Development of 16S rRNA-Gene-Targeted Group-Specific Primers for the Detection and Identification of Predominant Bacteria in Human Feces

Takahiro Matsuki, Koichi Watanabe, Junji Fujimoto, Yukiko Miyamoto, Toshihiko Takada, Kazumasa Matsumoto, Hiroshi Oyaizu and Ryuichiro Tanaka Appl. Environ. Microbiol. 2002, 68(11):5445. DOI: 10.1128/AEM.68.11.5445-5451.2002. Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

Updated information and services can be found at: http://aem.asm.org/content/68/11/5445 These include:
REFERENCES

This article cites 40 articles, 26 of which can be accessed free at: http://aem.asm.org/content/68/11/5445#ref-list-1 Receive: RSS Feeds, eTOCs, free email alerts (when new articles cite this article), more

CONTENT ALERTS

Information about commercial reprint orders: http://journals.asm.org/site/misc/reprints.xhtml To subscribe to to another ASM Journal go to: http://journals.asm.org/site/subscriptions/

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 2002, p. 54455451 0099-2240/02/$04.000 DOI: 10.1128/AEM.68.11.54455451.2002 Copyright 2002, American Society for Microbiology. All Rights Reserved.

Vol. 68, No. 11

Development of 16S rRNA-Gene-Targeted Group-Specic Primers for the Detection and Identication of Predominant Bacteria in Human Feces
Takahiro Matsuki,1* Koichi Watanabe,1 Junji Fujimoto,1 Yukiko Miyamoto,1 Toshihiko Takada,1 Kazumasa Matsumoto,1 Hiroshi Oyaizu,2 and Ryuichiro Tanaka1
Yakult Central Institute for Microbiological Research, 1796 Yaho, Kunitachi, Tokyo 186-8650,1 and Graduate School of Agriculture and Agricultural Life Science, The University of Tokyo, Bunkyo-ku, Tokyo 113-8657,2 Japan
Received 11 March 2002/Accepted 5 August 2002

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

For the detection and identication of predominant bacteria in human feces, 16S rRNA-gene-targeted groupspecic primers for the Bacteroides fragilis group, Bidobacterium, the Clostridium coccoides group, and Prevotella were designed and evaluated. The specicity of these primers was conrmed by using DNA extracted from 90 species that are commonly found in the human intestinal microora. The group-specic primers were then used for identication of 300 isolates from feces of six healthy volunteers. The isolates were clearly identied as 117 isolates of the B. fragilis group, 22 isolates of Bidobacterium, 65 isolates of the C. coccoides group, and 17 isolates of Prevotella, indicating that 74% of the isolates were identied with the four pairs of primers. The remaining 79 isolates were identied by 16S ribosomal DNA sequence analysis and consisted of 40 isolates of Collinsella, 24 isolates of the Clostridium leptum subgroup, and 15 isolates of disparate clusters. In addition, qualitative detection of these bacterial groups was accomplished without cultivation by using DNA extracted from the fecal samples. The goal for this specic PCR technique is to develop a procedure for quantitative detection of these bacterial groups, and a real-time quantitative PCR for detection of Bidobacterium is now being investigated (T. Requena, J. Burton, T. Matsuki, K. Munro, M. A. Simon, R. Tanaka, K. Watanabe, and G. W. Tannock, Appl. Environ. Microbiol. 68:2420-2427, 2002). Therefore, the approaches used to detect and identify predominant bacteria with the group-specic primers described here should contribute to future studies of the composition and dynamics of the intestinal microora. The human intestinal tract harbors a large, active, and complex community of microbes. The intestinal microora plays several signicant roles in the digestion of food, metabolism of endogenous and exogenous compounds, immunopotentiation, and prevention of colonization by pathogens in the gastrointestinal tract and hence is involved in maintaining human health (8, 36). The gut microora has been investigated in great detail by using anaerobic culture techniques (5, 21, 23 25). The predominant genera in the large bowel are reported to be Bacteroides, Eubacterium, Clostridium, Ruminococcus, Peptococcus, Peptostreptococcus, Bidobacterium, and Fusobacterium. Thus, intensive investigations have provided signicant information concerning the ora. However, the classical culture methods are labor-intensive and time-consuming. Moreover, classication and identication based on phenotypic traits do not always provide clear-cut results and are sometimes unreliable. For some years, molecular techniques based on 16S rRNA sequences have attracted attention as reliable methods for detection and identication of bacterial species (26, 42). Techniques such as the clone library method (35, 41) and denaturing gradient gel electrophoresis pattern analysis (33, 43) have allowed analysis of bacteria that are difcult to culture but represent a signicant population. Methods involving 16S rRNA* Corresponding author. Mailing address: Yakult Central Institute for Microbiological Research, 1796 Yaho, Kunitachi, Tokyo 186-8650, Japan. Phone: 81 (42) 577 8962. Fax: 81 (42) 577 3020. E-mail: takahiro -matsuki@yakult.co.jp. 5445

targeted hybridization probes or PCR primers enable rapid and specic detection of a wide range of bacterial species and have become key procedures for detection of microorganisms (3, 7, 16, 19, 32, 39). Depending on the primers used, the hybridization method and the PCR technique can be used to detect bacteria at different phylogenetic levels. For complex mixed populations, 16S rRNA-targeted oligonucleotide probes have been used with uorescent in situ hybridization as a culture-independent method (7, 17, 31). Franks et al. developed and used eight 16S rRNA-targeted probes for major species and groups of anaerobic intestinal bacteria to enumerate the bacterial population in fresh feces of healthy volunteers (7). According to their estimates, members of the genus Bacteroides and the Clostridium coccoides group constituted onehalf of the fecal ora examined (7, 18). On the other hand, PCR techniques with specic 16S ribosomal DNA (rDNA)-based oligonucleotide primers have been developed as powerful methods for detecting target bacteria in complex ecosystems (39). So far, specic oligonucleotide primers have been designed for many bacterial species which are known to be present in the intestinal tract, and these primers have been used successfully (14, 19, 20, 29, 34, 3840). However, the complex microora of the human gut is difcult to study with only primers that are specic at the species level due to the diversity of this ecosystem. Therefore, it is more convenient to have primers which are specic for major genera and groups present in the gut. Genus-specic primers have been designed for Bidobacterium and have been extensively tested (15, 16). However, the number of such group-specic primers

5446

MATSUKI ET AL.

APPL. ENVIRON. MICROBIOL.

DNA sequencer (Applied Biosystems, Foster City, Calif.). The assembled partial rDNA sequences were compared with sequences in the GenBank database (2). DNA extraction from fecal samples. Fecal samples (10 mg) were washed three times by suspending them in 1.0 ml of phosphate-buffered saline and centrifuging each preparation at 14,000 g in order to reduce the PCR inhibitors. The fecal pellets were resuspended in 450 l of extraction buffer (100 mM Tris-HCl, 40 mM EDTA; pH 9.0) and 50 l of 10% sodium dodecyl sulfate. Three hundred milligrams of glass beads (diameter, 0.1 mm) and 500 l of buffer-saturated phenol were added to the suspension, and the mixture was vortexed vigorously for 30 s by using a FastPrep FP 120 (Bio 101, Vista, Calif.) at a power level of 5.0. After centrifugation at 14,000 g for 5 min, the supernatant was collected. Subsequently, phenol-chloroform extractions were performed, and DNA was obtained by isopropanol precipitation. Finally, the DNA was suspended in 1 ml of TE buffer. Routinely, 1 l of the fecal DNA solution was used for the PCR analysis.

is still limited, in spite of a number of 16S rRNA-targeted group-specic hybridization probes which have been prepared (7, 11, 17, 32). In this study, we designed 16S rRNA-gene-targeted groupspecic primers for the Bacteroides fragilis group, Bidobacterium, the C. coccoides group, and Prevotella. The specicity of these primers was tested with a range of reference strains that are the predominant bacteria in the human intestinal tract. After this validation, the specic primers were used for identication of colonies obtained by culture methods and for specic PCR detection with human fecal DNA.
MATERIALS AND METHODS Reference strains and culture conditions. The strains listed in Table 1 were obtained from the American Type Culture Collection (Rockville, Md.) (ATCC), the Japan Collection of Microorganisms (Wako, Japan) (JCM), and the German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany) (DSM). Most of the strains were cultured anaerobically in GAM broth (Nissui Seiyaku, Tokyo, Japan) supplemented with 1% glucose at 37C overnight; the only exception was Escherichia coli, which was cultured aerobically in Trypticase soy broth (Difco, Detroit, Mich.) at 37C overnight. When required, the number of bacteria was determined microscopically by the method of Jansen et al. (13). Vectashield with 4,6-diamidino-2-phenylindole (DAPI) (Vector Laboratories, Burlingame, Calif.) was used for DNA staining and mounting. Microscopic counts were determined from 10 images, and a minimum of 100 cells were counted per image. Development of 16S rDNA-targeted species-specic primers. By using 16S rRNA sequences obtained from the DDBJ, GenBank, and EMBL databases, multiple alignments of the target groups and reference organisms were constructed with the program Clustal X (37). After sequences unique to the group were compared with the sequences of a large number of reference strains, potential target sites for specic detection were identied (Tables 2 and 3). These oligonucleotide sequences were then checked by using the Check-Probe function of the Ribosomal Database Project software package (18). The primers were synthesized commercially by Greiner Japan (Tokyo, Japan). PCR amplication. Each PCR mixture (25 l) was composed of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2, each deoxynucleoside triphosphate at a concentration of 200 M, each group-specic primer (Table 3) at a concentration of 0.25 M, template DNA, and 0.45 U of Taq DNA polymerase (Perkin-Elmer, Norwalk, Conn.). The PCR was carried out with a Gene Amp PCR System 9600 (Perkin-Elmer). The amplication program consisted of one cycle of 94C for 5 min; 40 cycles of 94C for 20 s, 55 or 50C for 20 s, and 72C for 30 s; and nally one cycle of 72C for 5 min. The amplication products were subjected to gel electrophoresis in 1% agarose, followed by ethidium bromide staining. Fecal samples. Fecal specimens from six healthy adult volunteers who were 28 to 52 years old (ve males and one female) were collected, and serial 10-fold dilutions were prepared with prereduced dilution buffers in an anaerobic cabinet, after which 0.05-ml samples of the 107 to 109 dilutions were plated on nonselective Medium 10 agar (12). The plates were subsequently incubated at 37C for 4 days under strictly anaerobic conditions with N2-CO2-H2 (88:5:7, vol/vol/vol) as the gas phase, and cultural counts (CFU) for total anaerobes were determined in duplicate. Total cell counts were also determined by using DAPI staining as described above. Isolation of predominant bacteria. Fifty colonies that appeared on the Medium 10 agar plates inoculated with the highest dilution were transferred with a sterile toothpick to 50 l of 10 mM Tris-HCl1 mM EDTA (pH 8.0) (TE buffer). One microliter of the suspension was smeared onto a glass slide for Gram staining. The remaining suspension was boiled for 15 min to lyse the cells and used as template DNA for the PCR. 16S rDNA sequence analysis. Each PCR was performed with primers 926f (5-AAA CTY AAA KGA ATT GAC GG-3) and 1392r (5-ACG GGC GGT GTG TRC-3) to amplify 16S rDNA (positions 906 to 1406 in the Escherichia coli numbering system) directly from the transferred colonies. The PCR was performed under the following conditions: 94C for 3 min; 35 cycles of 94C for 30 s, 52C for 30 s, and 72C for 1 min; and nally 72C for 5 min. The PCR products were puried with Microspin S-400 columns (Pharmacia Biotech, Uppsala, Sweden) as recommended by the manufacturer. The puried DNA was used for 16S rDNA sequence analysis performed with an ABI Prism dye terminator cycle sequencing Ready Reaction kit and primers 926f and 1392r as the sequencing primers. The sequences were automatically analyzed with an ABI model 373A

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

RESULTS Specicity of primers. When group-specic amplication was performed with the newly developed primers, PCR products of the expected size were obtained (Fig. 1). The specicity of each primer was experimentally tested by using DNA extracts from strains representing 90 different bacterial species (Table 1). The specic primers gave positive PCR results for the corresponding target bacteria and did not cross-react with any of the nontarget microorganisms. The detection limits for these group-specic PCR techniques were also determined with DNA extracted from pure cultured bacteria. Figure 2 shows that B. fragilis NCTC 9343T was detected with the g-Bfra primers at a concentration of 10 cells per PCR mixture. Similar results were obtained for Bacteroides vulgatus ATCC 8424T, Prevotella melaninogenica JCM 6321, Bidobacterium adolescentis ATCC 15703T, Bidobacterium longum ATCC 15707T, Clostridium clostridioforme JCM 1291T, and C. coccoides JCM 1395T with their specic primers (data not shown). Bacterial counts. According to DAPI staining, there were 2.3 1011, 3.8 1011, 1.1 1011, 2.7 1011, 6.3 1010, and 4.0 1010 cells per g (wet weight) of feces in samples from volunteers A, B, C, D, E, and F, respectively (mean standard deviation, 1.8 1011 1.3 1011 cells per g [wet weight]); the numbers of cultivated bacteria in the anaerobic chamber with Medium 10 were 1.1 1011, 9.3 1010, 6.7 1010, 1.8 1011, 4.8 1010, and 2.0 1010 cells per g, respectively (mean standard deviation, 8.6 1010 5.6 1010 cells per g). These results indicated that organisms which grew anaerobically on a nonselective medium accounted for 48, 24, 61, 67, 76, and 50% of the bacteria counted by DAPI staining, respectively (mean standard deviation, 54% 18%). Identication of the isolates. By using the group-specic primers, 300 isolates from feces of six volunteers were identied as 117 isolates of the B. fragilis group, 65 isolates of the C. coccoides group, 22 isolates of Bidobacterium, and 17 isolates of Prevotella; 79 isolates remained unidentied. All of the isolates identied as Bacteroides and Prevotella were gramnegative rods, while the Bidobacterium isolates were grampositive rods. On the other hand, the Gram staining results and the morphology of the isolates identied as members of the C. coccoides group were diverse, and the organisms ranged from gram-negative rods to gram-positive cocci. The compositions of the bacterial groups in each sample are summarized in Table 4. On average, the B. fragilis group accounted for 39% 31% of the total culturable population, while the C. coccoides

VOL. 68, 2002

GROUP-SPECIFIC PRIMERS FOR FECAL BACTERIA

5447

TABLE 1. Specicity tests with the group-specic primers

Species Strain Reactions with the following group-specic primersb: g-Bfrac g-Prevod g-Bide g-Ccocf

Bacteroides fragilis Bacteroides ovatus Bacteroides thetaiotaomicron Bacteroides uniformis Bacteroides vulgatus Bacteroides distasonis Bacteroides putredenis Prevotella buccae Prevotella intermedia Prevotella melaninogenica Prevotella oralis Bidobacterium adolescentis Bidobacterium angulatum Bidobacterium bidum Bidobacterium breve Bidobacterium catenulatum Bidobacterium pseudocatenulatum Bidobacterium longum Bidobacterium infantis Clostridium clostridioformea Clostridium coccoidesa Clostridium nexilea Clostridium oroticuma Clostridium sphenoidesa Ruminococcus gnavusa Ruminococcus lactarisa Ruminococcus productusa Clostridium baratii Clostridium celatum Clostridium perfringens Clostridium sporogenes Clostridium limosum Clostridium bifermentans Clostridium glycolicum Clostridium sordellii Fusobacterium varium Fusobacterium gonidiaformans Fusobacterium prausnitzii Escherichia coli Enterococcus faecalis Enterococcus faecium Porphyromonas asaccharolytica Porphyromonas gingivalis Collinsella aerofaciens Eubacterium biforme Propionibacterium acnes Lactobacillus acidophilus Peptostreptococcus prevotii
a b c

NCTC 9343T JCM 5824T JCM 5827T JCM 5828T ATCC 8482T JCM 5825T ATCC 29800T DSM 20615 JCM 7365T JCM 6321 JCM 6330 ATCC 15703T ATCC 27535T ATCC 29521T ATCC 15700T ATCC 27539T JCM 1200T ATCC 15707T ATCC 15697T JCM 1291T JCM 1395T DSM 1787T JCM 1429T JCM 1415T ATCC 29149T ATCC 29176T ATCC 27340T JCM 1385T JCM 1394T JCM 1290T JCM 1416T JCM 1427T JCM 1386T JCM 1401T JCM 3814T ATCC 8501T ATCC 25563T ATCC 27766T ATCC 11775T ATCC 19433T ATCC 19434T ATCC 25260T JCM 8525 ATCC 25986T ATCC 27806T ATCC 6919T ATCC 4356T ATCC 9321T

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

These species belong to the C. coccoides group. , positive; , negative. In addition, positive PCR results were obtained for Bacteroides heparinolytica ATCC 35895T, Bacteroides caccae ATCC 43185T, and Bacteroides stercoris ATCC 43183T. d In addition, positive PCR results were obtained for Prevotella buccalis DSM 20616T, Prevotella corporis JCM 8529T, Prevotella denticola JCM 8528T, Prevotella loescheii JCM 8530T, Prevotella oris JCM 8540T, Prevotella ruminicola JCM 8958T, and Prevotella veroralis JCM 6290T. e In addition, positive PCR results were obtained for Bidobacterium angulatum ATCC 27535T, Bidobacterium animalis ATCC 25527T, Bidobacterium asteroides ATCC 25910T, Bidobacterium boum JCM 1211T, Bidobacterium choerinun ATCC 27686T, Bidobacterium coryneforme ATCC 25911T, Bidobacterium cunniculi ATCC 27916T, Bidobacterium dentium ATCC 27534T, Bidobacterium denticolens DSM 10105T, Bidobacterium gallinarum JCM 6291T, Bidobacterium indicum ATCC 25912T, Bidobacterium inopinatum DSM 10107T, Bidobacterium lactis DSM 10140T, Bidobacterium magnum JCM 1218T, Bidobacterium merycicum JCM 8219T, Bidobacterium minimum ATCC 27538T, Bidobacterium pseudolongum subsp. globosum ATCC 25864T, Bidobacterium pseudolongum subsp. pseudolongum JCM 1205T, Bidobacterium pullorum JCM 1214T, Bidobacterium ruminantium JCM 8222T, Bidobacterium saeculare DSM 6531T, Bidobacterium subtile DSM 20096T, Bidobacterium thermophilum ATCC 25866T, and Gardnerella vaginalis DSM 4944T. f In addition, positive PCR results were obtained for Clostridium aminovalericum DSM 1283T, Clostridium symbiosum JCM 1297T, Ruminococcus hansenii ATCC 27752T, Ruminococcus hydrogenotrophicus DSM 10507T, Ruminococcus schinkii DSM 10518T, and Ruminococcus torques ATCC 27756T.

5448

MATSUKI ET AL.

APPL. ENVIRON. MICROBIOL.

TABLE 2. Partial 16S rDNA sequences of the reference organisms obtained with the group-specic primers
Organism or sitea Forward primer Designation Sequence
b

Reverse primer Designation Sequenceb

B. fragilis group-specic primers Target site Bacteroides caccaec Bacteroides fragilisc Bacteroides ovatusc Bacteroides thetaiotaomicronc Bacteroides vulgatusc Bacteroides distasonis Porphyromonas gingivalis Prevotella melaninogenica Bidobacterium longum Clostridium coccoides Collinsella aerofaciens Prevotella-specic primers Target site Prevotella buccalisc Prevotella intermediac Prevotella melaninogenicac Prevotella oralisc Bacteroides vulgatus Porphyromonas gingivalis Bidobacterium longum Clostridium coccoides Collinsella aerofaciens Bidobacterium-specic primers Target site Bidobacterium adolescentisc Bidobacterium brevec Bidobacterium catenulatumc Bidobacterium longumc Propionibacterium acnes Bacteroides vulgatus Clostridium coccoides Collinsella aerofaciens C. coccoides group-specic primers Target site Clostridium clostridioformec Ruminococcus gnavusc Clostridium coccoidesc Eubacterium rectalec Clostridium perfringens Clostridium ramosum Bacteroides vulgatus Bidobacterium longum Collinsella aerofaciens

g-Bfra-F

g-Prevo-F

g-Bid-F

g-Ccoc-F

5 ATAGCCTTTCGAAA 3 5 ATAGCCTTTCGAAA 3 .............. .............. .............. .............. .C............ ...A..CGG..... ...A..CG.T.... ...A...GC..... .....TCC.G.... ...ACAG..AG... ......GCC..... 5 CACRGTAAACGATGGATGCC 3 5 CACRGTAAACGATGGATGCC 3 .................... .................... .................... .................... ..............A..A.T .G............AT.A.T .G.C.......G.......T .G.C..N...N...A..A.T AG.C............C..T 5 CTCCTGGAAACGGGTGG 3 5 CTCCTGGAAACGGGTGG 3 ................. ................. ................. ................. ..T.A......T..G.C .CTTCT....G.AAGAT .AGT.A....T.AC..C .CG.CC....G.ACG.. 5 AAATGACGGTACCTGACTAA 3 5 AAATGACGGTACCTGACTAA 3 .................... .................... ..................N. T................... T............CA.GG.G G.G.........T.T.T.TT GNT..CAT....T.T.TG.. G.G...GTT....C.TTG.. TC.A...T.......CAG..

g-Bfra-R

g-Prevo-R

g-Bid-R

g-Ccoc-R

3 ATTTTAACGTCAACTATGACC 5 5 TAAAATTGCAGTTGATACTGG 3 ..................... ....................T ...............A..... ..................... ..................... ..G......C.....A..... .C.GCC...C.....A....C CTG........CGC....... .GG.TCC..GCCG.G...G.. C.GG.C....T.G..A....T CCCG.AGC.CCCG..AC..CC 3 CCAGACGTTGGGCTGG 5 5 GGTCTGCAACCCGACC 3 ................ ................ ................ ................ A..............T A.........T....T A.........T....T A......N..T....T ..GC..........C. 3 ACATCTATAGCCCTTCTTGTGG 5 5 TGTAGATATCGGGAAGAACACC 3 ...................... ...................... ...................... ...................... C.C.......A...G....... CT........AC.......T.. C........TA...G....... C.C..........TG....... 3 AAGCGTTCTTACTTTGAGTTTC 5 5 TTCGCAAGAATGAAACTCAAAG 3 ...................... ...................... ...................... ...................... G........T.A.......... ...................... CCG....CGG............ GC......GC.A.......... GC......N-.A..........

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

a The positions of the target sites for the forward primers are as follows (numbering based on the E. coli 16S rDNA sequence): B. fragilis group-specic primer, nucleotides 148 to 169; Prevotella-specic primer, nucleotides 803 to 827; Bidobacterium-specic primer, nucleotides 153 to 169; and C. coccoides group-specic primer, nucleotides 477 to 496. The target sites for the reverse primers are as follows: B. fragilis group-specic primer, nucleotides 626 to 646; Prevotella-specic primer, nucleotides 1311 to 1335; Bidobacterium-specic primer, nucleotides 699 to 720; and C. coccoides group-specic primer, nucleotides 895 to 916. b Only the nucleotides that are different from the nucleotides in the target sequences are shown. c Targeted organism.

group accounted for 22% 11%. Although Bidobacterium was not isolated from volunteers E and F, this group of bacteria accounted for 7.3% 8.5%. Prevotella was detected only in volunteers C and D and accounted for 5.7% 9.3% of the total culturable population. 16S rDNA sequence analysis of unidentied isolates. The 16S rDNA sequences of the 79 isolates which were not identied with the group-specic primers were determined. These sequences were compared to those available in public databases in order to ascertain their closest relatives (Table 5). Forty isolates were identied as Collinsella aerofaciens. Twenty-four isolates were included in the Clostridium leptum sub-

group (18), which is equivalent to Clostridium cluster IV (4). The remaining 15 isolates were members of other phylogenetic groups, such as the Porphylomonas macacae subgroup (isolates A14, A45, B18, B39, B44, and E09), the Rikenella microfusus subgroup (isolates C24 and E44), the Acholeplasma-Anaeroplasma group (isolates C13 and D47), and other groups (18). Collinsella accounted for 13% 14% of the total culturable population, while the C. leptum subgroup accounted for 8.0% 5.2% (Table 4). Group-specic PCR detection. Group-specic PCR assays were applied to DNA extracted from fecal samples from the six volunteers. The B. fragilis group, Bidobacterium, and the C. coc-

VOL. 68, 2002

GROUP-SPECIFIC PRIMERS FOR FECAL BACTERIA TABLE 3. Group-specic primers based on 16S rDNA sequences

5449

Target bacteria

Primera

Sequence (5 to 3)

Product size (bp)

Annealing temp (C)

Bacteroides fragilis group Prevotella Bidobacterium Clostridium coccoides group

g-Bfra-F g-Bfra-R g-Prevo-F g-Prevo-R g-Bid-F g-Bid-R g-Ccoc-F g-Ccoc-R

ATAGCCTTTCGAAAGRAAGAT CCAGTATCAACTGCAATTTTA CACRGTAAACGATGGATGCC GGTCGGGTTGCAGACC CTCCTGGAAACGGGTGG GGTGTTCTTCCCGATATCTACA AAATGACGGTACCTGACTAA CTTTGAGTTTCATTCTTGCGAA

501 527529 549563 438441

50 55 55 50

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

a The standardized primer names are as follows: g-Bfra-F, S-G-Bfra-0148-a-S-21; g-Bfra-R, S-G-Bfra-0626-a-A-21; g-Prevo-F, S-G-Prevo-0803-a-S-20; g-Prevo-R, S-G-Prevo-1311-a-A-16; g-Bid-F, S-G-Bid-0153-a-S-17; g-Bid-R, S-G-Bid-0699-a-A-22; g-Ccoc-F, S-G-Ccoc-0477-a-S-20; and g-Ccoc-R, S-G-Ccoc-0895-a-A-22 (1).

coides group were detected in all the samples, whereas Prevotella was detected only in samples from volunteers C and D. DISCUSSION To investigate the population structure of the human fecal microora, new oligonucleotide primers for the B. fragilis group, Bidobacterium, the C. coccoides group, and Prevotella were designed, validated, and used for detection and identication of the predominant bacteria in human feces. The group-specic g-Bfra primers were developed to detect the B. fragilis group (18). Species of this cluster are isolated primarily from human feces. Although Bacteroides distasonis and Bacteroides putredenis are isolated from human feces, these two species are not members of the B. fragilis group (18). Therefore, the specicity of these primers is consistent with the phylogenetic relationships based on the 16S rDNA sequence. The g-Prevo primers are designed for specic detection of Prevotella. Although group-specic primers for Bidobacterium were prepared by Kok et al. (16) and Kauffmann et al. (15), we found other specic sequences which are highly conserved in the genus Bidobacterium. The g-Bid primers gave positive PCR results with Gardnerella vaginalis as well. Although G.

vaginalis is not a member of the genus Bidobacterium, it is difcult to distinguish between these two genera on the basis of 16S rDNA sequences (18, 22). As G. vaginalis has not been isolated from human feces, the g-Bid primers would be useful for analysis of the fecal ora. The members of the genus Clostridium do not form a monophyletic cluster on the basis of 16S rRNA sequences (4). Therefore, primers for phylogenetic groups or clusters had to be considered. Members of the C. coccoides group, which corresponded to Clostridium cluster XIVa (4), have been reported to be major components of the human fecal ora (7, 32). Although this group contains members of the genera Clostridium, Coprococcus, Eubacterium, Lachnospira, and Ruminococcus, the organisms falling into this branch are phylogenetically very similar to one another. Extensive efforts have been made in the past to cultivate the bacteria found in human feces, with the result that the human intestinal ora is one of the most successfully studied natural communities of bacteria (5, 6, 23, 24). The total bacterial counts as shown by DAPI staining were in general agreement with the values obtained by other investigators (13, 17). On the other hand, considerable variation has been reported for culturable cell counts. According to some investigators, the majority of the fecal ora is culturable (6, 23), whereas other researchers have reported that the plate counts of total anaerobes were 5- or 10-fold lower than the total cell counts (9, 17,

FIG. 1. PCR products obtained for eight species with group-specic primers. Lane M, DNA size markers (sizes [in bases] are indicated on the left); lane 1, Bacteroides fragilis NCTC 9343T; lane 2, Bacteroides vulgatus ATCC 8424 T; lane 3, Prevotella melaninogenica JCM 6321; lane 4, Prevotella buccae DSM 20615; lane 5, Bidobacterium bidum ATCC 29521T; lane 6, Bidobacterium longum ATCC 157071T; lane 7, Clostridium coccoides JCM 1395T; lane 8, Clostridium clostridioforme JCM 1291T; lane 9, negative control (PCR performed with g-Bfra primers and Escherichia coli ATCC 11775T).

FIG. 2. Detection limits of the group-specic PCR methods, as determined by using DNA extracted from pure cultured B. fragilis NCTC 9343T. Lane M, DNA size markers (sizes [in bases] are indicated on the left); lane 1, 106 cells per PCR mixture; lane 2, 105 cells per PCR mixture; lane 3, 104 cells per PCR mixture; lane 4, 103 cells per PCR mixture; lane 5, 102 cells per PCR mixture; lane 6, 10 cells per PCR mixture; lane 7, 1 cell per PCR mixture; lane 8, no cells (negative control).

5450

MATSUKI ET AL. TABLE 4. Identication of 300 strains isolated from feces of six volunteers
No. of strains obtained from the following volunteers: A B C D E F Total no. of strains

APPL. ENVIRON. MICROBIOL. TABLE 5. 16S rDNA phylogenetic analysis of 79 isolates that were not identied with the newly developed group-specic primers
Isolate(s) Microorganism with most similar sequence in database (accession no.) % Similarity

Bacterial group

Isolates identied with group-specic primers Bacteroides fragilis group Bidobacterium Clostridium coccoides group Prevotella Isolates identied by sequencing of 16S rDNAa Collinsella Clostridium leptum subgroup Disparate cluster

27 2 10 0 3 4 4

17 10 8 0 6 6 3

6 8 11 11 8 3 3

1 2 18 6 20 2 1

21 0 16 0 3 8 2

45 0 2 0 0 1 2

117 22 65 17 40 24 15

a The results of a 16S rDNA phylogenetic analysis of isolates that were not identied with the group-specic primers are shown in Table 5.

35). The difference may be explained by the different culture methods and media used. In our hands, the culturable fraction was 54% of the total DAPI counts. The percentage in our study was in good agreement with the results obtained by Wilson and Blitchington (41), who used the same nonselective agar, Medium 10. When a panel of four pairs of primers was used, 74% of the isolates were identied in the present study (Table 4). The results of identication with specic primers are consistent with the Gram staining results and the morphology of the isolates, although the C. coccoides group showed considerable variation. The proportion of the B. fragilis group and Bidobacterium enumerated was consistent with current knowledge obtained by both culture-based and molecule-based methods (7, 23, 41). The proportions of the C. coccoides group and the C. leptum subgroup were comparable to the results obtained by other investigators (7, 32). C. aerofaciens is also well recognized as the predominant bacterium in the human fecal ora (10, 14, 23, 24). Although Prevotella is a genus found in both the oral microora and the rumen microora (27), this genus has been detected in the adult fecal ora by direct 16S rDNA analysis (35). The results of this study show that 95% of the cultivated bacteria could be assigned to six major phylogenetic lineages (the B. fragilis group, the C. coccoides group, Bidobacterium, Prevotella, Collinsella, and the C. leptum subgroup). Therefore, group-specic primers for Collinsella and the C. leptum subgroup should be prepared. By using DNAs extracted from fecal samples, qualitative PCR detection of the B. fragilis group, Bidobacterium, the C. coccoides group, and Prevotella was accomplished. Targeted bacteria were detected when they were present at a concentration of at least 10 cells per PCR mixture, indicating that the detection limit for the procedures described here was 106 cells per g of feces. In contrast, the detection limit of the culture method for minor species was 2% of the total bacterial counts in this study (for example, 9.6 108 and 4.0 108 cells per g in samples from volunteers E and F, respectively). This accounts for the fact that Bidobacterium was detected in volunteers E and F by the specic PCR technique but was not detected by the culture method.

Collinsella A15, A46, A46, B02, B03, B08, B28, B49, C08, C25, C28, C35, D05, D06, D09, D10, D14, D15, D17, D18, D19, D21, D22, D26, D30, D33, D34, D41, D44, D49, E13, E19, E23 C11, C15, C18, C41 B17, D04, D23 Clostridium leptum subgroup A05, E10, E33 B26 A42, D50, E32, E34 C29, C44, D45 E47 C45 B20, B50, E07, E49 B01, B29 A02, F30 E25 B34 A50 Disparate cluster B44, E09 A45 A14 B18, B39 C24 E44 A26 A38 C13, D47 C46 F11 F22

Collinsella aerofaciens (AB011816)

100

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO

Collinsella aerofaciens (AB011816) Collinsella aerofaciens (AB011816) Fusobacterium prausnitzii (X85022) Fusobacterium prausnitzii (X85022) Fusobacterium prausnitzii (X85022) Fusobacterium prausnitzii (X85022) Fusobacterium prausnitzii (X85022) Fusobacterium prausnitzii (X85022) Ruminococcus albus (L76598) Ruminococcus albus (L76598) Eubacterium desmolans (L34618) Ruminococcus bromii (L76600) Ruminococcus bromii (L76600) Clostridium orbiscindens (Y18187) Bacteroides distasonis (M86695) Bacteroides distasonis (M86695) Bacteroides distasonis (M86695) Bacteroides distasonis (M86695) Bacteroides putredenis (L16497) Bacteroides putredenis (L16497) Clostridium propionicum (X77841) Clostridium aldrichii (X71846) Clostridium ramosum (M23731) Megasphaera elsdenii (U95029) Clostridium hiranonis (AB023971) Anaerovibria glycerini (AJ010960)

99 98 99 98 97 96 95 94 95 94 98 100 94 98 100 97 94 93 97 96 96 92 93 100 100 91

Establishing a procedure for quantitative detection of these bacterial groups is a task for the future, and research into real-time quantitative detection is proceeding (28). The primers described here should also be used for group-specic PCR and denaturing gradient gel electrophoresis to monitor the diversity of the target bacterial groups in human feces (30) and for identication of the cloned 16S rRNA genes that were directly amplied from fecal DNA (35). Therefore, the techniques for detection and identication of predominant bacteria with the group-specic primers described here should create new opportunities for noncultivation studies of the human intestinal microora.
REFERENCES 1. Alm, E. W., D. B. Oerther, N. Larsen, D. A. Stahl, and L. Raskin. 1996. The oligonucleotide probe database. Appl. Environ. Microbiol. 62:35573559. 2. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403410. 3. Amann, R. I., W. Ludwig, and K. H. Schleifer. 1995. Phylogenetic identication and in situ detection of individual microbial cells without cultivation. Microbiol. Rev. 59:143169. 4. Collins, M. D., P. A. Lawson, A. Willems, J. J. Cordoba, J. FernandezGarayzabal, P. Garcia, J. Cai, H. Hippe, and J. A. Farrow. 1994. The phylogeny of the genus Clostridium: proposal of ve new genera and eleven new species combinations. Int. J. Syst. Bacteriol. 44:812826. 5. Finegold, S. M., H. R. Attebery, and V. L. Sutter. 1974. Effect of diet on human fecal ora: comparison of Japanese and American diets. Am. J. Clin. Nutr. 27:14561469. 6. Finegold, S. M., V. S. Sutter, and G. E. Mathisen. 1983. Normal indigenous

VOL. 68, 2002

intestinal ora, p. 331. In D. J. Hentges (ed.), Human intestinal microora in health and disease. Academic Press, New York, N.Y. Franks, A. H., H. J. Harmsen, G. C. Raangs, G. J. Jansen, F. Schut, and G. W. Welling. 1998. Variations of bacterial populations in human feces measured by uorescent in situ hybridization with group-specic 16S rRNAtargeted oligonucleotide probes. Appl. Environ. Microbiol. 64:33363345. Fuller, R. 1989. Probiotics in man and animals. J. Appl. Bacteriol. 66:365 378. Harmsen, H. J., G. R. Gibson, P. Elfferich, G. C. Raangs, A. C. WildeboerVeloo, A. Argaiz, M. B. Roberfroid, and G. W. Welling. 2000. Comparison of viable cell counts and uorescence in situ hybridization using specic rRNAbased probes for the quantication of human fecal bacteria. FEMS Microbiol. Lett. 183:125129. Harmsen, H. J., A. C. Wildeboer-Veloo, J. Grijpstra, J. Knol, J. E. Degener, and G. W. Welling. 2000. Development of 16S rRNA-based probes for the Coriobacterium group and the Atopobium cluster and their application for enumeration of Coriobacteriaceae in human feces from volunteers of different age groups. Appl. Environ. Microbiol. 66:45234527. Harmsen, H. J. M., P. Elfferich, F. Schut, and G. W. Welling. 1999. A 16S rRNA-targeted probe for detection of lactobacilli and enterococci in faecal samples by uorescent in situ hybridization. Microb. Ecol. Health Dis. 11: 312. Holdman, L. V., E. P. Cato, and W. E. C. Moore. 1977. Anaerobe laboratory manual, 4th ed. Southern Printing Co., Blacksburg, Va. Jansen, G. J., A. C. Wildeboer-Veloo, R. H. Tonk, A. H. Franks, and G. W. Welling. 1999. Development and validation of an automated, microscopybased method for enumeration of groups of intestinal bacteria. J. Microbiol. Methods 37:215221. Kageyama, A., M. Sakamoto, and Y. Benno. 2000. Rapid identication and quantication of Collinsella aerofaciens using PCR. FEMS Microbiol. Lett. 183:4347. Kaufmann, P., A. Pfefferkorn, M. Teuber, and L. Meile. 1997. Identication and quantication of Bidobacterium species isolated from food with genusspecic 16S rRNA-targeted probes by colony hybridization and PCR. Appl. Environ. Microbiol. 63:12681273. Kok, R. G., A. de Waal, F. Schut, G. W. Welling, G. Weenk, and K. J. Hellingwerf. 1996. Specic detection and analysis of a probiotic Bidobacterium strain in infant feces. Appl. Environ. Microbiol. 62:36683672. Langendijk, P. S., F. Schut, G. J. Jansen, G. C. Raangs, G. R. Kamphuis, M. H. Wilkinson, and G. W. Welling. 1995. Quantitative uorescence in situ hybridization of Bidobacterium spp. with genus-specic 16S rRNA-targeted probes and its application in fecal samples. Appl. Environ. Microbiol. 61: 30693075. Maidak, B. L., J. R. Cole, C. T. Parker, Jr., G. M. Garrity, N. Larsen, B. Li, T. G. Lilburn, M. J. McCaughey, G. J. Olsen, R. Overbeek, S. Pramanik, T. M. Schmidt, J. M. Tiedje, and C. R. Woese. 1999. A new version of the RDP (Ribosomal Database Project). Nucleic Acids Res. 27:171173. Matsuki, T., K. Watanabe, R. Tanaka, M. Fukuda, and H. Oyaizu. 1999. Distribution of bidobacterial species in human intestinal microora examined with 16S rRNA-gene-targeted species-specic primers. Appl. Environ. Microbiol. 65:45064512. Matsuki, T., K. Watanabe, R. Tanaka, and H. Oyaizu. 1998. Rapid identication of human intestinal bidobacteria by 16S rRNA-targeted speciesand group-specic primers. FEMS Microbiol. Lett. 167:113121. Mitsuoka, T., K. Hayakawa, and N. Kimura. 1974. Die Faekalora bei Menschen. II. Mitteilung: Die Zusammensetzung der Bidobakerien ora der verschiedenen Altersgruppen. Zentbl. Bakteriol. Parasitenkd. Infektionskr. Abt. 1 Orig. Reihe A 226:469478. Miyake, T., K. Watanabe, T. Watanabe, and H. Oyaizu. 1998. Phylogenetic analysis of the genus Bidobacterium and related genera based on 16S rDNA sequences. Microbiol. Immunol. 42:661667. Moore, W. E. C., and L. V. Holdeman. 1974. Human fecal ora: the normal ora of 20 Japanese-Hawaiians. Appl. Microbiol. 27:961979.

GROUP-SPECIFIC PRIMERS FOR FECAL BACTERIA

5451

7.

8. 9.

10.

11.

12. 13.

14. 15.

16. 17.

18.

19.

20. 21.

22. 23.

24. Moore, W. E. C., and L. H. Moore. 1995. Intestinal oras of populations that have a high risk of colon cancer. Appl. Environ. Microbiol. 61:32023207. 25. Mutai, M., and R. Tanaka. 1987. Ecology of Bidobacterium in the human intestinal ora. Bidobacteria Microora 6:3341. 26. Olsen, G. J., C. R. Woese, and R. Overbeek. 1994. The winds of (evolutionary) change: breathing new life into microbiology. J. Bacteriol. 176:16. 27. Paster, B. J., F. E. Dewhirst, I. Olsen, and G. J. Fraser. 1994. Phylogeny of Bacteroides, Prevotella, and Porphyromonas spp. and related bacteria. J. Bacteriol. 176:725732. 28. Requena, T., J. Burton, T. Matsuki, K. Munro, M. A. Simon, R. Tanaka, K. Watanabe, and G. W. Tannock. 2002. Identication, detection, and enumeration of Bidobacterium species by PCR targeting the transaldolase gene. Appl. Environ. Microbiol. 68:24202427. 29. Satake, S., N. Clark, D. Rimland, F. S. Nolte, and F. C. Tenover. 1997. Detection of vancomycin-resistant enterococci in fecal samples by PCR. J. Clin. Microbiol. 35:23252330. 30. Satokari, R. M., E. E. Vaughan, A. D. Akkermans, M. Saarela, and W. W. de Vos. 2001. Bidobacterial diversity in human feces detected by genus-specic PCR and denaturing gradient gel electrophoresis. Appl. Environ. Microbiol. 67:504513. 31. Schwiertz, A., G. Le Blay, and M. Blaut. 2000. Quantication of different Eubacterium spp. in human fecal samples with species-specic 16S rRNAtargeted oligonucleotide probes. Appl. Environ. Microbiol. 66:375382. 32. Sghir, A., G. Gramet, A. Suau, V. Rochet, P. Pochart, and J. Dore. 2000. Quantication of bacterial groups within human fecal ora by oligonucleotide probe hybridization. Appl. Environ. Microbiol. 66:22632266. 33. Simpson, J. M., V. J. McCracken, H. R. Gaskins, and R. I. Mackie. 2000. Denaturing gradient gel electrophoresis analysis of 16S ribosomal DNA amplicons to monitor changes in fecal bacterial populations of weaning pigs after introduction of Lactobacillus reuteri strain MM53. Appl. Environ. Microbiol. 66:47054714. 34. Song, Y., N. Kato, C. Liu, Y. Matsumiya, H. Kato, and K. Watanabe. 2000. Rapid identication of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specic primers derived from the 16S-23S rRNA intergenic spacer region and its anking 23S rRNA. FEMS Microbiol. Lett. 187:167173. 35. Suau, A., R. Bonnet, M. Sutren, J. J. Godon, G. R. Gibson, M. D. Collins, and J. Dore. 1999. Direct analysis of genes encoding 16S rRNA from complex communities reveals many novel molecular species within the human gut. Appl. Environ. Microbiol. 65:47994807. 36. Tannock, G. W. 1995. Normal microora: an introduction to microbes inhabiting the human body. Chapman & Hall, London, United Kingdom. 37. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The CLUSTAL_X Windows interface: exible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25:48764882. 38. Walter, J., G. W. Tannock, A. Tilsala-Timisjarvi, S. Rodtong, D. M. Loach, K. Munro, and T. Alatossava. 2000. Detection and identication of gastrointestinal Lactobacillus species by using denaturing gradient gel electrophoresis and species-specic PCR primers. Appl. Environ. Microbiol. 66: 297303. 39. Wang, R. F., W. W. Cao, and C. E. Cerniglia. 1996. PCR detection and quantitation of predominant anaerobic bacteria in human and animal fecal samples. Appl. Environ. Microbiol. 62:12421247. 40. Wang, R. F., W. W. Cao, and C. E. Cerniglia. 1997. PCR detection of Ruminococcus spp. in human and animal faecal samples. Mol. Cell. Probes 11:259265. 41. Wilson, K. H., and R. B. Blitchington. 1996. Human colonic biota studied by ribosomal DNA sequence analysis. Appl. Environ. Microbiol. 62:22732278. 42. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:221271. 43. Zoetendal, E. G., A. D. Akkermans, and W. M. De Vos. 1998. Temperature gradient gel electrophoresis analysis of 16S rRNA from human fecal samples reveals stable and host-specic communities of active bacteria. Appl. Environ. Microbiol. 64:38543859.

Downloaded from http://aem.asm.org/ on December 9, 2013 by UAM UNIDAD XOCHIMILCO