Vous êtes sur la page 1sur 45
Biochimie et Biologie moléculaire Chapitre 8 : Méthodes d’études Professeur Joël LUNARDI PCEM1 - Année
Biochimie et Biologie moléculaire Chapitre 8 : Méthodes d’études Professeur Joël LUNARDI PCEM1 - Année

Biochimie et Biologie moléculaire

Chapitre 8 :

Méthodes d’études

Professeur Joël LUNARDI

Chapitre 8 : Méthodes d’études Professeur Joël LUNARDI PCEM1 - Année universitaire 2007/2008 Faculté de
Chapitre 8 : Méthodes d’études Professeur Joël LUNARDI PCEM1 - Année universitaire 2007/2008 Faculté de

PCEM1 - Année universitaire 2007/2008 Faculté de Médecine de Grenoble (UJF) - Tous droits réservés.

Joël LUNARDI PCEM1 - Année universitaire 2007/2008 Faculté de Médecine de Grenoble (UJF) - T ous

Chapitre 8. Méthodes d’études

Chapitre 8. Méthodes d’études

I. Méthodes et outils généraux d’études moléculaires

II. Hybridation moléculaire

III. Clonage d’ADN

IV. Amplification de l’ADN

V. Séquençage de l’ADN

VI. Modifier le matériel génétique des cellules eucaryotes

VII. Méthodes d’étude de l’expression des gènes

VIII. Bioinformatique

I. Méthodes et outils généraux d’études moléculaires

I. Méthodes et outils généraux

1. Extraction et purification du matériel génétique

d’études moléculaires

- matériel présent dans les virus, les bactéries et les cellules

- ADN des cellules eucaryotes animales = ADN nucléaire + ADNmit

- source : sang, tissus (biopsies), cultures cellulaires…

- chez l’homme (2 x 3 10 9 ) x 660 / 6,02 10 23 6-7 10 -12 gramme /cellule

/ 6,02 10 2 3 ≈ 6-7 10 - 1 2 gramme /cellule 1 ml de

1 ml de sang 5-6 10 6 leucocytes soit 30 10 -6 g d’ADN

- ARN = ARNm, ARNt, ARNr, ARNsn, ARNsc…

- sensibilité aux RNAses

- spécificité tissulaire des ARNm (ADNc)

- quantification par mesure de l’absorption à 260 nm

Principales étapes de la purification des acides nucléiques

prélèvement biologique

lyse des cellules nuclées

dégradation des protéines

extraction des acides nucléiques

précipitation de l’ADN

-

-

lyse par détergents

traitement mécanique

- traitement par la protéinase K

- solvants organiques

- agents chaotropiques

- fixation par interaction de charges

- alcools

Principales étapes de la purification des acides nucléiques

2. Des outils enzymatiques pour étudier l ’ADN

2. Des outils enzymatiques pour étudier l ’ADN

l ’ADN 2. Des outils enzymatiques pour étudier l ’ADN (endonucléases, DNAses…) Colle (ligases) (polymérases,

(endonucléases, DNAses…)

pour étudier l ’ADN (endonucléases, DNAses…) Colle (ligases) (polymérases, kinases…) atgctaATC tgat
Colle
Colle

(ligases)

l ’ADN (endonucléases, DNAses…) Colle (ligases) (polymérases, kinases…) atgctaATC tgat (polymérases…)
l ’ADN (endonucléases, DNAses…) Colle (ligases) (polymérases, kinases…) atgctaATC tgat (polymérases…)
l ’ADN (endonucléases, DNAses…) Colle (ligases) (polymérases, kinases…) atgctaATC tgat (polymérases…)
l ’ADN (endonucléases, DNAses…) Colle (ligases) (polymérases, kinases…) atgctaATC tgat (polymérases…)

(polymérases, kinases…)

(endonucléases, DNAses…) Colle (ligases) (polymérases, kinases…) atgctaATC tgat (polymérases…) (polymérases…)

atgctaATC tgat

(polymérases…)

(polymérases…)

2.1. Couper

a. Enzymes de restriction

- séquences spécifiques de reconnaissance (4 à 8 bases, palindromes)

- origine bactérienne : Eco RI = Escherichia coli type R souche I

- coupures franches

5 ’---GTTAAC--- ---CAATTG---5 ’

- coupures cohésives

5 ’---GAATTC--- ---CTTAAG---5 ’

b. Endonucléases

Hpa I

5 ’---GAATTC--- ---CTTAAG---5 ’ b. Endonucléases Hpa I Eco RI 5 ’---GTT ---CAA AAC--- TTG---5 ’

Eco RI

---CTTAAG---5 ’ b. Endonucléases Hpa I Eco RI 5 ’---GTT ---CAA AAC--- TTG---5 ’ 5 ’

5 ’---GTT

---CAA

5 ’---GTT ---CAA AAC--- TTG---5 ’

AAC---

TTG---5 ’

5 ’ ---G AATTC--- ---CTTAA G---5 ’
5 ’ ---G
AATTC---
---CTTAA
G---5 ’

- DNAse I :

- nucléase S1:

- RNAse A (ARN), H (hybrides ARN/ADN)

- ADN double ou simple brin

- ADN simple brin

c. Exonucléases : 5’

A (ARN), H (hybrides ARN/ADN) - ADN double ou simple brin - ADN simple brin c.

3’

ou

3’

A (ARN), H (hybrides ARN/ADN) - ADN double ou simple brin - ADN simple brin c.

5’

2.2. Copier

activité des polymérases : 5 ’2.2. Copier 3 ’ ADN polymérases : - produit : ADN - matrice : ADN simple

2.2. Copier activité des polymérases : 5 ’ 3 ’ ADN polymérases : - produit :

3 ’

ADN polymérases :2.2. Copier activité des polymérases : 5 ’ 3 ’ - produit : ADN - matrice

- produit : ADN

- matrice : ADN simple brin + amorce ARN ou ADN

- activité 3 ’-5 ’ et 5 ’-3 ’ exonucléases : + / -

- polymérases modifiées, thermostables (PCR)

ARN polymérases :: + / - - polymérases modifiées, thermostables (PCR) - produit : ARN - matrice :

- produit : ARN

- matrice : ADN simple brin

ADN polymérase ARN dépendante (réverse transcriptase) :(PCR) ARN polymérases : - produit : ARN - matrice : ADN simple brin - produit

- produit : ADN

- matrice : ARN + amorce

2.3. Coller

2.3. Coller Les ligases catalysent la formation d’une liaison phosphodiester entre un 5’ phosphate et un

Les ligases catalysent la formation d’une liaison phosphodiester entre un 5’ phosphate et un 3’-OH de 2 brins adjacents

entre un 5’ phosphate et un 3’-OH de 2 brins adjacents 5 ’ ---AGGTCG - OH

5 ’ ---AGGTCG-OH ---TCCAGC-Pi

Pi- CGTCCA-- OH-GCAGGT--5 ’

- OH ---TCCAGC - Pi Pi- CGTCCA-- OH- GCAGGT--5 ’ ligase + ATP 5 ’ ---AGGTCGCGTCCA--

ligase + ATP

5 ’ ---AGGTCGCGTCCA-- ---TCCAGCGCAGGT--5 ’

2.4. Marquer

groupes marqueurs : isotopes ( 3 2 P, 3 3 P, 3 5 S), fluorophores, biotinylation 32 P, 33 P, 35 S), fluorophores, biotinylation

marquage aux extrémités2 P, 3 3 P, 3 5 S), fluorophores, biotinylation - extrémité 3 ’-OH : terminal

- extrémité 3 ’-OH : terminal transférase

- extrémité 5 ’- Pi : ATP-γ 32 P & T4-kinase

5 ’ Pi-GATC-------------------CAGTCA CTAG-------------------GTCAGT-Pi 5 ’

Adénosine-Pi-Pi-Pi*

(ATP)

Pi 5 ’ Adénosine-Pi-Pi- Pi* (ATP) Pi* -Pi-Pi-Adénosine kinase kinase marquage interne par

Pi*-Pi-Pi-Adénosine

kinase

’ Adénosine-Pi-Pi- Pi* (ATP) Pi* -Pi-Pi-Adénosine kinase kinase marquage interne par amorçage aléatoire (random

kinase

marquage interne par amorçage aléatoire (random priming)Pi* (ATP) Pi* -Pi-Pi-Adénosine kinase kinase + amorces 5 ’ + ADN pol + dNTP 5

+ amorces

5 ’

marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
+ ADN pol + dNTP
+ ADN pol
+ dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP

5 ’

5

marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP

5’

5

marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP
marquage interne par amorçage aléatoire (random priming) + amorces 5 ’ + ADN pol + dNTP

5’

3. Séparation de fragments d’ADN

3.1. Électrophorèse sur gel (agarose, acrylamide…)

3. Séparation de fragments d’ADN

- - témoins témoins dépot ADN (-) + + cathode (-) anode (+) tablette de
- -
témoins
témoins
dépot
ADN (-)
+ +
cathode (-)
anode (+)
tablette de gel
ADN (-) + + cathode (-) anode (+) tablette de gel Électrophorèse en champ pulsé taille

Électrophorèse en champ pulsé

taille en pb (échelle logarithmique) (400 pb) 400 (300 pb) 300 200 (200 pb) taille
taille en pb (échelle logarithmique)
(400 pb)
400
(300 pb)
300
200
(200 pb)
taille
(100 pb)
distance de migration

(mm)

visualisation de l ’ADN - utilisation de molécules fluorescentes UV bromure d ’éthidium (molécule intercalante

visualisation de l ’ADN

- utilisation de molécules fluorescentes

de l ’ADN - utilisation de molécules fluorescentes UV bromure d ’éthidium (molécule intercalante
de l ’ADN - utilisation de molécules fluorescentes UV bromure d ’éthidium (molécule intercalante
de l ’ADN - utilisation de molécules fluorescentes UV bromure d ’éthidium (molécule intercalante

UV

de l ’ADN - utilisation de molécules fluorescentes UV bromure d ’éthidium (molécule intercalante fluorescente)

bromure d ’éthidium

(molécule intercalante fluorescente)

fluorescentes UV bromure d ’éthidium (molécule intercalante fluorescente) - coloration chimiques - autoradiographie

- coloration chimiques

- autoradiographie

3.2.

Electrophorèse capillaire

3.3. Chromatographie liquide haute pression (HPLC)

Chromatographie liquide-solide en phase réverse utilisant une forte pression (cf cours protéines ) e réverse utilisant une forte pression (cf cours protéines )

DHPLC : HPLC en conditions dénaturantespression (HPLC) Chromatographie liquide-solide en phas e réverse utilisant une forte pression (cf cours protéines )

II. Hybridation moléculaire

1. sondes moléculaires et hybridation

II. Hybridation moléculaire

- sonde : séquence d ’ADN complémentaire de la séquence cible

- hybridation : association de 2 séquences d ’acides nucléiques sous

forme simple brin sur la base de leur complémentarité

5’ caggtagggatactgaactgacatgg gtccatccctatgacttgactgtacc 5

5’ caggtagtcatctgattactgacatgg gtccatcagtagataatgactgtacc 5

5’ caggtagggatactgaactgacatgg gtccatccctatgacttgactgtacc 5

gtccatccctatgacttgactgtacc 5 ’ 95 ° C 5’ caggtag tcatctgatt actgacatgg

95°C

5’ caggtagtcatctgattactgacatgg

gtccatccctatgacttgactgtacc 5

5’ caggtagggatactgaactgacatgg

5’ tcatctgatt-

5’ tcatctgatt- tcatctgatt-

5’ tcatctgatt-

5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’

5’ tcatctgatt-

5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt-
5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt-

5’ tcatctgatt-

5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt-

5’ tcatctgatt- tcatctgatt-

5’ tcatctgatt-

5’ tcatctgatt- 5’ tcatctgatt- 5’ tcatctgatt- gtccatccctatgacttgactgtacc 5 ’ gtccatc agtagataa

gtccatccctatgacttgactgtacc 5

gtccatccctatgacttgactgtacc 5 ’
gtccatccctatgacttgactgtacc 5 ’
gtccatccctatgacttgactgtacc 5 ’

gtccatcagtagataatgactgtacc 5’

5 ’ gtccatc agtagataa tgactgtacc 5’ 5’ tcatctgatt- gtccatc agtagataa tgactgtacc 5’ 5’

5’ tcatctgatt- gtccatcagtagataatgactgtacc 5’

5’ caggtagggatactgaactgacatgg

gtccatccctatgacttgactgtacc 5’

5’ tcatctgatt- gtccatc agtagataa tgactgtacc 5’ 5’ caggtagggatactgaactgacatgg gtccatccctatgacttgactgtacc 5’

- Types de sondes

- sonde génomique : fragment obtenu par coupure de l’ADN génomique

- sonde ADNc : sonde ADN obtenue par transcription réverse d ’un ARNm messager (= séquence codante)

- sonde oligonucléotides : ADN (ou ARN) simple brin de 18 à 50 nucléotides synthétisé chimiquement

- Obtention d’un ADNc

- Obtention d’un ADNc
- Obtention d’un ADNc

2. Hybridation sur support : Southern blot (ADN), northern blot (ARN)

?
?

III. Le clonage

III. Le clonage obtenir une population de bactéries, de cellules ou d’organismes qui contiendront le même

obtenir une population de bactéries, de cellules ou d’organismes qui

contiendront le même matériel génétique

III. Le clonage

population homogène de cellules identiques (population clonale) entiques (population clonale)

organisme vivant identique à un organisme d’originele même matériel génétique III. Le clonage population homogène de cellules id entiques (population clonale)

clonage pour amplifier et conserver une séquence d’ADN 1. préparation de l’ insert à cloner

clonage pour amplifier et conserver une séquence d’ADN

1. préparation de l’insert à cloner et du vecteur

III. Le clonage

2. intégration-ligation de l ’insert dans le vecteur

3. transformation de l ’hôte par le vecteur recombiné

4. sélection des hôtes recombinants

gène de sélection (lac Z)

des hôtes recombinants gène de sélection (lac Z) 1. Vecteurs les plasmides site de clonage multiple

1. Vecteurs

hôtes recombinants gène de sélection (lac Z) 1. Vecteurs les plasmides site de clonage multiple gène

les plasmides

site de clonage multiple

gène de résistance à un antibiotique

origine de réplication

cosmides, phages, yac et bac, vecteurs viraux…

2. Intégration, transformation et sélection d’un vecteur recombinant

2. Intégration, transformation et sélection d’un vecteur recombinant

transformation et sélection d’un vecteur recombinant plasmide recombinant chimère contenant l’insert d’ADN
plasmide recombinant chimère contenant l’insert d’ADN
plasmide recombinant chimère
contenant l’insert d’ADN

2.1. Intégration

coupure du vecteur et de l’ADN à intégrer avec le même enzyme de restriction

l’ADN à intégrer avec le même enzyme de restriction ligation des extrémités libres du vecteur et

ligation des extrémités libres du vecteur et de l’insert

plasmide natif
plasmide natif

recircularisé

2.2. Transformation et sélection des bactéries hôtes

les plasmides sont introduits dans les bactéries : la transformation

chromosome

chromosome

bactérie avec plasmide natif recircularisé

insert chromosome bactérie avec plasmide recombinant
insert
chromosome
bactérie avec plasmide recombinant

les bactéries ayant intégré un plasmide sont sélectionnées grâce aux 2 gènes de sélection présents dans le vecteur (ex choisi : gène de résistance à l’ampicilline et gène permettant l’expression de la β-galactosidase)

colonie bleue: vecteur seul

colonie blanche: vecteur recombiné

milieu nutritif + ampicilline + Xgal

β -galactosidase) colonie bleue: vecteur seul coloni e blanche: vecteur recombiné milieu nutritif + ampicilline +

3. Les « banques » d ’ADN

banque génomique

- obtenue en intégrant des fragments d ’ADN génomique dans des vecteurs.

3. Les « banques » d ’ADN

- représente tout le matériel génétique

» d ’ADN - représente tout le matériel génétique banque ADNc : - obtenue en intégrant

banque ADNc :

- obtenue en intégrant des fragments d ’ADNc dans des vecteurs

- ne représente que l ’ADN exprimé dans les cellules à partie desquelles l ’ARNm a été extrait

IV. Amplifier l’ADN 1. Amplification par clonage IV. Amplifier l’ADN

IV. Amplifier l’ADN

1. Amplification par clonage

IV. Amplifier l’ADN

2. Amplification PCR : polymerase chain reaction

(amplification enzymatique en chaîne par ADN polymérase thermostable)

2. Amplification PCR : polymerase chain reaction

oligonucléotides « amorces »

ADN à amplifier Taq polymérase

dNTP

« amorces » ADN à amplifier Taq polymérase dNTP 94°C 56°C 72°C dénaturation amorçage extension n
« amorces » ADN à amplifier Taq polymérase dNTP 94°C 56°C 72°C dénaturation amorçage extension n
94°C 56°C
94°C
56°C
» ADN à amplifier Taq polymérase dNTP 94°C 56°C 72°C dénaturation amorçage extension n cycles facteur
72°C
72°C
dénaturation amorçage extension n cycles
dénaturation
amorçage
extension
n cycles

facteur d’amplification : 2 n

5’ --agttacttaatgctgatcgtacgtcgatcg-----gatcgatcgtcgatcgatcgtagctgct--

2. Amplification PCR :

--tcaatgaattacgactagcatgcagctagc-----ctagctagcagctagctagcatcgacga-- 5 ’

agcatgcagctagc-----ctagctagcag ctagctagcatcgacga-- 5 ’ polymerase chain reaction 94 ° 5’ 5’ --agttacttaatgctga

polymerase chain reaction

94°

ctagctagcatcgacga-- 5 ’ polymerase chain reaction 94 ° 5’ 5’ --agttacttaatgctga tcgtacgtcgatcg-----gatcgatcgtc
ctagctagcatcgacga-- 5 ’ polymerase chain reaction 94 ° 5’ 5’ --agttacttaatgctga tcgtacgtcgatcg-----gatcgatcgtc

5’ 5’ --agttacttaatgctgatcgtacgtcgatcg-----gatcgatcgtcgatcgatcgtagctgct-- --agttacttaatgctgatcgtacgtcgatcg-----gatcgatcgtcgatcgatcgtagctgct--

tcgtacgtcgatcg-----gatcgatcgtc gatcgatcgtagctgct-- ctagctagcagctagctagcatcgacga-- 5 ’ ctagctagcatcgacga-- 5

ctagctagcagctagctagcatcgacga-- 5 ’

ctagctagcatcgacga-- 5 ’

5 ’ ctagctagcatcgacga-- 5 ’ 5’ --agttacttaatgctgatcgtacgtcgatcg 5’

5’ --agttacttaatgctgatcgtacgtcgatcg

5’ --agttacttaatgctga

--agttacttaatgctgatcgtacgtcgatcg 5’ --agttacttaatgctga --tcaatgaattacgact agcatgcagctagc-----ctagctagcag

--tcaatgaattacgactagcatgcagctagc-----ctagctagcagctagctagcatcgacga-- --tcaatgaattacgactagcatgcagctagc-----ctagctagcagctagctagcatcgacga-- 5 5 ’ ’

ctagctagcatcgacga-- 5 5 ’ ’ 5’ -- agttacttaatgctga tcgtacgtcgatcg-----gatcgatcgtc

5’ --agttacttaatgctgatcgtacgtcgatcg-----gatcgatcgtcgatcgatcgtagctgct-- --tcaatgaattacgactagcatgcagctagc-----ctagctagcagctagctagcatcgacga-- 5 ’

5’ --agttacttaatgctgatcgtacgtcgatcg-----gatcgatcgtcgatcgatcgtagctgct-- --tcaatgaattacgactagcatgcagctagc-----ctagctagcagctagctagcatcgacga-- 5 ’

quantification : détermination du nombre de copies cibles initialesx n cycles détermination de E (efficacité) A = A 0 x (1+E) n avec

: détermination du nombre de copies cibles initiales x n cycles détermination de E (efficacité) A

x n cycles

du nombre de copies cibles initiales x n cycles détermination de E (efficacité) A = A

détermination de E (efficacité)

A = A 0 x (1+E) n avec 0 < E < 1

A = A 0 x (1+E) n avec 0 < E < 1 - par PCR

- par PCR « temps réel » où l’amplification est mesurée à chaque cycle grâce à un marqueur fluorescent qui s ’incorpore dans le double brin formé

- par utilisation d’un standard interne

amplification à partir d’ARN : RT-PCRfluorescent qui s ’incorpore dans le double brin formé - par utilisation d’un standard interne ARNm

ARNm

RT

le double brin formé - par utilisation d’un standard interne amplification à partir d’ARN : RT-PCR

ADNc

PCR

le double brin formé - par utilisation d’un standard interne amplification à partir d’ARN : RT-PCR
+
+

Détection des remaniements du gène MLH1 impliqués dans le

cancer du colon par QMPSF (Quantitative Multiplex PCR of Short Fragments)

- extraction de l’ADN du patient et d’un témoin sain

- amplification PCR simultanée des exons 1 à 9 d’une part et 10 à 19 d’autre part avec marquage fluorescent des exons amplifiés par PCR

- séparation et comparaison entre patient ( --- ) et témoin ( --- ) des fragments amplifiés

exon 7 exon 5 exon 1 exon 2 exon 4 exon 8 exon 6 exon
exon 7
exon 5
exon 1
exon 2
exon 4
exon 8
exon 6
exon 13
exon 9
200 pb
250 pb
300 pb
taille des
fragments
amplifiés

MLH1

19 exons

250 pb 300 pb taille des fragments amplifiés MLH1 19 exons allèle normal allèle muté :
250 pb 300 pb taille des fragments amplifiés MLH1 19 exons allèle normal allèle muté :

allèle normal

allèle muté : délétion de l’exon 8

V. Séquencer l’ADN

V. Séquencer l’ADN

1. Méthode enzymatique (aux di-déoxynucléotides) de Sanger

- matrice ADN

- ADN polymérase

- dNTP & ddNTP (didéoxy-NTP)

di -déoxynucléotides) de Sanger - matrice ADN - ADN polymérase - dNTP & ddNTP (didéoxy-NTP) d

dATP

H
H

ddATP

5 5 5 5 5

séparation des 2 brins

séparation des 2 brins

séparation des 2 brins

séparation des 2 brins

séparation des 2 brins

s 2 brins séparation de s 2 brins séparation de s 2 brins ’

’ aatgctgatcgatgctatggctagctagctatcgatcgtatcgtatcgtagcatgatgcta

’ aatgctgatcgatgctatggctagctagctatcgatcgtatcgtatcgtagcatgatgcta

’ aatgctgatcgatgctatggctagctagctatcgatcgtatcgtatcgtagcatgatgcta

’ aatgctgatcgatgctatggctagctagctatcgatcgtatcgtatcgtagcatgatgcta

’ aatgctgatcgatgctatggctagctagctatcgatcgtatcgtatcgtagcatgatgcta

gcatagcatcgtactacgat 5 ’

agcatcgtactacgat 5 ’

tagcatcgtactacgat 5 ’

atagcatcgtactacgat 5 ’

catagcatcgtactacgat 5 ’

+ amorce

+

ADN polymérase

+

dATP + 1% ddATP dCTP + 1% ddCTP dGTP + 1% ddGTP dTTP + 1% ddTTP

dATP + 1% ddATP dCTP + 1% ddCTP dGTP + 1% ddGTP dTTP + 1% ddTTP
dATP + 1% ddATP dCTP + 1% ddCTP dGTP + 1% ddGTP dTTP + 1% ddTTP
dATP + 1% ddATP dCTP + 1% ddCTP dGTP + 1% ddGTP dTTP + 1% ddTTP
dATP + 1% ddATP dCTP + 1% ddCTP dGTP + 1% ddGTP dTTP + 1% ddTTP
+ 1% ddATP dCTP + 1% ddCTP dGTP + 1% ddGTP dTTP + 1% ddTTP Électrophorégramme

Électrophorégramme de séquence

tagcatcgtactacgat 5 ’ atagcatcgtactacgat 5 ’ catagcatcgtactacgat 5 ’ gcatagcatcgtactacgat 5 ’

c

a

t

a

g

c

a

t

5 ’

5 ’ c a t a g c a t 5 ’ séparation par électrophorèse des

séparation par électrophorèse des fragments générés lors de la réaction de séquençage

visualisation des fragments portant un ddNTP fluorescent

la réaction de séquençage visualisation des fragments portant un ddNTP fluorescent lumière détecteur de fluorescence

lumière

détecteur de

fluorescence

2.

Méthode chimique de Maxam et Gilbert

3. Séquençage par hybridation : puces de re-séquençage

4. Pyro-séquençage

VI. Modifier le matériel génétique des cellules eucaryotes

1. Mutagénèse

VI. Modifier le matériel génétique

des cellules eucaryotes

2. Transfert ex vivo et in vivo de matériel génétique

transfection, vecteurs de transfection , marqueurs de sélection (gènes de résistance aux antibiotiques, thymidine kinase, dihydrofolate réductase…)

injection transgène
injection
transgène

virus

biolistique

transformation

Modification des cellules germinales ou des cellules somatiques

des cellules germinales ou des cellules somatiques modification de toutes les cellules de l ’organisme
des cellules germinales ou des cellules somatiques modification de toutes les cellules de l ’organisme

modification de toutes les cellules de l ’organisme

modification d’une partie des cellules de l’organisme y compris au niveau des gonades (animal chimère)

modification d’une cellule ou d’un clone cellulaire

VII. Méthodes d’étude de l’expression des gènes

VII. Méthodes d’étude de

1. Analyse qualitative et quantitative des transcrits

l’expression des gènes

- taille du transcrit

- intermédiaires de maturation

- estimation semi-quantitative

northern blot :intermédiaires de maturation - estimation semi-quantitative RT-PCR : quantification 2. Analyse dynamique de la

RT-PCR : quantificationde maturation - estimation semi-quantitative northern blot : 2. Analyse dynamique de la transcription élongation in

2. Analyse dynamique de la transcription

élongation in vitro (après isolement des noyaux) et en présence d’ UTP 3 2 P de in vitro (après isolement des noyaux) et en présence d’UTP 32 P de la transcription initiée in vivo

- la quantité d’UTP incorporée =

(f) vitesse de transcription (f) ARN pol fonctionnelles

3. Analyse des éléments de régulation de la transcription

3. Analyse des éléments de régulation de la transcription

+
+

3.1. analyse de l’interaction entre facteurs protéiques trans et séquences ADN cis

facteurs de

transcription

séquence d’ADN

ADN cis facteurs de transcription séquence d’ADN retardement sur gel « foot-printing » zone
ADN cis facteurs de transcription séquence d’ADN retardement sur gel « foot-printing » zone
ADN cis facteurs de transcription séquence d’ADN retardement sur gel « foot-printing » zone
ADN cis facteurs de transcription séquence d’ADN retardement sur gel « foot-printing » zone
ADN cis facteurs de transcription séquence d’ADN retardement sur gel « foot-printing » zone
ADN cis facteurs de transcription séquence d’ADN retardement sur gel « foot-printing » zone
retardement sur gel « foot-printing »
retardement sur gel
« foot-printing »

zone d’interaction

sur gel « foot-printing » zone d’interaction traitement par la DNAse et électrophorèse analyse par
sur gel « foot-printing » zone d’interaction traitement par la DNAse et électrophorèse analyse par
sur gel « foot-printing » zone d’interaction traitement par la DNAse et électrophorèse analyse par

traitement par la DNAse et électrophorèse

d’interaction traitement par la DNAse et électrophorèse analyse par électrophorèse des complexes ADN/protéines
d’interaction traitement par la DNAse et électrophorèse analyse par électrophorèse des complexes ADN/protéines
d’interaction traitement par la DNAse et électrophorèse analyse par électrophorèse des complexes ADN/protéines

analyse par électrophorèse des complexes ADN/protéines

3.2. Caractérisation de séquences régulatrices

5’

gène d’intérêt

gène d’intérêt

gène d’intérêt
de séquences régulatrices 5’ gène d’intérêt promoteur séquences régu latrices ? 5’ fragments d

promoteur

séquences régulatrices 5’ gène d’intérêt promoteur séquences régu latrices ? 5’ fragments d ’ADN

séquences régulatrices ?

5’

d’intérêt promoteur séquences régu latrices ? 5’ fragments d ’ADN contenant des séquences régulatr ices
d’intérêt promoteur séquences régu latrices ? 5’ fragments d ’ADN contenant des séquences régulatr ices

fragments d ’ADN contenant des séquences régulatrices potentielles

insertion de ces séquences devant le promoteur d’un gène « reporter »

promoteur du gène reporter gène reporter dont l’activité est facilement mesurable

gène reporter d ont l’activité est facilement mesurable fragment d’ADN à tester intégration de la construction

fragment d’ADN à tester

est facilement mesurable fragment d’ADN à tester intégration de la construction dans un vecteur,
est facilement mesurable fragment d’ADN à tester intégration de la construction dans un vecteur,
est facilement mesurable fragment d’ADN à tester intégration de la construction dans un vecteur,
est facilement mesurable fragment d’ADN à tester intégration de la construction dans un vecteur,
est facilement mesurable fragment d’ADN à tester intégration de la construction dans un vecteur,

intégration de la construction dans un vecteur, transfection cellulaire et mesure de l’expression du gène « reporter » dans la cellule modifiée

expression du gène = (f) protéine = (f) ARNm ) = (f) rôle de la séquence testée

4. Méthodes d ’analyse globale post génomique

4. Méthodes d ’analyse globale

analyse du transcriptome

post génomique

’analyse globale analyse du transcriptome post génomique analyses simultanées du produit (ARN, protéine,

analyses simultanées du produit (ARN, protéine, activité) de l’expression d’une grande population de gènes

analyse du protéome

analyse du métabolome

4.1. Analyse du transcriptome

4.1. Analyse du transcriptome 4. Méthodes d ’analyse globale post génomique séquences d’ADN sonde - Préparation
4.1. Analyse du transcriptome 4. Méthodes d ’analyse globale post génomique séquences d’ADN sonde - Préparation

4. Méthodes d ’analyse globale post génomique

séquences d’ADN sonde

-

Préparation des ARNm

des cellules 1 et 2

- Marquage des ARN avec 2 fluorophores

des cellules 1 et 2 - Marquage des ARN avec 2 fluorophores échantillon 1 échantillon 2

échantillon 1

1 et 2 - Marquage des ARN avec 2 fluorophores échantillon 1 échantillon 2 dépôt des

échantillon 2

dépôt des sondes correspondant à des milliers de gènes différents

sondes correspondant à des milliers de gènes différents hybridation des sondes et des ARNm gène uniquement
sondes correspondant à des milliers de gènes différents hybridation des sondes et des ARNm gène uniquement

hybridation des sondes et des ARNm

de gènes différents hybridation des sondes et des ARNm gène uniquement exprimé dans échantillon 2 (vert)
de gènes différents hybridation des sondes et des ARNm gène uniquement exprimé dans échantillon 2 (vert)

gène uniquement exprimé dans échantillon 2 (vert)

gène exprimé dans échantillon 1 & 2

2 (vert) gène exprimé dans échantillon 1 & 2 gène uniquement exprimé dans échantillon 1 (rouge)
2 (vert) gène exprimé dans échantillon 1 & 2 gène uniquement exprimé dans échantillon 1 (rouge)

gène uniquement exprimé dans échantillon 1 (rouge)

analyse informatisée et quantification des signaux

4.2. Analyse du protéome

4. Méthodes d ’analyse globale

protéines

post génomique

4. Méthodes d ’analyse globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse
4. Méthodes d ’analyse globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse
4. Méthodes d ’analyse globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse
4. Méthodes d ’analyse globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse
4. Méthodes d ’analyse globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse

lyse et extraction

charge

globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse de la protéine -
globale protéines post génomique lyse et extraction charge électrophorèse 2D taille Analyse de la protéine -

électrophorèse 2D

génomique lyse et extraction charge électrophorèse 2D taille Analyse de la protéine - spectrométrie de masse
génomique lyse et extraction charge électrophorèse 2D taille Analyse de la protéine - spectrométrie de masse

taille

lyse et extraction charge électrophorèse 2D taille Analyse de la protéine - spectrométrie de masse -

Analyse de la protéine

- spectrométrie de masse

- immuno-détection

- séquençage

5. Analyse du rôle d’un gène

5. Analyse du rôle d’un gène

4.1. expression / surexpression

4.2. - utilisation d’ARN anti-sens et d’ARN interférents

- hybride ARNm normal / ARN anti-sens :

interférents - hybride ARNm normal / ARN anti -sens : traduction - hybride ARNm normal /

traduction

- hybride ARNm normal / ARNsi : dégradation des ARNm =

- hybride ARNm normal / ARN anti -sens : traduction - hybride ARNm normal / ARNsi

traduction

(Dicer) Complexe RISC Complexe RISC
(Dicer)
Complexe RISC
Complexe RISC

Principe des ARN interférents (ARNsi)

5. Analyse du rôle d’un gène

5. Analyse du rôle d’un gène

4.1. expression / surexpression

4.2. - utilisation d’ARN anti-sens et d’ARN interférents

- hybride ARNm normal / ARN anti-sens :

interférents - hybride ARNm normal / ARN anti -sens : traduction - hybride ARNm normal /

traduction

- hybride ARNm normal / ARNsi : dégradation des ARNm =

- hybride ARNm normal / ARNsi : dégradation des ARNm = 4.3. invalidation génique (KO, K-In)

4.3. invalidation génique (KO, K-In)

traduction

- remplacement du gène ciblé par recombinaison homologue dans une cellule souche embryonnaire par :

- un gène inactivé (KO constitutif, KO conditionnel)

- un gène modifié (KIn)

- animaux chimériques et sélection des homozygotes par croisement

gène gène inactivé normal m M 1
gène
gène
inactivé
normal
m
M
1
gène gène inactivé normal m M 1 préparation d’un vecteur contenant le gène d’intérêt inactivé souriceau

préparation d’un vecteur contenant le gène d’intérêt inactivé

souriceau chimère formé de cellules provenant des deux souches de souris

6 5
6
5

réimplantation

embryon chimère

gène muté gène sain a/a; MM souris grise 4
gène muté
gène sain
a/a; MM
souris grise
4

blastocyste

muté gène sain a/a; MM souris grise 4 blastocyste 3 transfection et sélection de cellules ES
3
3

transfection et sélection de cellules ES contenant le gène d’intérêt inactivé

cellules ES

2 A/A; MM souris brune
2
A/A; MM
souris brune
d’intérêt inactivé cellules ES 2 A/A; MM souris brune injection de cellules ES transfectées dans le

injection de cellules ES transfectées dans le blastocyste de l’autre type de souris

embryon a/a; MM + A/A; M/m

X. Bioinformatique

- clonage « in silico »

X. Bioinformatique

- analyse et traitement des séquences

- annotation des génomes

- analyse génétique (lod scores, haplotypage…)

- banques de données

- séquences d’ADN, ARN, protéines

- http://www.ncbi.nih.gov/Genbank/

- http://www.ensembl.org/Homo_sapiens/

- http://us.expasy.org/sprot

- génétiques :

-

OMIM maladies génétiques: http://www.ncbi.nih.gov/Omim/

-

HMDB mutations, http://www.uwcm.ac.uk

-

info-biogène : http://www.infobiogen.fr

-

- bibliographiques : http://www.ncbi.nih.gov/PubMed/

Que faut il retenir a :

- savoir pourquoi la nature des prélèvements nécessaires à l’étude peut varier selon que l’on analyse l’ADN ou l’ARNm

- connaître le principe de l’extraction de l’ADN

- savoir définir les termes d’enzyme de restriction, de palindrome, d’endonucléase, d’exonucléase

- savoir définir les différents types de polymérases

- savoir quel types de données peut on obtenir par l’électrophorèse des fragments d’ADN

- connaître le principe de l’hybridation et les différents types de sondes utilisables

- connaître le principe du clonage à l’aide d’un vecteur plasmidique , savoir définir ce qu’est un banque génomique, un banque d’ADNc

- connaître le principe de la PCR et savoir dessiner les 2 amorces nécessaires à une réaction de PCR, savoir définir ce qu’est l’efficacité d’un réaction PCR

- connaître le principe de la réaction de séquençage aux didéoxynucléotides

- connaître les principales méthodes d’analyse de l’ARN et des interactions entre ADN et facteurs de régulation

- connaître les méthodes d’analyse du rôle d’un gène,

a : les exemples numériques et de pathologies sont destinés à illustrer le cours et à permettre une meilleure intégration des connaissances

Mentions légales L'ensemble de ce document relève des législations française et intern ationale sur le

Mentions légales

Mentions légales L'ensemble de ce document relève des législations française et intern ationale sur le droit

L'ensemble de ce document relève des législations française et internationale sur le droit d'auteur et la propriété intellectuelle. Tous les droits de reproduction de tout ou partie sont réservés pour les textes ainsi que pour l'ensemble des documents iconographiques, photographiques, vidéos et sonores.

Ce document est interdit à la vente ou à la location. Sa diffusion, duplication, mise à disposition du public (sous quelque forme ou support que ce soit), mise en réseau, partielles ou totales, sont strictement réservées à l’université Joseph Fourier de Grenoble.

réservées à l’univers ité Joseph Fourier de Grenoble. L’utilisation de ce document est strictement réservée

L’utilisation de ce document est strictement réservée à l’usage privé des étudiants inscrits à l’UFR de médecine de l’Université Joseph Fourier de Grenoble, et non destinée à une utilisation collective, gratuite ou payante.

www.medatice-grenoble.fr

collective, gratuite ou payante. www.medatice-grenoble.fr Ce document a été réalisé par la Cellule TICE Médecine
collective, gratuite ou payante. www.medatice-grenoble.fr Ce document a été réalisé par la Cellule TICE Médecine

Ce document a été réalisé par la Cellule TICE Médecine de la Faculté de Médecine de Grenoble (Université Joseph Fourier – Grenoble 1) en collaboration avec le Service Commun Audio-Visuel (SCAV) de l’Université Stendhal de Grenoble.