Bioresource Technology 150 (2013) 387392

Contents lists available at ScienceDirect

Bioresource Technology
journal homepage: www.elsevier.com/locate/biortech

Enhancing methane production during the anaerobic digestion of crude glycerol using Japanese cedar charcoal
Ryoya Watanabe a,b, Chika Tada a,, Yasunori Baba a, Yasuhiro Fukuda a, Yutaka Nakai a,
a b

Laboratory of Sustainable Environmental Biology, Graduate School of Agricultural Science, Tohoku University, Yomogida 232-3, Naruko-onsen, Osaki, Miyagi 989-6711, Japan Dept. of Civil and Environmental Engineering, Tohoku University, 6-6-06 Aoba, Sendai, Miyagi 980-8579, Japan

h i g h l i g h t s
 The use of Japanese cedar charcoal as

g r a p h i c a l a b s t r a c t

a support could enhance methane production.  It was achieved to operate the highest OLR of crude glycerol in the previous studies.  Methane production yield containing charcoal was about 1.6 times higher than without.  Propionate degradation was enhanced on charcoal by attached microorganisms.  The use of Japanese cedar charcoal in anaerobic digestion is a sustainable practice.

a r t i c l e

i n f o

a b s t r a c t
The use of Japanese cedar charcoal as a support material for microbial attachment could enhance methane production during anaerobic digestion of crude glycerol and wastewater sludge. Methane yield from a charcoal-containing reactor was approximately 1.6 times higher than that from a reactor without charcoal, and methane production was stable over 50 days when the loading rate was 2.17 g chemical oxygen demand (COD) L1 d1. Examination of microbial communities on the charcoal revealed the presence of Uncultured Desulfovibrio sp. clone V29 and Pelobacter seleniigenes, known as 1,3-propandiol degraders. Hydrogenotrophic methanogens were also detected in the archaeal community on the charcoal. Methanosaeta, Methanoregula, and Methanocellus were present in the charcoal-containing reactor. The concentration of propionate in the charcoal-containing reactor was also lower than that in the control reactor. These results suggest that propionate degradation was enhanced by the consumption of hydrogen by hydrogenotrophic methanogens on the charcoal. 2013 Elsevier Ltd. All rights reserved.

Article history: Received 8 August 2013 Received in revised form 3 October 2013 Accepted 9 October 2013 Available online 16 October 2013 Keywords: Anaerobic digestion Methane Glycerol Charcoal Microbial community

1. Introduction Biodiesel fuel is increasingly being produced for use in public transportation (Dube et al., 2007). However, glycerol is generated during the manufacture of biodiesel, and an efcient waste-treat-

Corresponding authors. Tel.: +81 229 84 7395; fax: +81 229 84 7391.
E-mail addresses: tada@bios.tohoku.ac.jp (C. Tada), nakai@bios.tohoku.ac.jp (Y. Nakai). 0960-8524/$ - see front matter 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.biortech.2013.10.030

ment system for the glycerol byproduct is required (Du et al., 2003; Vicente et al., 2004). Because crude glycerol contains a high concentration of organic matter, large amounts of methane (CH4) can be generated from small volumes of glycerol during anaerobic digestion (Yang et al., 2008). Most studies of the anaerobic digestion of glycerol have used loading rates of approximately 1.0 g chemical oxygen demand (COD) L1 d1 (Astals et al., 2012; Nakamura et al., 2008; Robra et al., 2010). Further study is needed to determine the treatment capability when operating at higher glycerol loading rates.

388

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392

Immobilization of microorganisms on waste or other support material is a widely used technique in anaerobic digestion for producing biogas. Parameters such as specic surface area, porosity, surface roughness, pore size, and the orientation of the packing material inuence the performance of anaerobic lter reactors (Elmitwalli et al., 2000; Picanco et al., 2001; Yang et al., 2004). Manufactured materials including activated carbon, polyurethane, and clay have been used as support materials for microorganisms (Hansen et al., 1999). To safely reuse digested uids as liquid fertilizer on agricultural elds, it is necessary to use natural support materials for microbial colonization. Most trees in Japans forest plantations are Japanese cedar (Cryptomeria japonica) (Ministry of Agriculture, 2011). Japanese cedar is no longer used as a building material, and the condition of plantation forests has consequently deteriorated. Improved forestry management, including thinning of Japanese cedar trees, is now required, necessitating innovative uses for the thinned trees. Carbonization is one technique that has been considered; the pore size of Japanese cedar charcoal is larger than that of oak charcoal, and the pores are linear and regularly spaced (Saito and Arima, 2007). Charcoal produced from Japanese cedar has the ability to absorb chloroform and trichloroethylene in drinking water (Abe et al., 2001). In this study, the use of Japanese cedar charcoal as a support material for microorganisms during anaerobic digestion of glycerol was investigated. The functions of microorganisms attached to the support material were examined by gene analysis. 2. Methods 2.1. Wastewater sludge substrate and crude glycerol The wastewater sludge used as substrate was obtained from a noodle factory (Table 1). Crude glycerol (47 8.6% pure glycerol, 11.3 mg L1 P2O5, 20.0 g L1 K2O) was obtained from a biodiesel production company in Osaki City, Japan. The COD of the crude glycerol was 1477 235 g L1. Total solids (TS), volatile total solids (VS), and density were 7.5%, 72.1%, and 1.02 g cm3, respectively. 2.2. Effect of support material injection Two single-step anaerobic bioreactors (1.5 L active volume each) were employed in the study (Fig. 1). Charcoal (pore size = 50 lm) from thinned Japanese cedar was placed into one reactor and the other was used as a control. Each reactor was inoculated with 1000 mL of seed sludge harvested from a full-scale anaerobic digester. The seed sludge was fed with a synthetic medium as described in a previous report (Yang et al., 2004). The two reactors were operated in semi-continuous mode with a hydraulic retention time of 30 days. Temperature was maintained at 35 C. 2.3. Conditions of crude glycerol loading Crude glycerol was dosed into the reactor every day during the experiment. The rst period of operation ran from days 0 to 12,

during which crude glycerol was added at 0.375 mL d1 (0.54 g-COD L1 d1). The second period of operation ran from day 13 to day 34, during which crude glycerol was added at 0.75 mL d1 (1.09 g-COD L1 d1). The nal period of operation was performed from day 35 to day 85, during which crude glycerol was added at 1.5 mL d1 (2.17 g-COD L1 d1). 2.4. Chemical analysis Total solids were analyzed according to Japanese standard methods (JSWA, 1997). Total C and total N were measured with an on-line TOC-VCSH (Shimadzu, Kyoto, Japan) operated at 680 C using high-purity air as the carrier gas at a ow rate of 150 mL min1. Volatile fatty acids (VFAs) were determined by high-performance liquid chromatography (HPLC) (Jasco, Tokyo, Japan) equipped with an ion-exchange column (RSpak KC-811; Shodex, Japan) at 60 C using 3 mM HClO4 as eluent at a ow rate of 0.8 ml min1 and a UV detector (870-UV; Jasco). COD was measured using a colorimetric method with Hach 01500 mg L1 vials (Jirka and Carter, 1975). Samples were centrifuged for 15 min at 3000 rpm and the supernatant as ltered through 0.45-lm cellulose lters. Gas samples were collected in gas bags (PVDF); CH4 and CO2 contents were determined using a gas chromatograph (GC-8A, Shimadzu, Kyoto, Japan) with a thermal conductivity detector equipped with a Porapak-Q column (Shinwakakou, Kyoto, Japan). 2.5. Scanning electron microscopy At the end of operation, the surfaces of the support materials were observed via scanning electron microscopy (SEM) (SU8000, Hitachi, Tokyo, Japan). Tissue of Japanese cedar was xed for 3 h in 4% glutaraldehyde containing 0.1 M sodium cacodylate buffer at 4 C (Ramage et al., 2002). Tissue samples were then dehydrated through an ethanol gradient as follows: 50% for 40 min, 70% for 40 min, 80% for 40 min, 90% for 40 min, and 100% for 40 min (this last dehydration step was repeated twice). After dehydration, samples were treated with a mixture of 100% ethanol and t-butyl alcohol (1:1) for 30 min, and then three times (30 min each) with t-butyl-alcohol. Finally, samples were frozen in saturated t-butylalcohol at 4 C. Operation of the SEM was commissioned to Tohoku University, Sendai, Japan. 2.6. Polymerase chain reactiondenaturing gradient gel electrophoresis and sequencing Fluid samples were collected from each reactor after 25 d (crude glycerol addition = 0.75 mL d1) and after 53 d (crude glycerol addition = 1.5 mL d1). Samples of the attached support materials were collected at the end of the operation. DNA was extracted using a Power Soil DNA Isolation Kit (Mo Bio Laboratories, Inc., Carlsbad, CA, USA) according to the manufacturers instructions. The bacterial 16S rRNA gene sequences were amplied by polymerase chain reaction (PCR) with the primer sets 968F (50 -AACGCGAAGAACCTTAC-30 ) and 1401R (50 -CGGTGTGTA 0 CAAGGCCCGGGAACG-3 ) (Heuer et al., 1997). The bacterial PCR reaction consisted of 25 cycles of 30 s at 94 C, 30 s at 55 C, and 1 min at 72 C. Archaeal 16S rRNA gene sequences were amplied by PCR with the primer set 1106F (50 -TTWAGTCAGGCAACGAGC-30 ) and 1378R (50 -TGTGCAAGGAGCAGGGAC-30 ) (Lu et al., 2009). The archaeal PCR reaction consisted of 30 cycles of 30 s at 94 C, 30 s at 52 C, and 1 min at 72 C. For denaturing gradient gel electrophoresis (DGGE), primers 968F and 1106F contained a 40-bp GC clamp (CGCCCGCCGCGCCCCGCGCCCGTCCCGCCGCCCCCGCCCG) (Cheng et al., 2009). DGGE of the PCR-amplied 16S rRNA genes was performed using a D-code multiple system (Bio-Rad, Hercules,

Table 1 Characteristics of waste sludge from noodle production. Parameter TS pH VFA T-CODcr Total-C Total-N Unit % gL g L 1 g L 1 g L 1
1

Average 6.4 5.6 6.88 0.11 0.72 0.35 18.3 3.1 0.87 0.7 0.21 0.17

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392

389

Fig. 1. Schematic of two single-step anaerobic reactors; (a) control, (b) Japanese cedar charcoal containing reactor.

Fig. 2. Cumulative methane production in each reactor during the operational period at different operational loading rates (OLRs).

Table 2 Volatile fatty acid (VFA) concentration and composition in each reactor during the operational period. VFA (g L-1) Control Acetate Day 13 25 37 45 53 61 73 81 0 0 0 0 0.53 0.20 1.89 0.16 Propionate 0 0 0 0 0.49 0 1.97 4.51 Isobutyrate 4.35 3.51 3.14 2.30 1.79 2.59 0.33 0.46 Japanese cedar charcoal Acetate 0 0 0 0 0.19 0.61 1.06 0.95 Propionate 0 0 0 0 0 0.08 0.37 0.65 Isobutyrate 2.88 3.61 2.96 3.19 2.91 2.44 1.60 1.60

CA, USA). Polyacrylamide gels, consisting of 8% acrylamidebisacrylamide mixture (37.5:1.0) in 0.5 TAE buffer with a gradient of 3070% denaturant, were prepared according to the manufac-

turers guidelines (Muyzer et al., 1993). One hundred percent denaturing acrylamide was dened as 7 M urea and 40% formamide, such that 30% denaturant corresponded to 2.1 M urea and 12%

390

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392

formamide. Gels were run for 12 h at 100 V in 1 TAE buffer at a constant temperature of 60 C. After electrophoresis, the gels were stained for 15 min in 1 TAE buffer containing 100 ng mL1 GelStar Nucleic Acid Gel Stain (Lonza Rockland, Rockland, ME, USA), the DNA bands were excised and transferred to 1.5-mL tubes containing 70 lL TE buffer. Part of each aliquot (1 lL) was used as the template for PCR to sequence the DNA bands using primer sets without the GC clamp. (Oishi et al., 2012). The PCR product was puried in a polyethylene glycol (13% PEG-6000, 1.6 M NaCl) precipitation. The puried DNA was sequenced using a Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and an ABI Prism-310 automated sequence analyzer (Applied Biosystems, Foster City, CA, USA). The determined sequences were compared with known 16S rRNA sequences by a nucleotidenucleotide BLAST search (http://blast.ddbj.nig.ac.jp/top-j.html).

(a) Bacterial

(b) Archaeal

B1

A1 A2 A3 A4 A5

B2 B3 B4

3. Results and discussion 3.1. Degradation efciency following addition of support materials Cumulative methane production in the experimental and control reactors is illustrated in Fig. 2. There was little difference between the two reactors during the rst and second periods of operation; however, during the nal period of operation, methane production in the charcoal-containing reactor was higher than that in the control. Cumulative methane production in the charcoalcontaining reactor was more than 1.6 times higher than that in the control reactor. Nakamura et al. (2008) examined thermophilic anaerobic digestion (55 C) of mixed materials including glycerol and food waste operated at a loading of 1.02.0 g-COD L1 d1, and found that methane production and pH decreased when COD loading increased to 2.0 g-COD L1 d1. Yang et al. (2008) reported methanogenic fermentation of glycerol under mesophilic conditions using a polyurethane support for 120 days, but their loading rate was only 0.7 g-COD L1 d1. In this study, methane production from the reactor containing Japanese cedar charcoal was stable for 50 days when the loading rate was increased to 2.17 g-COD L1 d1. This is the highest organic loading rate using crude glycerol currently reported. Stable operating conditions were also achieved for longer than previously reported. Some VFAs (acetic acid, propionic acid, isobutyric acid, butyric acid, valeric acid, isovaleric acid) were detected in both reactors. The dominant VFAs were acetic acid, propionic acid, and isobutyric acid; details on the contents of these compounds are presented in Table 2. Propionic acid was detected in the control reactor at a concentration of 490 mg L1 after 53 days, but was not observed in the charcoal-containing reactor until day 61. The propionic acid concentration increased to 4510 mg L1 by day 81 in the control reactor and to 650 mg L1 in the charcoal-containing reactor. A decrease in methane production was seen in the control reactor due to the increasing levels of propionic acid, consistent with other reports that methane production decreases when propionate accumulates (Gallert and Winter, 2008). The accumulation of propionate began earlier in the control than in the charcoal-containing reactor, which also had a lower concentration of propionate. These results suggest that propionate was more efciently degraded in the presence of charcoal. The pH values of the control and charcoal-containing reactors at the end of the experiment were 5.87 and 6.72, respectively, and pH was maintained at >6.7 in the charcoal-containing reactor. The optimum pH for propionate degradation is reported to be between 6.8 and 7.3 (Fukuzaki et al., 1990). Using charcoal as a support material resulted in pH conditions better suited for methane production. The cost of alkaline agents required to maintain pH above

B5

Fig. 3. Results of denaturing gradient gel electrophoresis (DGGE) analysis for (a) bacterial and (b) archaeal communities on Japanese cedar charcoal.

C1

C2

J1

J2

B1 B2 B3 B4

B5 B7 B8 B10 B6

Fig. 4. Results of denaturing gradient gel electrophoresis (DGGE) analysis for bacterial communities in the uid of each reactor for different levels of crude glycerol using the primer sets 968F and 1401R, (C1: control, 0.75 mL d1, C2: control, 1.5 mL d1, J1: Japanese cedar, 0.75 mL d1, J2: Japanese cedar, 1.5 mL d1).

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392 Table 3 Sequence analysis of excised bacterial bands that appear in Fig. 4. Band B1 B2 B3 B4 B5 B6 B7 B8 B9 Reactor J J J J,C C J J,C C C Accession number AB004752 EU360793 JN049594 HQ407284 CU466930 AF327558 AY169413 FR737799 JF802205 Closest relative Serratia liquefaciens Klebsiella pneumoniae Klebsiella sp. Klebsiella variicola Candidatus Cloacamon acidam inovorans Endosymbiont of Folsomia candida Finegodia magna Staphylococcus epidermidis Delta proteobatcerium S3R1 Similarity (%) 97 99 98 96 95 99 87 88 89

391

C1

C2

J1

J2

A1 A3

A2

J: Japanese cedar charcoal; C: control.

A4 A5

Fig. 6. Results of denaturing gradient gel electrophoresis (DGGE) analysis of archaeal communities in the uid of each reactor for different levels of crude glycerol (C1: control, 0.75 mL d1, C2: control, 1.5 mL d1, J1: Japanese cedar, 0.75 mL d1, J2: Japanese cedar, 1.5 mL d1). Fig. 5. The process of bacterial conversion of glycerol to propionate.

6.87.3 can be prohibitive to the operation of anaerobic digestion processes. Furthermore, the addition of alkaline agents raises the concentrations of sodium and other salts, raising the risk of salt damage when the digested liquid is used as fertilizer for vegetable cultivation (Shannon and Grieve, 1999). The use of Japanese cedar charcoal as a support material reduces the need for the addition of alkaline agents to maintain pH, and thus minimizes the salt concentration in the digested liquid. The use of charcoal can also replenish carbon when the digested liquid is applied to paddy elds (Zhang et al., 2010). 3.2. Differences in the microbial communities of the two reactors The SEM photos of Japanese cedar charcoal before and after cultivation revealed rods and cocci of several microorganisms adhered to the pores of the charcoal. During the nal period of operation, ve bands for both the bacterial and the archaeal community were detected from the charcoal (Fig. 3). Bands B0 2 and B0 3 were related to uncultured Desulfovibrio sp. clone V29 (94% similarity) and Pelobacter seleniigenes (95% similarity), respectively. These bacteria are reported to be involved in the degradation of 1,3-propanediol to propionic acid (Oppenberg and Schink, 1990; Qatibi et al., 1991). In the archaeal community, A0 2 was related to Methanoregula formicicum SMSP (98% similarity), and A0 5 was related to Methanocellus sp. SMA-21 (93% similarity), both of which are hydrogenotrophic methanogens. Propionic acid degradation is accelerated in the presence of H2-utilizing methanogen cells (Fukuzaki et al., 1990). These methanogens are believed to contribute to the degradation of propionate acid by consuming hydrogen. The bacterial community in the uid of each reactor during the second and nal periods of operation is presented in Fig. 4. Bands B1, B2, and B3 were only detected in the uid of the charcoal-containing reactor. Band B1 was related to Serratia liquefaciens (97% similarity), B2 to Klebsiella pneumonia (99% similarity), and B3 to Klebsiella sp. (98% similarity); Klebsiella variicola (96% similarity) was detected in liquid from the control reactor (Table 3). Klebsiella spp. have also been reported to degrade glycerol to 1,3-propane-

diol (Nakamura and Whited, 2003; Nemeth et al., 2003; Wu et al., 2008). These results suggest that the bacterial communities on charcoal enhance the conversion of glycerol to propionate (Fig. 5). The archaeal communities in the reactor uids during the second and nal periods of operation are illustrated in Fig. 6. Bands A1, A2, and A5 were related to Methanospillum sp. (94% similarity), M. formicicum (95% similarity), and Methanoculleus sp. IIE1 (98% similarity), respectively, which are hydrogenotrophic methanogens (Table 4). Bands A3 and A4 were aceticlastic methanogens related to Methanosaeta concilii (98% similarity) and Methanosarcina sp. SMA-21 (97% similarity), respectively. There was little difference in the archaeal communities between the control and experimental reactors. Analysis of VFAs showed the progressive degradation of propionate, suggesting the presence of hydrogenotrophic methanogens; Gibbs free energy indicates that hydrogen is consumed when propionate is degraded (McCarty, 1981). The degradation of propionate was faster, and the methane yield was greater, in the charcoal-containing reactor than in the control reactor (Table 2, Fig. 1). These ndings suggested that much of the methane originated from hydrogen and that a greater number of hydrogenotrophic methanogens was present in the charcoal-containing reactor than in the control. Further quantitative study, such as real-time PCR, is necessary to evaluate these inferences.

Table 4 Sequence analysis of excised archaeal bands that appear in Fig. 6. Band A1 A2 A3 A4 A5 Reactor J,C J J,C J,C J,C Accession number AJ133792 AB479390 CP002565 JF812255 AB089178 Closest relative Methanospirillum sp. Methanoregula formicicum SMSP Methanosaeta concilii GP-6 Methanosarcina sp. SMA-21 Methanoculleus sp. IIE1 Similarity (%) 94 95 98 97 98

J: Japanese cedar charcoal; C: control.

392

R. Watanabe et al. / Bioresource Technology 150 (2013) 387392 Jirka, A., Carter, M., 1975. Micro-semi-automated analyses of surface and wastewaters for chemical oxygen demand. Anal. Chem. 47, 13971402. JSWA, 1997. Examination method for wastewater and sludge. Japan Sewage Works Association, Tokyo, p. 812 (in Japanese). Lima de Oliveira, L., Silveira Duarte, I.C., Sakamoto, I.K., Amncio Varesche, M.B., 2009. Inuence of support material on the immobilization of biomass for the degradation of linear alkylbenzene sulfonate in anaerobic reactors. J. Environ. Manage. 90 (2), 12611268. Lu, Y., Lai, Q., Zhang, C., Zhao, H., Ma, K., Zhao, X., Chen, H., Liu, D., Xing, X.H., 2009. Characteristics of hydrogen and methane production from cornstalks by an augmented two- or three-stage anaerobic fermentation process. Bioresour. Technol. 100 (12), 28892895. McCarty, P. L., 1981. History and overview of anaerobic digestion. In Second International Symposium on Anaerobic Digestion. Ministry of Agriculture, Forestry and Fisheries, Japan, 2011. Annual Report on Forest and Forestry in Japan. Muyzer, G., de Waal, E.C., Uitterlinden, A.G., 1993. Proling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplied genes coding for 16S ribosomal-RNA. Appl. Environ. Microbiol. 59 (3), 695700. Nakamura, C.E., Whited, G.M., 2003. Metabolic engineering for the microbial production of 1,3-propanediol. Curr. Opin. Biotechnol. 14 (5), 454459. Nakamura, K., Kishi, Y., Ikegami, M., 2008. Application of waste glycerin liquid produced from biodiesel production to methane fermentation. J. Jpn. Soc. Waste Manage. Experts 19 (1), 916. Nemeth, A., Kupcsulik, B., Sevella, B., 2003. 1,3-propanediol oxidoreductase production with Klebsiella pneumonia DSM2026. World J. Microbiol. Biotechnol. 19 (7), 659663. Oishi, R., Tada, C., Asano, R., Yamamoto, N., Suyama, Y., Nakai, Y., 2012. Growth of ammonia-oxidizing archear and bacteria in cattle manure compost under various temperatures and ammonia concentrations. Microb. Ecol. 63 (4), 787 793. Oppenberg, B., Schink, B., 1990. Anaerobic degradation of 1,3-propanediol by sulfate-reducing and fermenting bacteria. Antonie Van Leeuwenhoek 57 (4), 205213. Picanco, A.P., Vallero, M.V., Gianotti, E.P., Zaiat, M., Blundi, C.E., 2001. Inuence of porosity and composition of supports on the methanogenic biolm characteristics developed in a xed bed anaerobic reactor. Water Sci. Technol. 44 (4), 197204. Qatibi, A.I., Bories, A., Garcia, J.L., 1991. Sulfate reduction and anaerobic glycerol degradation by a mixed microbial culture. Curr. Microbiol. 22 (1), 4752. Ramage, G., Saville, S.P., Wickes, B.L., Lopez-Ribot, J.L., 2002. Inhibition of Candida albicans biolm formation by farnesol, a quorum-sensing molecule. Appl. Environ. Microbiol. 68 (11), 54595463. Robra, S., Serpa da Cruz, R.S., de Oliveira, A.M., Almeida Neto, J.A., Santos, J.V., 2010. Generation of biogas using crude glycerin from biodiesel production as supplement to cattle slurry. Biomass Bioenerg. 34 (9), 13301335. Saito, Y., Arima, T., 2007. Features of vapor-grown cone-shaped graphitic whiskers deposited in the cavities of wood cells. Carbon 45 (2), 248255. Shannon, M.C., Grieve, C.M., 1999. Tolerance of vegetable crops to salinity. Sci. Hortic. 78, 538. Vicente, G., Martinez, M., Aracil, J., 2004. Integrated biodiesel production: a comparison of different homogeneous catalysts systems. Bioresour. Technol. 92 (3), 297305. Wu, K.J., Saratalae, G.D., Lo, Y.C., Chen, W.M., Tseng, Z.J., Chang, M.C., Tsai, B.C., Su, A., Chang, J.S., 2008. Simultaneous production of 2,3-butanediol, ethanol and hydrogen with a Klebsiella sp. strain isolated from sewage sludge. Bioresour. Technol. 99 (17), 79667970. Yang, Y., Tada, C., Miah, M.S., Tsukahara, K., Yagishita, T., Sawayama, S., 2004. Inuence of bed materials on methanogenic characteristics and immobilized microbes in anaerobic digester. Mater. Sci. Eng., C. 24 (3), 413419. Yang, Y., Tsukahara, K., Sawayama, S., 2008. Biodegradation and methane production from glycerol-containing synthetic wastes with xed-bed bioreactor under mesophilic and thermophilic anaerobic conditions. Process Biochem. 43 (4), 362367. Zhang, A., Cui, L., Pan, G., Li, L., Hussain, Q., Zhang, X., Zheng, J., Crowley, D., 2010. Effect of biochar amendment on yield and methane and nitrous oxide emissions from a rice paddy from Tai Lake plain, China. Agric. Ecosyst. Environ. 139 (4), 469475.

In this analyses revealed differences in the microbial community when charcoal was included as a microbial substrate for the anaerobic digestion of glycerol. Operation of two horizontal-ow anaerobic immobilized biomass reactors containing either charcoal or expanded clay and polyurethane foam generated different microbial communities on the different support materials (Lima de Oliveira et al., 2009). Yang et al. (2004) also reported on effects of support materials on the performance of methanogenic uidized bed reactors. Four kinds of support materials (carbon lter, rock wool, loofah sponge, and polyurethane foam) were evaluated, and microbial analyses indicated differences among the archaeal communities (Yang et al., 2004). These reports suggest that the presence of charcoal causes changes in the microbial community, as observed in the present study. 4. Conclusions Charcoal produced from Japanese cedar was determined to be a useful support material, allowing the attachment of microbes that produced methane from glycerol. Propionate degradation was enhanced by hydrogenotrophic methanogens attached to charcoal. Cumulative methane production in the charcoal-containing reactor was about 1.6 times higher than control, and this production remained stable during 50 days at 2.17 g-COD L1 d1. The use of Japanese cedar charcoal in anaerobic digestion of glycerol is a sustainable practice that not only enhances the production of methane but also allows for the use of digested liquid on rice paddies and arable elds. References
Abe, I., Fukuhara, T., Maruyama, J., Tatsumoto, H., Iwasaki, S., 2001. Preparation of carbonaceous adsorbents for removal of chloroform from drinking water. Carbon 39 (7), 10691073. Astals, S., Nolla-Ardevol, V., Mata-Alvarez, J., 2012. Anaerobic co-digestion of pig manure and crude glycerol at mesophilic conditions: biogas and digestate. Bioresour. Technol. 110, 6370. Cheng, Y.F., Mao, S.Y., Liu, J.X., Zhu, W.Y., 2009. Molecular diversity analysis of rumen methanogenic Archaea from goats in eastern China by DGGE methods using different primer pairs. Lett. Appl. Microbiol. 48 (5), 585592. Du, W., Xu, Y., Liu, D., 2003. Lipase-catalyzed transesterication of soya bean oil for biodiesel production during continuous batch operation. Biotechnol. Appl. Biochem. 38 (2), 103106. Dube, M.A., Treblay, A.Y., Liu, J., 2007. Biodiesel production using a membrane reactor. Bioresour. Technol. 98 (3), 639647. Elmitwalli, T.A., van Dun, M., Bruning, H., Zeeman, G., Lettinga, G., 2000. The role of lter media in removing suspended and colloidal particles in an anaerobic reactor treating domestic sewage. Bioresour. Technol. 72 (3), 235242. Fukuzaki, S., Nishio, N., Shobayashi, M., Nagai, S., 1990. Inhibition of the fermentation of propionate to methane by hydrogen, acetate, and propionate. Appl. Environ. Microbiol. 56 (3), 719723. Gallert, C., Winter, J., 2008. Propionic acid accumulation and degradation during restart of a full-scale anaerobic biowaste digester. Bioresour. Technol. 99 (1), 170178. Hansen, K.H., Angelidaki, I., Ahring, B.K., 1999. Improving thermophilic anaerobic digestion of swine manure. Water Res. 33 (8), 18051810. Heuer, H., Krsek, M., Baker, P., Smalla, K., Wellington, E.M., 1997. Analysis of actionmycetes communities by specic amplication of genes encoding 16S rRNA and gel-electrophiretic separation in denaturing gradients. Appl. Environ. Microbiol. 63 (8), 32333241.