Vous êtes sur la page 1sur 86

19/09/2010

Enseignement de Biologie Cellulaire : Biologie Molculaire


Universit des Antilles-Guyane Premire Anne des Etudes de Sant Dr Maryse ETIENNE-JULAN-OTTO

BIBLIOGRAPHIE
Gnes VI B. LEWIN DeBoeck Universit

Biologie molculaire et Mdecine JC KAPLAN et M. DELPECH Mdecine-Sciences, Flammarion


Biologie molculaire de la cellule B ALBERTS et al Mdecine-Sciences, Flammarion

19/09/2010

I- Introduction : historique et dfinitions

Historique
Lhistoire de la biologie molculaire est base :
Sur les rsultats de lobservation avec sa puissance et ses limites Suivie de lidentification des supports biologiques des mcanismes de lhrdit

Les tapes cls sont :


Thorie de lEvolution de Charles Darwin Lois de Mendel Dcouverte de lADN Lidentification des rgles de fonctionnement de lADN

19/09/2010

La thorie de Charles R. Darwin (1809-1882)

C.R. Darwin
Biologiste britannique 1836 : analyse des spcimens rapports de son tour du monde :
Similitudes entre fossiles et espces vivantes prlevs dans la mme zone gographique (tortues, oiseaux,)
Espce commune lorigine Adaptation la vie de manire diffrente sur chaque le, donc en fonction du milieu

19/09/2010

C.R. Darwin
1859 : Origine des espces par la slection naturelle Premire thorie expliquant lvolution des espces par un mcanisme biologique : la slection naturelle

Les thories antrieures celle de Darwin


Avant le XIXme sicle : le catastrophisme
Extinction des espces cause des catastrophes

Puis formation de nouvelles espces ex nihilo


(cres partir de rien)

Dbut XIXme : plusieurs scientifiques remettent en cause le catastrophisme (Lamarck, Lyell ,)

19/09/2010

La structure de la thorie de Darwin


Tous les individus dune population sont diffrents les uns des autres (variabilit)

Certains sont mieux adapts que dautres leur environnement


Meilleure chance de survie Meilleure chance de se reproduire

La structure de la thorie de Darwin (2)


Caractres avantageux
Sont hrits par les gnrations suivantes

deviennent dominants dans la population :


Slection naturelle

19/09/2010

La structure de la thorie de Darwin (3)


Evolution des espces est un processus progressif et volutif (plusieurs milliers plusieurs millions dannes) :
Une seule forme de vie lorigine Puis apparaissent diffrentes espces : la spciation

Difficults daccueil de la thorie de Darwin


Communauts religieuses Communauts scientifiques :
Du fait de la mconnaissance de la capacit des individus transmettre leurs caractres leurs descendants

19/09/2010

Les lois de Grgor Mendel

Gregor Mendel : 1865


Natif de lempire austro-hongrois Travaux sur les petits pois

Choix de 7 caractres transmissibles qui diffraient entre varits :


La taille et la couleur des graines La longueur des tiges,.

19/09/2010

Gregor Mendel : 1865


En croisant diffrentes varits
Etude de la transmission, au cours des gnrations, de ces caractres Diversit des caractres concerns par lhrdit : raction mtabolique, forme du nez,

Gregor Mendel
En croisant diffrentes varits
tablissement des principales lois de lhrdit
Caractres dominants et rcessifs Pas de mlange des dterminants des caractres Transmissions de dterminants non altrs Transmission alatoire Transmission de manire indpendante de caractres diffrents

19/09/2010

Premire loi de Mendel


Loi de luniformit des hybrides de premire gnration et de la sgrgation indpendante des caractres Croisement de 2 races pures (homozygotes pour tous les gnes) qui diffrent par 1 caractre
Couleur du petits pois : color, non color

Premire loi de Mendel (2)


2 parents homozygotes pour la couleur du pois : AA (dominant) et aa (rcessif) 1re gnration dhybrides (F1) homogne : tous identiques (Aa) et ayant le phnotype du caractre dominant A

19/09/2010

Premire loi de Mendel (3)


2me gnration dhybrides (F2) htrogne (phnotypes diffrents): 25% AA, 50% Aa, 25% aa Htrognit de F2 = disjonction (sgrgation) indpendante des allles : les gamtes sont purs = ils ne portent quun seul allle de chaque gne F2 : rapparition du phnotype rcessif

Premire loi de Mendel (4)


Base sur la dominance complte dun allle sur lautre Ce que MENDEL na pu mettre en vidence : il existe diffrents degrs de dominance (partielle, absence de dominance ou codominance). Dans ces cas, cette loi ne sapplique pas

10

19/09/2010

Deuxime loi de Mendel


Loi de lindpendance des couples de caractres Croisement de 2 individus de race pure diffrant par plusieurs caractres (ou gnes) Constat : ces diffrents caractres sont hrits de faon indpendante les uns des autres

Deuxime loi de Mendel (2)


2 individus homozygotes
1 pour 2 caractres dominants : AABB (color et lisse) 1 pour 2 caractres rcessifs : aabb (incolore et rid)

F1 : individus AaBb : phnotype parent dominant F2 : 2 grands groupes de descendants:


1 groupe : phnotypes parentaux 1 groupe : nouveau phnotype : 1 caractre dominant associ un caractre rcessif

11

19/09/2010

Deuxime loi de Mendel (3)


= Association au hasard entre 1 allle dun caractre et 1 allle de lautre = indpendance des couples de caractres = chaque caractre a un support biologique diffrent Exception cette loi : gnes lis = gnes ports par le mme chromosome. Ntaient pas connus de Mendel

Notions introduites par les travaux de Mendel


Diffrence entre
lapparence dun organisme (ce qui est observ, ce qui est mesurable) : le phnotype et le support gntique sous-jacent : le gnotype

Notion dun facteur qui passe inchang dun parent sa progniture : futur gne

12

19/09/2010

Notions introduites par les travaux de Mendel (2)


Diffrentes formes dun mme gne : les allles Organisme diplode : 2 copies de chaque gne 2 allles identiques dans le mme organisme : homozygote phnotype reflte directement le gnotype

Notions introduites par les travaux de Mendel (3)


2 allles diffrents : htrozygote Phnotype fonction de la relation entre les allles
Le plus souvent : 1 allle dominant et 1 allle rcessif phnotype dtermin par lallle dominant : phnotype de lhtrozygote = phnotype du parent homozygote dominant

13

19/09/2010

En 1945 : gne = support de lhrdit Identification des gnes uniquement par le biais des mutations (aberrations phnotypiques) Nature physique du gne? Relation entre dfauts biochimiques observs et nature physique?

1953 : dcouverte de lADN et de sa structure rvolutionn la gntique, la biologie rpercussions majeures en Mdecine (origine et cause des maladies, modalits du diagnostic de certaines maladies, )

14

19/09/2010

II- Quelques dfinitions

Gnotype : ensemble de linformation gntique hrite par un organisme Phnotype correspond lexpression du gnotype (aspect physique de lorganisme) Gnome : quantit totale dADN ou dARN contenue dans chaque cellule (gnes + squences non codantes)

15

19/09/2010

Dfinitions (2)
Allles : diffrentes formes dun mme gne Organisme ayant deux allles identiques dun mme gne : homozygote Organisme ayant deux allles diffrents dun mme gne : htrozygote

Dfinitions (3)
Type sauvage : gnotype et phnotype courants
Un gne sauvage protine fonctionnelle

Mutations : changements transmissibles de


linformation gntique Mutants : organismes portant la mutation Type sauvage : organisme portant le gne non modifi

16

19/09/2010

Dfinitions (4)
Les procaryotes : organismes dans lesquels il y a thoriquement 1 seul compartiment cellulaire dlimit par une ou plusieurs membranes qui le protgent du milieu extrieur : Bactries ;

Dfinitions (5)
Les Eucaryotes sont dfinis par la division de chaque cellule en :
un noyau contenant le matriel gntique entour par : le cytoplasme qui est dlimit par une membrane plasmique marquant la priphrie de la cellule. Le cytoplasme contient galement dautres compartiments cellulaires individuels entours eux aussi par des membranes.

17

19/09/2010

Dfinitions (6)
Virus : particules minuscules.
Comme les organismes, une gnration donne naissante la suivante. Contrairement aux autres organismes, pas de structure cellulaire propre, ce qui les oblige infecter une cellule hte.

La science de la gntique a vu le jour lorsque lon sest aperu que ce ntait pas la copie dun organisme qui se transmettait dune gnration lautre mais le matriel gntique contenant linformation ncessaire la construction de lorganisme des descendants. Ce matriel est constitu dacides nucliques dont la structure est diffrente des autres molcules qui constituent lorganisme (protines, lipides, glucides).

18

19/09/2010

Le gne est lunit de linformation gntique, de lhrdit. Il ne fonctionne pas de faon autonome : il a besoin dautres composantes cellulaires pour sa transmission et son expression.

Les questions :
Quelle est la nature de linformation gntique Comment se reproduit elle avec exactitude dune gnration lautre? Comment est utilise linformation gntique par la cellule : expression, rgulation, rparation,

19

19/09/2010

Le dogme central de la biologie molculaire


Lexpression de linformation gntique est presque exclusivement unidirectionnelle : Polynuclotide ADN
Transcription Polynuclotide

ARN
Traduction

Polymres dacides amins COLINEARITE

Protine

Protines Autres types de molcules (acides nucliques inclus)


Activits catalytiques Activits structurales

Phnotype

20

19/09/2010

les acides nucliques portent linformation gntique Les protines lexcuter. fournissent le moyen de

Programme du cours
Les principes fondamentaux qui rgissent la gntique molculaire en tudiant
les principales molcules impliques dans ces phnomnes et les tapes fondamentales de leurs fonctionnement .

21

19/09/2010

II- La structure des acides nucliques

La structure des acides nucliques


Le matriel gntique est constitu dacide nuclique 2 types dAcides nucliques
Acide dsoxyribonuclique ou ADN Acide ribonuclique ou ARN

22

19/09/2010

Structure des acides nucliques


Acide nuclique : succession de nuclotides relis chimiquement par des liaisons covalentes. Un nuclotide : une base azote (noyau htrocyclique datomes dazote et de carbone) + un sucre pentose ( 5 carbone en forme danneau) + un groupement phosphate
ADN : dsoxynuclotides ARN : ribonuclotides

Les bases azotes : 4 par acide nuclique


2 catgories Les pyrimidines : noyau 6 sommets : cytosine (C), uracile (U), thymine (T) (CH3 en position C5/uracile) cytosine et thymine pour lADN, cytosine et uracile dans lARN ;

23

19/09/2010

Les bases azotes


Les purines : noyaux 5 et 6 sommets entrelacs : guanine (G), adnine (A) communes lADN et lARN

24

19/09/2010

Le pentose
Dans lADN : 2-dsoxyribose Dans lARN : ribose : prsence dun rsidu hydroxyle en position 2 du cycle du sucre permet de diffrencier les atomes du pentose de ceux des bases.

25

19/09/2010

Pentose

Le groupement phosphate est reli au pentose (C5) Liaison base sucre : liaison entre un atome dazote de la base et un hydroxyle du sucre : N1 des pyrimidines, N9 des purines NUCLEOSIDE = BASE + SUCRE

26

19/09/2010

Nuclosides
Adnosine Guanosine Uridine Cytidine

ARN

ADN : dsoxynuclosides (dsoxythymidine au lieu duridine)

Pentose

27

19/09/2010

Nuclotides
NUCLEOTIDE = BASE + SUCRE + PHOSPHATE Adnosine phosphate Guanosine phosphate Uridine phosphate Cytidine phosphate Dsoxynuclotides : ADN (dsoxythymidine phosphate)

28

19/09/2010

Acide nuclique : polynuclotides = chane polynuclotidique Le nuclotide terminal dune extrmit de la chane possde un groupement 5 libre ; Le nuclotide terminal de lautre extrmit possde lui une extrmit 3 libre.

Par convention on crit les squences dacides nucliques dans le sens 5 3 (5 gauche et 3 droite).

29

19/09/2010

LADN est une double hlice : arguments de Watson et Crick


Watson et Crick (1953) modle de la double hlice partir de 3 notions :
Diffraction aux rayons X ADN a la forme dune hlice rgulire
tour complet tous les 34 (3,4 nm) = le pas de lhlice diamtre 20 (2 nm) distance entre 2 nuclotides adjacents : 3,4 10 nuclotides / tour dhlice

Modle de la double hlice de Watson et Crick : arguments (2)


La mesure de la densit de lADN suggrait que - lhlice est constitue de 2 chanes
polynuclotidiques ; - le diamtre constant de lhlice = les bases se font face lintrieur de lhlice et quune purine fait face une pyrimidine la liaison purine-purine serait trop volumineuse la liaison pyrimidine-pyrimidine trop peu volumineuse

30

19/09/2010

Modle de la double hlice de Watson et Crick : arguments


Quelque soit la squence de lADN,
quantit de G toujours = quantit de C quantit de A toujours = quantit de T

Modle de la double hlice de Watson et Crick


- - Les 2 chanes sont associes par des liaisons hydrogne entre bases azotes - G ne peut former de liaisons hydrogne quavec C (3 liaisons H) : cest appariement des bases - A ne peut former de liaisons hydrogne quavec T (2 liaisons H) : appariement des bases

31

19/09/2010

4 6 1 3

6 1 2

4 3 2

Hlice dADN
- Les 2 chanes sont antiparallles : orientation dans des sens opposs : 53 et 35 - Squelette sucre-phosphate lextrieur et les bases sont lintrieur de la double hlice sous la forme de paires perpendiculaires laxe de lhlice
Squelette = succession de sucres et de phosphates = succession de liaisons 5 3 phosphodiesters Position 5 du cycle dun pentose est relie la position 3 du pentose suivant par lintermdiaire dun groupement phosphate

32

19/09/2010

Hlice dADN
Les liaisons hydrogne ncessitent peu dnergie pour les briser mais leur multiplicit forte cohsion de la molcule. Les brins peuvent tre spars par chauffage ou par la soude : cest la dnaturation ou fusion de lADN. La sparation est un phnomne rversible Quand les brins se lient de nouveau lun lautre, on parle de renaturation ou hybridation de lADN.

33

19/09/2010

Chaleur Soude

ADN natif

ADN simple brin dnatur

ADN renatur

Hlice dADN
Lenroulement des deux brins lun autour de lautre forme une double hlice :
avec un petit sillon ( 12 de large) avec un grand sillon ( 22 de large). double hlice droite. enroulement se fait dans le sens des aiguilles dune montre le long de laxe de lhlice. ADN de forme B.

34

19/09/2010

Double hlice de Watson et Crick


tour complet tous les 34 (3,4 nm) : pas de lhlice diamtre 20 (2 nm) distance entre 2 nuclotides adjacents : 3,4 10 nuclotides / tour dhlice

Petit sillon

Grand sillon

20

34

35

19/09/2010

Acide ribonuclique ou ARN (RNA)


Polynuclotide simple brin Appariemment de bases complmentaires lintrieur des chanes repliement des molcules :
Exemple : ARN de transfert

III- LADN est le support de linformation gntique : relation structure fonction


A- ADN est le support des gnes

36

19/09/2010

Linformation gntique est transmise sous deux formes dune gnration lautre :
soit sous la forme dUn uf fcond (reproduction sexue) qui reoit un exemplaire de chaque gne parental Ou soit sous la forme dUne cellule fille (reproduction asexue) qui reproduit lidentique la cellulemre

Deux expriences classiques ont prouv que lADN est le matriel gntique
La dcouverte de lADN (Griffith, 1928) Les travaux de Hershey et Chase (1952)

37

19/09/2010

La dcouverte de lADN (Griffith, 1928)


Pneumocoque : plusieurs types * Pneumocoques lisses qui sont virulents :
virulence lie la prsence dun polysaccharide capsulaire (surface cellulaire) mort des souris infectes (bactries non dtruites par la cellule hte) Si les Pneumocoques lisses sont tus par la chaleur inoffensifs pour les souris

* Pneumocoques rugueux : absence de polysaccharide


non virulents

La dcouverte de lADN (Griffith, 1928) (2)


Si Pneumocoques lisses tus par la chaleur et pneumocoques rugueux injects simultanment la souris mort de la souris + prsence de bactries lisses virulentes chez la souris morte de mme type que les bactries lisses tues qui avaient t injectes.

38

19/09/2010

La dcouverte de lADN (Griffith, 1928) (3)


Un composant des bactries L tues a pu transformer les bactries R vivantes, ce qui les a rendu virulentes. Ce composant est rsistant la chaleur Il est appel principe transformant. Il a t purifi.

La dcouverte de lADN (Griffith, 1928) (4)


Avery et coll, en 1944, ont montr que chimiquement ce principe transformant isol est lacide dsoxyribonuclique ou ADN. Autre apport : lADN tait connu comme composant essentiel des chromosomes eucaryotes . Cette exprience a montr quil est le matriel gntique des procarytotes : unification des fondements de lhrdit chez les bactries et les organismes suprieurs.

39

19/09/2010

Pneumocoques lisses pathognes

Pneumocoques rugueux non virulents

ADN

ADN purifi Addition de lADN purifi de la souche lisse

Pneumocoque lisse

Les travaux de Hershey et Chase (1952)


Il sagissait de dmontrer que lADN est aussi le matriel gntique dun autre systme : le virus bactriophage T2 Le phage T2 infecte la bactrie Escherichia coli.

40

19/09/2010

Les travaux de Hershey et Chase (1952) (2)


Cycle viral normal : 1- particules phagiques sadsorbent (se fixent) la surface des bactries 2- du matriel viral pntre dans la bactrie 3- 20 minutes plus tard, la bactrie clate (elle est lyse) en librant de nombreuses particules virales filles.

41

19/09/2010

Les travaux de Hershey et Chase (1952) (3)


- Marquage des phages au 32P (marquage de lADN) et au 35S (marquage des protines)

- Infection des bactries centrifugation 2 fractions : 1 contenant les enveloppes vides des phages libres la surface des bactries (marques au 35S) et 1 constitue des bactries infectes

42

19/09/2010

Les travaux de Hershey et Chase (1952) (4)


Le 35S est retrouv quasi exclusivement au niveau des enveloppes virales vides Le 32P se retrouvait en grande partie dans les bactries infectes (70%) et en partie dans les particules virales filles (environ 30%)

Les travaux de Hershey et Chase (1952) (4)


Conclusions :
Ce ne sont pas les protines virales qui pntrent dans la bactrie mais lADN LADN des phages parentaux entre dans la bactrie et intgre les particules virales filles : preuve directe de transmission du matriel gntique :

43

19/09/2010

Les travaux de Hershey et Chase (1952) (5)


Conclusion : LADN est aussi le matriel gntique du phage T2.

LADN est le matriel gntique quasi universel Exception : virus ARN : virus de la grippe, rtrovirus,

III- LADN est le support de linformation gntique : relation structure fonction


B- La relation structure-fonction

44

19/09/2010

La structure de lADN dfinit les mcanismes de lhrdit


La squence des bases dans lADN est la forme sous laquelle est transporte linformation gntique
Spcificit despce

Organisme Virus E. coli Levures


Caenorhabditis elegans

Longueur du gnome haplode en paires de bases

103 105 4,5 x 106 5 x 107 8 x 107

Drosophile 1,5 x 108 Vertbrs 108 1010 Homme 3 x 109 Plantes 1010 1011 Longueur du gnome de quelques organismes

45

19/09/2010

La structure de lADN dfinit les mcanismes de lhrdit


Structure en double hlice forme de 2 brins anti-parallles Le matriel gntique est reproduit fidlement de gnration en gnration : la rplication de lADN est semi-conservative
Chaque brin dADN sert de matrice pour la synthse dun brin fils complmentaire Assemblage du nouveau brin fils se fait avec le brin parental complmentaire

3 modes potentiels de rplication


Le mode semi-conservatif Le mode conservatif Le mode dispers

46

19/09/2010

Rplication semi-conservative : modle attendu


Culture de cellules contenant l ADN parental dans milieu contenant des atomes lourds dazote (15N) 2 brins lourds

Puis remplacement par du milieu lger (contenant de lazote 14N) premire gnration duplex dADN de densit intermdiaire : 1 brin parental lourd et 1 brin fils lger
2nde gnration : 50% des duplex de densit intermdiaire,
50% de duplex de densit lgre

47

19/09/2010

1re gnration

2nde gnration

Rplication semi-conservative : preuve exprimentale


Exprience de Meselson et Stahl (1958) Ont effectivement suivi la rplication dE. coli pendant 3 gnrations A chaque gnration, mesure de la densit dADN par centrifugation et comparaison des densits mesures

48

19/09/2010

Rsultats
Lger

Intermdiaire

Lourd

Parental

Gnration 1

Gnration 2

49

19/09/2010

La structure de lADN dfinit les mcanismes de lhrdit


Linformation gntique est code : le code gntique
Structure simple et universelle de lADN Seule variable : ordre denchanement des bases (squence) Squence dADN est traduit par une squence dacides amins dans les chanes peptidiques Code gntique lu par groupe de 3 nuclotides ou codon. Chaque codon correspondant un acide amin ( lexception de 3)

La structure de lADN dfinit les mcanismes de lhrdit


Le code gntique : les relations faisant correspondre les diffrents codons avec les diffrents acides amins Chaque gne = une suite de codons Squence nuclotidique : 5 3 Peptide N-terminale C-terminale

50

19/09/2010

La structure de lADN dfinit les mcanismes de lhrdit


Le code gntique est dchiffr par des mcanismes complexes situ entre gnes et protines

La structure de lADN dfinit les mcanismes de lhrdit


Les mutations changement dans la squence dADN) : preuve finale que lADN est le support de linformation gntique Ont permis didentifier les protines codes par certains gnes Ont permis didentifier la fonction de certaines protines

51

19/09/2010

ADN sous forme super-enroule dans le noyau des eucaryotes (comme un ressort) Associ des protines dans le noyau Il existe des formes extranuclaires dADN :
ADN mitochondrial ADN des chloroplastes (vgtaux)

III- LADN est le support de linformation gntique : relation structure fonction


C- Conclusion

52

19/09/2010

Linformation porte par lADN doit :


pouvoir tre lue tout moment (transcription, traduction), tre protge (noyau, protines, superenroul), rpare en cas daltration (mcanismes de rparation) prennise dans les cellules filles (rplication, division cellulaire).

IV- Organisation du gnome

53

19/09/2010

IV-1. Organisation du gnome eucaryote


A- La rptition

La rptition
Dans le gnome, on distingue : Des squences uniques (des squences prsentes en une copie unique dans le gnome) :
Seul composant de lADN procaryote Composant principal de lADN eucaryote

Des squences rptes : squences prsentes en plusieurs copies dans le gnome. En fonction du nombre de copies, on les classe en :
Squences moyennement rptes Squences hautement rptes

54

19/09/2010

La rptition (2)
La plupart des gnes de structure : ADN non rpt La frquence des diffrents types dADN est spcifique de chaque gnome

IV-1 Organisation du gnome eucaryote


B- Labondance dun gne

55

19/09/2010

Abondance dun gne


Correspond au niveau dexpression dun gne Elle se mesure par le nombre de copies dARNs messagers(ARNm), correspondant ce gne, prsents dans les cellules. En fonction de leur abondance, les gnes sont classs en :
Gnes abondants : 103 - 105 copies dARNm par cellule Gnes moyennement abondants : environ 103 copies Rarement exprims : < 10 copies (majorit des gnes)

Abondance dun gne (2)


La majorit des ARNs sont prsents dans la plupart des cellules (voire toutes). Ils correspondent des gnes impliqus dans des fonctions ncessaires tous les types cellulaires : ce sont les fonctions dites de mnage (housekeeping en anglais) ou activits constitutives

56

19/09/2010

Abondance dun gne (3)


Par opposition, on retrouve des gnes impliqus dans des fonctions spcialises qui ne sont exprimes que dans certaines cellules:
Cellules musculaires : gnes qui codent pour les protines impliques dans la contraction musculaire (myoglobine) Globules rouges : gnes qui codent pour lhmoglobine

IV-1 Organisation du gnome eucaryote


C- Nombre de gnes

57

19/09/2010

Bactries : en moyenne, plus de 2000 gnes par bactrie Eucaryotes suprieurs: de lordre de 100 000 gnes dont 10 000 qui sexpriment Mammifres : 200 000 gnes de 10 000 pb

de longueur moyenne environ

IV-1 Organisation du gnome eucaryote


D- Morcellement du gnome

58

19/09/2010

De nombreux gnes eucaryotes sont plus longs que leurs ARNm Cette diffrence provient de squences intermdiaires sparant plusieurs parties dune rgion codante dADN. Chez les eucaryotes suprieurs, peu de gnes continus (continu = absence de squences intermdiaires)

Exons : squences dADN reprsentes dans lARN mature

Introns : squences intermdiaires, enleves lors de la


maturation du transcrit primaire. Ces introns sont dlts lors de lpissage du transcrit primaire chez les eucaryotes

59

19/09/2010

Exons (300 pb) beaucoup plus petits que les introns (300 pb 60 000 pb) Du fait de leur longueur, la taille des introns dtermine celle du gne Les exons sont relis les uns aux autres dans lARN dans le mme ordre que dans lADN Les introns nont pas de fonctions codantes

IV-1 Organisation du gnome eucaryote


E- Les polymorphismes gntiques

60

19/09/2010

Dfinition
Les polymorphismes concernent n'importe quelle
diffrence entre les individus. On peut l'observer au niveau de l'aspect gnral des individus, au niveau des protines, au niveau nuclaire (gntique).

En ce qui concerne les polymorphismes gntiques, on distingue :


Ceux qui modifient le phnotype d'un individu, ceux qui modifient seulement l'ADN, qui nont pas de rpercussions sur le phnotype et qui servent de marqueurs molculaires pour identifier des individus ou des groupes dindividus

Exemple de polymorphisme
Les Microsatellites :
Squences rptes un certain nombre de fois dun motif court ( de 1 4 nuclotides) Selon les individus un microsatellite peut comporter un nombre de rptitions qui est diffrent. Chaque allle aura un nombre diffrents de rptitions Peuvent tre utilises pour identifier des individus, comme repre non ambigu, sils sont entours de squences uniques de part et dautre

61

19/09/2010

In La science Paris, Universit Pierre et Marie CURIE

LES MICROSATELLITES

Dcouverts en 1989

Il s'agit de squences d'ADN constitues de motifs rpts avec 2, 3 ou 4 nuclotides :

nnnnnnCACACACACACACACACACACACACAnnnnnnnn
nb variable de rptitions

In POLYMORPHISMES CARTE & LIAISON GNTIQUES, L. VILLARD, Facult de Mdecine de la Timone

nnnnnnGTTGTTGTTGTTGTTGTTGTTGTTGTTnnnnnnnn
nb variable de rptitions

nnnnnnATGGATGGATGGATGGATGGATGGATGGnnnnn
nb variable de rptitions

62

19/09/2010

13

Les microsatellites sont des marqueurs multi-allliques


Allle 1
9 rptitions (CA)

nnnnnnnnCACACACACACACACACAnnnnnnnnnnnn nnnnnnnnCACACACACACACACACAnnnnnnnnnnnn
13 rptitions (CA)

Allle 2

nnnnnnnnnCACACACACACACACACACACACACAnnnnnnn nnnnnnnnnCACACACACACACACACACACACACAnnnnnnn

Allle 3

11 rptitions (CA)

nnnnnnnnnnCACACACACACACACACACACAnnnnnnnn nnnnnnnnnnCACACACACACACACACACACAnnnnnnnn

Les microsatellites multi-allliques sont plus intressants pour les applications mdicales ou lgales que les marqueurs bi-allliques. Pourquoi? En raison de la diversit des combinaisons allliques

63

19/09/2010

Deuxime exemple
Les SNP (Polymorphisme pour un nuclotide ou Single Nucleotide Polymorphisms)
constituent la forme la plus abondante de variations gntiques dans le gnome humain. Ils reprsentent plus de 90% de toutes les diffrences entre individus. C'est un type de polymorphisme de l'ADN dans lequel deux chromosomes diffrent sur un segment donn par une seule paire de bases.

Deuxime exemple
Les SNP (Single Nucleotide Polymorphisms)
Allle A

AGCATAGCAGCAATCAGCGCAGCAGTCTCTCTTCGCAAGCA
TCGTATCGTCGTTAGTCGCGTCGTCAGAGAGAAGCGTTCGT

Allle B
AGCATAGCAGCAATCAGCACAGCAGTCTCTCTTCGCAAGCA TCGTATCGTCGTTAGTCGTGTCGTCAGAGAGAAGCGTTCGT

64

19/09/2010

Dans deux gnomes humains tirs au hasard, 99,9% de la squence d'ADN est identique. Les 0,1% restants contiennent des variations de squence dont le type le plus commun est le polymorphisme pour un nuclotide (SNP).

Les SNP sont stables, trs abondants et distribus uniformment dans tout le gnome. Ces variations sont associes de la diversit entre populations ou individus, une diffrence de sensibilit des maladies et la rponse individuelle aux mdicaments.

65

19/09/2010

IV-2. Organisation du matriel gntique cellulaire

Matriel gntique
1. Le matriel gntique se prsente sous la forme dune masse compacte dans le volume limit quest le noyau

2. Il pouvoir raliser ses diffrentes activits (rplication, transcription,) dans ce volume restreint
3. Il doit pouvoir passer dun tat inactif un tat actif pour fonctionner

66

19/09/2010

Matriel gntique (2)


Consquence :
Ncessit dune condensation trs serre de lADN Ltat condens rsulte de la liaison de lacide nuclique des protines basiques (nucloprotines).

Matriel gntique (3)


Chez les Bactries : Le matriel gntique est sous la forme dun nuclode Chez les Eucaryotes : masse de chromatine dans les noyaux, pendant linterphase. Pendant la mitose, lempaquetage est encore plus troit et aboutit la formation des chromosomes

67

19/09/2010

IV-2. Organisation du matriel gntique cellulaire


A- Chez les procaryotes

Les procaryotes
Nuclode : Grand nombre de boucles dADN double brin

Chaque boucle est fixe sa base domaine structural indpendant


Chaque boucle : propre degr denroulement Environ 100 domaines / gnome

68

19/09/2010

1 boucle = 1 domaine indpendant

IV-2. Organisation du matriel gntique cellulaire


B- Chez les eucaryotes

69

19/09/2010

a) Hirarchisation du degr de compaction


Nuclosome Fibre de 100 Fibre de 300 : chromatine

b) Le nuclosome
Sous-unit fondamentale de la chromatine

Identique chez tous les eucaryotes


Plus de 90% du gnome est organis en nuclosome

70

19/09/2010

b) Le nuclosome (2)
Constitu :
Dune longueur dADN de 200 pb enroule autour Dun octamre contenant des histones (protines) 2 copies de H2A 2 copies de H2B Histones du noyau = core 2 copies de H3 2 copies de H4 1 copie de H1 (lhistone H1 nappartient pas au nuclosome)

Structure du nuclosome
Le core (histones) a une structure cylindrique de 110 sur 60
ADN
hauteur= 60 H1

110 = diamtre

71

19/09/2010

c) La fibre de 100 de diamtre ou fibre nuclosomique


Est une chane continue de nuclosomes chapelet Le diamtre de la fibre correspond celui du nuclosome

100

72

19/09/2010

Examen en microscopie lectronique de la fibre de 100 (serveur pdagogique - Facult de Mdecine de Marseille Universit de la Mditerrane

d) La fibre de 300 de diamtre ou nuclofilament Provient de lenroulement des fibres de 100

H1 ncessaire cet enroulement (stabilisation) 6 8 nuclosomes par tour Constituant de base de la chromatine

73

19/09/2010

e) La chromatine
Niveau dorganisation suprieure de la fibre du des protines non histones

Au niveau de la chromatine, on distingue des rgions hypersensibles lADNase I

e) La chromatine (2)
LADNase I est une nuclase qui coupe lADN

Les rgions de lADN qui sont hypersensibles lADNase I correspondent des zones o les protines de structures ont t dplaces, ce qui rend lADN accessible

74

19/09/2010

e) La chromatine (2)
Les rgions hypersensibles lADNase I sont donc des domaines contenant des zones actives o les nuclosomes sont exclus par la prsence dautres protines (ARN polymrase,) Elles correspondent aux sites de rgulation de la transcription, origine de rplication, etc

e) La chromatine (4)
Euchromatine : compaction plus lche des fibres Htrochromatine : empaquatage trs dense des fibres, forme inactive de la chromatine

75

19/09/2010

f) Les chromosomes
La forme la plus condense que prend la molcule dADN au cours du cycle cellulaire Condensation maximale atteinte au cours de la mitose Perte provisoire de la fonction transcriptionnelle Structure provisoire

f) Les chromosomes (2)


Le chromosome mtaphasique est constitu de deux chromatides, Chaque chromatide reprsente une des deux molcules d'ADN identiques issues de la rplication en phase S. Elles sont troitement associes au niveau du centromre qui correspond la zone de fixation sur les fibres du fuseau de division.

76

19/09/2010

f) Les chromosomes (3)


La constriction centromrique est un repre qui permet de sparer le chromosome en deux rgions principales :
un bras court (par convention situ au-dessus du centromre) un bras long (en-dessous du centromre).

f) Les chromosomes (3)


Les extrmits des bras chromosomiques sont des rgions possdant une architecture particulire sur le plan molculaire et sont appeles tlomre. Il y a un tlomre pour le bras court et un tlomre pour le bras long.

77

19/09/2010

Le nombre et l'aspect gnral des chromosomes sont caractristiques de chaque espce, et sont donc identiques chez tous les individus d'une espce donne. Il existe cependant certaines rgions dont la morphologie peut prsenter des variations de taille non pathologiques, appels polymorphismes.

78

19/09/2010

Ces variations sont lies la prsence de squences rptes en nombre variable, non codantes, ce qui explique l'absence de retentissement clinique. En dehors de ces zones polymorphes, les rgions d'ADN rpt non codant qui forment l'htrochromatine constitutive se retrouvent galement au niveau des centromres de tous les chromosomes.

IV-2. Organisation du matriel gntique cellulaire


C- Gnome extra chromosomique (extra nuclaire)

79

19/09/2010

Responsable de la transmission non mendlienne des caractres Transmission mendlienne contributions gales des deux parents

Rsulte de la prsence dans les mitochondries et les chloroplastes (vgtaux) de gnomes dADN transmis indpendamment des gnes nuclaires

80

19/09/2010

LADN extrachromosomique est transcrit et traduit


Il est transmis uniquement par la mre Les protines synthtises partir des transcrits sont insuffisantes pour assurer le fonctionnement de lorganite Il doit faire appel dautres protines codes par des gnes nuclaires. Ces protines sont importes dans lorganite

IV-2. Organisation du matriel gntique cellulaire


C- Gnome extra chromosomique (extra nuclaire) 1) Organisation gnrale de lexpression du gnome mitochondrial

81

19/09/2010

Gnome mitochondrial
ADN circulaire (exceptionnellement linaire) : ADNmt Plusieurs exemplaires par organite grand nombre par cellule Squence spcifique

Gnome mitochondrial (2)


Taille trs variable
Petite taille chez les animaux : squence

connue chez lhomme, la souris, la vache


taille de 16,5 kb environ Levure : environ 84 kb Plantes : minimum de 100 kb

82

19/09/2010

Gnome mitochondrial (3) : expression


La plupart des protines constituantes sont importes du cytoplasme Petit nombre de protines synthtises in situ
Appartiennent des complexes dont certaines sous-units sont importes du cytoplasme

Gnome mitochondrial (4) : expression


Produisent tous les ARNs ncessaires la synthse de ces protines : ARN messagers, ribosomaux et de transfert

83

19/09/2010

Gnome mitochondrial (5) : expression


Synthse des ARNs par une ARN polymrase code par le noyau La synthse des protines synthse chez les procaryotes Code gntique un peu diffrent du code cytoplasmique

IV-2. Organisation du matriel gntique cellulaire


C- Gnome extra chromosomique (extra nuclaire) 2) LADN mitochondrial de mammifres

84

19/09/2010

Molcule compacte codant pour un nombre restreint de protines : Pas dintrons, Chevauchement des gnes ou pas de sparation entre les gnes Toutes les rgions appartiennent un gne (cest--dire quelles sont exprimes) sauf lorigine de la rplication

13 rgions codant pour des protines Les gnes des ARNs de transfert sparent les

gnes codant pour les protines ou pour les


ARNr Il existe un seul promoteur pour les gnes sexprimant dans le mme sens 1 transcrit unique

85

19/09/2010

Transcrit clivage Un brin transcrit dans le sens des aiguilles

dune montre : brin H (heavy = lourd en densit)


Brin L (light) : transcrit dans le sens contraire des aiguilles dune montre

86