Genetics Exam 2, Spring 2007

1. If a molecule of DNA has a GC content of 42%, what percentage of the bases would be A? a. 29% c. 42% e. none of the above b. 21% d. 58% 2. Which of the following studies (authors shown) was ultimately given credit for showing without a doubt that DNA was the hereditary material? a. Griffith c. Hershey and Chase b. Avery, MacLeod and d. Pagan and Paparone McCarty e. Wysocki, Hunter and Mertz 3. How many amino acids are there? a. 5 c. 15 e. 25 b. 10 d. 20 4. Which of the following types of RNA molecules is a copy of one side of a DNA molecule that is involved in translation? a. transfer c. messenger e. none of the above b. ribosomal d. all of the above 5. Which of the following describes the Central Dogma of Molecular Biology? a. DNA!RNA!Protein c. RNA!Protein!DNA e. None of the above b. RNA!DNA!Protein d. DNA!Protein!RNA 6. Which position in a codon is least important for determining the amino acid? a. First b. Second c. Third d. a and b are equally important e. All are equally important 7. What would be the probable outcome if mRNA molecules coding for human red blood cell antigen A were inserted into 2 solutions: one containing ribosomes, tRNA and all of the translation factors from a yeast cell, and the other containing ribosomes, tRNA and translation factors from a human? a. neither solution could make c. the correct protein would be made d. the correct protein would be made the protein only in the solution of yeast only in the solution of human b. both solutions would make molecules molecules the same protein e. mRNA does not get translated into protein 8. What level of protein structure are !-helixes and "-pleated sheets? a. primary c. tertiary e. both b and c b. secondary d. quaternary 9. A tRNA molecule has 3-GGG-5 as its anticodon. What amino acid does it carry? a. Pro c. Gly e. None, its a stop codon b. Thr d. Leu 10. Which of the following describe the genetic code? a. Overlapping 3 base codons c. Non-overlapping 3 base codons e. All of the above are possible b. Overlapping 4 base codons d. Non-overlapping 4 base codons 11. Which of the following gene mutations typically have the most negative effects? a. insertions c. base substitutions e. both a and c b. deletions d. both a and b 12. What is one mechanism by which a cell undergoing DNA replication can determine which base in a mismatched pair is incorrect? a. all newly added bases are c. the newly made strands are radioactive methylated b. the original strands are d. both a and c methylated e. none of the above 13. Which of the following techniques can be used to determine whether a gene is being transcribed in a certain tissue? a. Northern blotting c. Microarray analysis e. Both a and c b. PCR d. Both a and b 14. Which of the following is the primary cause of gene mutations? a. lasers from outer space c. damage due to reactive byproducts d. an intrinsic desire to change b. environmental effects of cellular metabolism e. errors during DNA replication

Use the following strand of DNA and the genetic code (found on last page) to answer questions 15-18 GGTACAAGCTCCGTACCGTGCAGGGGAACCCGGCCATTGAC CCATGTTCGAGGCATGGCACGTCCCCTTGGGCCGGTAACTG 15. When this DNA molecule is transcribed, the top strand serves as the template and RNA polymerase moves from left to right. Which end of the top strand is the 3 end? a. left b. right 16. Assuming that during DNA replication the replication fork moves from left to right, which strand is the lagging strand? a. top b. bottom 17. Assuming this DNA strand is from an E. coli, what are the first three bases in the coding sequence of the mRNA molecule? a. GGU c. CAG e. AUG b. CCA d. GUC 18. When the mRNA copy of the top strand is translated into a protein, how many amino acids will the protein contain? Assume that the transcript contains no introns. a. 9 c. 11 e. impossible to know b. 10 d. 12 19. What is a cDNA library? a. clones containing mRNA b. clones containing DNA made from a mRNA molecule c. clones made from ribosomes d. clones containing pieces of whole genomic DNA e. all of the above 20. Which of the following describes the location where a substrate binds to an enzyme? a. Template strand c. reactive region e. all of the above b. binding site d. active site 21. A mouse that you are studying is heterozygous for an inversion in one of its chromosomes. Different genes on this chromosome are designated with different letters and they are in the order shown below and O represents the centromere. A B C D O E F G A D C B O E F G Which of the following would not be a product if a crossover occurs between C and D? a. ABCDOEFG c. ABCCBOEFG e. ADCBOEFG b. ABCDA d. GFEODCBOEFG 22. Why are polyploid organisms with an odd number of chromosome sets typically sterile? a. they produce diploid gametes b. they produce haploid gametes c. they produce polyploid gametes d. they produce aneuploid gametes e. none of the above 23. Which of the following types of single base gene mutations are most likely to result in total loss of protein function? a. synonymous base substitution b. non-synonymous base substitution c. deletion d. all equally likely e. mutations never cause loss of protein function 24. What is an expression vector? a. clones that can transcribe the inserted gene and produce its protein product b. clones containing DNA made from a mRNA molecule c clones containing mRNA d clones containing pieces of whole genomic DNA e all of the above 25. You are studying two variants of the same protein which have the following sequences: Variant 1: Met Leu Pro His Asn Gly Tyr Glu Variant 2: Met Leu Pro Gln Asn Gly Tyr Glu Which of the following describes the type of mutation that has resulted in the difference in the two variants? a. synonymous base substitution b. nonsynonymous base substitution c. insertion d. deletion e. nonsense mutation

Match the correct definition on the right with the term on the left. (1 each) 26. Cloning ______ 27. Ribosome ______ 28. Enzyme ______ 29. Pseudogene ______ 30. Pericentric inversion ______ 31. Translocation ______ 32. Autopolyploidy ______ 33. DNA probe _______ 34. RNA Polymerase ______ 35. Promoter ______ a. an inversion that includes the centromere b. a protein that catalyzes biochemical reactions c. the process of making a protein from a mRNA code d. a copy of a gene that no longer encodes a protein e. the process of inserting recombinant vectors into bacteria for multiplication f. the organelle responsible for packaging proteins to leave the cell g. organisms with more than 2N sets of chromosomes that are all from the same species h. an inversion that does not include the centromere i. a labeled piece of ssDNA that is complementary to a gene of interest j. the enzyme responsible for transcription k. when a piece of a chromosome is attached to a non-homologous chromosome l. the organelle responsible for translation m. versions of the same gene that have different sequences n. the site on a DNA strand to which RNA polymerase attaches o. a sequence in the 5UTR of a mRNA that aligns it to a ribosome

36. Bonus: Using the following data set, draw a restriction map of this plasmid. Enzyme(s) Eco RI Pst I Xho I Eco RI + Xho I Eco RI + Pst I Pst I + Xho I Fragment size 2800 400, 2400 2800 1300, 1500 300, 400, 2100 400, 600, 1800

37. You have two molecules of DNA that are both 1000 bp in length. Molecule A is 70% AT and 30% GC while molecule B is 30% AT and 70% GC. Which molecule will melt (split into two single strands) at the higher temperature?

A. B.
C.

A B
Both will melt at the same temperature
A. P B. O C. C D. S E. N

38. Which of the following elements is not found in DNA?

39. Which of the following best describes a primer in DNA replication?

A. A 20-30 bp piece of RNA that hybridizes with ssDNA to provide an attachment point for Pol III. B. A 20-30 bp piece of DNA that hybridizes with ssDNA to provide an attachment point for Pol III. C. The start point for DNA replication on an E. coli chromosome. D. The end point for DNA replication on an E. coli chromosome. E. The primary enzyme of DNA replication.

40. Which of the following reactions does Pol III catalyze?

A. Formation of H bonds between complementary nucleotides on opposite DNA strands. B. Formation of a phosphodiester bond between the most internal 5 Phosphate of an already attached nucleotide and the 3 OH of an incoming dNTP. C. Formation of a phosphodiester bond between the most internal 5 Phosphate of an incoming dNTP and the 3 OH of an already attached nucleotide. D. Splitting of H bonds between complementary nucleotides on opposite DNA strands. E. Breaking of a phosphodiester bond between adjacent nucleotides.

41. A molecule of tRNA has the anticodon 3GGA5. What amino acid does it carry? A. Gly B. Ser C. Pro D. Arg E. It does not carry an amino acid 42. When the following sequence is replicated, Pol III travels along the top strand from left to right and makes the complementary strand continuously. What is the most 3 base of the top strand? ACCAGCGCAGTGTTACTGGTACTGTAG TGGTCGCGTCACAATGACCATGACATC A. A B. G C. T D. C 43. The bottom strand is transcribed and the resulting mRNA is translated into a protein. How many amino acids will the protein contain? ACCAGCGCAGTGTTACTGGTACTGTAG TGGTCGCGTCACAATGACCATGACATC A. 3 B. 5 C. 7 D. 8 E. 9 44. A mutation changes the DNA template strand of a gene such that a codon undergoes a base change from CGA to UGA. What kind of mutation is this? A. Synonymous B. Nonsynonymous C. Nonsense D. Aneuploidy E. Polyploidy 45. An individual is heterozygous for an inversion as shown below. If a crossover occurs between genes C and D in two homologous chromosomes, which of the following will not be a product? (The * represents the centromere.) ABCDE*FGHI ABGF*EDCHI A. ABCDE*FGHI B. ABCDE*FGBA C. ABGF*EDCHI D. ABC*DEF*GHI E. IHGF*EDCHI

46. A) differentiate between conservative and semi-conservative replication Semi-conservative replication means that one strand of the parent DNA molecule will be in each of the daughter strands. Conservative replication would mean that the original DNA molecule would be recombined post-replication into a single molecule and the replicated strands would make a whole new DNA molecule with none of the original parts in it.

B) Differentiate between overlapping and non-overlapping translation of the genetic code. In each case tell which method is actually found in organisms.

Overlapping translation would take the sequence of bases and read them 3 at a time for each codon, but only Moving the reading frame over 1 base for each codon. So the sequence ACGTGTACAATG would be read as ACG-CGT-GTG-TGT-GTAetc Non-overlapping translation is how the sequence of bases is actually read where the 3-base codons Are read in discrete segments and the reading frame moves over 3 bases each time; the above sequence would be ACG-TGT-ACA-ATG

47. Fully describe DNA replication in E. coli. (10) E. coli DNA replication always starts at OriC, the origin of replication. It begins by denaturing the DNA molecule by breaking the Hydrogen bonds between the bases. Replication moves in both directions on each of the two strands, starting at OriC, continuing to The terminus. 1. The enzyme DNA-A binds to OriC and initiates the unwinding process 2. Topoisomerases relax the coils further away from the replication site to augment the process. 3. Helicase and other associated enzymes break the hydrogen bonds to separate the 2 strands into ssDNA 4. Single-stranded binding proteins block the reannealing of the 2 single strands of DNA during the process 5. Primase adds RNA primers to each 3 end of a segment so that DNA Pol III can attach to the short double strand 6. Pol III binds to the primer/DNA complex and moves down the ssDNA in the 3-5 direction, adding dNTPs in the 5-3 direction 7. On the leading strand, this addition of dNTPs is done continuously, following the helicase. On the lagging strand, this is done in Short segments of DNA called Okazaki fragments (because the DNA is unzipping in the opposite direction of the lagging strand Replication). 8. The RNA primers are removed by DNA Pol I and replaced by normal dNTPs 9. The Okazaki fragments and newly added DNA in place of RNA primers are bound together by ligase, which seals the Phosphodiester bonds between the nucleotides.

48. You are studying a gene that in standard Mendelian crosses has two distinguishable alleles, one dominant and one recessive. But when you sequence the gene in multiple individuals you find that all individuals that all copies of the dominant allele have identical sequences, but there are actually several different sequences of the recessive allele. Explain these results. (5) The dominant allele codes for a functional protein that enables the organism to exhibit the dominant phenotype. The recessive alleles are mutants that code for non-functional proteins that all display a phenotype where the protein coded for by the Dominant allele is missing. There are nearly endless ways to mess up the code for a functional proteineo ipso there Are myriad different mutations of that original gene that screw up the code somehow. In this way, not all of the mutants have the Same code.

49. Explain how automated DNA sequencing is performed. (10) Automated DNA sequencing begins with a master mix and a highly pure sample of a gene (DNA segment) that has been acquired Through cloning, PCR, Southern/northern blot, etc. The master mix contains: Buffer, MgCl2, lots of dNTPs, very few ddNTPs (with fluorescent or radioactive tags), Taq Polymerase, And a primer specific to the beginning of our gene. 1. The process goes through a step of denaturing, where the DNA strands are denatured at high temperatures 2. Then the annealing step, where the primers are attached to the single-stranded DNA 3. The extension step is where the Taq polymerase attaches to the DNA-Primer complex and begins adding dNTPs to the template Strand. At some point, it will add a ddNTP to the strand, which will stop the polymerase from proceeding down that template strand. 4. The DNA is denatured again and this cycle repeated 30-40 times, whereupon you will have the original template DNA strands and The newly formed strands of DNA of every possible lengthwhere each different size is determined by the base pair where the ddNTP was added. 5. The different-sized fragments are run through a polacrilamide gel that can separate out molecules by size that differ by only 1 base 6. A laser is then shone through the tiny bands in the gel where a computer can pick up the different fluorescent tags of each base In order, giving us a sequence of bases for the gene we chose.

50. A 1500 bp gene encoding Lactamase is amplified by PCR and then cut with the restriction enzyme Eco RI in three individuals. Northern and Western blots are performed for this gene in each individual and are also shown below. Finally the activity of Lactamase is measured in each individual. Provide genotypes for each individual and provide an explanation of the observed patterns of each analysis. (10)

ANSWERS: 1. A 2. C 3. D 4. D 5. A 6. C 7. B 8. B 9. A 10. C 11. D 12. B 13. E 14. E 15. A 16. B 17. E 18. C 19. B 20. D 21. C 22. D 23. C 24. A 25. B 26. E 27. L 28. B 29. D 30. A 31. K 32. G 33. I 34. J 35. N 36. (To The right) 37. B 38. D 39. A 40. C 41. C 42. A 43. B 44. C 45. D

Pst

Ec o 300

400

1500

Pst

600

Xho