Physiological and Molecular Plant Pathology 73 (2009) 6777

Contents lists available at ScienceDirect

Physiological and Molecular Plant Pathology

journal homepage: www.elsevier.com/locate/pmpp

Induced resistance in tomato plants to the toxin-dependent necrotrophic pathogen Alternaria alternata
Mayumi Egusa a, Hajime Akamatsu b,1, Takashi Tsuge c, Hiroshi Otani b, Motoichiro Kodama b, *
a

The United Graduate School of Agricultural Sciences, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japan Laboratory of Plant Pathology, Faculty of Agriculture, Tottori University, 4-101 Koyama-Minami, Tottori 680-8553, Japan c Graduate School of Bioagricultural Sciences, Nagoya University, Chikusa, Nagoya 464-8601, Japan
b

a r t i c l e i n f o
Article history: Accepted 3 February 2009 Keywords: Alternaria alternata Host-specic toxin AAL-toxin Salicylic acid Jasmonic acid Induced resistance Solanum lycopersicum

a b s t r a c t
A necrotrophic pathogen, the tomato pathotype of Alternaria alternata (Aa) causes Alternaria stem canker on tomato. Its pathogenicity depends on the production of host-specic AAL-toxin. Pre-inoculation with nonpathogenic Aa or pretreatment an elicitor prepared from Aa reduced disease symptoms by the pathogen. Salicylic acid (SA)- and jasmonic acid (JA)-dependent defense responses in tomato are not involved in the resistance to the pathogen induced by nonpathogenic Aa. The results suggest that an alternative and unknown signaling pathway independent of SA- and JA-signaling might modulate the induced resistance by activating the expression of the multiple defense genes. 2009 Elsevier Ltd. All rights reserved.

1. Introduction Plants are exposed to a large number of microorganisms, most of which are not able to invade plants because of the preformed resistance, including cell wall and antimicrobial compounds, and because of induced resistance, including the elicitor-induced production of phytoalexin and pathogenesis-related (PR) proteins [14]. There are many reports concerning the resistance conferred by a specic interaction between the fungal avirulence gene (Avr) and the plant resistance gene (R), called gene-for-gene resistance [1,3,5]. Because gene-for-gene resistance is generally regarded as race/cultivar specic, this type of resistance is called host resistance and the products of Avr genes are the specic elicitors [2,3,5]. On the other hand, the resistance that does not depend on R/Avr interaction and is induced in broad range of host plants against broad spectrum pathogens has been considered as basal resistance, general resistance or non-host resistance which is triggered by non-specic or general elicitors known as microbe-associated molecular patterns (MAMPs) [1,2,5,6]. Recently, several MAMPs, including bacterial agellin (e.g., g22 highly conserved 22 amino acids in agellin [7]), lipopolysaccharide, elongation factor Tu (EF-

* Corresponding author. Tel./fax:81 857 31 5364. E-mail address: mk@muses.tottori-u.ac.jp (M. Kodama). 1 Present address: Biological Resources Division, Japan international Research Center for Agricultural Sciences, 1-1 Ohwashi, Tsukuba, Ibaraki 305-8686 Japan. 0885-5765/$ see front matter 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.pmpp.2009.02.001

Tu [8]), and fungal chitin and b-glucans [9,10] have been well characterized. MAMPs are constitutively present in microbes and are essential for viability, for example as main structural components of cell walls or membranes, and bacterial motility. Plant defense responses are activated by the perception of these elicitors or MAMPs through signal transduction pathways. Salicylic acid (SA) and jasmonic acid (JA)/ethylene (ET) signaling have been well demonstrated as playing important roles in both basal and specic resistance [2,1113,19]. It is well known that SA signaling is important for resistance against biotrophic pathogens, whereas JA/ ET signaling is important against necrotrophic pathogens, and that these signaling pathways interact with each other in a complicated manner [1113]. Application of SA and its analogs enhanced resistance in Arabidopsis or tobacco against Erwinia carotovora, Peronospora parasitica, Phytophthora parasitica, Pseudomonas syringae pv. maculicola, and tobacco mosaic virus [1216]. On the other hand, exogenous JA and methyl jasmonate (MeJA) application plant induced resistance against Alternaria brassicicola, Botrytis cinerea and Phytophthora infestans [12,13,17,18]. Furthermore, expression of SA- or JA-dependent genes was increased infection with virulent and a virulent pathogens [19]. In addition to this evidence, the isolation of signaling mutants has helped to elucidate the role of signaling in host defense responses. Transgenic Arabidopsis plants expressing NahG, which are unable to accumulate SA and express the SA-dependent PRgenes [20], npr1/nim1, which have a defect in responding to SA and

68

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

expressing SA-dependent genes [14,15], and sid2, which fail to accumulate SA [21], have shown enhanced susceptibility not only to virulent and a virulent pathogens but also to non-host pathogens, including Blumeria graminis, Erysiphe orontii, Peronospora parasitica, P. syringae pv. maculicola and Uromyces vignae [12,14,15,2123]. In contrast, the JA-related tomato mutant def1, which is defective in the octadecanoid synthesis pathway and in the systemic wound signaling pathway [24,25], exhibited increased susceptibility to Fusarium oxysporum f. sp. lycopersici, P. syringae, P. infestans and Verticillium dahliae [26]. The JA-insensitive Arabidopsis coi1 mutant [27] also showed enhanced susceptibility against A. brassicicola and B. cinerea [12]. Alternaria alternata (Fries) Keissler (Aa) is a ubiquitous fungus that can be found on many kinds of plants and other substrata. While having a general potential for aggressiveness, most of them are unable to invade the potential host plants due to basal, general or non-host resistance [28,29]. However, some of these fungal pathogens are necrotrophic and produce host-specic toxins (HSTs) that cause necrotic cell death only on susceptible plant cultivars [2831]. HSTs are dened as pathogen effectors that induce toxicity and promote disease only in the susceptible host plants [32]. The tomato pathotype of Aa, which produces host-specic AALtoxins, causes Alternaria stem canker on susceptible tomato cultivars [28,33]. AAL-toxins have shown to induce the infection of nonpathogenic Aa, which does not produce these toxins, on susceptible tomato cultivars at low concentrations [34]. AAL-toxindecient mutants cannot cause symptoms on susceptible tomatoes [35]. These results indicate that the AAL-toxins play an essential role in the pathogenicity of the tomato-Aa pathotype. The structure of the AAL-toxins, which is a chemically related analog of the mycotoxin fumonisins produced by Fusarium moniliforme, has already been determined [36,37]. AAL-toxins and fumonisins are sphinganine-analog mycotoxins that induce apoptotic cell death in susceptible tomato and mammalian cells by inhibiting ceramide biosynthesis [3840]. In the resistant cultivar, insensitivity to AALtoxin is conferred by the resistance gene Asc-1 (Alternaria stem canker), a homolog of the yeast longevity assurance gene (LAG1), which appears to salvage the endoplasmic reticulum-to-Golgi transportation of glycosylphosphatidylinositol-anchored proteins by the production of alternative ceramide [41]. Although roles for toxins as effectors of disease susceptibility have been well characterized in many plant-pathogen interactions, there is little knowledge on the mechanisms of general, basal or non-host resistance in host plants against toxigenic and necrotrophic pathogens that depend on toxins for their pathogenesis, except for defense responses in rough lemon against Aa [4244]. We have analyzed the induced- and basal-defense responses of plants against Aa, using the Aa/AAL-toxin and tomato interaction as a model system. Here, we demonstrate that the resistance against pathogenic Aa was induced by infection with nonpathogenic Aa. Furthermore, SA- and JA-dependent signaling pathways are not involved in host defense against the necrotrophic and toxindependent Aa pathogen. Rather, the induced resistance might be activated by alternative unknown signaling involving the activated expression of multiple defense genes. 2. Materials and methods 2.1. Fungal strains and plant materials The tomato pathotype of A. alternata (Aa) (synonym A. alternata f. sp. lycopersici, synonym A. arborescens) strain As-27, which produces host-specic AAL-toxins, and nonpathogenic strain O-94 producing no AAL-toxin, was maintained on potato dextrose agar (PDA) (Difco, Detroit, MI, USA) slopes or as 15% glycerol stocks at

80  C. For pathogenicity tests, spores of the fungus were prepared as previously described [45]. Corynespora cassiicola [46,47] strain LC93020, which produces the host-specic CCT-toxin, was maintained on PDA as described above, and conidia of the fungus were prepared as described previously [48]. B. cinerea strain O-235 was maintained on PDA and conidia were prepared by culturing on V-8 Juice agar plates under Black Light Blue (BLB) light for 2 days and then in the dark for 1 week. Spores formed on the plates were harvested by brushing the surface of the plates and suspended in distilled water containing 1% peptone. Tomato plants (Solanum lycopersicum L.) were grown in sterilized soil in a growth chamber (Growth Cabinet MLR-350, Sanyo, Osaka) with a 16 h photoperiod at 25  C. After 5 weeks of growth, tomato plants were grown in a greenhouse at 2426  C. Tomato cultivar Aichi-rst (AF; Toyohashi Seed Co., Aichi, Japan) was highly susceptible to the tomato pathotype of Aa, and cultivar Micro-Tom was resistant [48]. The jasmonate biosynthetic mutant def1 [24,25] was kindly provided by G.A. Howe, and the NahG [20] transgenic tomato mutant expressing the SA hydroxylase gene was provided by J. Jones. 2.2. Assay for induced resistance The detached leaves of tomato cultivar AF (8 weeks old) were inoculated with spore suspension (106 spores ml1) of the nonpathogenic strain O-94 using a glass atomizer and incubated in a moist chamber for 6 h at 25  C. The leaves were then washed with distilled water (DW) and sprayed with spore suspension (106 spores ml1) of the virulent strain As-27 or spore suspensions (105 spores ml1) of LC93020. The necrotic lesion area was observed 4 days post-inoculation (dpi). A whole plant of the cultivar Micro-Tom (5-weeks-old) was inoculated with spore suspension of O-94, covered with a plastic bag and maintained under the same conditions as described above. After 24 h, the plant was rinsed with DW and inoculated with spore suspension (5 106 spores ml1) of B. cinerea. The necrotic area was determined by using ATTO analyzing software (ATTO Densitograph series Version 2.0, ATTO, Tokyo, Japan) at 3 dpi. 2.3. Microscopic observation Inoculated leaves were xed and decolorized in ethanol-acetic acid solution (3:1, v/v) until chlorophyll was removed. The leaves were then stained with aniline blue (0.1%, w/v) in lactophenol (1:1:1:1, v/v/v/v, lactic acid/glycerol/phenol/water) at 65  C for 3 h. The infection behaviors, spore germination, appressorium formation and infection haypha formation were observed under a light microscope (Nikon, Tokyo, Japan). 2.4. Real-time PCR For the estimation of in plant fungal biomass, fungal genomic DNAs were extracted from 0.1 g of inoculated leaves with DNeasy Plant Mini Kit (Qiagen, Tokyo, Japan), following the manufacturers instructions. Extracted DNA was diluted 1/100 and used for realtime PCR template. Real-time PCR was performed using SYBER Green system on a LightCycler (Roche Diagnostics, Tokyo, Japan). Five ml of diluted DNA was added to a 20-ml reaction containing 4 ml SYBER Green Mastermix, 0.5 mM gene specic primers pairs. The primer pairs (DeH-F, 50 -CTCCGCCTGCCAATGTGATTAC-30 and E8T7, 50 -GCGTACCAAGGCACGTGCTCAA-30 ) designed for amplication of the gene for AAL-toxin biosynthesis (ALT1) were used for detecting the tomato pathotype of Aa [34,49]. PCR was performed with an initial step of 10 min at 95  C followed by 35 cycles of 5 s at 95  C, 6 s at 68  C, 10 s at 72  C, and then melting program of 0 s at 95  C, and

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

69

slowly heated from 73 to 97  C at 0.1  C s1. The primer pairs (CCT-F, 50 -GGCGAGCTGATTATTGAAGG-30 and CCT-R, 50 -CCTGTGGGAATAAAGTCTGG-30 ) designed for amplication of the gene for a nonribosomal peptide synthetase specically found in C. cassiicola strains (M. Kodama, personal communication) were used for quantifying the DNAs of C. cassiicola. PCR was performed with an initial step of 10 min at 95  C followed by 35 cycles of 1 s at 95  C, 5 s at 60  C, 18 s at 72  C, and then melting program of 0 s at 95  C, and slowly heated from 65 to 97  C at 0.2  C s1. Standard curve was created with fungal genomic DNAs as a template, which prepared from As-27 or LC93020 mycelia by DNeasy Plant Mini Kit (Qiagen). To analyze the expression of genes for disease resistance in tomato, a whole plant of AF (5-weeks-old) was inoculated with O94 spore suspensions (106 spores ml1) by spray treatment. The plants were covered with a plastic bag to keep a high-humidity and incubated at 25  C in a growth chamber. After 6, 12 and 24 h of incubation, leaves were harvested and total RNA was extracted with RNeasy Plant Mini Kits (Qiagen), following the manufacturers instructions. Total RNA was treated with DNase I (Nippongene, Toyama, Japan) to remove traces of contaminating DNA and 1 mg of RNA was converted into cDNA by the RNA PCR kit (AMV) Ver. 3.0 (Takara, Shiga, Japan) using random 9 mers primer, according to the manufacturers conditions. Real-time PCR was conducted with 2 ml of the cDNA sample and the specic primers indicated in Table 1 as described above. PCR was performed with an initial step of 10 min at 95  C followed by 35 cycles of 1 s at 95  C, 5 s at 58  C, 10 s at
Table 1 Oligonucleotide primers used in this study. Primer pair 94AF1A05-F 94AF1A05-R 94AF1G04-F 94AF1G04-R 94AF2C04-F 94AF2C04-R 94AF2E09-F 94AF2E09-R 94AF2E12-F 94AF2E12-R 94AF2F12-F 94AF2F12-R 94AF2H06-F 94AF2H06-R 94AF3A06-F 94AF3A06-R 94AF3F08-F 94AF 3F08-R 94AF 3F09-F 94AF 3F09-R 94AF 4D02-F 94AF 4D02-R 94AF 4E03-F 94AF 4E03-R 94AF 4G03-F 94AF 4G03-R 94AF4G11-F 94AF4G11-R 94AF 4H04-F 94AF 4H04-R 94AF4H11-F 94AF4H11-R 94AF13-F 94AF13-R 94AF35-F 94AF35-R 94AF36-F 94AF36-R Target genea AC215459 AF512549 BP910076 AK247674 BY999927 TC194085 BY999940 BY999943 L12051 BT013028 BY999978 TC206865 TC206779 AK246682 BY999995 BY999999 AF230371 AF004165 CJ999369 Sequence (50 / 30 ) GTTCCCTTGGCTGTGGTTTC TTAGTGACGCGCATGAATGG CCATTTGGTTTACGTAGCAG CTCTCTAACCCTTGCTTCAC AGATGAAACAGTACAAGTGG TGTCTTCTCTTTACTCTGTG ACGATGAGAGTAAGAACGCA GCCGATTATAACCCCTTCAC GCAAATTCCCACAAGGTTTC TCTGTTTCACTGTAATGGCT GCCCCTGATGATCTGACCTT TACGTGCAGCAAGAGTCTCA GGTTGCATATGTTGTTCGCT TCAGTCAGAGAGCTATTGGG TCTTTATCCGCGTCTTGCTC ATGGAACAGCCTCGTCTATG GTTGGCATCACTAGGGTTGT CTCTGATGTGGGGTACTGTG GACTTGTTTCTGGCACCTCA TGGCATAGCATCCTGGAAAG CCCTTCCATTTCATTCCCAA GGAATGAGTGGATCTCCGAA GGTGGTCTTTTCCTGCTATC TCCATTTGGAACTTAGCCTT TGAGTGATCCGTACAAGACC CGGGTGATACTGAAGAGCAA ACTTGCAATTTGAGAACCTG TGGGTAATCAGACTGCAAAA GTTTGTATTGAAGATTGTGG ATCCAGAAAGGTATCATATC CTCCAAATCCCTAAACCTCT AATGGTGATGATCTGTTGTG GAGCTTTTCGAAACCCTAGA AAGACCGAGAGTTATCACAG GTGCCTATTACGCTCCTTGA ATGTGCGGTGAATAGTCTGT ACTGTAAGCATGATTGTCTC CCAATCATGACATATCCACT

72  C, and then melting program of 0 s at 95  C, and slowly heated from 63 to 97  C at 0.1  C s1. 2.5. Preparation and treatment Aa elicitor Spore suspensions (106 spores ml1) of O-94 were dropped in a moist chamber and incubated at 25  C for 24 h. After incubation, the spore germination uids (SGF) were collected and ltrated with Whatman No. 50 lter paper, and then the ltrate was concentrated 20-fold of the original volume by lyophilization and used as the elicitor. AF leaves were sprayed with the elicitor solution or DW and incubated in moist chamber at 25  C for 6 h. After rinsing with DW, the leaves were inoculated with As-27 spore suspensions (106 spores ml1). AF leaves were also inoculated with As-27 spores suspended in the elicitor solution. The lesion formation was observed at 4 dpi. 2.6. Effect of SA or MeJA on Aa AF plants were treated with SA (0.2 mM) or MeJA (100 mM) solution by root feeding. After 24 h, AF plants were inoculated with spore suspension (106 spores ml1) of As-27 using grass atomizer. Necrotic lesion formation was observed at 4 dpi. The leaves of 8week-old def1 and NahG plants were inoculated with spore suspension of O-94 (106 spores ml1). After 4 days, inoculated leaves were xed and decolorized, and the infection behaviors of O94 were observed as described above. 2.7. SA determination AF leaves were inoculated with spore suspension of O-94 or As27, or treated with elicitor. After 24 h, leaves (0.5 g) were ground in liquid nitrogen, then SA and SA conjugates were extracted and analyzed as described Enyedi et al. [50]. HPLC analysis was performed using a Hitachi HPLC system equipped with a F-1050 uorescence spectrophotometer, L-6000 pump, L-5000 LC controller, and D-2500 chromato-integrator (Hitachi, Tokyo, Japan). The sample was injected and chromatographed on an ODS-UG-5 column (4.6 150 mm) using methanol/0.1%(v/v) phosphate (75:25, v/v) at a ow rate of 0.7 ml/min. The excitation and emission wavelengths were 295 nm and 400 nm, respectively. 2.8. Suppression subtractive hybridization (SSH) For RNA preparation, AF plants were treated with spores of O-94 (106 spores 1ml) or DW. Tomato leaves were collected at 6, 12 and 24 h after inoculation and total RNA was extracted with the RNeasy Plant Mini Kit (Qiagen). The mRNA was puried with the PolyATtract mRNA isolation system (Promega, Tokyo, Japan) following the manufacturers instructions. SSH was performed with the mRNA from DW-treated leaves as a driver and O-94-inoculated leaves as a tester according to the protocol for the PCR-Select cDNA subtraction kit (BD Biosciences Clonetech, Palo Alto, CA). After cDNA amplication, PCR products were cloned into the pDrive Cloning vector and transformed into Qiagen EZ Competent Cells using the PCR Cloning kit (Qiagen) according to the suppliers protocol. In total, 262 randomly selected clones were one-pass sequenced at the Dragon Genomics Center (Takara-Bio, Shiga, Japan). The sequences of the clones were annotated using the NCBI (National Center for Biotechnology Information) BlastN and BlastX searches, and functional classication was performed using the Arabidopsis thaliana Munich Information Center for Protein Sequences database (MIPS, http://mips.gsf.de/projects/funcat).

a Primer pairs were designed from SSH clones and corresponding genes of tomatoes showing signicant identities (more than 95%) by a BlastN search of NCBI or the TIGR Gene Indices (http://compbio.dfci.harvard.edu/tgi/).

70

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

Fig. 1. Induced resistance to the tomato pathogens in tomato by pre-inoculation with nonpathogenic Aa. (a) The leaves of susceptible tomato AF were inoculated with nonpathogenic Aa (O-94), the tomato pathotype of Aa (As-27) or C. cassiicola (LC93020). Tomato leaves pre-inoculated with O-94 were then inoculated with As-27 (Pre-O-94 / As27) or LC93020 (Pre-O-94 / LC93020). DW was treated as a control (DW). Lesion formation on the leaves was observed at 4 dpi. (b,c) Fungal biomass of the tomato pathogens in the infected plants pre-inoculated with O-94 (Pre-O-94) or control (DW) was estimated by quantifying fungal DNA with real-time PCR using primers specic for the As-27 ALT1 gene (b) and the LC93020 cyclic peptide synthetase gene (c). The results show relative values to control leaves for four independent experiments and error bars indicate standard error (SE). An asterisk indicates a signicant difference between pre-inoculated leaves and control (paired t-test, P < 0.05). RU; relative unit.

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

71

3. Results 3.1. Induced resistance to the tomato pathotype in tomato To assess the effects of pre-inoculation with the non-pathogen against infection by toxin-dependent pathogens, we inoculated leaves of the susceptible tomato AF with nonpathogenic Aa strain O-94 and then the tomato pathotype Aa strain As-27. Necrotic lesion formation was observed on the leaves inoculated with As-27 (Fig. 1a), while there was no visible lesion, even hypersensitive response (HR)-like cell death, on the leaves inoculated with O-94 (Fig. 1a). Microscopic observation indicated that spore germination and appressorium formation of O-94 on AF leaves were normal, whereas infection hypha formation was clearly inhibited (data not shown). The combination of pathogenic Aa As-27 and resistance cultivar Micro-Tom also resulted in no visible symptoms and a suppression of infection hypha formation, as is the case with the non-pathogen and cultivar AF [48]. The results indicate that formation of the infection hypha is the most critical step for successful infection by Aa pathogens. On the other hand, when AF leaves were inoculated with As-27 following pre-inoculated with O-94, lesion formation by the pathogen clearly decreased compared with the control inoculation (Fig. 1a). Because O-94 and

As-27 are morphologically indistinguishable under the microscope, it is difcult to observe the infection behaviors of the pathogen on the leaves pre-inoculated with the non-pathogen. The amount of in planta fungal DNA representing the biomass of As-27 in AF leaves was quantied by real-time PCR using ALT1 specic primers. Fig. 1b shows that the amount of fungal biomass of As-27 in AF leaves inoculated with As-27 following O-94 was 2.1-times less than that in control leaves (paired t-test, P < 0.05). These results imply that infection by the pathogen was suppressed by pre-inoculation with the nonpathogenic strain. The SGF prepared from the germinating spores of O-94 was used as an elicitor. AF leaves were pretreated with the elicitor, and after 6 h of incubation the leaves were inoculated with spores of As-27. Treatment of leaves with the elicitor alone did not cause any visible change on the leaves (Fig. 2a), suggesting that the elicitor does not induce HR-like cell death on tomato leaves. Lesion formation by As-27 was inhibited by pretreatment of the elicitor, as well as by pre-inoculation with O-94 (Fig. 2a). When AF leaves were inoculated with spores of As-27 suspended in the elicitor solution (i.e., the simultaneous treatment with elicitor and pathogen), the development of symptoms on the leaves was not suppressed (Fig. 2a). Infection behaviors of As-27 spores on the inoculated leaves were observed under the microscope. The rates of spore germination and appressorium formation

Fig. 2. Induced resistance to the Aa tomato pathotype in tomato by pretreatment with elicitor. The elicitor was prepared from nonpathogenic Aa spore germination uids. (a) Leaves of AF were pretreated with elicitor and then inoculated with As-27 (Pre-elicitor / As-27). AF leaves were inoculated with As-27 with the elicitor simultaneously (Elicitor As-27). Elicitor treatment (Elicitor) and As-27 inoculation (As-27) only were used as controls. Lesion formation was observed at 4 dpi. (b) Infection behaviors of As-27 were observed under light microscopy 48 h post-inoculation. SG; spore germination, A; appressorium formation, IH; infection hypha formation. Data represent the mean of four independent experiments, and error bars indicate SE. Different letters indicate signicant levels of difference (Duncans new multiple range test, P < 0.05).

72

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

were similar among all treatments and inoculations (Fig. 2b). On the other hand, infection hypha formation was clearly inhibited by pretreatment of the elicitor (Fig. 2b). 3.2. Induced resistance in tomato by nonpathogenic Aa to infection with other necrotrophic pathogens To evaluate the effectiveness of the induced resistance by nonpathogenic Aa against infection with other necrotrophic pathogens, C. casiicola, a causal agent of target spot of tomato and a host-specic CCT-toxin producer, was used for a challenge inoculation. Spore inoculation of a virulent strain LC93020 resulted in the development of severe symptoms on the leaves (Fig. 1a), but pre-inoculation with O-94 clearly decreased lesion formation by LC93020 (Fig. 1a). Fungal biomass of C. casiicola in the infected plants was estimated by quantifying fungal DNAs with real-time PCR using primers specic for the pathogen. The amount of fungal DNA in the leaves pre-inoculated with O-94 was 1.5-fold less than that in the control leaves (paired t-test, P < 0.05) (Fig. 1c). This result suggests that induced resistance by nonpathogenic Aa might be efcient not only against the infection with pathogenic Aa but also against other HST-producing necrotrophic pathogens. B. cinerea has been used as a typical necrotrophic pathogen in the studies of disease resistance in some plants, including tomato and Arabidopsis [12,18,51,52]. To determine whether the Aainduced resistance in tomato is effective against B. cinerea, MicroTom plants were inoculated with O-94 and then challenged with B. cinera. Necrotic lesions on the infected plants were indistinguishable in Aa pre-inoculated and control tomatoes (Fig. 3a and b). This result indicates that induced resistance by O-94 was not efcacious against B. cinerea infection. 3.3. SA- and JA-signaling pathways are not involved in the induced resistance against infection by Aa in tomato SA and JA have been shown to have a major role in plant defense against pathogens in tomato, Arabidopsis and other plants [2,11 13,19]. To assess the involvement of SA and JA in the induced resistance of tomato against HST-producing necrotrophic pathogens, AF plants were treated with 0.2 mM of SA or 100 mM of MeJA solutions and then inoculated with the Aa tomato pathotype As-27. Expression of the marker genes PR-1 and PI for SA- and JA-signaling pathways, respectively, increased after treatment with SA and JA, respectively, indicating that those signaling pathways were activated in the tomato plants (data not shown). Pretreatment of the tomato plants with SA and MeJA did not inuence lesion formation on the leaves (Fig. 4a). Likewise, there were no differences in infection behaviors of the pathogen on the plants treated with SA or MeJA (Fig. 4b). The SA levels in the leaves inoculated with nonpathogenic Aa O-94 or the tomato pathotype As-27 were quantied by HPLC. The concentration of SA in the leaves was not changed after inoculation with O-94 or As-27 (Fig. 5). 3.4. Response of NahG and def1 tomatoes to infection with nonpathogenic Aa Previous studies have shown that mutants with a defect in SAor JA-signaling pathways exhibit increased susceptibility to pathogens since SA and JA are closely related to disease resistance in many plants [12,14,15,2123,26]. To further determine whether SAand JA-signaling pathways in tomato are involved in the resistance to Aa infection, NahG and def1 mutant tomatoes were inoculated with spores of a nonpathogenic Aa strain O-94. The NahG tomato is unable to accumulate SA, due to the degradation of SA by nahGencoded SA hydoroxylase [20]. The def1 tomato does not

accumulate JA in response to wounding and pathogen infection, and it is decient in the activation of wound or JA-inducible defense genes [24,25]. Inoculation of these mutant plants with O-94 did not cause any visible lesions on the leaves of either plant (Fig. 6). Under microscopic observation, although spore germination and appressorium formation were observed on the mutant leaves, infection hypha formation, which is the most critical step for establishing the initial infection of Aa pathogens, was not induced, even on the mutant tomato leaves (Table 2). The results indicate that the defect in SA- and JA-signaling in tomatoes does not lead to the induction of Aa infection. SA and JA may not be important compounds for basal defense responses in tomato against infection by Aa. 3.5. Induced resistance by nonpathogenic Aa in the def1 tomato Since def1 tomato and its WT strain of origin, Castlemart, are susceptible to tomato pathotype Aa, it is possible to assess whether JA signaling is involved in the resistance to tomato pathotype induced by nonpathogenic Aa O-94. def1 leaves were pre-inoculated with spores of O-94 and then challenged with virulent strain

Fig. 3. Effect of pre-inoculation with nonpathogenic Aa in tomato on infection by B. cinera. (a) Micro-Tom tomato was pre-inoculated with nonpathogenic Aa (O-94) and then inoculated with B. cinera. Pretreatment of DW was used as control (DW). Lesion formation was observed at 3 dpi. (b) Comparison of necrotic areas between the leaves pre-inoculated with O-94 (O-94) and control (DW). The proportion of lesion area on the leaf was estimated. Results indicate relative value to control leaves in three independent experiments and error bars indicate SE. RU; relative unit.

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

73

Fig. 4. Effects of SA and MeJA on infection of the Aa tomato pathotype. (a) Leaves of AF were pretreated with 0.2 mM SA (pre-SA / As-27) or 100 mM MeJA (pre-MeJA / As-27) and then inoculated with As-27. Pretreatment with DW was used as control (As-27). Lesion formation on the leaves was observed at 4 dpi. (b) Infection behaviors of As-27 were observed under light microscopy at 4 dpi. SG; spore germination, A; appressorium formation, IH; infection hypha formation. Data represent the mean of four independent experiments and error bars indicate SE. There were no signicant differences among pretreatment with SA (shaded bar), MeJA (lled bar) and DW (control; open bar).

As-27. After 4 days, necrotic lesions were found on both O-94-preinoculated and control (DW) leaves (Fig. 7a). However, pathogeninduced development of necrotic lesions on def1 leaves pre-inocu lated with the non-pathogen signicantly decreased compared to that on control leaves (Fig. 7a). The amount of As-27 DNA in the pre-inoculated leaves estimated by real-time PCR was 6.0-fold less than in the control leaves (Fig. 7b), indicating a suppression of pathogen growth by pre-inoculation with nonpathogenic Aa. These results suggest that the resistance against the tomato pathotype induced in tomato by nonpathogenic Aa is still active in the absence of JA-dependent signaling. 3.6. Suppression subtractive hybridization (SSH) identied putative defense gene(s) associated with induced resistance by nonpathogenic Aa in tomato To identify tomato genes that are involved in the resistance to infection by the tomato pathotype induced by nonpathogenic Aa, SSH was performed using O-94-inoculated leaves as the tester and

DW-treated leaves as the driver. In total, 262 clones were randomly picked up from a subtraction library and subsequently sequenced. The nucleotide sequences of 219 clones were determined. BlastN analysis (<e5) showed 150 clones were unigenes (57 contigs and 135 singlets) corresponded to known genes, and 27 clones had no matches in the databases. On the other hand, BlastX (<e5) analysis indicated that 143 clones had signicant homology to known proteins and that 34 clones were not similar to any known proteins (Supplemental Table). These clones were divided into functional categories by the MIPS Functional Catalogue (MIPS, http://mips.gsf. de/projects/funcat). To analyze the expression of genes in tomato plants involved in signal transduction and defense or reported to be included in the defense responses against biotic or abiotic stress in plants inoculated with nonpathogenic Aa O-94, we randomly selected nineteen clones that had been categorized as such. Thirteen clones whose expression was increased from 6 to 24 h after O-94 inoculation are listed in Table 3. These corresponding proteins determined by the SSH were known to be involved in both non-host resistance and host resistance [5360].

74

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

Fig. 5. Accumulation of SA in tomato following pathogen inoculation and elicitor treatment. Leaves of AF tomato were inoculated with nonpathogenic Aa (O-94), the tomato pathotype of Aa (As-27), or treated with elicitor. Leaves were collected after 24 h and total SA (conjugated with glucose) and free SA were extracted. Amounts of SA were quantied by HPLC. Data represent the mean of two independent experiments and error bars indicate SE.

4. Discussion Lesion formation on tomato leaves by the Aa tomato pathotype was reduced by pre-inoculation with nonpathogenic Aa. It is difcult to observe infection behaviors of the tomato pathotype on the leaves that were pre-inoculated with nonpathogenic Aa, since there is no morphological difference between nonpathogenic and pathogenic strains of Aa. Thus, fungal biomass of the pathogenic strain in the infected plants was estimated by quantifying fungal DNA with real-time PCR using primers specic for the ALT1 gene, which is involved in toxin biosynthesis and in Aa tomato pathotype pathogenicity. The amount of fungal pathogen DNA in the preinoculated plants was decreased, indicating that in planta growth of the Aa tomato pathotype was restricted by the inoculation with the non-pathogen. Plants defend themselves from pathogens by basal defenses and induced resistances including anti-fungal properties, phytoalexins and PR-proteins [14]. Although tomato is known to produce the anti-fungal compound, a-tomatine, Aa has ability to detoxify it [61]. Until now there has been no report on anti-fungal compounds effective against infection with Aa. Pretreatment with the SGF of nonpathogenic Aa O-94 also protected tomato against infection by the Aa tomato pathotype. The SGF elicitor from Aa is a mannose-rich heteropolysaccharide with a molecular weight of about 40,000 Daltons [29]. The resistanceinducing activity of the SGF elicitor was found not only in tomato but also in Japanese pear, apple and strawberry against other Aa pathotypes [29]. This means that SGF from Aa is a non-specic and general elicitor that induces the defense response in a wide range of plant species. Moreover, pre-inoculation with O-94 induced resistance against infection with the tomato pathogen C. cassiicola that causes Corynespora target spot. This result also indicates that the Aa elicitor has resistance-inducing activity against a broad spectrum of pathogen species as a general elicitor. Microscopic observation of infection behaviors of the Aa tomato pathotype on tomato leaves revealed that reduction of lesion formation depends on the restriction of infection hypha formation of the pathogen. An incompatible interaction between Aa and resistant cultivars does not depend on a specic R-gene and Avr gene interaction; rather it has been regarded as non-host, general or basal resistance. Two types of non-host resistance have been reported. Type I has no visible reaction on the non-host plant, and type II is accompanied with HR cell death [6,62]. In type II resistance, non-pathogens are restricted in cell death after penetration

Fig. 6. Response of SA and JA signaling in mutant tomato plants infected with nonpathogenic Aa. The leaves of NahG, derived from Moneymaker, and of def1, derived from Castlemart, were inoculated with O-94. Inoculated leaves were observed at 4 dpi.

in one or a few plant cells, whereas in type I resistance, invasion and penetration in plant cell tissues by non-pathogens are not observed. The interaction between Aa and resistant plants should be considered to be type I non-host resistance, because neither visible symptoms nor cell death were detected on the infected tomato leaves. In the interactions between nonpathogenic Aa and its potential host, or between Aa pathotypes and a resistant cultivar, spore germination and appressorium formation are observed as between the pathogenic Aa and the susceptible cultivar. However, infection hypha formation is obvious only in the interaction between pathogenic Aa and the susceptible cultivar. Infection hypha formation strictly depends on the susceptibility of plants to HSTs [28]. The formation of infection hypha is the most critical step for the initial establishment of infection by the Aa pathogens. It was reported that the infection-inhibiting factor (IIF) that inhibits only

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777 Table 2 Infection behaviors of nonpathogenic A. alternata on signaling mutant tomatoes. Tomato cv.a Infection behavior (%)b Spore germination Moneymaker NahG Castlemart def1 89.4 4.6 82.4 4.6 83.4 2.3 70.6 5.3 Appressorium formation 29.6 2.5 30.3 1.6 30.4 1.4 28.1 4.2

75

Infection hypha formation 0 0 0 0

a Mutant tomato NahG was derived from cv. Moneymaker, and def1 derived from cv. Castlemart. Tomato leaves were inoculated with nonpathogenic Aa O-94. Leaves were xed and decolorized for microscopic observation at 3 dpi. b Rates of spore germination, appressorium formation and infection hypha formation were indicated as percentages. Data represent the mean of four independent experiment and SE. There were no signicant differences on infection behaviors among these tomatoes.

infection hypha formation of the Japanese pear pathotype of Aa was identied from pear leaves inoculated with nonpathogenic Aa [63]. However, such a compound has not been found in tomato plants inoculated with nonpathogenic Aa.

There are some reports that MAMPs play an important role in non-host resistance [1,2,5,6]. MAMPs from lamentous fungidinc luding oligosaccharides, P-glucan and chitin, which are components of fungal cell wallsdhave been characterized [9,10]. Although the critical structure of the SGF elicitor of Aa is unknown, MAMPslike factors might be involved in induced resistance based on nonhost or general resistance of tomato plants against Aa infection. There have been many reports indicating that SA- and JAsignaling pathways play important roles in plant defense systems [2,1113,19]. However, little is known about the involvement of these signaling pathways in interactions between plants and Aa pathogens. Pretreatment of host plants with SA or MeJA has been shown to enhance resistance against infection with A. brassicicola, B. cinerea, Peronospora parasitica, P. syringae and P. infestans,
Table 3 Functional categorization of SSH clones and their expression prole. Clone ID Accession Blast No. hita Corresponding protein EST EMIPS (Organism)a length valuea fanction categoryb 260 403 3.00E- 99 25 2.00E- 14 68

Fig. 7. Induced resistance in the tomato JA signaling mutant def1 to the Aa tomato pathotype pre-inoculated with nonpathogenic Aa. (a) The leaves of def1 were inoculated with the tomato pathotype of Aa (As-27). Tomato leaves pre-inoculated with O94 were then inoculated with As-27 (Pre-O-94 / As-27) and lesion formation on the leaves was observed at 4 dpi. (b) Comparison of As-27 growth in def1 plants preinoculated with O-94 and inoculated with As-27 at 4 dpi. Fungal biomass in the infected plants was estimated by quantifying fungal DNA with real-time PCR using primers specic for the As-27 ALT1 gene. Results shows values relative to control leaves for three independent experiments and error bars indicate SE. An asterisk indicates a signicant difference between pre-inoculation with O-94 and the control (paired ttest, P < 0.05). RU; relative unit.

94AF2E09 CJ999324 CAO23453 Unnamed protein product (Vitis vinifera) 94AF2E12 BY999927 CAE45567 SUMO E2 conjugating enzyme SCE1 (Nicotiana benthamiana) 94AF2H06 BY999940 AAM13899 Putative 4-coumarate CoA ligase (Arabidopsis thaliana) 94AF3A06 BY999943 CAO68296 Putative metallophosphatase (Lupinus luteus) 94AF3F08 BY999959 P52884 GTP-binding protein SAR2 (Solanum lycopersicum) 94AF3F09 BY999960 No hit No hit 94AF4D02 BY999978 AAU00066 Pathogenesis-related protein 10 (Solanum virginianum) 94AF4E03 BY999983 AAD17230 FtsH-like protein (Nicotiana tabacum) 94AF4G03 CJ999351 ABC69274 Putative DnaJ protein (Camellia sinensis) 94AF4G11 BY999994 ABD28590 C2 (Medicago truncatula) 94AF4H04 BY999995 CAB51914 Prolin Hev b 8 (Hevea brasiliensis) 94AF13 CJ999355 AAF67141 Allene oxide synthase (Solanum lycopersicum) 94AF35 CJ999368 O04973 2-isopropylmalate synthase A (Solanum pennellii)
a b

335

2.00E- 1 39 1.00E- 99 54 3.00E- 20,30 54 No hit No hit 3.00E- 32 07 1.00E33 1.00E24 8.00E20 4.00E16 1.00E46 70 32 99 40,42,43 99

378

324

338 501

317 199 420 383 284

311

3.00E- 99 34

Corresponding proteins are predicted from BlastX (<e-5) searches. Functional categorization was performed according to the MPIS catalogue. 1; metabolism, 14; protein fate, 20; cellular transport, 30; signal transduction, 32; cell rescue, 40; cell fate, 42; biogenesis of cellular components, 43; cell type differentiation, 70; subcellular localization, 99; unclassied proteins.

76

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777

[14,15,17,18]. However, pretreatment of SA or MeJA did not reduce lesion formation in tomato leaves by the tomato pathotype of Aa. In particular, JA signaling has been known to be involved in resistance against necrotrophic pathogens [1113,18,19], while MeJA treatment did not decrease lesion development by the necrotrophic pathogen Aa tomato pathotype whose infection depends on the host-specic AAL-toxin [28,34,35]. In addition to JA signaling, ET is also involved in plant defense systems against necrotorophic pathogens [52,64]. However, in tomato-Aa tomato pathotype and AAL-toxin interactions, ET has been shown to promote cell death by the AAL-toxin [65,66]. Therefore, ET signaling in tomato may facilitate infection by the tomato pathotype, rather than induce resistance against the pathogen. Many studies have shown that SA- and JA-signaling mutants exhibit increased susceptibility against pathogens or non-pathogens [12,14,15,2123,26]. However, neither of the SA- and JAsignaling mutant tomatoes, NahG and def1, displayed increased susceptibility to nonpathogenic Aa. On the other hand, pre-inoculation of JA-related mutant def1 with O-94 induced resistance against the Aa tomato pathotype, indicating that the defense response by nonpathogenic Aa is induced in tomato independently of SA and JA signaling. It has also been reported that Arabidopsis SA-, JA- and ET-related signaling mutants retain the full inducedresistance responsibility mediated by MAMPs against a bacterial pathogen [67]. These results suggest that SA- and JA-associated signal transduction might not be involved in the induced resistance of tomatoes against infection by Aa. In addition, tomato plants preinoculated with nonpathogenic Aa O-94 did not exhibit induced resistance against B. cinerea, and SA- and JA-signaling pathways have been shown to play an important role in plant resistance against B. cinerea [51,52,12,18]. Taken together, these ndings indicate that induced resistance in tomato against infection with the tomato pathotype elicited by nonpathogenic Aa might result from activation of an alternative pathway that is independent of SA- and JA-signaling. Thuerig et al. [68] also reported that a fungal elicitor-induced resistance in Arabidopsis independently of the SAand JA/ET signaling pathways. To gain insight into factors involved in the resistance induced by nonpathogenic Aa, the expression of tomato genes induced by infection with the non-pathogen were proled using SSH. In our study, some defense-related PR-protein genes were identied, for example, PR-1 (94AF2C10, 94AF3C05; GenBank accession nos. BY999919, CJ999333), PR-5 (94AF1A09, 94AF2A03, 94AF51; GenBank accession nos. BY999894, CJ999319, CJ999375) and PR-10 (94AF4D02; GenBank accession no. BY999978).2 PR-proteins are well documented as being involved in defense responses, and some of them were known as marker genes of SA- or JA-signaling pathways [4]. Regulation of tradeoffs between SA- and JA-signaling has been reported in Arabidopsis inoculated with necrotrophic and biotrophic pathogens [69]. In this study, however, SSH clones involved in both SA- and JA-signaling pathways have been, indicating that the induced resistance against Aa might not strictly depend on those signaling pathways. In the MAMP-associated resistance, although signaling mutants exhibit induced resistance against bacterial pathogens [67], expression of SA-dependent genes was induced by MAMPs [70]. The data suggest that although basal, general or non-host resistance partially depends on SA- and JArelated pathways, SA- and JA-related defense genes may not be critical for induced resistance by nonpathogenic Aa in tomato plants. To further elucidate the role of these candidate genes in the

induced resistance of tomato against infection with Aa, functional analysis of the defense-related genes identied by SSH will be required. In summary, the results indicate that SA- and JA-dependent defense responses in tomato are not involved in induced resistance by nonpathogenic Aa against infection with the toxigenic and necrotrophic pathogen, the tomato pathotype of Aa. This nding suggests that an alternative and unknown signaling pathway that is independent of SA and JA signaling may modulate the induced resistance by nonpathogenic Aa based on basal, non-host or general resistance in tomato. However, some SA- and JA-dependent genes were expressed during the induced resistance response, suggesting the existence of SA- and JA-independent signaling pathways in this induced defense pathway in tomato. The expression proling and functional analysis of SSH clones should reveal the details of the induced resistance against toxin-dependent necrotrophic pathogens. Acknowledgements We gratefully acknowledge G. A. Howe for providing the seeds of the def1 tomato line and J. Jones for providing the seeds of the NahG transgenic tomato mutant. This work was supported by a Grant-in-Aid for Scientic Research from the Japanese Society for Promotion of Sciences. Appendix. Supplementary data Supplementary data associated with this article can be found in the online version at doi:10.1016/j.pmpp.2009.02.001. References
[1] Jones JDG, Dangl JL. The plant immune system. Nature 2006;444:3239. [2] Nurnberger T, Lipka V. Non-host resistance in plants: new insights into an old phenomenon. Mol Plant Pathol 2005;6:33545. [3] Thordal-Christensen H. Fresh insights into processes of nonhost resistance. Curr Opin Plant Biol 2003;6:3517. [4] Van Loon LC, Rep M, Pieterse CMJ. Signicance of inducible defense-related proteins in infected plants. Annu Rev Phytopathol 2006;44:13562. [5] Bent AF, Mackey D. Elicitors, effectors, and R genes: the new paradigm and a lifetime supply of questions. Annu Rev Phytopathol 2007;45:399436. [6] Mysore KS, Ryu C- M. Nonhost resistance: how much do we know? Trends Plant Sci 2004;9:97104. [7] Felix G, Duran JD, Volko S, Boller T. Plants have a sensitive perception system for the most conserved domain of bacterial agellin. Plant J 1999;18:26576. [8] Kunze G, Zipfel C, Robatzek S, Niehaus K, Boller T, Felix G. The N terminus of bacterial elongation factor Tu elicits innate immunity in Arabidopsis plants. Plant Cell 2004;16:3496507. [9] Jurgen E. Oligoglucoside elicitor-mediated activation of plant defense. Bioessays 1998;20:56976. [10] Shibuya N, Minami E. Oligosaccharide signalling for defence responses in plant. Physol Mol Plant Pathol 2001;59:22333. [11] Glazebrook J. Contrasting mechanisms of defense against biotrophic and necrotrophic pathogens. Annu Rev Phytopathol 2005;43:20527. [12] Thomma BPHJ, Eggermont K, Penninckx IAMA, Mauch-Mani B, Vogelsang R, Cammue BPA, et al. Separate jasmonate-dependent and salicylate-dependent defense-response pathways in Arabidopsis are essential for resistance to distinct microbial pathogens. Proc Natl Acad Sci USA 1998;95:1510711. [13] Ton J, Van Pelt JA, Van Loon LC, Pieterse CMJ. Differential effectiveness of salicylate-dependent and jasmonate/ethylene-dependent induced resistance in Arabidopsis. Mol Plant Microbe Interact 2002;15:2734. [14] Cao H, Bowling SA, Gordon AS, Dong X. Characterization of an Arabidopsis mutant that is nonresponsive to inducers of systemic acquired resistance. Plant Cell 1994;6:158392. [15] Delaney TP, Friedrich L, Ryals JA. Arabidopsis signal transduction mutant defective in chemically and biologically induced disease resistance. Proc Natl Acad Sci USA 1995;92:66026. [16] Friedrich L, Lawton K, Ruess W, Masner P, Specker N, Rella MG, et al. A benzothiadiazole derivative induces systemic aquired resistance in tobacco. Plant J 1996;10:6170. [17] Cohen Y, Gisi U, Niderman T. Local and systemic protection against Phytophthora infestans induced in potato and tomato plants by jasmonic acid and jasmonic methyl ester. Phytopathology 1993;83:105462.

2 The nucleotide sequence data reported are available in the DDBJ/EMBL/GenBank database under the accession numbers BY999892BY999999 and CJ999310 CJ999378.

M. Egusa et al. / Physiological and Molecular Plant Pathology 73 (2009) 6777 [18] Thomma BPHJ, Eggermont K, Broekaert WF, Cammue BPA. Disease development of several fungi on Arabidopsis can be reduced by treatment with methyl jasmonate. Plant Physiol Biochem 2000;38:4217. [19] Thomma BPHJ, Tierens KFM, Penninckx IAMA, Mauch-Mani B, Broekaert WF, Cammue BPA. Different micro-organisms differentially induce Arabidopsis disease response pathways. Plant Physiol Biochem 2001;39:67380. [20] Brading PA, Hammond-Kosack KE, Parr A, Jones JDG. Salicylic acid is not required for Cf-2- and Cf-9-dependent resistance of tomato to Cladosporium fulvum. Plant J 2000;23:30518. [21] Dewdney J, Reuber TL, Wildermuth MC, Devoto A, Cui J, Stutius LM, et al. Three unique mutants of Arabidopsis identify eds loci required for limiting growth of a biotrophic fungal pathogen. Plant J 2000;24:20518. [22] Mellersh DG, Heath MC. An investigation into the involvement of defense signaling pathways in components of the nonhost resistance of Arabidopsis thaliana to rust fungi also reveals a model system for studying rust fungal compatibility. Mol Plant Microbe Interact 2003;16:398404. [23] Zimmerli L, Stein M, Lipla V, Schulze-Lefert P, Somerville S. Host and non-host pathogens elicit different jasmonate/ethylene responses in Arabidopsis. Plant J 2004;40:63346. [24] Lightner J, Pearce G, Ryan CA, Browse J. Isolation of signaling mutants of tomato (Lycopersicon esculentum). Mol Gen Genet 1993;241:595601. [25] Howe GA, Lightner J, Browse J, Ryan CA. An octadecanoid pathway mutant (JL5) of tomato is compromised in signaling for defense against insect attack. Plant Cell 1996;8:206777. [26] Thaler J, Owen B, Higgins VJ. The role of the jasmonate response in plant susceptibility to diverse pathogens with a range of lifestyles. Plant Physiol 2004;135:5308. [27] Feys BJF, Benedetti CE, Penfold CN, Turner JG. Arabidopsis mutants selected for resistance to the phytotoxin coronatine are male sterile, insensitive to Methyl jasmonate, and resistant to a bacterial pathogen. Plant Cell 1994;6:7519. [28] Nishimura S, Kohmoto K. Host-specic toxins and chemical structures from Alternaria species. Annu Rev Phytopathol 1983;21:87116. [29] Otani H, Kohmoto K, Kodama M, Nishimura S. Role of host-specic toxins in the pathogenesis of Alternaria alternata. In: Patil SS, Ouchi S, Mills D, Vance C, editors. Molecular strategies of pathogens and host plants. New York: Springer-Verlag; 1991. p. 13949. [30] Kohmoto K, Otani H. Host-recognition by toxigenic plant pathogens. Experientia 1991;47:75564. [31] Otani H, Kohmoto K, Kodama M. Alternaria toxins and their effects on host plants. Can J Bot 1995;73:S4538. [32] Friesen TL, Faris JD, Solomon PS, Oliver RP. Host-specic toxins: effectors of necrotrophic pathogenicity. Cell Microbiol 2008;10:14218. [33] Gilchrist DG, Grogan RG. Production and nature of a host-specic toxin from Alternaria alternata f. sp. lycopersici. Phytopathology 1976;66:16571. [34] Yamagishi D, Akamatsu H, Otani H, Kodama M. Pathological evaluation of host-specic AAL-toxins and fumonisin mycotoxins produced by Alternaria and Fusarium species. J Gen Plant Pathol 2006;72:3237. [35] Akamatsu H, Itoh Y, Kodama M, Otani H, Kohmoto K. AAL-toxin-decient mutants of Alternaria alternata tomato pathotype by restriction enzymemediated integration. Phytopathology 1997;87:96772. [36] Bottini AT, Bowen JR, Gilchrist DG. Phytotoxins. II. Characterization of a phytotoxic fraction from Alternaria alternata f. sp. lycopersici. Tetrahedron Lett 1981;22:27236. [37] Bottini AT, Gilchrist DG. Phytotoxins. I. A 1-aminodimethylheptadecapentol from Alternaria alternata f. sp. lycopersici. Tetrahedron Lett 1981;22:271922. [38] Gilchrist DG, Wang H, Bostock RM. Sphingosine-related mycotoxins in plant and animal disease. Can J Bot 1995;73:S45967. [39] Wang H, Jones C, Ciacci-Zanella J, Holt T, Gilchrist DG, Dickman MB. Fumonisins and Alternaria alternata lycopersici toxins: sphinganine analog mycotoxins induce apoptosis in monkey kidney cells. Proc Natl Acad Sci USA 1996;93:34615. [40] Spassieva SD, Markham JE, Hille J. The plant disease resistance gene Asc-1 prevents disruption of sphingolipid metabolism during AAL-toxin-induced programmed cell death. Plant J 2002;32:56172. [41] Brandwagt BF, Mesbah LA, Takken FLW, Laurent PL, Kneppers TJA, Hille J, et al. A longevity assurance gene homolog of tomato mediates resistance to Alternaria alternata f. sp. lycopersici toxins and fumonisin B1. Proc Natl Acad Sci USA 2000;97:49616. [42] Gomi K, Itoh N, Yamamoto H, Akimitsu K. Characterization and functional analysisof class I and II acidic chitinase cDNA from rough lemon. J Gen Plant Pathol 2002;68:1919. [43] Gomi K, Yamamoto H, Akimitsu K. Characterization of a lipoxygenase gene in roughlemon induced by Alternaria alternata. J Gen Plant Pathol 2002;68:2130.

77

[44] Gotoh Y, Nalumpang S, Isshiki A, Utsumi T, Gomi K, Yamamoto H, et al. A cDNA encoding polygalacturonase-inhibiting protein induced in citrus leaves by polygaracturonase of Alternaria citri. J Gen Plant Pathol 2002;68:5761. [45] Johnson RD, Johnson L, Itoh Y, Kodama M, Otani H, Kohmoto K. Cloning and characterization of a cyclic peptide synthetase gene from Alternaria alternata apple pathotype whose product is involved in AM-toxin synthesis and pathogenicity. Mol Plant Microbe Interact 2000;13:74253. [46] Blazquez CH. Target spot. In: Jones JB, Jones JP, Stall RE, Zitter TA, editors. Compendium of tomato diseases. St. Paul, Minnesota: APS Press; 1991. p. 23. [47] Wei CT. Notes on Corynespora. Mycol Papers 1950;34:110. [48] Takahashi H, Shimizu A, Arie T, Rosmalawati S, Fukushima S, Kikuchi M, et al. Catalog of Micro-Tom tomato responses to common fungal, bacterial, and viral pathogens. J Gen Plant Pathol 2005;71:822. [49] Akamatsu H, Otani H, Kodama M. Characterization of a gene cluster for hostspecic AAL-toxin biosynthesis in the tomato pathotype of Alternaria alternata. Abstracts of the 22nd Fungal Genetics Conference, Asilomar, California; 2003. p. 121. [50] Enyedi AJ, Yalpani N, Silverman P, Raskin I. Localization, conjugation, and function of salicylic acid in tobacco during the hypersensitive reaction to tobacco mosaic virus. Proc Natl Acad Sci USA 1992;89:24804. [51] Audenaert K, De Meyer GB, Hofte MM. Abscisic acid determines basal susceptibility of tomato to Botrytis cinerea and suppresses salicylic aciddependent signaling mechanisms. Plant Physiol 2002;128:491501. [52] Diaz J, Ten Have A, Van Kan JAL. The role of ethylene and wound signaling in resistance of tomato to Botrytis cinerea. Plant Physiol 2002;129:134151. [53] Wasternack C. Jasmonates: an update on biosynthesis, signal transduction and action in plant stress responses, growth and development. Ann Bot 2007;100:68197. [54] Lamb CJ, Lawton MA, Dron M, Dixon RA. Signals and transduction mechanisms for activation of plant defenses against microbial attack. Cell 1989;56:21524. [55] Kobayashi I, Hakuno H. Actin-related defense mechanism to reject penetration attempt by a non-pathogen is maintained in tobacco BY-2 cells. Planta 2003;217:3405. [56] McCurdy DW, Kovar DR, Staiger CJ. Actin and actin-binding proteins in higher plants. Protoplasma 2001;215:89104. [57] Schutz I, Gus-Mayer S, Schmelzer E. Prolin and Rop GTPases are localized at infection sites of plant cells. Protoplasma 2006;227:22935. [58] Shen G, Adam Z, Zhang H. The E3 ligase AtCHIP ubiquitylates FtsH1, a component of the chloroplast FtsH protease, and affects protein degradation in chloroplasts. Plant J 2007;52:30921. [59] Innes R. New effects of type III effectors. Mol Microbiol 2003;50:3635. [60] Kim CY, Koo YD, Jin JB, Moon BC, Kang CH, Kim ST, et al. Rice C2-domain proteins are induced and translocated to the plasma membrane in response to a fungal elicitor. Biochemistry 2003;42:1162533. [61] Sandrock RW, VanEtten HD. Fungal sensitivity to and enzymatic degradation of the phytoanticipin a-tomatine. Phytopathology 1998;88:13743. [62] Oh S-K, Lee S, Chung E, Park JM, Yu SH, Ryu C-M, et al. Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco. Planta 2006;223(1):1017. [63] Kodama M, Wada H, Otani H, Kohmoto K, Kimura Y. 3,5-DI-O-caffeoylquinic acid, an infection-inhibiting factor from Pyrus pyrifolia induced by infection with Alternaria alternata. Phytochemistry 1998;47:3713. [64] Van Loon LC, Geraats BPJ, Linthorst HJM. Ethylene as a modulator of disease resistance in plants. Trends Plant Sci 2006;11:18491. [65] Moore T, Martineau B, Bostock RM, Lincoln JE, Gilchrist DG. Molecular and genetic characterization of ethylene involvement in mycotoxin-induced plant cell death. Physiol Mol Plant Pathol 1999;54:7385. [66] Moussatos VV, Yang SF, Ward B, Gilchrist DG. AAL-toxin induced physiological changes in Lycopersicon esculentum Mill:role for ethylene and pyrimidine intermediates in necrosis. Physiol Mol Plant Pathol 1994;44:45568. [67] Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G, et al. Bacterial disease resistance in Arabidopsis through agellin perception. Nature 2004;428:7647. [68] Thuerig B, Felix G, Binder A, Boller T, Tamm L. An extract of Penicillium chrysogenum elicits early defense-related responses and induces resistance in Arabidopsis thaliana independently of known signalling pathways. Physiol Mol Plant Pathol 2006;67:18093. [69] Spoel SH, Johnson JS, Dong X. Regulation of tradeoffs between plant defenses against pathogens with different lifestyles. Proc Natl Acad Sci USA 2007;104:188427. [70] Gomez-Gomez L, Felix G, Boller T. A single locus determines sensitivity to bacterial agellin in Arabidopsis thaliana. Plant J 1999;18:27784.