JOURNALOF FERMENTATIONAND BIOENGINEERWG

Vol. 80, No. 5, 454-461. 1995

Cloning and Sequencing of chic Gene of Bacillus circulans WL-12

and Relationship of Its Product to Some Other Chitinases and
Chitinase-Like Proteins
MD. MUSTAFA ALAM,’ NAOKI NIKAIDOU,2 HIROSATO TANAKA,2 AND TAKESHI WATANABE2*
Department of Biosystem Science, Graduate School of Science and Technology,’ and Department of Applied Biological
Chemistry, Faculty of Agriculture,2 Niigata University, 8050 Ikarashi-2, Niigata 950-21, Japan

Received 10 July 1995/Accepted 28 August 1995

To clarify the roles of individual chitinases comprising in the chitinase system of Bacillus circulans WL-12,
the gene (chic) encoding chitinase C, a minor constituent of the chitinase system, was cloned and expressed in
Escherichia coli. The predicted product of the chic gene is 491 amino acids long with a calculated molecular
mass of 53,447 Da. The N-terminal portion of the deduced polypeptide exhibited 46.8% amino acid homology
with the catalytic domain of chitinase Al of this bacterium, suggesting that the chitinase encoded by the chic
gene is comprised of an N-terminal catalytic domain and a C-terminal domain with unknown function. Two
bands of chitinases with estimated molecular masses of 55 kDa and 40 kDa were detected on SDS-PAGE of the
periplasmic fraction of E. coZi carrying the cloned chic gene. Chitinase C of B. circulans WL-12 is practically
identical to the 40 kDa chitinase detected in E. coli based on their N-terminal amino acid sequences, isoelectric
points and estimated sizes, and corresponds to the catalytic domain of the initial product of the chic gene
(55 kDa chitinase, designated as chitinase Cl). Comparison of domain organizations of chitinases, of this
bacterium, sequenced so far suggested that they represent two types of catalytic domains and that domain
shuffling occurred relatively recently giving rise to three chitinases. Sequence comparison and the evolutionary
relationship of chitinase Cl with other chitinases and chitinase-like proteins are also discussed.

[Key words: chitinase C, Bacillus circulans WL-12, chitinase-like proteins, multiple gene, proteolytic
cleavage]

Chitinases have been the focus of considerable recent parison with that of other chitinases of this bacterium.
attention due to their roles in chitin recycling in nature In this paper we report molecular cloning, expression
and in defense mechanisms of plants, and as prospects and sequencing of the chic gene which encodes precur-
for biotechnological exploitation of natural chitinous sor of chitinase C of B. circulans WL-12.
materials. They are present in a wide range of organisms
including bacteria, insects, plants and animals. The roles
MATERIALS AND METHODS
of chitinase vary from species to species. For example, it
has long been speculated that plant chitinases play a Chemicals and reagents Glycol chitin and colloidal
vital role in plant defense mechanisms (l), fungal chitin were prepared using chitin obtained from
chitinase is important in apical growth and branching of Funakoshi Chemical Co. (Tokyo) following the methods
hyphae (2), yeast chitinase is required for cell separation described by Yamada and Imoto (10) and Jeuniaux (1 l),
during growth (3), and insects use chitinase to digest respectively. All other chemicals and reagents used
chitin in the exoskeleton during the molting process (4). throughout this study were of the highest purity avail-
Among them bacterial chitinases have been given special able or of analytical grade. Restriction enzymes were
attention by researchers due to their contribution to the purchased from Toyobo Biochemicals (Osaka) and New
maintenance of the ecological balance by degrading England Biolabs (Beverly, MA, USA).
chitin present in nature. Bacterial strains, plasmids and culture media B. cir-
Baciilus circulans WL-12 has been reported to secrete culans WL-12 (12) was used as the source of chitinase C
multiple chitinases when grown on a minimal medium (5) and chromosomal DNA for cloning. E. cofi HBlOl
containing chitin. These chitinases (chitinase Al, A2, supE44 hsdS20 (rBPmBP) recA13 ara-14 proA lacy1
Bl, B2, C and D) were suggested to be encoded by multi- galK2 rpsL20 xyl-5 mtl-I, MV II84 ara A(lac-proAB)
ple genes (5). Some other bacteria and fungi have also rpsL thi(p80 lacZAM15) A(srl-recA)306::Tn10(tetr)
been reported to possess multiple chitinases (6-9) but the F’[traD36 proAB+ la& lacZAM151 and JM109 recA1
reason for the presence of multiple chitinases is not yet supE44 endA hsdRl7 gyrA96 relAl thi A(lac-proAB)
clear. Extensive characterization of individual members F’[traD36 proAB+ lacl’l lacZAM151 were used through-
of the multiple chitinase system at both physicochemical out this study. For the cloning of the chic gene, E. coli
and molecular levels is necessary to understand the HBlOl and pUC19 were used as the host organism and
significance of the presence of multiple chitinases. the vector, respectively. B. circulans WL-12 was grown
Chitinase C was previously described as a member of on Luria-Bertani (LB) medium (13) supplemented with
the chitinase system in B. circulans WL-12 (5). The level 0.5% glucose for chromosomal DNA extraction and on
of production of chitinase C is significantly low in com- yeast-nitrogen base (YNB) medium (Difco Laboratories,
Detroit, MI, USA) with 0.2% (wt/vol) chitin for chi-
* Corresponding author. tinase production. E. co/i harboring plasmid as grown

454
VOL. 80, 1995 chic GENE OF B. CIRCULANS WL-12 455

on LB medium supplemented with ampicillin (100 protein concentration was measured according to the
pg/ml). Single-stranded plasmid DNA was prepared method of Lowry et al. (19) using bovine serum albumin
on 2 x YT medium (13) containing ampicillin (150 pg/ml) as standard.
and kanamycin (70 pg/ml) when M13K07 was used as a N-terminal amino acid sequence For N-terminal
helper phage. amino acid sequencing, ammoniumsulfate-precipitated
Cloning procedure Chromosomal DNA of B. circu- chitinases from both B. circulans and E. coli were
lam WL-12 was partially digested with Hind111 and frag- partially purified by means of isoelectric focusing. The
ments ranging from 2 to 10 kb were collected and ligated concentrated enzyme preparations were then subjected
with the HindIII-digested and bacterial alkaline phos- to SDS-PAGE. Following SDS-PAGE, proteins on the
phatase-treated vector pUC19 and then transformed into gel were electroblotted onto polyvinylidene difluoride
E. coli HBlOl. Chitinase-producing colonies were detect- (PVDF) membrane, as described by Matsudaira (20).
ed from observation of a colorless zone (glycol chitin- The membrane was stained with Coomassie brilliant
degraded zone which is unable to adsorb Congo red dye) blue R-250 for protein band visualization and ex-
around the colonies after growing on an LB plate con- cised chitinase bands were sequenced on an Applied
taining ampicillin and glycol chitin, and staining with Biosystems 473 gas phase sequencer (Foster City, CA,
Congo red according to the method of Watanabe et al. USA).
(14). All routine DNA manipulations throughout this Computer analysis of uucleotide and amino acid se-
study were carried out by following the methods quences The SDC Genetyx system (Software Kaihatsu,
described by Sambrook et al. (13) unless otherwise men- Tokyo) was used to determine the open reading frame
tioned. for the chic gene, promoter region, terminator region
DNA Sequencing The recombinant plasmid and Shine-Dalgarno (SD) sequence. A homology search
pALC1102 which was used for sequencing contains analysis of the deduced amino acid sequence was done
pUC19 and a 2.8 kb long Hind111 fragment of B. circu- using the SWISS-PROT protein data bank. Alignment
lam WL-12 chromosomal DNA carrying the chic gene. of amino acid sequences and phylogenic tree construc-
pALCl1 and pALC12 were constructed by subcloning tion are done using Fujitsu integrated biotechnologi-
the chic gene-containing fragment from pALC1102 into cal research systems, Bioresearch AE and Bioresearch
pUC119 in both orientations (Fig. 1). For sequencing, SINCA (Fujitsu Limited, Tokyo), respectively. The
overlapping deletions of both pALC11 and pALC12 unweighed pair group method with arithmetic mean
were made by using a deletion kit purchased from (UPGMA) and neighbor-joining (N-J) method were used
Takara Shuzo Co. Ltd. (Osaka). Sequencing was per- for phylogenic tree construction.
formed using the dideoxy chain termination method of
Sanger et al. (15) and Sequenase Version 2.0 from US
RESULTS
Biochemical Corp. (Cleveland, OH, USA) supplied by
Toyobo Biochemicals. Detection was done using a Selection of clone expressing expected chitinase-encod-
Chemiluminescent Sequencing kit from Toyobo Biochem- ing gene Multiple chitinases detected in the culture
icals . supernatant of B. circulans WL-12 were suggested to be
Extraction of chitinase from E. coli The product derived from at least four different genes, designated as
of the cloned chic gene was extracted from the periplas- chiA, chiB, chic and chiD (5). The chiA and chiD genes
mic space of E. coli harboring the chic gene-containing have already been cloned and sequenced, and their
plasmid by osmotic shock treatment following the products characterized (14, 21). To characterize the
method described by Manoil and Beckwith (16). After
osmotic shock treatment, the extracted periplasmic pro-
teins were precipitated with ammoniumsulfate and the -
precipitate was dissolved in 5 ml of 20 mM phosphate
buffer, pH 6.0, dialyzed against the same buffer and
lyophilized.
Sodium dodecyl sulfate-polyacrylamide gel electro-
phoresis and detection of chitinase activity on zymogram
Sodium dodecyl sulfate-polyacrylamide gel electro-
phoresis (SDS-PAGE) in 10% slabs was performed as
described by Laemmli (17). Detection of chitinase activ-
ity on an agar replica sheet containing 0.03% glycol chi-
tin was carried out as described previously (5).
Isoelectric focusing The isoelectric point of
chitinases from both B. circulans and E. coli as deter-
mined using Ampholine electrofocusing equipment (LKB
8100-10; LKB Instruments AB, Sweden) according to the
manufacturer’s instructions.
Enzyme and protein assays Chitinase activity was
FIG. 1. Partial restriction map of the inserted fragment and
determined using glycol chitin as substrate. Activity was
strategy for sequencing. Horizontal lines indicate the sizes of deletion
determined by measuring the amount of reducing sugar derivatives used for sequencing. Arrows beneath the horizontal lines
formed after enzyme reaction, according to the proce- indicate direction and extent of sequenced region. q , The region not
dure described by Imoto and Yagishita (18). One unit of sequenced; %8,upstream region of ORF; 8, signal sequence region; n ,
chitinase was defined as the amount of enzyme that the region encoding putative catalytic domain; @, the region encoding
liberated reducing sugar corresponding to one pmol of C-terminal domain; q, down-stream region of ORF. H, P and E
GlcNAc per minute under the stated condition. Soluble indicates HindIII, PvuII and EcoRI cleavage sites, respectively.
456 ALAM ET AL. J. FERMENT.BIOENG

GAAATCGATTACATTTAATTGTAAACGCTTCCTTCCTTC 60
PVUII
GGGTGAAGAAGCGATGTGGATCAACAAATATAGTCTTTCAGCTGCATTAACGAGAGAAGC 120
“-35” ‘0.10” EcoRI
AGTAGGGAGTACAGGGCGTGACCCTCCTGCTAACCAAAACC 180

CTAAAATTAAAACCCC mAGTTATATGATGAACCTAA?iTCGAGTGGGTACGACCC 240

MMNLNRVGTTP

CTTCATTTGTAAAAGTGTTTATGCTCTTATTATTTTTATCTTTTGCACT~CCGTTTC~CAT 300
SFVKVFMLLFLSFALTVSTF

TTGCCATTGGACCAGCTAAACAAGCGGACGCAGATCCTCTTCCAAAGAAAATTATTGCTT 360
AAI GPAKQADAAD PLPKXI I A Y
E. coo WL-12
SLTGTGGCTGGTTGGGCCAACTGGACCGCGCG~TGATATC~GGTAG~CAGCTCTCTCATA 420
VAGWANWTAND IKVEQLSHI

TCAATTATTCCTTCGCTCTCATCTCCAACGGCAAAGCAACCGTA 480
NYSFALISNGXATITNSDRT

CCAAACTGCAlLATGATGGTTGGATTGAAATCCAGAAACCCTGATCTGAAGGTGTGTTATTGT 540
K L Q M MVGLKSRNPDLXVLLS

CTGTTGGTGGCTGGGGAGCTAACGGTTTTTTCAGACGCTGCGCT~CGGACGCCTCACGCA 600
VGGWGANGFSDAALTDASRT

CAACCTTTGCTGACAGCATTGTGCAGTTGGTAACCTCCAATC 660
TFADSI V QLV T SNNLDGVDL

TGGATTGGGAATATCCGACCAACCCCTGCTGCCGGTAC~CTGCGC~CCACA~AT~C 720
DWEYPTNPAAGTTARPQDKQ

AAAACTTCACACAACTGCTCTCGAAGGTTCGTGAGAAGTTGAATGCTCAAGGACAAATTA 780
NFTQLL SXVREXLNAQGQIN

ATGGCAAACAATATCTGCTGACCATTGCCGCAGGAGCGCAGGAGCGAGCAGCAGTTATCTG~C~TG 840
GXQYLLTIAAGASSSYLNGV

TGGAAATCAATAATATCACGCCTCTGCTGGATTGGATCAATTTC 900
EINNITPLLDWINLMTYDFH

ATGGAACCTGGGATGCAACCACAGGTCATCATACGAATCTTATTAGTG 960
GTWDATTGHHTNLSGRDISV

TAACGTCTGCGGTCAATCTGTTCAGAAATAGCGGTGTTCCCTGGTCATTG 1020
TSAVNLFRNSGVPANXLVIG
EcoRI
GCGGAGCCTTTTATGGCCGGGCCTGGACTGGTGTGCAOAATGGTCTGGACA 1080
GAFYGRAWTGVQN SNNGLDR

GGCCCGCTTCTGGGGGTTTTGAACCCCGATTACACCATTA 1140
PASGGFE PDYNTIVSQ FL N X

AAAACGGATATACACGGTACTGGGACAGCAGTGCCCAAGCTCCTTATCTGTTTAATGGAA 1200
NGYTRYWDSSAQAP YLFNGN

ATACTTTTATCTCGTATGACGACCCACAATCACTCACTCAGCCTG~GGTGC~TATGTG~ 1260
T F I S Y D D P Q S L S L K V Q Y V K N

ATAGCAATCTGGGTGGCATCATGTTCTGGGAGTACAGCAA 1320
SNLGGIMFWEYSNDRSGALL

TTCAGGCCGTATATTCAGAGGTTACGGGTGGTGGCACGGlGCG 1380
QAVYSEVTGGGTVQPPNPSG
VOL. 80, 1995 chic GENE OF B. CIRCULANS WL-12 457

GGTATAACTATTTAATTGCTCAAGCCAATCAGCAAATCGTCTCTGCCGAGAATCAAGGCA 1440
YNYLIAQANQQIVSAENQGN

ATGACCAGCTTGTCGCCGATCGGACGACGGCAGGAGACTG 1500
D Q LVADRTTAGDWELFEWIT

CGAACTCCGATGGAACGGTGTCCCTCAAGTCCAAAATCAATAATAAATATGTCACAGCAG 1560
N s DGTVSLKSKINNKYVTAD

ATGTTAATCTGGGTGGTGCCTTGATCGCAAAAGCCACACAACCATTCAGCAATGGGAGAAGT 1620
VNLGGAL IAKATTIQQWEKF

TCAATCGTGTGGATTTGGGTGATGGAACAATCGCATGCAGCCTGTA 1680
NRVDLGDGTIACRBSPITCT

CGTGACCTGTGATCT~~TG~GGTATTCGGTTGGCGG 1740
* HidI e+
GGCCTGGGAAGCTT

FIG. 2. Nucleotide sequence of the chic gene of B. circulans WL-12 and the amino acid sequence deduced from it. Box indicates N-terminal
amino acid sequence of chitinase C detected in culture supernatant of B. circulans WL-12 that was determined previously. The “ - 10” and “-35”
regions of the tentative promoter are underlined. The putative ribosome binding site and inverted repeat sequences are indicated by a double
underline and horizontal arrows, respectively. Signal peptide cleavage sites in E. coli and B. circulans WL-12 are indicated by closed triangles.
Relevant restriction enzyme sites are listed above their recognition sequences (which are highlighted as boldface letters). Amino acid residues
putatively involved in catalytic mechanism are also highlighted as boldface letters.

products of the remaining genes in order to elucidate less zones on a Congo red-stained glycol chitin plate.
their individual roles in the multiple chitinase system, we Overlapping deletion derivatives of pALCl1 and
commenced this study. A genomic library was prepared pALC12, and their sizes, extents and directions of se-
by ligating Hind111 fragments obtained by partial diges- quencing are shown in Fig. 1. The deletion derivatives
tion of chromosomal DNA and HindIII-digested vector were designated as DM and DMR for pALCl1 and
pUC19. A total of about 4,500 clones of E. co/i trans- pALC12, respectively. Using the overlapping deletion
formed with the genomic library were tested for mutants, 1750 nucleotide bases were sequenced from
chitinase production. Of these, 22 clones were detected both strands. Translation of the sequenced DNA be-
based on their ability to produce chitinase on Congo tween nucleotide positions 210 and 1685 resulted in an
red-stained glycol chitin plate, as described in Materials open reading frame (ORF) for a polypeptide of 491 amino
and Methods. Plasmid DNA prepared from all chitinase- acids (Fig. 2) long with a deduced molecular mass of
positive clones as analyzed by digestion with HindIII. 53,447 Da. A putative promoter region spans nucleotide
Three patterns of inserted DNA were observed in plas- positions 63 to 68 (“ -35” region) and 89 to 94 (‘I - 10”
mid DNA prepared from all 22 chitinase-positive clones. region). A putative Shine-Dalgarno sequence is located
Employing our previous knowledge about the restriction 12 bases upstream of the ATG initiation codon. The
maps of the chiA and chiD genes, candidates for chiB or deduced amino acid sequence from Asp-42 to Ala-56
chic gene-containing recombinant plasmids were desig- fully coincided with N-terminal amino acid sequence of
nated as pALC220 (contains a total of five inserted frag- chitinase C secreted by B. circulans WL-12 (Table 1). No
ments including one 2.8 kb fragment) and pALC1102 portion identical with N-terminal amino acid sequence
(contains only 2.8 kb inserted fragment). Further anal- of chitinase B was observed within the entire deduced
ysis indicated that the 2.8 kb inserted fragment of amino acid sequence. Therefore, we preliminarily consi-
pALC1102 is identical to the 2.8 kb fragment of dered that the cloned gene is specific for chitinase C of
pALC220 and therefore we chose pALC1102 rather than B. circulans and termed it the chic gene.
pALC220 for sequencing. Sodium dodecyl sulfate-polyacrylamide gel electropho-
Sequencing analysis For sequencing, the inserted resis (SDS-PAGE) analysis of the chitinases produced in
fragment of pALC1102 was subcloned into pUC119 in E. coli The periplasmic protein extracted from E.
both orientations and the resulting plasmids were desig- coli harboring pALCl1 showed two chitinase bands on
nated as pALCl1 and pALC12, respectively. Both SDS-PAGE. Their approximate molecular masses were
pALC11 and pALC12 had the ability to produce color- 55 kDa and 40 kDa, as estimated from SDS-PAGE

TABLE 1. N-terminal amino acid sequence, molecular mass and isoelectric point analysis of chitinase C
Molecular mass
(kDa) Isoelectric point N-terminal amino acid sequence

B. circulans WL- 12 39 8.5 DPLPKKIIAYVAGXA

E. co/i harboring pALCl1 55 (upper band) 5.7
40 (lower band) 8.3 ZZAKQ AD ADPLPKUAY
E. coli harboring pALC220 55 (upper band) 5.5 IGPAKQADADPLPKKIIAY
40 (lower band) 8.3 ND
E. co/i harboring DM25 40 ND ND
a ND, Not determined.
458 ALAM ET AL. J. FERMENT. BIOENG.,

A B
M.W. 123 4512 34 5

FIG. 3. SDS-PAGE analysis of chitinase from culture supernatant of B. circuluns WL-12 and periplasmic protein of E. coli. (A) Protein
staining of the polyacrylamide gel with Coomassie brilliant blue R-250 and (B) chitinase activity detected on agar replica of polyacrylamide gel.
Lane 1: partially purified chitinase C isolated from culture supernatant of B. circuluns WL-12 by means of isoelectric focusing (6 pg); lanes 2, 3,
4 and 5 are periplasmic proteins of E. coli harboring pALCl1, pALC221 (a derivative of pALC220 carrying exclusively the 2.8 kb Hind111
fragment), pALC220 and DM25 (a deletion derivative of pALCll), respectively, (50 ,ug of each except lane 3 which is 100 pg). M.W. indicates
molecular size marker. Bovine serum albumin (M,, 68,000); ovalbumin (Mr, 45,000); carbonic anhydrase (A4,, 32,000). Arrow indicates the
position of chitinase C.

(Fig. 3). On the other hand, the periplasmic protein of upper-band chitinase (55 kDa) from periplasmic proteins
E. coli harboring pALC220 which contained a fragment of E. coli harboring pALC220 were identical and coincid-
common to pALCl1 also showed two chitinase bands ed with the deduced amino acid sequence from Ile-33 to
with the same molecular masses, i.e., 55 kDa and Tyr-51 (Fig. 2 and Table 1). E. coli harboring the plas-
40 kDa, on SDS-PAGE, although the ratio of their mid which contained the PvuII-Hind111 fragment from
amounts is markedly different. The N-terminal amino pALCl1 (Figs. 1 and 2) also produced both 55 and
acid sequences of lower-band chitinase (40 kDa) from 40 kDa chitinases (data not shown), and DM25, a dele-
periplasmic proteins of E. coli harboring pALCl1 and tion derivative of pALC11 which lacks the region cor-
responding to the C-terminal part of the deduced poly-
Method: N-J peptide, produced only 40 kDa chitinase (Figs. 1 and 3).
These observations indicate that the 55 kDa chitinase
is the initial product of the chic gene and 40 kDa
chitinase is generated from 55 kDa chitinase by cleavage
of its C-terminal portion.
The N-terminal amino acid sequence of chitinase C
from B. circulans WL-12 and those of the chitinases
from E. coli matched perfectly with the deduced amino
acid sequences from Asp-42 and from Ile-33, respective-
ly, as described above. In addition, as shown in Table 1,
the isoelectric point of chitinase C is nearly the same
as that of 40 kDa chitinase and the sizes of the two
chitinases are comparable. The above observations have
led us to conclude that chitinase C detected in the cul-
ture supernatant of B. circulans WL-12 is the product of
KTXh_KL”LA the chic gene and is almost identical to 40 kDa chitinase
detected in E. coli carrying the cloned chic gene. The
FIG. 4. Phylogenic tree of the proteins sharing significant se-
signal peptide cleavage site in E. coli was 9 amino acid
quence homologies with the putative catalytic domain of chitinase Cl.
The enzymes and proteins shown here are as follows (data base
residues proximal to the N-terminus of the deduced poly-
accession numbers in parentheses): CHIC_BACCI, B. circuluns Chic; peptide as compared with that in B. circulans WL-12.
CHIl_BACCI, B. circuluns ChiAl (P20533); CHIB_SERMA, S. As mentioned above, pALC1102 and pALC220 share
marcescens ChiB (P11797); CHIl_APHAL, A. album Chil (P32470); a common fragment; however, marked difference was
TRRENDOCHI, Z’. harziunum Chi (L14614); CHIA_ALTSO, observed when produced chitinases were analyzed
Alteromonas sp. strain O-7 Chi85 (P32823); ACU09139, Aeromonus (Fig. 3). The amount of 40 kDa chitinase was markedly
cuvie Chi (U09139); CHIA_SERMA, S. murcescens ChiA (P07254); higher than that of 55 kDa chitinase in the periplasmic
JLUO7025, Junthinobacterium lividum (UO7025); STMCH140, protein of E. coli harboring pALCl1 (a derivative of
S. thermoviolaceus Chi40 (D14536); CHIT_STRPL, S. plicutus
pALC1102), while 55 kDa chitinase was dominant in the
Chi63 (P11220); CHIT_STRLI, S. lividuns Chic (P36909); CHIT_
BRUMA, Brugiu muluyi Chi (P29030); CHIT-MANSE, Munduca case of E. coli harboring pALC220. On the other hand,
sextu Chi (P36362); GP39_HUMAN, glycoprotein from rheumatoid when a 2.8 kb fragment containing the chic gene was
arthritis patient GP-39 (P36222); mouse protein, mouse macrophages isolated from pALC220, subcloned into pUC119
secretory protein; KTXA_KLULA, Kluyveromyces lactis toxin (pALC221) and expressed in E. coli, the ratios of
(u-chain (PO9805). Chi indicates chitinase. produced chitinases were indistinguishable from that of
VOL. 80, 1995 chic GENE OF B. CIRCULANS WL-12 459

Chitinase Al
41

Chitinase D
485

Cafalytrc domains of chitinase Al and Cl Ctutin bindmg domain

II’
_t Flbronectin type Ill-like domarn Catalytic domain of chitinase D

cl- C termmal domain of chitinase Cl

FIG. 5. Domain organization of chitinase Al, Cl and D of B. circulans WL-12 based on analysis of the amino acid sequences deduced from
the nucleotide sequences of their corresponding genes. Dotted lines indicate the domains sharing strong sequence homology. Numerals indicate
number of amino acid residues counting from the N-terminal amino acid residue of deduced amino acid sequence.

chitinases in the periplasmic protein of E. coli harboring
pALC11 (Fig. 3). It means that proteolytic cleavage of
55 kDa chitinase was markedly reduced in the presence
of additional fragments of pALC220. We therefore sug-
gest that the extra fragments in pALC220 play some role
inhibiting the proteolytic cleavage of 55 kDa chitinase,
although further experiments are required to verify this
assumption.
The 55 kDa chitinase, which is an initial product of
the chic gene which has not yet been identified in the
culture supernatant of B. circulans WL-12, will be desig-
nated as chitinase Cl hereafter.
Comparison of deduced amino acid sequence of chic
gene with those of other proteins The deduced
amino acid sequence of chitinase Cl was compared with
those of other chitinases and related proteins, and also
with data from the SWISS-PROT protein data bank.
Chitinase Cl showed amino acid sequence homology
with all members of bacterial Group A chitinases (22).
Apparent amino acid sequence similarity was also ob-
served with some fungal chitinases (23, 24), an insect
chitinase (4), a nematode chitinase (25) and also with
glycoprotein from rheumatoid arthritis patients termed
gp-39 (26). The strongest homology was found with
chitinase Al of B. circulans (46.8% amino acid identity)
and the region exhibiting homology with the N-terminal
portion of chitinase Cl corresponded to the catalytic
domain of this enzyme (21). Therefore, the N-terminal
portion of chitinase Cl (amino acid residues 42 to 384)
exhibiting the homology with other chitinases and relat-
ed proteins appeared to be the catalytic domain of this
enzyme. The C-terminal portion of chitinase Cl showed
no meaningful similarity with any other proteins in the
protein data bank. The N-terminal amino acid sequences
and the sizes of the proteins suggested that chitinase C
found in the culture supernatant of B. circulans and
40 kDa chitinase found in the periplasmic protein of E.
coli correspond to the catalytic domain of chitinase Cl
generated by cleavage of its C-terminal portion.
The catalytic domain and the putative catalytic
domains which showed homology with the N-terminal
portion of chitinase Cl were extracted from the proteins
mentioned above and the amino acid sequences were
aligned. Based on the alignment, phylogenic trees are
constructed by two different methods N-J (neighbor join-
ing) and UPGMA (unweighed pair group method with
arithmetic mean) in order to visualize relation of these
proteins in terms of sequence homology. Topology of
trees constructed by the two methods is very similar and
the tree constructed by the N-J method is shown in Fig.
4. Chitinase Cl is most closely related with chitinase Al,
followed by Serratia marcescens chitinase B (27). Anal-
ysis of phylogenic tree led us to propose that duplication
occurred at the beginning of the evolution of this class
of chitinases and resulted in two groups: one consists of
animal chitinases and chitinase-like proteins, and the
other consists of group A bacterial chitinases including
chitinase Cl and some fungal chitinases. In the latter,
Streptomyces chitinases formed a small cluster separately
from other bacterial chitinases indicating their close
relationship. A most interesting observation is that the
two fungal chitinases from Trichoderma harzianum (23)
and Aphanocladium album (24) exhibited monophylogen-
ic group with bacterial chitinases. In comparison with
animal chitinases and chitinase-like proteins and observ-
ing the divergence among bacterial chitinases, these fun-
gal chitinases seem to be closely related to these bacterial
chitinases. This may be the consequence of horizontal
gene transfer of chitinase that occurred between fungi
and bacteria.
DISCUSSION
By analyzing the periplasmic protein of E. coli harbor-
ing the chic gene-containing plasmid (pALCll), it was
concluded that the chic gene encodes chitinase Cl
(55 kDa). Forty kDa chitinase was suggested to be
generated by a proteolytic cleavage of the C-terminal por-
tion of chitinase Cl. This cleaved 40 kDa chitinase was
observed in culture supernatant of B. circulans WL-12 as
chitinase C. However, 55 kDa chitinase has not been
identified in the culture supernatant of B. circulans WL-
12, maybe due to the rapid conversion of this chitinase
to chitinase C. Presence of a chitinase (chitinase D) with
460 ALAM ET AL. J. FERMENT. BIOENG.,

size similar to that of chitinase Cl might also interfere chitinases and chitinase-like proteins formed a mono-
with the identification of this (chitinase Cl) chitinase. phylogenic group separately from bacterial and fun-
Amino acid sequence comparison with chitinase Al of gal chitinases in the phylogenic tree, as we expected
B. circulans WL-12 leads us to presume that the N-termi- (Fig. 4). Clustering of Streptomyces chitinases is also
nal region of chitinase Cl (55 kDa chitinase) is the cata- somewhat expected. The close relationship of fungal
lytic domain of this enzyme, since this region is apparent- chitinases with certain members of group A bacterial
ly homologous with the catalytic domain of chitinase chitinases is in agreement with the reports of Blaiseau
Al. Asp-200, Asp-202 and Glu-204 of chitinase Al, and Lafay (24) and Hayes et al. (23). The present study
which were previously shown to be the residues directly of phylogenic trees leads us to suspect that horizontal
involved in the catalytic event of this enzyme (22, 28) gene transfer of these chitinases occurs between fungi
corresponded to Asp-150, Asp-152 and Glu-154 of and bacteria. It is very difficult to prove horizontal gene
chitinase Cl (Fig. 2). There are many examples of transfer in general but there are many examples which
chitinases and cellulases in which the catalytic domain is are suspected to be horizontal gene transfers between
followed by a (putative) binding domain or vice versa. prokaryotes and eukaryotes (30-32). Fibronectin type III
In the case of chitinase Al of this bacterium, the catalyt- domains found in prokaryotic enzymes including
ic domain was followed by two type III domains which chitinase Al and D of this bacterium are one of the
have shown to be related to fibronectin type III domains most convincing examples of horizontal gene transfer
of higher eukaryotes, and a chitin binding domain (14, from eukaryotes to prokaryotes (33, 34). Unlike other
21, 29). However, the C-terminal domain of chitinase Cl fungal chitinases sequenced so far, the two fungal
does not seem to be the chitin binding domain, since chitinases mentioned above are produced extracellularly
chitinase Cl did not show any apparent binding activity and do not share sequence homology with other fungal
in the preliminary experiments, and significant sequence chitinases except for the short conserved regions which
homology with any other chitin binding domain was not are suggested to be important for catalytic activity (22,
found. We do not have any data to determine the role 28). These findings may be consistent with our assump-
of the C-terminal domain of this enzyme at present. tion. At least one of the two fungal chitinases is report-
However, a comparative study between 55 kDa chitinase ed to be an endochitinase while bacterial chitinases
and 40 kDa chitinase (termed chitinase C) may help in shown here are thought to be exochitinases which pro-
understanding the precise role of the C-terminal domain, duce (GlcNAc)? predominantly. Comparison of proper-
and this is now under way. ties between closely related bacterial and fungal chitinases
Three out of four predicted chitinase genes of B. circu- in detail seems to be an extremely interesting topic for
lans WL-12 (5) have been cloned and sequenced by now. future study.
Domain organization of the chitinases (chitinase Al, Cl
and D) of B. circulans WL-12 based on the analysis of REFERENCES
the amino acid sequences deduced from the nucleotide
1. Boller, T.: Cellular and molecular biology of plant stress,
sequences of their corresponding genes is summarized in p. 247-262. In Key, J. L. and Kosuge, T. (ed.), A. R. Liss
Fig. 5. The chitin binding domain of chitinase Al shows Inc., New York (1995).
61.7% amino acid homology with that of chitinase D, 2. Bartnicki-Garcia, S.: Role of vesicles in apical growth and a
and two type III domains of chitinase Al show 62.8% new mathematical model of hyphal morphogenesis, p. 211-232.
and 60.6% amino acid homology with that of chitinase In Heath, I. B. (ed.), Tip growth in plant and fungal cells.
D, while the catalytic domains of these two chitinases Academic Press, New York (1990).
show only weak sequence homology (21). In contrast, 3. Kuranda, M. J. and Robbios, P. W.: Chitinase is required for
the catalytic domains of chitinases Al and Cl are highly cell separation during growth of Succharomyces cerevisiue. J.
Biol. Chem., 266, 19758-19767 (1991).
homologous (46.8% amino acid homology) while the
4. Kramer, K. J., Corpus, L., Choi, H. K., and Muthukrishnan,
remaining regions of the two chitinases do not show any S.: Sequence of a cDNA and expression of the gene encoding
significant sequence homology. These results suggest that epidermal and gut chitinases of Manduca sex&. Insect.
the three chitinases sequenced so far represent two types Biochem. Molec. Biol., 23, 691-701 (1993).
of catalytic domains which probably diverged early in 5. Watanabe, T., Oyanagi, W., Suzuki, K., and Tanaka, H.:
the evolution of chitinases, and domain shuffling oc- Chitinase system of Bacillus circufuns WL-12 and importance
curred relatively recently giving rise to these three of chitinase Al in chitin degradation. J. Bacterial., 172, 4017-
chitinases. It is likely that alterations in the amino acid 4022 (1990).
sequence within the domains or domain shuffling has 6. Jones, J. D. G., Grady, K. L., Suslow, T.V., and Bedrook,
J. R.: Isolation and characterization of genes encoding two
resulted in the unique properties of individual chitinases
chitinase enzymes from Serrutia marcescens. EMBO, 5, 467-
in the chitinase system. Studies are underway regarding 473 (1986).
these unique properties which will help in understanding 7. Robbins, P. W., Albright, C., Beufield, B., and Pero, J.: Clon-
the individual roles of multiple chitinases in the overall ing and high-level expression of chitinase-encoding gene of
degradation of chitinous materials. Streptomyces plicatus. Gene, 111, 69-76 (1992).
Strong sequence homology of fungal chitinases, an in- 8. Romaguera, A., Menge, U., Breves, R., and Diekmann, H.:
sect chitinase, a nematode chitinase and mammalian pro- Chitinases of Streptomyces okvaceoviridis and significance of
teins with unknown functions with certain members of processing for multiplicity. J. Bacterial., 174, 3450-3454
bacterial chitinases has been described (4, 23-26). Those (1992).
9. Yanai, K., Takaya, N., Kojima, N., Horiuchi, H., Ohata, A.,
bacterial chitinases were previously classified into group
and Takagi, M.: Purification of two chitinases from Rhizopus
A based on the strong sequence homology among their oligosporus and isolation and sequencing of the encoding
(putative) catalytic domains (22). Since chitinase Cl genes. J. Bacterial., 174, 7398-7406 (1992).
appears to be a new member of this group, we attempted 10. Yamada, H. and Imoto, T.: A convenient synthesis of glycol
to compare proteins sharing apparent homology with chitin, a substrate of lysozyme. Carbohydr. Res., 92, 160-162
the putative catalytic domain of chitinase Cl. Animal (1981).
VOL. 80, 1995
11. Jeuniaux, C.: Chitinases. Methods Enzymol., 8, 644-650
(1966).
12. Tanaka, H. and Phaff, H. J.: Enzymatic hydrolysis of yeast
cell walls. J. Bacterial., 89, 1570-1580 (1965).
13. Sambrook, J., Fritsch, E. F., and Maniatis, T.: Molecular clon-
ing: a laboratory manual, 2nd ed. Cold Spring Harbor Labora-
tory, Cold Spring Harbor, N.Y. (1989).
14. Watanabe, T., Suzuki, K., Oyaoagi, W., Ohnishi, K., and
Tanaka, H.: Gene cloning of chitinase Al from Bacillus circu-
lans WL-12 revealed its evolutionary relationship to Serratiu
chitinase and to the type III homology units of fibronectin. J.
Biol. Chem., 265, 15659-15665 (1990).
15. Sanger, F., Nicklen, S., and Coulson, A. R.: DNA sequencing
with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA,
73, 5463-5467 (1977)-
16. Manoil, C. and Beckwith, J.: A genetic approach to analyzing
membrane nrotein tonology. Science, 233. 1403-1408 (1986).
17. Laemmli, U.K.: Cleavage of structural proteins during the
assembly of the head of bacteriophage T4. Nature (London),
227, 680-685 (1970).
18. Imoto, T. and Yagishita, K.: A simple activity measurement of
lysozyme. Agric. Biol. Chem., 35, 1154-1156 (1971).
19. Lowrv. 0. H.. Rosebrough. N. J., Farr. A. L.. and Randall,
R. J.:” Protein’measurem&t with the folin phenol reagent. J.
Biol. Chem., 193, 265-275 (1951).
20. Matsudaira, P.: Sequence from picomole quantities of proteins
electroblotted onto polyvinylidene difluoride membranes. J.
Biol. Chem., 262, 10035-10038 (1987).
21. Watanabe, T., Oyanagi, W., Suzuki, K., Ohnishi, K., and
Tanaka, H.: Structure of the gene encoding chitinase of Bacfl-
lus circulans WL-12 and possible homology of the enzyme to
other prokaryotic chitinases and class III plant chitinases. J.
Bacterial., 174, 408-414 (1992).
22. Watanabe, T., Kobori, K., Miyashita, K., Fujii, T., and
Tanaka, H.: Identification of glutamic acid 204 and aspartic
acid 200 in chitinase Al of Bacillus circulans WL-12 as essential
residues for chitinase activity. J. Biol. Chem., 268, 18567-
18572 (1993).
23. Hayes, C. K., Klemsdal, S., Lorito, M., Pietro, A. D., Peter-
bauer, C., Nakas, J. P., Tronsmo, A., and Harman, G. E.:
chic GENE OF B. CIRCULANS WL-12 461
Isolation and sequence of an endochitinase-encoding gene from
a cDNA library of Trichoderma harzianum. Gene, 138, 143-
148 (1994).
24. Blaiseau, P.L. and Lafay, J-F.: Primary structure of a
chitinase-encoding gene (chil) from the filamentous fungus
Aphanocladium album: similarity to bacterial chitinases. Gene,
120, 243-248 (1992).
25. Fuhrman, J. A., Lane, W. S., Smith, F. F., Piessens, W. F.,
and Perler, F. B.: Transmission-blocking antibodies recognize
microfilarial chitinase in brugian lymphatic filariasis. Proc.
Natl. Acad. Sci. USA, 89, 1548-1552 (1992).
26. Hakala, B. E., White, C., and Reclies, A. D.: Human cartilage
gp-39, a major secretory product of articular chondrocytes and
synovial cells, is a mammalian member of a chitinase protein
family. J. Biol. Chem., 268, 25803-25810 (1993).
27. Harpster, M. H. and Dunsmuir, P.: Nucleotide sequence of the
chitinase B gene of Serratia marcescens QMB1466. Nucleic
Acids Res., 17, 5395 (1989).
28. Watanabe, T., Uchida, M., Kobori, K., and Tanaka, H.: Site-
directed mutagenesis of the Asp-197 and Asp-202 residues in
chitinase Al of Bacillus circulans WL-12. Biosci. Biotech.
Biochem., 58, 2283-2285 (1994).
29. Watanabe, T., Ito, Y., Yamada, T., Hashimoto, M., Sekine,
S., and Tanaka, H.: The roles of the C-terminal domain and
type III domains of chitinase Al from Bacillus circulans WL-
12 in chitin degradation. J. Bacterial., 176, 44654472 (1994).
30. Carlson, T. A. and Chelm, B. K.: Apparent eukaryotic origin
of glutamine synthetase II from the bacterium Bradyrhizobium
japonicum. Nature (London), 322, 568-570 (1986).
31. Doolittle, R. F., Feng, D. F., Anderson, K. L., and Alberro,
M. R.: A naturally occurring horizontal gene transfer from a
eukaryote to a prokaryote. J. Mol. Evol., 31, 383-388 (1990).
32. Iwaasa, H., Takagi, T., and Shikama, K.: Protozoan my-
oglobin from Paramecium caudatum. Its unusual amino acid
sequence. J. Mol. Biol., 208, 355-358 (1989).
33. Bork, P. and Doolittle, R. F.: Proposed acquisition of an
animal protein domain by bacteria. Proc. Natl. Acad. Sci.
USA, 89, 8990-8994 (1992).
34. Doolittle, R. F. and Bork, P.: Evolutionarily mobile modules
in proteins. Sci. Amer., October, 34440 (1993).