg New York.

Bohannan, B. J. M. and R. E. Lenski (2000). "The relative importance of competition and
predation varies with productivity in a model community." American Naturalist 156: 329-340.

Boon, N., E. M. Top, et al. (2003). "Bioaugmentation as a Tool To Protect the Structure and
Function of an Activated-Sludge Microbial Community against a 3-Chloroaniline Shock Load."
Applied and Environmental Microbiology 69(3): 1511-1520.

Bothe, H., G. Jost, et al. (2000). "Molecular analysis of ammonia oxidation and denitrification in
natural environments." FEMS Microbiology reviews 24(5): 673-690.

Bougard, D. (2004). "Traitement biologique d'effluents azots avec arrt de la nitrification au
stade nitrite." Thse INRA-Laboratoire de Biotechnologies de l'Environnement.

Bougard, D., N. Bernet, et al. (2006). "Influence of closed loop control on microbial diversity in
a nitrification process." Water Science and Technology 53(4-5): 85-93.

Britton, N. F. (2004). "Essential mathematical biology." Editions Springer: 370 p.

Bruno, J. F. and M. I. O'Connor (2005). "Cascading effects of predator diversity and omnivory in
a marine food web." Ecology letters 8(10): 1048-1056.


Rfrences bibliographiques
185

C

Caldeira, M. C., A. Hector, et al. (2005). "Species richness, temporal variability and resistance of
biomass production in a Mediterranean grassland." Oikos 110(1): 115-123.

Cardinale, B. J. (2002). "Species diversity enhances ecosystem functioning through interspecific
facilitation." Nature 415: 426-429.

Cavalier-Smith, T. (2006). "Cell evolution and Earth history: stasis and revolution."
Philosophical transactions of the British Royal Society 361: 969-1006.

Chase, J. M., P. A. Abram, et al. (2002). "The interaction between predation and competition: a
review and synthesis." Ecology Letters 5: 302-315.

Cohen, J. E., F. Briand, et al. (1990). "Community food webs : data and theory." Editions
Springer-Verlag, Berlin.

Contois, D. E. (1959). "Kinetics of bacterial growth : relationship between population density
and specific growth rate f continuous cultures." The Journal of general microbiology 21: 40-50.

Costanza, R., R. dArge, et al. (1997). "The value of the world's ecosystem services and natural
capital." Nature 387(6630): 253-260.

Crerar, D. A., A. G. Fischer, et al. (1980). "Metallogenium and biogenic deposition of
manganese from Precambrian to recent time." In Geology and geochemistry of manganese.
Editions Schweizerbart'sche Verlagsbuchhandlung, Stuttgart, Deutshland vol. III: 285-303.
D

Dabert, P., B. Sialve, et al. (2001). "Characterisation of the microbial 16S rDNA diversity of an
aerobic phosphorus-removal ecosystem and monitoring of its transition to nitrate respiration."
Journal of Applied Microbiology and Biotehnology 55: 500-509.

Daims, H., J. L. Nielsen, et al. (2001). "In situ characterization of Nitrospira-like nitrite oxidizing
bacteria active in wastewater treatment plants." Applied and Environmental Microbiology
67(11): 5273-5284.

De Angelis, D. L. (1975). "Stability and connectance in food web models." Ecology 56: 238-
243.

Deruiter, P. C., A. M. Neutel, et al. (1995). "Energetics, Patterns of Interaction Strengths, and
Stability in Real Ecosystems." Science 269(5228): 1257-1260.

Dochain, D. (1986). "On line parameter estimation, adaptive state estimation and control of
fermentation processes." Ph.D thesis, Universit Catholique de Louvain-la-Neuve, Belgique.

Dodd, M. E., J. Silvertown, et al. (1994). "Stability in the Plant-Communities of the Park-Grass-
Experiment - the Relationships between Species Richness, Soil-Ph and Biomass Variability."
Philosophical Transactions of the Royal Society of London Series B-Biological Sciences
346(1316): 185-193.

Rfrences bibliographiques
186

Drake, J. A., G. R. Huxel, et al. (1996). "Microcosms as models for generating and testing
community theory." Ecology 77(3): 670-677.

Drossel, B. and A. J. MacKane (2003). "Modelling food webs." In Handbook of Graphs and
Networks (eds S. Bornholdt and H.G. Schuster), pp. 218-247. Wiley-VCH, Berlin.

Duffy, J. E. (2002). "Biodiversity and ecosystem function: the consumer connection." Oikos 99:
201-219.

Duffy, J. E., J. P. Richardson, et al. (2003). "Grazer diversity effects on ecosystem functioning in
seagrass beds." Ecology letters 8: 301-309.

Dumont, M., A. Rapaport, et al. (2008). "Observers for microbial ecology - How including
molecular data into bioprocess modeling." Proceeding of the 16th Mediterranean conference on
control and automation.
E

Egli, K., C. Langer, et al. (2003). "Community analysis of ammonia and nitrite oxidizers during
start-up of nitritation reactors." Appl Environ Microbiol 69(6): 3213-22.

Farnleitner, A., N. Kreuzinger, et al. (2000). "Comparative analysis of denaturing gradient gel
electrophoresis and temporal temperature gradient gel electrophoresis in separating Escherichia
coli uidA amplicons differing in single base substitutions." Applied and Environmental
Microbiology 30: 427-431.

Feigenbaum, M. J. (1980). "The metric universal properties of period doubling bifurcations and
the spectrum for a route to turbulence." Annals of the New York academy of Sciences 357: 330-
336.

Fernandez, A., S. Huang, et al. (1999). "How stable is stable ? Function versus community
composition." Applied and Environmental Microbiology 65: 3697-3704.

Fischesser, B. and M. Dupuis-Tate (1996). "Le guide illustr de l'Ecologie." Editions de La
Martinire.

Fontaine, C., I. Dajoz, et al. (2006). "Functional diversity of plant-pollinator interaction webs
enhances the persistence of plant communities." PLoS Biology 4: 29-135.

Fox, G. E., K. Pechman, et al. (1977). "Comparative cataloging of 16S ribosomal ribonucleic
acid: molecular approach to prokaryotic systematics." Journal of Systematic in Bacteriology 27:
44-57.

Fox, J. W. and J. MacGrady-Steed (2002). "Stability and complexity in microcosm
communities." Journal of Animal Ecology 71: 749-756.

France, K. E. and J. E. Duffy (2006). "Consumer diversity mediates invasion dynamics at
multiple trophic levels." OIKOS 113: 515-529.

Fredrickson, S. A. (1977). "Behavior of mixed cultures of microorganisms." Annual Reviews of
Microbiology 31: 63-87.

Rfrences bibliographiques
187

Fromin, N., J. Hamelin, et al. (2002). "Statistical analysis of denaturing gel electrophoresis
(DGE) fingerprinting patterns." Environmental Microbiology 4: 634-643.

Frontier, S., D. Pichod-Viale, et al. (2004). "Ecosystme : Structure, Fonctionnement,
Evolution." Editions Dunod 3ime dition: 550 p.

Fuhrman, J. A. (1999). "Marine viruses and their biogeochemical and ecological effects." Nature
399: 541-548.

Fussmann, G. F., M. Loreau, et al. (2007). "Eco-evolutionary dynamics of communities and
ecosystems." Functional Ecology 21: 465-477.

Gardner, M. R. and W. R. Ashby (1970). "Connectance of a large (cybernetic) systems: critical
values for stability." Nature 228: 780-784.
G

Gause, G. F. (1934). "The struggle for existence." Editions Williams and Wilkins, Baltimore,
USA.

Giller, P. S., U. G. Berninger, et al. (2004). "Biodiversity effects on ecosystem functioning :
emerging issues and their experimental test in aquatic environments." OIKOS 104: 423-436.

Gleick, J. (1999). "La thorie du chaos : vers une nouvelle science." Editions Flammarion,
collection Champs, Paris, France: 431 p.

Godon, J. J., F. Duthoit, et al. (2001). "Utilisation d'une technique d'empreinte molculaire dans
l'tude d'cosystmes microbiens complexes. Application la fabrication d'un fromage au lait
cru "l'AOC Salers"." Lait 81: 257-262.

Godon, J. J., E. Zumstein, et al. (1997). "Microbial 16S rDNA diversity in an anaerobic
digester." Water Science and Technology 36(7): 49-55.

Gouz, J. L. (1995). "Analyse mathmatique qualitative de modles biologiques." Mmoire
d'habilitation diriger des recherches, Universit de Nice.

Graham, D. W., C. W. Knapp, et al. (2007). "Experimental demonstration of chaotic instability
in biological nitrification." The International Society for Microbial Ecology Journal 12(1-9).

Grant, P. R. (1999). "The ecology and evolution of Darwin's finches." Princeton University
Press, Oxford, England.

Greenleaf, W. E. (1926). "The influence of volume of culture medium and cell proximity on the
rate of reproduction of infusoria." Journal of Experimental Zoology 46: 143-167.

Grime, J. P., V. K. Brown, et al. (2000). "The response of two contrasting limestone grasslands
to simulated climate change." Science 289(5480): 762-765.

Grover, J. P. (1997). "Resource competition." Editions Chapman and Hall, New York, USA
Population and community biology series 19.

Rfrences bibliographiques
188

H

Hairston, N. G., F. E. Smith, et al. (1960). "Community structure, population control, and
competition." American Naturalist 94: 421-425.

Hall, G. H. (1986). "Nitrification in lakes." In: Nitrification, pp. 127-156. Prosser J.I. (ed), IRL
Press, Oxford.

Hanaki, K., C. Wantawin, et al. (1990). "Nitrification at low levels of dissolved oxygen with and
without organic loading in a suspended-growth reactor." Water Research 24(3): 297-302.

Hansen, S. R. and S. P. Hubbell (1980). "Single-nutrient microbial competition: qualitative
agreement between experimental and theoretically forecast outcomes." Science 207: 1491-1493.

Harder, W., J. G. Kuenen, et al. (1977). "A review of microbial selection in continuous culture."
Journal of Applied Bateriology 43: 1-24.

Harding, G. (1960). "The competitive exclusion principle." Science 131: 1292-1297.

Havens, K. (1992). "Scale and structure in natural food webs." Science 257(1107-1109).

Hayashi, K. (1991). "PCR-SSCP: a simple and sensitive method for the detection of mutations in
genomic DNA." PCR Methods Applications 1: 34-38.

Hayatsu, M., K. Tago, et al. (2008). "Various players in the nitrogen cycle: diversity and
functions of the microorganisms involved in nitrification and denitrification." Soil science and
plant nutrition 54: 33-45.

Hebeler, J., J. K. Schmidt, et al. (2006). "Coexistence in the chemostat as a result of metabolic
by-products." Journal of Mathematical Biology 53: 556-584.

Hector, A., B. Schmid, et al. (1999). "Plant diversity and productivity experiments in European
grasslands." Science 286(5442): 1123-1127.

Heldal, M. and G. Bratbak (1991). "Production and decay of viruses in aquatic environments."
Marine Ecology Progress Series 72: 205-212.

Hillier, S. H., D. W. H. Walton, et al. (1990). "Calcareous Grasslands, Ecology and
Management." Bluntisham editions, Huntingdon, England.

Holland, J. N., D. L. DeAngelis, et al. (2002). "Population dynamics and mutualism Functional
responses of benefits and costs." American Naturalist 159(3): 231-244.

Holling, C. S. (1973). "Resilience and stability of ecological systems." Annual Rewiev of
Ecology and Systems 4: 1-23.

Horner-Devine, M. C., M. A. Leibold, et al. (2003). "Bacterial diversity patterns along a gradient
of primary productivity." Ecology Letters 6(7): 613-622.

Hubbell, S. P. (2001). "The unified neutral theory of biodiversity and biogeography." Princeton
University Press, Oxford: 375 p.

Rfrences bibliographiques
189

Hughes, A. R. and J. J. Stachowicz (2004). "Genetic diversity enhances the resistance of a
seagrass ecosystem to disturbance." Proceedings of the National Academy of Sciences of the
United States of America 101(24): 8998-9002.

Huisman, J. and F. J. Weissing (1999). "Biodiversity of plankton by species oscillations and
chaos." Nature 402: 407-410.

Huisman, J. and F. J. Weissing (2000). "Coexistence and resource competition." Nature 4: 407-
432.

Hutchinson, G. E. (1957). "Concluding remarks." Proceedings of Cold Spring Harbour
Symposium on quantitative biology 22: 415-427.

Hutchinson, G. E. (1961). "The paradox of the plankton." American Naturalist 95(882): 137-145.

Hutson, M. A. (1997). "Hidden treatments in ecological experiments: re-evaluating the
ecosystem function of biodiversity." Oecologia 110: 449-460.

Huxley, T. H. (1888). "The struggle for existence and its bearing upon Man." Nineteenth
Century 23: 161-180.
I

Israel, G. (1996). "La mathmatisation du rel." Seuil.
J

Jacob, F. (2002). "Qu'est-ce que la Vie ?" Editions Odile Jacob, Paris, France.

Jessup, C. M., R. Kassen, et al. (2004). "Big questions, small worlds : microbial model systems
in ecology." Trends in Ecology and Evolution 19(4): 189-197.

Jetten, M. S. M., S. Logemann, et al. (1997). "Novel principles in the microbial conversion of
nitrogen compounds." Antonie Van Leeuwenhoek International Journal of General and
Molecular Microbiology 71(1-2): 75-93.

Jiang, S., W. Fu, et al. (2003). "The vertical distribution and diversity of marine bacteriophage at
a station off Southern California." Microbial Ecology 45: 399-410.

Jossi, M., N. Fromin, et al. (2006). "How elevated pCO2 modifies total and metabolically active
bacterial communities in the rhizosphere of two perennial grasses grown under field conditions."
FEMS Microbial Ecology 55: 339-350.

Jost, C. (2000). "Predator-prey theory : hidden twins in ecology and microbiology." Forum
90(1): 202-208.

Juretschko, S., G. Timmermann, et al. (1998). "Combined molecular and conventional analysis
of nitrifying bacterium diversity in activated sludge: Nitrosococcus mobilis and Nitrospira-like
bacteria as dominant populations." Applied and Environmental Microbiology 64(8): 3042-3051.

Rfrences bibliographiques
190

K

Kaewplpat, K. and J. Grady (2002). "Microbial population dynamics in laboratory-scale
activated sludge reactors." Water Science and Technology 46: 19-27.

Kahmen, A., J. Perner, et al. (2005). "Diversity-dependent productivity in semi-natural
grasslands following climate perturbations." Functional Ecology 19(4): 594-601.

Kardenavis, A. A., A. Kapley, et al. (2007). "Simultaneous nitrification and denitrification by
diverse Diaphorobacter sp." Applied Microbiology Biotechnology 77: 403-409.

Kerr, B., M. A. Riley, et al. (2002). "Local dispersal promotes biodiversity in a real-life game of
rock-paper-scissors." Nature 418(6894): 171-174.

Killham, K. (1986). "Heterotrophic nitrification." In: Nitrification, pp. 117-126. Prosser J.I. (ed),
IRL Press, Oxford.

Kim, J. K., K. J. Park, et al. (2005). "Aerobic nitrification-denitrification by heterotrophic
Bacillus strain." Bioressource Tehnology 96: 1897-1906.

Knowles, G., A. L. Downing, et al. (1965). "Determination of kinetic constants for nitrifying
bacteria in mixed culture, with the aid of an electronic computer." Journal of General
Microbiology 38: 263-278.

Koops, H. P. and A. Pommerening-Rser (2001). "Distribution and ecophysiology of the
nitrifying bacteria emphasizing cultured species." FEMS Microbial Ecology 37: 1-9.

Kowalchuk, G. A., A. W. Stienstra, et al. (2000). "Molecular analysis of ammonia-oxidizing
bacteria in soil of successional grasslands of the Drentesche A (The Netherlands)." FEMS
Microbiology Ecology 31(3): 207-215.

Kremen, C., N. M. Williams, et al. (2004). "The area requirements of an ecosystem service: Crop
pollination by native bee communities in California." Ecology Letters 7: 1109-1119.

Kuenen, J. G. and L. A. Robertson (1988). "Ecology of nitrification and denitrification." In: The
nitrogen and sulphur cycles, pp. 161-218. Cole J.A. and Fergusson S.J. (ed.), Cambridge
University Press, Cambridge.

Kuijper, L. D. J., B. W. Kooi, et al. (2003). "Omnivory and food web dynamics." Ecological
Modelling 163: 19-32.
L

Laanbroek, H. J. and S. Gerards (1993). "Competition for limiting amounts of oxygen between
Nitrosomonas europaea and Nitrobacter winogradsky grown in mixed continuous cultures."
Archives of Microbiology 159: 453-459.

Lane, D. J., B. Pace, et al. (1985). "Rapide determination of 16S ribosomal RNA sequences for
phylogenetic analysis." Proceeding of the National Academic in Science of the United State of
America 82: 6955-6959.

Lawton, J. H. (1995). "Ecological experiments with model systems." Science 269: 328-331.
Rfrences bibliographiques
191


Laylor, L. R. (1978). "A comment on randomly constructed model ecosystem." American
Naturalist 112: 445-447.

Lee, N., P. H. Nielsen, et al. (1999). "Combination of Fluorescent In Situ Hybridization and
Microautoradiography, a New Tool for Structure-Function Analyses in Microbial Ecology."
Applied and Environmental Microbiology 65(3): 1289-1297.

Leibold, M. A. (1995). "The niche concept revisited: mechanistic models and community
context." Ecology 75: 1371-1382.

Lemesle, V. and J. L. Gouz (2004). "Hybrid bounded error observers for uncertain bioreactor
models." Bioprocess and Biosystems Engineering 27: 311-318.

Lherminer, P. and M. Solignac (2000). "L'espce: dfinitions d'auteurs." Comptes Rendus de
l'Acadmie des Sciences - Series III - Sciences de la Vie 323(2): 153-165.

Li, B., S. Irvin, et al. (2007). "The variation of nitrifying bacterial population sizes in a
sequencing batch reactor (SBR) treating low, mid, high concentrated synthetic wastewater."
JOURNAL OF ENVIRONMENTAL ENGINEERING AND SCIENCE 6(6): 651-666.

Lin, Y., H. Kong, et al. (2007). "Isolation and characterization of a new heterotrophic nitrifying
Bacillus sp strain." Biomedical and Environmental Sciences 20: 450-455.

Lindeman, R. L. (1942). "The trophic-dynamic aspect of Ecology." Ecology 23: 399-418.

Liu, W., T. Marsh, et al. (1997). "Characterization of microbial diversity by determining terminal
restriction fragment lengtg polymorphisms of gene encoding 16S rRNA." Environmental
Microbiology 63: 4516-4522.

Lobry, C. and J. Harmand (2004). "A study about the coexistence of N species in the presence of
a single resource."

Loisel, P., J. Harmand, et al. (2005). "Denaturing gradient electrophoreses (DGE) and single-
strand conformation polymorphism (SSCP) molecular fingerprintings revisited by simulation and
used as a tool to measure microbial diversity." Environmental Microbiology 3: 43-52.

Loreau, M. (1998). "Biodiversity and ecosystem functioning: A mechanistic model."
Proceedings of the National Academy of Sciences of the United States of America 95(10): 5632-
5636.

Loreau, M. and W. Ebenhoh (1994). "Competitive exclusion and coexistence of species with
complex life cycles." Theoretical Population Biology 46: 58-77.

Loreau, M. and A. Hector (2001). "Partitioning selection and complementarity in biodiversity
experiments." Nature 412: 72-76.

Loreau, M., S. Naeem, et al. (2001). "Biodiversity and ecosystem functioning : current
knowledge and future challenges." Science 294(October 26): 804-808.

Lovelock, J. (1979). "Gaia, A new look at life on Earth." Oxford University Press.

Rfrences bibliographiques
192

Lueders, T. and M. W. Friedrich (2003). "Evaluation of PCR amplification bias by terminal
restriction fragment length polymorphism analysis of small-subunit rRNA and mcrA genes by
using defined template mixtures of methanogenic pure cultures and soil DNA extracts." Applied
and Environmental Microbiology 69: 320-326.
M

Mac Arthur, R. H. (1955). "Fluctuations of animal populations, and a measure of community
stability." Ecology 36: 533-536.

Mac Arthur, R. H. (1967). "The limiting similarity, convergence and divergence of coexisting
species." American Naturalist 101: 377-385.

Mac Arthur, R. H. and E. O. Wilson (1967). "The theory of island biogeography." Princeton
University Press, Oxford.

Mac Grady-Steed, J., P. M. Harris, et al. (1997). "Biodiversity regulates ecosystem
predictability." Nature 390: 162-165.

Macgillivray, C. W., J. P. Grime, et al. (1995). "Testing Predictions of the Resistance and
Resilience of Vegetation Subjected to Extreme Events." Functional Ecology 9(4): 640-649.

Madritch, M. D. and M. D. Hunter (2003). "Intraspecific litter diversity and nitrogen deposition
affect nutrient dynamics and soil respiration." Oecologia 136: 124-128.

Maranger, R. and D. F. Bird (1995). "Viral abundance in aquatic systems: a comparison between
marine and fresh waters." Marine Ecology Progress Series 121: 1-3.

Maranger, R., D. F. Bird, et al. (1994). "Viral and bacterial dynamics in Arctic sea ice during the
spring algal bloom near Resolute, N.W.T., Canada." Marine Ecology Progress Series 111: 121-
127.

Margulis, L. and M. J. Chapman (1998). "Endosymbioses: cyclical and permanent in evolution."
Trends in Microbiology 6(9): 342-345.

Margulis, L. and D. Sagan (2002). "L'Univers bactriel." Editions du Seuil: 339 p.

Martinez, N. D. (1992). "Constant connectance in community food webs." American Naturalist
139: 1208-1218.

Martinez, N. D. (1994). "Scale-dependent constraints on food-web structure." American
Naturalist 144: 935-1218.

Marzorati, M., L. Wittebolle, et al. (2008). "How to get more out of molecular fingerprints:
pratical tools for microbial ecology." Environmental Microbiology 10(6): 1571-1581.

Mathieu, J. P. (1991). "Dictionnaire de physique." Eyrolles: 567 p.

May, R. M. (1976). "Simple mathematical models with very complicated dynamics." Nature
261: 459-467.

Rfrences bibliographiques
193

May, R. M. (1981). "Theoretical Ecology, principles and applications." Editions Sinauer
Associates, Oxford, England.

McCann, K., A. Hastings, et al. (1998). "Weak trophic interactions and the balance of nature."
Nature 395(6704): 794-798.

Meers, J. L. (1971). "Effect of dilution rate on the outcome of chemostat mixed culture
experiments." Journal of General Microbiology 67: 359-361.

Memmott, J., N. M. Waser, et al. (2004). "Tolerance of pollinisation networks to species
extinctions." Proceedings of the Royal Society of London: Biological Sciences 271: 2605-2611.

Michalski, J. and R. Arditi (1999). "The complexity-stability problem in food web theory. What
can we learn from exploratory models." Advances in Environmental and Ecological Modelling
4: 91-119.

Moeseneder, M. M., J. M. Arrieta, et al. (1999). "Optimization of Terminal-Restriction Fragment
Length Polymorphism Analysis for complex marine bacterioplankton communities and
comparison with denaturing gradient gel electrophoresis." Applied and Environmental
Microbiology 65: 3518-3525.

Monod, J. (1950). "La technique de culture continue." Annales de l'Institut Pasteur 79: 390-410.

Montoya, J. M. and R. V. Sol (2003). "Topological properties of food webs: from real data to
community assembly models." Oikos 102: 614-622.

Mooney, H. A. and E. E. Cleland (2001). "The evolutionary impact of invasive species."
Proceedings of the National Academy of Sciences of the United States of America 98: 5446-
5451.

Mounier, J., C. Monnet, et al. (2008). "Microbial interactions within a cheese microbial
community." Applied and Environmental Microbiology 74(1): 172-180.

Moyer, C., F. Dobbs, et al. (1994). "Estimation of diversity and community structure through
restriction fragment length polymorphism distribution analysis of bacterial 16S rRNA genes
from microbial mat at an active, hydrothermal vent system, Loihi Seamount, Hawa." Applied
and Environmental Microbiology 60: 871-879.

Mulder, C. P. H., D. D. Uliassi, et al. (2001). "Physical stress and diversity-productivity
relationships: the role of positive interactions." Proceedings of the National Academy of
Sciences of the USA 98: 6704-6708.

Muller-Landau, H. C. (2002). "Assessing recruitment limitation: concepts, methods and case-
studies from tropical forest." Seed dispersal and frugivory: Ecology, Evolution and Conservation
5: 35-53.

Muyzer, G. (1999). "DGGE/TGGE a method for identifying genes from natural ecosystems."
Current Opinion in Microbiology 2: 3217-3322.

Muyzer, G. and K. Smalla (1998). "Application of denaturing gradient gel electrophoresis
(DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology." Antonie
Van Leeuwenhoek International Journal of General and Molecular Microbiology 73(1): 127-141.
Rfrences bibliographiques
194

N

Naeem, S. (1998). "Species redundancy and ecosystem reliability." Conservation Biology 12(1):
39-45.

Naeem, S., L. J. Thompson, et al. (1994). "Declining Biodiversity Can Alter the Performance of
Ecosystems." Nature 368(6473): 734-737.

Nagy, L. A. (1974). "Transvaal stromatolite: first evidence for the diversification of cells about
2.2x10
9
years ago." Science 183: 514-516.

Narihiro, T. and Y. Sekiguchi (2007). "Microbial communities in anaerobic digestion processes
for waste and wasterwater treatment: a microbiological update." Current Opinion in
Biotechnology 18(3): 273-278.

Nathan, R. and H. C. Muller-Landau (2000). "Spatial patterns of seed dispersal, their
determinants and consequences for recruitment." Trends in Ecology and Evolution 15(7): 278-
285.

Neufeld, J., M. Dumont, et al. (2007). "Methodological Considerations for the Use of Stable
Isotope Probing in Microbial Ecology." Microbial Ecology 53(3): 435-442.

Neutel, A. M., J. A. P. Heesterbeek, et al. (2002). "Stability in real food webs: Weak links in
long loops." Science 296(5570): 1120-1123.

Nogueira, R., L. F. Melo, et al. (2002). "Nitrifying and heterotrophic population dynamics in
biofilm reactors: effects of hydraulic retention time and the presence of organic carbon." Water
Research 36(2): 469-481.

Novick, A. and L. Szilard (1950). "Experiments with the chemostat on spontaneous mutations of
bacteria." Proceeding of the National Academic in Science of the United State of America 36:
708-719.
O

Odum, E. P. (1953). "Fundamentals of ecology." Saunders editions, Philadelphia, USA.

Ogier, J. C., O. Son, et al. (2002). "Identification of the bacterial microflora in dairy products by
temporal temperature gradient gel electrophoresis." Applied and Environmental Microbiology
68: 3691-3701.

Olson, J. M. (1970). "The Evolution of photosynthesis." Science 168: 438-446.

Ouverney, C. C. and J. A. Fuhrman (1999). "Combined Microautoradiography-16S rRNA Probe
Technique for Determination of Radioisotope Uptake by Specific Microbial Cell Types In Situ."
Applied and Environmental Microbiology 65(4): 1746-1752.
P

Pace, M. L., J. J. Cole, et al. (1999). "Trophic cascades revealed in diverse ecosystems." Trends
in Ecology and Evolution 14: 483-488.
Rfrences bibliographiques
195


Paine, R. (2002). "Trophic control of production in a rocky intertidal community." Science 296:
736-739.

Paine, R. T. (1992). "Food-Web Analysis through Field Measurement of Per-Capita Interaction
Strength." Nature 355(6355): 73-75.

Painter, H. A. (1970). "A review of litterature on inorganic nitrogen metabolism in
microorganisms." Water Research 4: 393-450.

Pallen, M. and N. J. Mattzke (2006). "From the Origin of species to the origin of bacterial
flagella." Nature 4: 784-790.

Park, T. (1948). "Experimental studies of interspecific competition. Competition between
populations of the flour beetles Tribolium confusum and Tribolium castaneum." Ecological
Monographs 98: 265-308.

Park, T. (1954). "Experimental studies of interspecific competition. Temperature, humidity and
competition in two species of Tribolium." Physiological Zoology 27: 177-238.

Park, T. (1957). "Experimental studies of interspecific competition. Relation of initial species
proportion to the competitive outcome in populations of Tribolium." Physiological Zoology 30:
22-40.

Pearl, R. and S. L. Parker (1922). "On the influence of density of population upon the rate of
reproduction in Drosophila." Proceedings of the National Academy of Sciences of the United
States of America 8: 212-219.

Peitgen, H. O., H. Jurgens, et al. (1992). "Chaos and fractals: new frontiers of science and quot."
Editions Springer-Verlag, Berlin, Deutschland.

Perrier, E. (1996). "La philosophie zoologique avant Darwin." Editions F. Alcan, Paris, France.

Persson, F., T. Wik, et al. (2002). "Distribution and activity of ammonia oxidizing bacteria in a
large full-scale trickling filter." Water Research 36(6): 1439-1448.

Pfisterer, A. B., J. Joshi, et al. (2005). "Rapid decay of diversity-productivity relationships after
invasion of experimental plant communities." Basic Applied Ecology 5: 5-14.

Pimm, S. L. (1982). "Food webs." Chapman and Hall editions, London, England.

Poduska, R. A. and J. F. Andrews (1975). "Dynamics of nitrification in the activated sludge
process." Journal of the Water Pollution Control Federation 47(11): 2599-2620.

Popper, K. (1972). "La connaissance objective." Editions Flammarion.

Post, D. M. (2002). "The long and short of food-chain length." Trends in Ecology and Evolution
17: 169-277.

Purkhold, U., A. Pommerening-Roser, et al. (2000). "Phylogeny of all recognized species of
ammonia oxidizers based on comparative 16S rRNA and amoA sequence analysis: Implications
for molecular diversity surveys." Applied and Environmental Microbiology 66(12): 5368-5382.

Rfrences bibliographiques
196

Putman, R. J. and S. D. Wratten (1984). "Principles of Ecology." Editions Croon Helm, London,
England.
Q

Qu, Y., J. Zhou, et al. (2005). "Microbial community dynamics in bioaugmented sequencing
batch reactors for bromoamine acid removal." FEMS Microbiology letters 246: 143-149.
R

Raskin, L., L. K. Poulsen, et al. (1994). "Quantification of methanogenic groups in anaerobic
biological reactors by oligonucleotide probe hybridization." Applied and Environmental
Microbiology 60: 1241-1248.

Ringel, M. S., H. H. Hu, et al. (1996). "The stability and the persistence of mutualisms
embedded in community interactions." Theoretical Population Biology 50: 281-297.

Rixen, C. and C. P. H. Mulder (2005). "Improved water retention links high species richness
with increased productivity in artic tundra moss communities." Theoretical Population Biology
50: 281-297.

Roszak, D. B. and R. R. Colwell (1987). "Metabolic activity of bacterial cells enumerated by
direct viable count." Applied and Environmental Microbiology 53: 2889-2893.

Roszak, D. B., D. J. Grimes, et al. (1984). "Viable but nonrecoverable stage of Salmonella
enteritidis in aquatic systems." Canadian Journal of Microbiology 30: 334-338.

Rowann, A. K., G. Moser, et al. (2003). "A comparative study of ammonia-oxidizing bacteria in
lab-scale industrial wastewater treatment reactors." Water Science and Technology 48(3): 17-24.

Ruan, S., A. Ardito, et al. (2007). "Coexistence in competition models with density-dependent
mortality." Biological modelling 330: 845-854.

Rudolph, V. H. W. (2007). "The interaction of cannibalism and omnivory: Consequences for
community dynamics." Ecology 88(11): 2697-2705.
S

Saikaly, P. E. and D. B. Oerther (2003). "Bacterial competition in activated sludge: theoretical
analysis of varying solids retention times on diversity." Microbial Ecology 48: 274-284.

Saikaly, P. E. and D. B. Oerther (2004). "Bacterial competition in activated sludge: theoretical
analysis of varying solids retention times on diversity." Microbial Ecology 48: 274-284.

Sanguin, H., A. Herrera, et al. (2006). "Development and validation of a prototype 16S rRNA-
based taxonomic microarray for Alphaproteobacteria." Environmental Microbiology 8(2): 289-
307.

Sarkai, K., Y. Ikehata, et al. (1996). "Nitrite oxidation by heterotrophic bacteria under various
nutritional and aerobic conditions." Journal of Fermentation and Bioengineering 6: 613-617.

Rfrences bibliographiques
197

Schippers, P., A. M. Verschoor, et al. (2001). "Does "supersaturated coexistence" resolve the
"paradox of the plankton" ?" Ecology letters 4: 404-407.

Schluter, D. (1994). "Experimental evidences that competition promote divergence in adaptative
radiation." Science 266: 798-801.

Schoener, T. (1974). "Resource partitioning in ecological communities." Science 185: 27-39.

Schramm, A., D. Debeer, et al. (1998). "Identification and activities in situ of Nitrospira and
Nitrospira spp. as dominant populations in a nitrifying fluidized bed reactor." Applied and
Environmental Microbiology 64(9): 3480-3485.

Schroeder, E. D. (1985). "Nitrification in activated sludge processes." Comprehensive
Biotechnology Vol. 4. Oxford: Pergamon Press: 871-880.

Schwieger, F. and C. C. Tebbe (1998). "A new approach to utilize PCR-single-strand-
conformation-polymorphism for 16S rRNA gene-based microbial community analysis." Applied
and Environmental Microbiology 64: 4870-4876.

Sghaier, H., K. Ghedira, et al. (2008). "Basal DNA repair machinery is subject to positive
selection in ionizing-radiation-resistant bacteria." BMC Genomics 9: 297-302.

Shannon, E. and W. Weaver (1962). "The mathematical theory of communication." The
University of Illinois Press, Urbana, Illinois, USA.

Shelford, V. and F. Clements (1939). "Bio-Ecology." John Wiley editions, Illinois, USA.

Sibuet, D. C. and K. Olu (1998). "Biogeography, diversity and fluid dependence of deep-sea
cold-seep communities at active and passive margins." Deep Sea Research Part II: Topical
Studies in Oceanography 45: 517-567.

Simpson, E. H. (1949). "Measurement of diversity." Nature 163: 672-688.

Sliekers, A. O., S. C. Haaijer, et al. (2005). "Competition and coexistence of aerobic ammonium-
and nitrite-oxidizing bacteria at low oxygen concentrations." Applied and Environmental
Microbiology 68: 808-817.

Sommer, U. (1985). "Comparison between steady state and non-steady state competition:
experiments with natural phytoplankton." Limnology and Oceanography 30: 335-346.

Sonea, S. and M. Panisset (1983). "Introduction la nouvelle bactriologie." Montreal
University Press: 143 p.

Sorensen, B. H. and S. E. Jorgensen (1993). "The removal of nitrogen compounds from
watewater." Elsevier, Amsterdam, Netherlands Studies in environmental sciences.

Spehn, E. M., A. Hector, et al. (2005). "Ecosystem effects of biodiversity manipulations in
European grasslands." Ecological Monographs 75(1): 37-63.

Sree Hari Rao, V. and P. Raja Sekhara Rao (2005). "Mathematical models of the microbial
populations and issues concerning stability." Chaos, Solitons and Fractals 23: 657-670.

Rfrences bibliographiques
198

Stachowicz, J. J., J. F. Bruno, et al. (2007). "Understanding the effects of marine biodiversity on
communities ans ecosystems." Annual Review of Ecology Evolution and Systematics 38: 739-
766.

Stackerbrandt, E., W. Frederiksen, et al. (2002). "Report of the ad hoc committee for the re-
evaluation of the species definition in bacteriology." International Journal of Systematic and
Evolutionary Microbiology 52: 1043-1047.

Stackerbrandt, E. and B. M. Goebel (1994). "Taxonomic note: a place for DNA-DNA
reassociation and 16S rRNA sequence analysis in the present species definition in bacteriology."
International Journal of Systematic Bacteriology 44: 846-849.

Stackerbrandt, E. and F. Rainey (1995). "Partial and complete 16S rDNA sequences, their use in
generation of 16S rDNA phylogenetic trees and their implications in molecular ecological
studies." Molecular Microbial Ecology 4: 27-34.

Stephanopoulos, G., A. Aristidou, et al. (1998). "Metabolic Engineering." Elsevier Science.

Su, J. J., K. S. Yeh, et al. (2006). "A strain of Pseudomonas sp. isolated from piggery wastewater
treatment systems with heterotrophic nitrification capability in Taiwan." Current Microbiology
53: 77-81.
T

Taylor, S. L. (1988). "The construction and turnover of complex community models having
generalized Lotka-Volterra dynamics." Journal of Theoretical Biology 135: 569-588.

Tempkin, J. A. and J. A. Yorke (2007). "Spurious Lyapunov exponents computed from data."
SIAM Journal on Applied Dynamical Systems 6(2): 457-474.

Teske, A., E. Alm, et al. (1994). "Evolutionary relationships among ammonia- and nitrite-
oxidizing bacteria." Journal of Bacteriology 176(21): 6623-6630.

Thebault, E. and M. Loreau (2003). "Food-web constraints on biodiversity-ecosystem
functioning relationships." Proceedings of the National Academy of Sciences of the United
States of America 100(25): 14949-14954.

Thbault, E. and M. Loreau (2006). "The reationship between biodiversity and ecosystem
functioning in food webs." Ecological Research 21: 17-25.

Theron, J. and T. E. Cloete (2000). "Molecular techniques for determining microbial diversity
and community structure in natural environments." Critical Review of Microbiology 26: 37-57.

Thingstad, F. T. and R. Lignell (1997). "Theoretical models for the control of bacterial growth
rate abundance, diversity and carbon demand." Aquatic Microbial Ecology 13: 19-27.

Tilman, D. (1996). "Biodiversity: population versus ecosystem stability." Ecology 77: 350-353.

Tilman, D. (1996). "Productivity and sustainability influenced by biodiversity in grassland
ecosystems." Nature 379: 718-720.

Rfrences bibliographiques
199

Tilman, D. and J. A. Downing (1994). "Biodiversity and stability in grasslands." Nature 367:
165-175.

Tilman, D., C. Lehman, et al. (1998). "Diversity-stability relationships: Statistical inevitability or
ecological consequence ?" American Naturalist 151(3): 277-282.

Tilman, D., C. L. Lehman, et al. (1997). "Plant diversity and ecosystem productivity: Theoretical
considerations." Proceedings of the National Academy of Sciences of the United States of
America 94(5): 1857-1861.

Tilman, D., P. B. Reich, et al. (2001). "Diversity and productivity in a long-term grassland
experiment." Science 294: 843-845.

Tokeshi, M. (1999). "Species coexistence: ecological and evolutionary perspectives." Cambridge
University Press, England.

Travisano, M. and P. B. Rainey (2000). "Studies of adaptative radiation using model microbial
systems." American Naturalist 156: 35-44.

Troumbis, A. Y., P. G. Dimitrakopoulos, et al. (2000). "Hidden diversity and productivity
patterns in mixed Mediterranean grasslands." OIKOS 90: 549-559.

Tunnicliffe, V., A. G. Mac Arthur, et al. (1998). "A biogeographical perspective of the deep sea
hydrothermal Vent fauna." Advances in Marine Biology 34: 355-442.
V

Van der Heijden, M. G. A., J. N. Klironomos, et al. (1998). "Mycorrhizal fungal diversity
determines plant biodiversity, ecosystem variability and productivity." Nature 396(6706): 69-72.

Van Niel, E. W. J., P. A. M. Arts, et al. (1993). "Competition between heterotrophic and
autotrophic nitrifiers for ammonia in chemostat cultures." FEMS Microbiology Ecology 102:
109-118.

VanPeteghem, D., O. Zemb, et al. (2008). "Dynamics of neutral biodiversity." Mathematical
Biosciences 212(1): 88-98.

Vignais, P. (2001). "La biologie, des origines nos jours: une histoire des ides et des Hommes."
Grenoble Sciences ditions: 473 p.

Volkov, I., J. R. Banavar, et al. (2003). "Neutral theory and relative species abundance in
ecology." Nature 424: 1035-1037.
W

Walker, B. (1992). "Biological diversity and ecological redundancy." Conservation Biology 6:
18-23.

Wardle, D. A. (2001). "Experimental demonstration that plant diversity reduces invasibility:
evidence of a biological mechanism or a consequence of sampling effect ?" OIKOS 95: 161-170.

Rfrences bibliographiques
200

Watson, S. W., E. Bock, et al. (1989). "Nitrifying bacteria." In Bergey's manual of systematic
bacteriology The Williams and Wilkins Co editions, Baltimore: 1808-1834.

Wery, N., V. Bru-Adam, et al. (2008). "Dynamics of Legionella spp. And bacterial populations
during the proliferation of L. pneumophila in a cooling tower facility." Applied and
Environmental Microbiology 4: 30-37.

Whitehead, A. N. (1922). "The Principle of Relativity with Applications to Natural Science."
Cambridge University Press, England.

Whitham, T. G., W. P. Young, et al. (2003). "Community and ecosystem genetics: A
consequence of the extended phenotype." Ecology 84(3): 559-573.

Williams, R. J. and N. D. Martinez (2000). "Simple rules yield complex food webs." Nature 404:
180-183.

Winogradsky, M. S. (1888). "Recherches sur les organismes de la nitrification." Annales de
l'Institut Pasteur 5: 257-275.

Woese, C. R. (1987). "Bacterial evolution." Microbiological Review 51: 221-271.

Woese, C. R. and G. E. Fox (1977). "Phylogenetic structure of the prokaryotic domain: The
primary kingdoms." Proceeding of the National Academic in Science of the United State of
America 74: 5088-5090.

Woese, C. R., O. Kandler, et al. (1990). "Towards a natural system of organisms: Proposal for
the domains Archaea, Bacteria and Eucarya." Proceeding of the National Academic in Science of
the United State of America 87(12): 4576-4579.

Wommack, K. E. and R. R. Colwell (2000). "Virioplankton: Viruses in aquatic ecosystems."
Microbiology and Molecular Biology reviews 64(1): 69-114.

Wong, T., A. Amidi, et al. (2007). "Evolution of the bacterial flagellum." Microbe 2(7): 335-340.

Wootton, J. T. (1994). "Putting the Pieces Together - Testing the Independence of Interactions
among Organisms." Ecology 75(6): 1544-1551.

Wyffels, S., P. Boeckx, et al. (2004). "Nitrogen removal from sludge reject water by a two-stage
oxygen-limited autotrophic nitrification denitrification process." Water Science and Technology
49(5-6): 57-64.
Y

Yachi, S. and M. Loreau (1999). "Biodiversity and ecosystem productivity in a fluctuating
environment: The insurance hypothesis." Proceedings of the National Academy of Sciences of
the United States of America 96: 1463-1468.
Z

Zemb, O. (2006). "L'cosystme a-t-il une mmoire ? Importance de l'histoire sur la rsilience
fonctionnelle de communauts bactriennes htrotrophes marines et anarobies." Thse de
Doctorat, Universit Montpellier II, France: 252 p.
Rfrences bibliographiques
201


Zemb, O., B. Haegeman, et al. (2007). "SAFUM: statistical analysis of SSCP fingerprints using
PCA projections, dendrograms and diversity estimators." Molecular Ecology Notes 7(5): 767-
770.

Zemb, O., L. Urios, et al. (2008). "Efficient method to isolate and purify viruses of bacteria from
marine environments." Letters in Applied Microbiology 47(1): 41-45.

Zumstein, E., R. Moletta, et al. (2000). "Examination of two years of community dynamics in an
anaerobic bioreactor using fluorescence polymerase chain reaction (PCR) single-strand
conformation polymorphism analysis." Environmental Microbiology 2(1): 69-78.





202








Liste des illustrations
203

LISTE DES ILLUSTRATIONS LISTE DES ILLUSTRATIONS LISTE DES ILLUSTRATIONS LISTE DES ILLUSTRATIONS
Figure 1 : Schma reprsentant les interactions stablissant dans un cosystme donn.............. 21
Figure 2 : Valeurs de la richesse spcifique correspondant au nombre despces coexistant dans
un espace considr. Les individus sont reprsents ici par des carrs et les espces par des
couleurs, lensemble de chaque damier constituant le peuplement considr................................. 26
Figure 3 : Valeurs de lindice de Shannon-Weaver pour diffrents types de peuplement. Les
individus sont reprsents ici par des carrs et les espces par des couleurs, lensemble de chaque
damier constituant le peuplement considr.................................................................................... 26
Figure 4 : Valeurs de lindice de diversit de Simpson (i.e. gale 1-D) pour diffrents types de
peuplement. Les individus sont reprsents ici par des carrs et les espces par des couleurs,
lensemble de chaque damier constituant le peuplement considr................................................ 27
Figure 5 : Valeurs de lindice de diversit de Hill pour diffrents types de peuplement. Les
individus sont reprsents ici par des carrs et les espces par des couleurs, lensemble de chaque
damier constituant le peuplement considr.................................................................................... 27
Figure 6 : Relation entre la diversit (en termes de nombre despces) et la connectance selon
deux modalits dinteractions : spcifiques (figures de gauche o chaque espce entretient une
relation particulire avec une autre espce) ou gnralistes (figures de droite o chaque espce
entretient des relations avec plusieurs autres espces). Le nombre dinteractions par espce est
dsign par L , la connectance au niveau de la communaut par c ...................................... 28
Figure 7 : Schma reprsentant la classification phnomnologique des interactions biotiques
pouvant stablir entre deux ou plusieurs individus despces identiques ou diffrentes
(reprsentes par les cercles colors nomms X
1
et X
2
suivant la nomenclature mathmatique
usuelle) dans un cosystme donn (daprs Odum, 1953)............................................................. 29
Figure 8 : Schma reprsentant la classification mcaniste des interactions biotiques pouvant
stablir entre deux ou plusieurs individus despces identiques ou diffrentes (reprsentes par
les cercles colors nomms X
1
et X
2
suivant la nomenclature mathmatique usuelle) dans un
cosystme donn (daprs Fredrickson, 1977)............................................................................... 30
Figure 9 : Schma reprsentant diffrents rseaux trophiques ainsi que les interactions directes
(reprsentes par les flches continues) et indirectes (reprsentes par les flches discontinues)
stablissant entre les diffrents organismes qui composent les diffrents niveaux trophiques :
producteurs primaires (P), consommateurs primaires (H) et consommateurs secondaires (C)....... 31
Figure 10 : Schma reprsentant les pertes nergtiques le long dun rseau trophique partir de
1 000 000 joules dnergie solaire reus au cours dune priode donne........................................ 31
Figure 11 : Comparaison dun modle de variations priodiques temporelles avec les variations
rellement obtenues partir dobservations ralises dans le temps avec une frquence leve.... 40
Figure 12 : Schma reprsentant les diffrentes allures globales ou orbites des courbes intgrales.
Les graphiques du haut reprsentent la dynamique dun systme en visualisation classique tandis
que les graphiques du bas reprsentent les mmes dynamiques visualises dans lespace des
phases (a) Lorbite converge vers un point dquilibre. (b) Lorbite saccumule autour dune
Liste des illustrations
204

orbite priodique. (c) Lorbite prsente plusieurs boucles priodiques. (d) Lorbite prend la
forme en aile de papillon (daprs Gleick, 1999)............................................................................ 41
Figure 13 : Dynamiques dune population selon une suite logistique en fonction de la valeur du
paramtre r (daprs Gleick, 1999)............................................................................................ 46
Figure 14 : Dynamiques dune population selon une suite logistique en fonction de la valeur des
paramtres X
0
et r (daprs Gleick, 1999)........................................................................... 46
Figure 15 : Dynamiques dune population selon le modle logistique, ou de Verhulst, en fonction
de la valeur des paramtres X0 et r (daprs Feigenbaum, 1980)....................................... 47
Figure 16 : Espaces des phases du modle de Lotka-Volterra et volution de labondance des
proies et des prdateurs de part et dautres des isoclines nulles du systme................................... 50
Figure 17 : Oscillations entretenues indfiniment des populations de prdateurs et de proies selon
le modle de Lotka-Volterra............................................................................................................ 50
Figure 18 : Donnes gnres des populations de prdateurs et de proies selon le modle de
Lotka-Volterra tenant compte dune limitation densit-dpendante des deux espces. A gauche
figurent les oscillations amorties telles que donnes par le modle. A droite les mmes donnes
reprsentes sous espace de phases. ................................................................................................51
Figure 19 : Donnes gnres des populations de prdateurs et de proies selon le modle de
Lotka-Volterra tenant compte dune facilitation densit-dpendante des deux espces. A gauche
figurent les oscillations amorties telles que donnes par le modle. A droite les mmes donnes
reprsentes sous espace de phases..................................................................................................51
Figure 20 : Schma du cycle de lazote (source : wikipedia).......................................................... 58
Figure 21 : Corrlation entre la baisse de productivit en biomasse et la perte de diversit, en
termes de richesse spcifique, telle que dmontre par les travaux dHector et al. (1999) dans
diffrents pays dEurope : Allemagne, Irlande, Royaume Unis, Suisse, Portugal, Sude et
Grce................................................................................................................................................ 59
Figure 22 : Corrlation entre la diversit des espces assembles et la capacit totale de
consommation dune ressource, telle que dmontre par les travaux de Cardinale (2002)............. 60
Figure 23 : Schma reprsentant les diffrents types de modles mathmatiques visant la
simulation de rseaux trophiques. Les ronds correspondent ici aux espces et les flches aux
interactions trophiques. 1) Schma dun rseau trophique stochastique (i.e. o les interactions
sont dtermines ne manire alatoire). 2) Schma dun rseau trophique structur (i.e. o les
interactions sont tablies de manire rendre compte dun certain ralisme biologique). 3)
Schma dun rseau trophique structur o figurent en vert les rhagogies telles que dfinies
par Arditi et al. (2005)..................................................................................................................... 69
Figure 24 : Arbre phylogntique des trois domaines du vivant. Cet arbre a t ralis par la
mthode de maximum de vraisemblance et de parcimonie partir du squenage dADN
ribosomiques des reprsentants de chaque domaine du vivant (daprs Woese et al., 1990)..........77
Figure 25 : Schma des grandes divergences du vivant menant la complexit actuelle. La
divergence ayant conduit la formation des Eucaryotes, entre autres, demeure incertaine
notamment quant une origine archaebactrienne ou bactrienne................................................. 79
Figure 26 : Photos de stromatolithes (source : wikipedia)...............................................................79
Liste des illustrations
205

Figure 27 : Photos de diffrentes cultures en milieux synthtiques permettant ltude de ractions
enzymatiques par changement de coloration du milieu. (Source : Entreprise AES Chemunex)..... 83
Figure 28 : Les diffrentes phases de la croissance bactrienne en culture sur milieu ferm. I)
Phase de latence. II) Phase de croissance exponentielle. III) Phase maximale stationnaire. IV)
Phase de dcroissance (daprs Buchanan, 1918)............................................................................84
Figure 29 : Principe de lamplification en chane (ou PCR) dune squence cible partir dADN
total.................................................................................................................................................. 87
Figure 30 : Photo dun gel dlectrophorse permettant lobtention dune empreinte molculaire
dune communaut microbienne par la technique DGGE. Chaque bande reprsente un phylotype
diffrent et son intensit lumineuse permet dobtenir une indication quant son abondance
relative..............................................................................................................................................89
Figure 31 : Principe de la technique SSCP par lectrophorse capillaire........................................ 90
Figure 32 : Empreinte molculaire dune communaut microbienne par la technique T-RFLP
avec squenceur automatique. Chaque pic reprsente un phylotype diffrent et lintensit de sa
fluorescence permet dobtenir une indication quant son abondance relative............................... 91
Figure 33 : Schma dun racteur biologique.................................................................................. 94
Figure 34 : Reprsentations des taux de croissance de deux populations en comptition pour un
mme substrat limitant suivant la modlisation de Monod. I. Evolution du taux de croissance en
fonction du substrat quand
max1
>
max2
et K
1
>K
2
ou quand
max1
<
max2
et K
1
<K
2
. II. Evolution
du taux de croissance en fonction du substrat quand
max1
<
max2
et K
1
>K
2
ou quand
max1
>
max2

et K
1
<K
2
(daprs Harder et al., 1977).............................................................................................102
Figure 35 : Description des deux tapes successives de la raction de nitrification : la nitritation
et la nitratation................................................................................................................................ 107
Figure 36 : Arbre phylogntique des espces nitrifiantes lithotrophes connues (daprs Jetten et
al., 1997)......................................................................................................................................... 109
Figure 37 : Zones dinhibitions des bactries nitrifiantes en fonction du pH (Daprs Anthonisen
et al., 1976)..................................................................................................................................... 112
Figure 38 : Photo du dispositif exprimental comprenant cinq chmostats nitrification............. 113
Figure 39 : Schma reprsentant les diffrentes phases du protocole exprimental comprenant
des perturbations cibles ainsi que des perturbations globales biotiques et abiotiques.................. 119
Figure 40 : Theoretical scheme of the methodology used for functional community assigning of
bacteria in their environment using observers and molecular fingerprinting. (I) Bioreactions in a
given microbial ecosystem (II) Mathematical modeling of the bioreactions (III) Estimate of
functional biomasses using a mathematical observer (IV) Functional assigning of molecular
species present in the microbial ecosystem.................................................................................... 128
Figure 41 : Nitrifying performances in the two regularly disturbed chemostats A and B. Black
continuous line with diamond-shaped signs represents nitrite, dotted black line with round signs
represents nitrates and dotted grey line with triangular signs represents residual ammonium
concentrations expressed in g N.L-1 throughout the duration of experiments (in days).
Disturbances introduced during the kinetics in both reactors are indicated as follows: circle with
arrow represents increasing or decreasing flow rate, black arrow represents biotic disturbance, a
Liste des illustrations
206

black triangular sign represents increasing or decreasing substrate concentration and black star
represents a decreased in operating temperature from 30C to 25C......................... 129
Figure 42 : Evolution of functional communities and total biomass concentrations in both
chemostats A and B. Grey continuous line with round signs represents dynamics of total biomass
obtained by measurements, dotted black line with diamond-shaped signs represents active
biomass of AOB community generated by observers, and dotted black line with triangular signs
represents active biomass of NOB communities generated by observers expressed in g.L-1.
Disturbances made during the kinetics in both reactors are indicated as described in figure
41.....................................................................................................................................................130
Figure 43 : Relative abundance dynamics of the phylotypes detected by fingerprints.
Disturbances created during the kinetics in both reactors are indicated as described in figure 2.
Molecular fingerprints in boxed insert corresponding to samples from which 16S rDNA
sequencing was carried out. The numbers under some peaks refer to identifications obtained by
the method presented in tables 13 and 14....................................................................................... 131
Figure 44 : Nitrifying performances in the regularly disturbed chemostat. Black continuous line
with diamond-shaped signs represents nitrite, dotted black line with round signs represents
nitrates and dotted grey line with triangular signs represents residual ammonium concentrations
expressed in g N.L-1 throughout the duration of experiments (in days). Disturbances introduced
during the kinetics in both reactors are indicated as follows: circle with arrow represents
increasing or decreasing flow rate, black arrow represents biotic disturbance, a black triangular
sign represents increasing or decreasing substrate concentration and black star represents a
decreased in operating temperature from 30C to 25C................................................................. 151
Figure 45 : Microbial community in the chemostat. Dotted black line with diamond-shaped signs
represents the total biomass, others continuous grey level lines represents the dynamics of the 41
phylotypes detected by fingerprints in the nitrifying chemostat expressed in g.L-1 throughout the
duration of experiments (in days). Disturbances created during the kinetics in the chemostat are
indicated as described in figure 44..................................................................................................152
Figure 46 : Optimization of the microbial interactions model on the experimental data. Cross
signs represent the experimental data, continuous black line represents results of the optimization
of the microbial interactions model, and dotted black line represents results of the optimization
of the model without interactions................................................................................................... 153
Figure 47 : Growth rate (in H
-1
) of AOB and NOB functional communities composed of two
phylotypes for each one. At the top, continuous black line represents the growth rate of AOB
community when interactions were considered and dotted black line represents the growth rate
when interactions were not taking account. At the bottom, continuous black line represents the
growth rate of NOB community when interactions were considered and dotted black line
represents the growth rate when interactions were not taking account.......................................... 154
Figure 48 : Virtual interactions web between nitrifying bacteria obtained by the model.
Continuous black line represents positive interaction and dotted black line represents negative
interaction between two phylotypes................................................................................................155
Figure 49 : Evolution de la distance euclidienne entre le profil SSCP obtenu juste avant la
perturbation biotique globale consistant en le renouvellement de 10% de la biomasse prsente
Liste des illustrations
207

dans chaque chmostat par une biomasse nitrifiante plus diverse issue dun racteur de
rserve............................................................................................................................................. 162
Figure 50 : Suivi des concentration en nitrite (courbe noire continue), nitrates (courbe noire en
pointill) et de lazote rsiduel (courbe crise en pointill) en g N.L-1 aprs application de la
perturbation biotique globale consistant en le renouvellement de 10% de la biomasse prsente
dans chaque chmostat par une biomasse nitrifiante plus diverse issue dun racteur de rserve.
.........................................................................................................................................................162
Figure 51 : Evolution de la distance euclidienne entre le profil SSCP obtenu juste avant la
perturbation biotique cible consistant en le renouvellement de 20% de la biomasse prsente
dans chaque chmostat par une biomasse de la bactrie nitratante Nitrobacter hamburgensis...... 163
Figure 52 : Suivi des concentration en nitrite (courbe noire continue), nitrates (courbe noire en
pointill) et de lazote rsiduel (courbe crise en pointill) en g N.L-1 aprs application de la
perturbation biotique globale consistant en le renouvellement de 10% de la biomasse prsente
dans chaque chmostat par une biomasse nitrifiante plus diverse issue dun racteur de
rserve............................................................................................................................................. 164
Figure 53 : Dynamiques dune population selon le modle logistique, ou de Verhulst, en fonction
de la valeur des paramtres X0 et r. En vert, reprsentation sous forme du diagramme de
Feigenbaum. En bleu, valeurs de lexposant de Lyapunov correspondant..................................... 171



208














Liste des tableaux
209

LISTE DES TABLEAUX LISTE DES TABLEAUX LISTE DES TABLEAUX LISTE DES TABLEAUX
Tableau 1 : Comparaison des caractristiques entre les espces r et k (daprs Fischesser
et Dupuis-Tate, 1996)...................................................................................................................... 45
Tableau 2 : Tailles et organisation cellulaire des diffrents organismes constituant le monde
microbien......................................................................................................................................... 76
Tableau 3 : Les divisions majeures du domaine des Bactries (daprs Woese, 1987 modifi)..... 78
Tableau 4 : Pourcentage de la fraction cultivable de la diversit microbienne pour diffrents
types dcosystmes. Ce pourcentage reprsente le nombre dunits formant des colonies
bactriennes par rapport au nombre de bactries total dnombr par comptage direct au
microscope (daprs Amann et al., 1996)........................................................................................ 85
Tableau 5 : Composition de lalimentation des racteurs nitrification........................................ 114
Tableau 6 : Composition de la solution minrale........................................................................... 114
Tableau 7 : Composition des solutions de conservation des prlvements issus des chmostats en
vue de l'extraction de l'ADN total................................................................................................... 115
Tableau 8 : Squences des amorces utilises pour l'amplification de l'ADN (F=Forward=sens ;
R=Reverse=antisens)...................................................................................................................... 115
Tableau 9 : Constitution du mix PCR............................................................................................. 118
Tableau 10 : Conditions opratoires de la PCR-SSCP................................................................... 118
Tableau 11 : Rcapitulatif des conditions environnementales, de la communaut installe ainsi
que des fonctions exprimes pour les chmostats A, B et C juste avant perturbation globale
effectue t = 121 j.........................................................................................................................120
Tableau 12 : Milieux de culture pour Nitrobacter (d'aprs Bock et al, 1983 ; Schimdt et al,
1973)............................................................................................................................................... 120
Table 13 : Statistical assigning of phylotypes to the AOB or the NOB community. Mean relative
abundance was calculated for each phylotype during its period (in days) of presence. Phylotypes
highlighted in black represent the AOB community, phylotypes highlighted in grey represent the
NOB community and phylotypes highlighted in white represent no AOB and no NOB functional
community. Bold peak numbers with an asterisk refer to assigned peaks (Figure 43 and Table
14)................................................................................................................................................... 133
Table 14 : Results of 16S rDNA sequencing identification carried out for thirteen phylotypes
present in both chemostats and their functional assigning obtained by the mathematical approach.
*, indicates the number of clones identified under the same name in the database, compared to
the total number of clones obtained for each peak. Phylotypes highlighted in black represent the
AOB community, phylotypes highlighted in grey represent the NOB community and phylotypes
highlighted in white represent no AOB and no NOB functional community.................................134
Table 15 : Kinetic parameters of the microbial interactions model................................................ 151
Table 16 : Interactions coefficients (ij) of the microbial interactions model................................155


210






211


Annexes


212





Annexe 1
213

ANNEXE 1 ANNEXE 1 ANNEXE 1 ANNEXE 1


New observers for Microbial Ecology How including molecular data into
bioprocess modeling ?



Maxime Dumont
1
, Alain Rapaport
2
, Jrme Harmand
12
, Boumedien Benyahia
3
, Jean-Jacques
Godon
1



1
Laboratoire de Biotechnologie de lEnvironnement, INRA UR050, Avenue des Etangs,
Narbonne, France
2
INRA-INRIA MERE Research Team, UMR-ASB, 2 place Viala, Montpellier, France
3
Automatic control lab, University Abou Bekr Belkaid, Tlemcen, Algeria



16
th
Mediterranean Conference on Control and Automocion
Congress Centre, Ajaccio, France
June 25-27, 2008



Corresponding author:
Jrme Harmand
Laboratoire de Biotechnologie de lEnvironnement
Avenue des Etangs
F-11100 Narbonne
France
Telephone number: +33 (0) 468 425 159
Facsimile number: +33 (0) 468 425 160
E-mail address: harmand@supagro.inra.fr
Annexe 1
214

Abstract
In this paper, we show how specific tools of automatic control and in particular nonlinear
observer theory can be exploited together with microbiological data to answer the important
ecological problem of assigning a function to the species of ecosystems for a large class of
biosystems. Preliminary experimental results are also presented.
Introduction
When considering a complex microbial ecosystem (here, "complex means that we consider
ecosystems involving several interacting species, each of them possibly realizing different
functions), one objective may be to identify which species is responsible for what function of the
ecosystem. In other word, one important question is to assign to a given species "one of the
functions realized by the ecosystem". This "assignation problem" is related to the question of
"who does what?" in this ecosystem. To do so, recent molecular probes are available to monitor
functional groups, cf. for instance the principle of micro-arrays (Sanguin, Herrera et al. 2006).
However, these techniques are very specific ("you only see what you look for" or in other words
"you only see what you already know") and they are costly and time-consuming. An alternative
method proposed in this paper consists in using modeling tools together with molecular
fingerprinting techniques.
Molecular techniques offer a new way of monitoring microbial ecosystems. These genomic
techniques are based on the discrimination of small parts of the DNA (DesoxyriboNucleic Acid)
of a microorganism which differ from one species to another, coding to some extent for a
particular species. After the extraction of the total DNA of a sample and amplification by PCR
(Polymerase Chain Reaction), the "16S rDNA" molecules are separated. Using the natural
conformation polymorphism of these molecules, particular devices have been developed to
generate, by electrophoresis, some "profiles" also called "molecular fingerprints". In a recent
work, it has been shown, under appropriate conditions (and in particular for ecosystems with
relatively low diversity), that the relative abundances of species could be monitored with this
technique while it is not possible if the ecosystems under interest is too diverse (Loisel, Harmand
et al. 2005).
These techniques allow us to monitor the concentrations of the species that are present in the
ecosystem. Assuming a functional model, typically a mass-balance type model describing both
biomass and substrates/products dynamics (Bastin and Dochain 1990), is available, several
procedures can be used to identify the function of each species:
A "direct" approach may simply consist in using the individual species concentrations as
inputs of a submodel where the equations of the functional biomasses have been removed: the
Annexe 1
215

biomass concentration are no longer states of the system but are now some of its inputs. The best
combination of species concentrations explaining the substrates/products dynamics immediately
delivers the solution to the assignation problem. This solution is particularly attractive but
presents two important drawbacks: first, an accurate mass-balance functional model of the
system is needed. It is well known that such models are highly uncertain and difficult to obtain
Second, if the number of individual species concentrations (let us call it here N) is large, one may
have to realize an incredibly high number of system integrations (in fact, we must integrate the
system no less than 2
N
times!).
Several two-step "indirect" approaches consist in the following. In a first step, functional
biomass trajectories which best explain the substrate/products dynamics are generated in some
way while, in a second step, the combination of individual species concentrations which best
approximate these functional biomass trajectories are searched for. Such an indirect approach
presents several advantages. First, we will show that, under some conditions depending on the
available data, we can design a new class of observers that are independent on the process
kinetics (thus, the functional model of the system is no longer necessary). Second, there is no
longer a large number of integrations to realize: the only optimization problem to be solved is a
static problem to find the combination of individual species concentrations which best explains
the biomass trajectories generated during the first step of the procedure.
In this paper, we propose a new approach to solve the assignation problem for the large class
of biosystems involving P bioreactions in cascade realized by P microbial functional consortia in
which the product of the i
th
reaction is the substrate of the i+1
st
reaction. Such reactions can be
schematically represented by the reaction scheme:


An example of such reaction network is the anaerobic digestion process which consists in the
transformation, under anaerobic conditions, of organic carbon by a number of successive
reactions in cascade realized by several specific functional microbial consortia. However, this
process is known to exhibit a high diversity (Godon, Zumstein et al. 1997; Narihiro and
Sekiguchi 2007), which is, in the present case, a quite important limitation as it has been
underlined hereabove since it is not possible, from fingerprint data, to monitor individual species
concentrations Another example of such a reaction system in cascade is the nitrification
process in which, under aerobic conditions, the ammonium nitrogen is transformed into nitrites
by a consortium of ammonium-oxydizing bacteria (AOB) while nitrites are transformed into
Annexe 1
216

nitrates by nitrite-oxydizing bacteria (NOB). This process presents the advantages of being well
known and its microbial dynamics are driven by a limited number of dominant species (thus "its
diversity is relatively low" and relative abundances of dominant species can then be computed
using fingerprint data).
Using the measurements of the total biomass, for instance using the measurement of the Total
or Volatile Suspended Solids (TSS and VSS), assuming the totality of this matter is "active
biomass", the substrate/product concentrations and the individual species concentrations
obtained via a fingerprint technique called SSCP (Single Strand Conformation Polymorphism),
we propose a two-step procedure (within the class of indirect approaches we have introduced
hereabove) to assign one of the two functions of the nitrification process (nitritation or
nitratation) to each of the 44 individual species detected in the ecosystem.
Identifying the function of a species within a complex ecosystem
Assigning a function to a microbial species is a key problem in microbial ecology. Consider a
nitrification process. Two functions are considered: the nitritation (a biological process realized
by a bacteria consortium X
A
which transforms ammonium nitrogen (S
1
) into nitrites (S
2
)) and the
nitratation (realized by a bacteria consortium X
A
which transforms nitrites (S
2
) into nitrates (S
3
)).
Molecular fingerprinting techniques allow us to monitor relative abundances of detected
microorganisms via SSCP.
The general form of the functional mass-balance model of this system functioning in the
chemostat is given by:


where S
in
is the ammonium nitrogen input concentration, S
1
, S
2
and S
3
are the ammonium
nitrogen, nitrites and nitrates concentrations, respectively, D is the dilution rate (ratio of the input
flow rate over the volume), X
A
and X
B
are the concentrations in AOB and NOB, Y
A
and Y
B
are
their yields coefficients while
A
and
B
are their growth rate.
In addition to the measurements of the substrates, we assume we have the measures of the
[1]
Annexe 1
217

individual species concentrations X
i
(i=1N). In addition, we measure the total biomass

. The assignation problem is to determine which individual species are part


of X
A
and which ones (the complement X
T
-X
A
) are part of X
B
.
To better understand our presentation, we recall here the different methods we suggested in
the introduction as "direct" and "indirect" approaches on the specific example of the nitrification
process.
The direct approach assumes the model [1] is available. Then we consider the restricted
model:


that we simulate using successively the 2
N
combinations of the individuals species
concentrations X
i
where
i { } 1 , 0
as inputs:
( )

=
=

=
=
N
i
i i B
N
i
i i A
X X
X X
1
1
1


The optimal solution is the combination of the N parameters
i
for which the criterion:
{ }
( ) ( ) ( )

= =
=

P
i
M
j
s prediction
i
measures
i
j S j S J
i
i
1 1
2
1 , 0
min


with N
P
=P=2 or N
P
=P+1=3 (depending on the available measurements) and M is the number of
samples over the period of time considered, is minimized. As underlined in the introduction,
notice that such an approach necessitates the model [1], and in particular
A
and
B
, to be
known
In the indirect approach, one proceeds in two steps. First, one generates the trajectories X
A
and
X
B
such that the criterion:
( ) ( ) ( )

+
= =
=
1
1 1
2
,
min
P
i
M
j
s prediction
i
measures
i
X X
j S j S J
B A

with N
P
=2 or 3, is minimized. This can be done using for instance a predictive approach.
Obviously, since this criterion is usually the one used for identification purposes, it is also
possible to simply simulating the model [2] to generate estimated trajectories of X
A
and X
B
which
best explain the substrate dynamics. Then, in a second step, we solve the static mixed integer
[2]
[3]
[4]
[5]
Annexe 1
218

optimization problem:
{ }
( ) ( ) ( ) ( ) ( ) ( )
( )

=
=
(

+ =


=
=
=

44
1
44
1
1
2 2
1

min
1 , 0
i
i i B
i
i i A
M
k
k B k B k A k A
X X
X X
t X t X t X t X J
i
i


where the notations

and

stand for the estimated trajectories of X


A
and X
B
whatever the
method used to generate them.
However, again, notice that the first step of these solutions (the generation of X
A
and X
B
)
necessitate the model [1] to be available
To better understand the importance of developing alternative techniques independent on the
kinetics, we present hereafter a practical example of experiments where an "unmeasured exogen
input" that was not monitored during some experiments (and thus the influence of which
cannot be modeled) had significant consequences on the monitored variables. As a
consequences, it was not possible to develop a [1]-like model using the available data.
Practical difficulties in modeling a nitrification process
The experimental device
Several chemostats were used to study a nitrification ecosystem. They were fed with a
controlled feeding system of an artificial wastewater. Details are available on ask to the authors.
Because of lack of space, we only use the date obtained from the reactor B.
The macroscopic functions (Nitritation and Nitratation) were monitored together with the
total biomass. SSCP profiles were also regularly realized from samples of the medium.
The experimental results
The previous chemostats was operated over 371 days at constant dilution rate (D constant) in
order to get data for modeling purposes. The input substrate concentration was varied several
times from 1 to 2 g/l and from 2 to 1 g/l. The results obtained are represented in the figures 1 and
2.

Figure 1: Input substrate concentration (thin continuous line), residual ammonium (S
1
, bold continuous line),
nitrites (S
2
, dotted line) and nitrates (S
3
, indented line) over 371 days of experiments. All units are in g/l.
0
0,5
1
1,5
2
2,5
0 14 25 36 51 66 82 95 107 117 129 155 176 204 215 227 243 255 266 283 294 308 327 347 360 371
[6]
Annexe 1
219


Figure 2: The measurement of the total biomass concentration in g/l.
As can be seen in the figure 1, the second reaction of the process did only start at t=150 days.
It is not because the initial condition in X
B
was null. Instead, we realized at t=150 days a change
in the operating temperature of the chemostat. Immediately, the second consortium began to
grow. If it is assumed that the kinetics are only functions of S
i
, a [1]-like model is simply unable
to reproduce these data with the appropriate hypotheses. One solution is to include the influence
of the temperature into the model. However, it is simply not possible here since the temperature
was not monitored during the experiment. Thus, a method allowing reconstructing X
A
and X
B

independently of
A
and
B
is needed.
In the next section, we propose a class of new observers allowing us to generate X
A
and X
B

from the available measurements (in particular taking into account we have measured the total
active biomass) without any hypothesis about the process kinetics (only the yield coefficient that
can be quite easily evaluated from the experiments or from the literature are necessary).
New coupled observers to estimate functional biomasses for a class of biosystems
The observer design
For simplicity, we present the proposed approach using the nitrification process. However, the
observer design is suited for any system in cascade considered in this paper.
Consider the mass balance model [1]. Taking into account the fact that the total biomass X
T
is
supposed to be available, we enounce the following results:
Proposition 1: The dynamical system:
( ) ( )
( )
( ) ( )
( )

=
+ + =
=
+ + =
2 1 2
2 2
2
1 1
1 1
1

S S Z Y X
X X X G S Z D
dt
Z d
S Z Y X
X X X G S Z D
dt
Z d
B B
T B A in
A A
T B A in

is a partially tunable observer for the system [1]. Notice that it is exactly the asymptotic observer
if G
1
=G
2
=0.


0,0
0,1
0,2
0,3
0,4
0,5
0,6
0 14 25 36 51 66 82 95 107 117 129 155 176 204 215 227 243 255 266 283 294 308 327 347 360 371
[7]
Annexe 1
220

Proof of the proposition 1: Consider the error vector:
( )

=
= = =
2
1
1 1

Z B X
Z A A A A X
e Y e
e Y Z Z Y X X e
B
A
.
where

and


Its dynamics is given by:
X
B B
A A
X
e
G Y D G Y
G Y G Y D
e
|
|

\
|
+
+
=
2 2
1 1
& .
In the case where D is constant, it is then straightforward to verify that the eigenvalues of the
observer are given by:
( )

+ + =
=

=
+ + = +
2 1 2
1
2 1 2 1
2 1 2 1
2
G Y G Y D
D
G Y G Y D D
G Y G Y D
B A B A
B A




If the gains G
1
and G
2
are suitably chosen, one has
A A
t
X X =

lim and
B B
t
X X =

lim and thus


the system [7] is an observer for the system [1].
The only important hypothesis which must be verified to design such an observer is that the
system to be observed be the general mass-balance model of P bioreactions in cascade. The
observer dynamics are completely independent of the bioreactions kinetics
A
and
B
which can
be very complicated functions of any state and/or exogen variables. The "price to pay" to build
such an observer with such few knowledge is that the observer is not completely tunable (only
one eigenvalue can be placed arbitrarily). Now, it may happen that part of the process kinetics is
known: for instance
A
or
B
. In this case, one may synthesize a new observer in taking
advantage of the fact that the total biomass is measured and in coupling a bounded error observer
(Lemesle and Gouz 2004) and the partially tunable observer presented hereabove. For instance,
assuming
A
is known, we get the following result:
Proposition 2: The dynamical system:
( ) ( )
( )
( )
( ) ( )
( )

=
+ + =
=
+ =
2 1 2
2 2
2
1 1 1
1
1 1 1
1

S S Z Y X
X X X G S Z D
dt
Z d
S Z Y X
X
Y
S
S Z D
dt
Z d
B B
B A in
A A
A
A
A
in



where the auxiliary variable Z
1
is now given by

and thus

while Z
2

and

are unchanged, is a completely tunable observer for the system [1].


[7]
Annexe 1
221

Again, notice that it is exactly the asymptotic observer if
1
=1 and G
2
=0.
Sketch of theproof of the proposition 2: The dynamics of the error matrix is given
by:

Notice F has only one time-varying term. A systematic approach to show that the error matrix is
stable is the following. First, assume
A
(S(t))>
A
>0 t. We have:

And with:

Let the constant matrix:

Then, we can place the eigenvalues of F using the change of variable which diagonalizes it.
For any positive pair
1

2
, one can find
1
and G
2
such that 1

and

with
i
>0, i=1,2 and
1
>1. Posing
1
=e
XA
and
2
=-G
2
e
XA
+(
2
-
1
)e
XB
, one
gets:

Introducing the candidate Lyapunov:

It is easy to show that V is decreasing if:

In particular, this holds if G2 is chosen such that:

where
The experimental results
The previous observers were used to reconstruct X
A
and X
B
from the knowledge of S
in
, D, Y
A

and Y
B
and the measurements of X
T
, S
1
, S
2
and S
3
. The first observer (denoted #1) is the partially
Annexe 1
222

tunable observer with G
1
0 and G
2
0 while the second observer (numbered #2) is the one
proposed in the proposition 2. The model parameters Y
A
and Y
B
were obtained from an
identification that has been realized using the available data and which were in accordance with
those from the literature: Y
A
=0.2511 and Y
B
=0.0629. For the observer #1, G
1
=-100 and G
2
=-100
while G
1
=1.1 and G
2
=-2 for the observer #2 were chosen to ensure the dynamics of the observers
to be asymptotically stable. Because of lack of place, comparisons of the results with the non-
tunable asymptotic observers are not shown (G
1
=0 and G
2
=0).

Figure 3: Sum of the signals

and

generated by the observer #1 (continuous line) and measurement of the total


biomass (stars) in g/l.

Figure 4: Sum of the signals

and

generated by the observer #2 (continuous line) and measurement of the total


biomass (stars) in g/l.
At thos step, we have generated 3 sets of two signals (

and

) with the observers #1 and


#2. The problem, now, is to choose which observer gives the best result before applying the
second step of the procedure. Obviously, the comparison of the measurement X
T
=

is a first
criterion that can be used. For instance, The figure 3 and 4 present such comparison for the
Annexe 1
223

estimated signals generated by the observers #1 and #2. However, it does not give direct
information about how the generated signals allow an appropriate fitting of substrate dynamics.
How evaluating the quality of the signals generated by the observers ?
Although it has been argued that the model is not necessary to generate estimations of X
A
and
X
B
, it can be used if available, to validate a posteriori our approach. In such a case, using (i) the
comparison between the estimations of X
A
and X
B
generated by the observers and the trajectories
generated by this model or (ii) the comparison of the substrate measurements and the trajectories
of the substrates generated by the model when the estimations of X
A
and X
B
generated by the
previous observers are used as inputs of a reduced [2]-like model including only the substrate
dynamics, are two different possible ways of evaluating our approach.

Figure 5: Predictions of Si using

and

(generated by the observer #1) as inputs of the reduced model [2].


Apart from this work, a simple macroscopic model of the chemostat experiments has been
obtained assuming there were no exogen inputs acting on the process (as the problem of the
temperature presented hereabove). Because of lack of space, one cannot show the evaluation
with both methods: only the results of the evaluation method (ii) are reported in the figures 5 and
6 for the observers #1 and #2 respectively.
Discussion of the results
Obviously, with the data set we have used, the partially tunable observer #1 give significantly
better results than the observer #2 with respect to the criteria we have chosen to evaluate them.
Obviously, it is due to the fact that the convergence rate of the asymptotic observer is only
driven by the dilution rate while the observer #2 uses kinetics function which can present
uncertainty. Such an observer thus gives appropriate tool to solve the first procedure step to
solve this important ecological assignation problem.
Annexe 1
224


Figure 6: Predictions of Si using

and

(generated by the observer #2) as inputs of the reduced model [2].


Assigning a function to a species in the nitrification process
The additional available data
In addition to the measurements of the total biomass and the substrates, the relative
abundances of 44 detected species by SSCP are available over the entire period of the
experiments. These data are represented in the figure 7

Figure 7: Relative abundances X
i
of the 44 species detected by SSCP with

. All units are in


g/L.
Generation of the best combination of individual relative species abundances to
approximate the signals XA and XB generated with the observers.
Once the signals of the functional biomasses have been generated the problem defined in [6]
must be solved. Although there exists many powerful softwares to do so, it is a static
optimization problem and as long as both the number of functional biomasses, the number of
species N and the number of sampling points M are not too large, the simplest way to proceed is
to test all possible combinations of X
i
. In the present case, the number of functions is only 2,
N=44 and M=76: the best solution (data not shown) was obtained in three days on a standard PC.
Conclusions and perspectives
In the present paper, a procedure to solve the important assignation problem in microbial
0,0
0,1
0,2
0,3
0,4
0,5
0,6
5 14 22 34 51 69 82 93 104 117 159 184 211 227 243 252 283 304 334
Annexe 1
225

ecology was presented and evaluated using real data from a nitrification process. The two-step
procedure proposes first the use of new observers to generate independently of the kinetics of
the process the trajectories of the functional biomasses of the bioprocess and, in a second step
to find the best combination of individual species concentrations detected via the use of
molecular fingerprint techniques.
The first proposed observer should be preferred if nothing is known about the kinetics. If only
one kinetic is known, we can completely tune an observer in coupling a robust observer (in the
sense it does not depend on the unknown kinetics) with a hybrid one. Finally, if the two kinetics
are known, it should be noticed that there is no reason of coupling the two observers: each
observer is tunable independently of the other.
It seems here particularly important to notice that it is possible to build different observers
from the set of measurements S
i
, i=1 or P+1. Indeed, the design of the proposed observers is
based on the introduction of auxiliary variable Z which allows the observer dynamics to be
independent of the kinetics. Depending on the quality of the different available measurements, it
may happen that one change of variable gives better result than another one. It means that it is
possible to reconstruct the same variables here X
A
and X
B
from different data: how using this
redundancy obviously poses new interesting research questions. Another interesting perspective
is to extend the results to cases where there are uncertainties on the input substrate concentration
or in the yield coefficients.



226




















Annexe 2
227

ANNEXE ANNEXE ANNEXE ANNEXE 2 22 2


APPORTS DE LA MODELISATION DES INTERACTIONS POUR UNE COMPREHENSION FONCTIONNELLE
DUN ECOSYSTEME,
APPLICATION A DES BACTERIES NITRIFIANTES EN CHEMOSTAT
Rsum
Les caractristiques des cosystmes microbiens en font des modles d'tude pertinents pour
aborder des questions importantes de l'cologie gnrale par une approche exprimentale et
thorique. Leur utilisation reste nanmoins marginale du fait de la difficult extraire certaines
informations cls. Dans cette thse, nous avons travaill dpasser ces difficults pour tudier le
lien biodiversit-fonctionnement des cosystmes par le couplage d'outils de la biologie
molculaire et de l'automatique lors du suivi de chmostats nitrifiants. Dabord, nous avons
labor une procdure gnrique permettant d'assigner une des fonctions tudie de l'cosystme
considr chacun des phylotypes (i.e. espces molculaires) dtects via des empreintes
molculaires. Cette mthode constitue une tape essentielle pour effectuer une modlisation
structure de type "bilan de matire" des interactions inter- et intra-spcifiques pouvant stablir
entre les diffrentes espces assembles. Ensuite, nous avons procd une modlisation de ce
type en considrant la dynamique de quatre bactries nitrifiantes : deux nitritantes (i.e. oxydant
lazote ammoniacal en nitrite) et deux nitratantes (i.e. oxydant les nitrites en nitrates). La
confrontation des donnes exprimentales de ces quatre phylotypes avec les sorties du modle
montre que la prise en compte des diffrents types dinteractions permet dexpliquer la
coexistence de plusieurs espces en comptition pour une mme ressource ainsi que la
dynamique des fonctions exprimes au niveau de lcosystme considr. Enfin, nous avons
tudi linfluence de diffrentes perturbations biotiques sur la rsilience des systmes nitrifiants
et confirmons plusieurs tudes tendant montrer que le fonctionnement macroscopique stable
d'un cosystme peut s'accompagner de variations importantes au niveau populationnel.
Abstract
The characteristics of microbial ecosystems make them appropriate models for studying
certain important issues in general ecology using both theoretical and experimental approaches.
However, their use remains marginal due to the difficulty in extracting key information. In this
thesis, we have worked to such difficulties in the study of the link between biodiversity and
ecosystem functioning by the use of molecular and automatic tools during the monitoring of
nitrifying chemostats. First, we propose a generic method for allocating one of the studied
functions performed by an ecosystem to each of the phylotypes (i.e. molecular species) detected
by molecular fingerprinting. This method constitutes an essential step in devising a structured
mass-balance model taking account of inter- and intra-specific interactions which may occur
between the different assembled species. Then, we accomplished such modeling by considering
the dynamics of four phylotypes: two AOB (i.e. oxidizing ammonium into nitrite) and two NOB
(i.e. oxidizing nitrites into nitrates). The comparison of the experimental data for these four
phylotypes with the simulation given by the model shows that microbial interactions can lead to
coexistence and play an important role in the functions expressed by the ecosystem. Finally, we
have also studied the influence of different biotic disturbances on the resilience of the nitrifying
systems and as a result, confirm studies which have been shown that the macroscopic
functioning of an ecosystem can be stable despite significant variations at the populational scale.
Mots clefs
Ecologie, Ecologie microbienne, chmostat, nitrification, empreintes molculaires, ADNr 16S,
systmes dynamiques, modlisation, approche systmique, bilan de matires, observateurs,
automatique, interactions inter- et intra-spcifiques, perturbations biotiques