Académique Documents
Professionnel Documents
Culture Documents
Computational modeling and preliminary iroN, fepA, and cirA gene expression
in Salmonella Enteritidis under iron-deficiency-induced conditions1
ABSTRACT Salmonellosis outbreaks in Europe, the determine chelating-agent addition timing to augment
United States, and Latin America have been associat- relative gene expression. Two antigenic peptides locat-
221
222 Zárate-Bonilla et al.
cines (Chanana et al., 2006). Outer membrane proteins Native Strain Nucleic Acid Extraction,
regulated by iron have been described in different bac- Quantification, and Sequencing
terial species such as Salmonella enterica serovar Typhi of Selected Genes
(Sood et al., 2005a,b), Pasteurella multocida (Snipes et
al., 1988), Nesisseria meningitidis (Banerjee-Bhatnagar Bacterial DNA extraction was performed with proD-
and Frasch, 1990), Escherichia coli (Allan et al., 1993), NA-Kit (CorpoGen, Bogotá, Colombia). Bacterial
Helicobacter pylori (Worst et al., 1995), and Hemophi- RNA extraction was carried out with chaotropic agents
lus parainfluenzae (Morton and Williams, 1989). (RNA extraction kit, CorpoGen; Zárate-Bonilla, 2009).
There are currently 2 inactivated vaccines based on Nucleic acid purity and concentration were determined
IROMP overexpression: the first contains Salmonella by using Nanodrop (Thermo Scientific NanoDrop 2000,
Enteritidis (Woodward et al., 2002), and the second Wilmington, DE). Genes encoding IROMP proteins
one contains a mixture of Salmonella Enteritidis and were amplified by PCR from the native strain, using
Salmonella Typhimurium. For both vaccines, micro- primers and conditions described in Table 1. The am-
organisms are grown under iron deficiency conditions plicons obtained were purified and sequenced in Macro-
(Clifton-Hadley et al., 2002). These vaccines have prov- gen Inc., Seoul, Korea. The assembled sequence analy-
en to be highly immunogenic and protective against sis was performed using Sequencher 4.1.0 (Ann Arbor,
salmonellosis. Thus, they have been considered an ef- MI).
fective option in the control of avian illness (Gast and
Beard, 1993; Nakamura et al., 1994). Secondary-Structure Prediction
The poultry industry in Colombia is one of the most
Primer2
iroN Expression iroNup CGCACTGATTTCCGATTTATTT
iroNlowNEW GTCCCGGTGATATGGCTATTT
fepA fepAup TGGGCTGACCGCTTGCT
fepAlow GAACGCCTGTCGATTATTCCAC
cirA cirAup CGCCACTCATCTTCAAGGAACA
cirAlow AGCCCTATCACGTCAGAAAGCA
gyrB gyrBup CGTCGATAGCGTTATCTACC
gyrBlow GTCGAATTCTTATGACTCCTCC
1Primers to amplify and sequence the genes iroN, fepA, and cirA from the native strain Salmonella Enteritidis.
Amplification conditions: 95°C for 5 min; 40 cycles (95°C for 45 s, 60°C for 45 s, 72°C for 3 min); 72°C for 10 min.
tein regardless of the hydrophobicity of the region, us- OD600nm = 0.1872X + 0.1215; R2 = 0.9905; [1]
ing PyMol software version 1.4.1. (DeLano Scientific
LLC, Portland, OR). OD600nm = 0.51267 × 10−3X + 0.03768;
R2 = 0.9875; and [2]
Strain, Improvement of Culture Media,
and Expression of cirA, fepA, and iroN log10 (X/X0), [3]
Genes Under Iron Deficiency Conditions
where X is the concentration (cell/mL) at different
Salmonella enterica serovar Enteritidis (native isolate times of culture and X0 is the concentration (cell/mL)
provided by Finmark Laboratories SA, Colombia) was at the beginning of the culture (Duque-Jamaica et al.,
isolated from poultry in the city of Fómeque Cundina- 2010).
marca, Colombia. For a previous study (unpublished
data) we determined tryptone was the principal organ- Px = dry biomass(g/L)/(culture − Timehour). [4]
ic nitrogen source influencing this strain’s growth. For
this study, we used a general factorial design (simple The cirA, fepA, and iroN gene induction was performed
design; Duque-Jamaica et al., 2010) performed with 2 by addition of deferoxamine mesylate (Novartis-Colom-
levels of only one categorical factor (21 × 6) to dis- bia) at 50 µM at different times during growth: in the
criminate between tryptone (15 g/L) and tryptone T beginning of culture (0 h), during the middle of log
broth at 15 g/L. All nutrients were purchased from phase (2.5 h of culture), and at the end of log phase
Oxoid, Thermo Scientific, Hampshire, UK. Cultures (5 h). A second general factorial design (simple design;
were grown at 37°C at 150 rpm with an effective work- Duque-Jamaica et al., 2010) was performed with 3 lev-
ing volume of 1/5 of the shake flask. Growth kinet- els of only one categorical factor (31 × 6) to identify the
ics were monitored every 2 h by measuring OD600nm optimal time for chelating agent addition. Salmonella
(optical density at 600 nm) and transformed into dry enterica serovar Enteritidis (native strain) was grown
weight by using a calibration curves (OD600nm vs. dry in FINLAB broth (Finmark Laboratories SA) supple-
weight) [equation 1]. McFarland [equation 2] was used mented with the selected nitrogen source for normal
to calculate dry biomass concentration (g/L) and cell/ and iron deficiency conditions (in the presence of the
mL concentration, respectively. To establish growth log chelating agent). Experiments were carried out in du-
phase, cells per milliliter were transformed according plicate in an effective working volume of 1/5 of the
to equation 3. To determine biomass productivity of shake flask at 37°C and 150 rpm. Bacterial growth was
P(x), equation 4 was used. SigmaPlot V-11.0 was used monitored by OD600nm. Data were replaced in equation
for kinetic behavior graphs, and factorial designs were 1 to obtain dry biomass (g/L). Culture samples were
analyzed using Design-Expert V-8.0.5 software. taken at 4, 8, and 10 h, centrifuged at 4,000 × g for 15
224 Zárate-Bonilla et al.
min at 25°C. The RNA was extracted from pellets for strains reported in the NCBI database. In addition,
synthesis of cDNA and analysis of gene expression by fepA and cirA genes were identified as a single copy
quantitative reverse-transcription PCR (qRT-PCR). gene in other enteric strains such as E. coli BW2952
(NCBI accession number CP001396), with an identity
Quantification of cirA, fepA, and iroN percentage of 76% for fepA and 78% for cirA. The high
identity found between the IroN, FepA, and CirA pro-
Relative Expression
teins for our strain and those in Salmonella spp., and E.
Total RNA was extracted from culture samples at 4, coli increases the possibility of using the native strain
8, and 10 h with 2 biological replicates for each con- for a chicken vaccine preparation.
dition (normal and iron deficiency cultures). Samples
were treated with DNase (RQ1 DNase; Promega, Bo- IROMP Primary Structure Analysis
gotá, Colombia) and then subjected to reverse tran-
scription generating cDNA (SuperScrip III, Roche, Bo- As a result of multiple sequence analysis and Pfam
gotá, Colombia). From each cDNA 3 replicates were profiles searches, IROMP evidenced the presence of
evaluated by qRT-PCR using specific primers designed 2 conserved regions: a typical plug domain useful for
(Table 1) with SybrGreen as a product detector. Reac- siderophore-iron complex binding, which allow its en-
tions were run on a LightCycler (Roche), crossing point try through the membrane and a TonBdep-rec do-
(CP) was determined by using 4.05 version software. main, needed for active transport and binding site for
Target gene rate of relative expression was determined transmembrane protein TonB. This complex transmits
by comparing with gyrB gene from Salmonella (which signals from the cytoplasm and provides the energy
The signal peptide for FepA included the first 24 FepA was a β-barrel protein composed of 727 aa, 10
aa. After alignment, the mature protein showed ho- occurring as α helices, 58 and 67 as β-sheets, and coil
mology with other 46 proteins with tertiary structures regions, respectively (Figure 1-IB).
that were determined experimentally. These molecules The CirA had a 26-aa signal peptide. After align-
showed identities of about 10 to 81%, similarities rang- ment, the mature protein displayed homology with 34
ing from 0.146 to 1.296, and occurrence probabilities other proteins, whose tertiary structure has been ex-
ranging from 21.12 to 99.99%. Among the 46 proteins perimentally determined. These molecules showed iden-
found, ferric enterobactin receptor (1fep A) and YCEI” tities of about 13 and 86%, similarities ranging from
(1y0gA) from the E. coli membrane had the highest 0.001 to 1.363, and occurrence probabilities ranging
probability of occurrence. Finally, the 3D model for from 25.16 to 99.99%. Among the 34 proteins found,
the colicin I receptor (2hdi A) and the ferric entero-
bactin receptor (1fep A) from E. coli membrane had
Table 2. Percentage of residues that lay in the most favored the highest probability of occurrence. Finally, the 3D
regions (Allow), percentage of residues that lay in additionally
allowed regions (Gener Allow), and percentage of residues that
lay in disallow regions for IroN, FepA, and CirA proteins accord- Table 3. QMEAN6 and Z scores for the validation of the ter-
ing to Ramachandran plot tiary structure: IroN, FepA, and CirA
Protein Protein QMEAN6 Z-score1
time (0, 2.5, or 5 h of culture), biomass productivity Finally, it is logical to think that the iron deficiency
was greatest at 4 h of culture, including the control conditions generated in this study could stimulate the
without deferoxamine mesylate (Figure 4-A). There production of other proteins related or not with iron
were no significant differences in productivity as a func- uptake, whose expression was not measured and that
tion of growth time when deferoxamine mesylate was probably will have an immunological effect.
added (0, 2.5, or 5 h), demonstrating the minimal effect
of the chelating agent on growth. We speculate this ef- Conclusions
fect was due to the low concentration used, suggesting
low toxicity. To increase iroN, fepA, and cirA relative gene ex-
The IroN captures enterobactin, salmochelin, and pression in native Salmonella enterica serovars under
2,3-dihydroxybenzoylserine, FepA transport entero- the culture conditions studied, the Enteritidis strain
bactin and 2,3-dihydroxybenzoylserine, whereas CirA requires maximum log phase extension. In addition, a
is the receptor for 2,3-dihydroxybenzoylserine. Some chelating agent should be added in the middle of the
studies have reported that the 3 genes are crucial for exponential phase, when the cell is at an accelerated
the survival of Salmonella in the host (Hantke et al., metabolic growth rate. Our study confirms that iron de-
2003; Rabsch et al., 2003). Under the conditions here ficiency did not simultaneously stimulate IROMP gene
evaluated, iroN expression tended to be slightly higher expression, probably due to differential gene promoter
than fepA and cirA (Figures 4-B and C). Taking into affinity. Our methodology and results can be used to
account that all these genes are transcriptionally regu- enhance the expression of other IROMP, such as Fiu,
lated by FUR, it is possible that FUR affinity degree FecA, FhuA, and FhuE in other strains. Moreover, it
may be different for each gene promoter (iroN, fepA, can be applied to generate more efficient vaccines that
and cirA; Andrews et al., 2003). combine several Salmonella spp. serotypes. The pro-
COMPUTATIONAL MODELING AND GENE EXPRESSION 229
posed native strain 3D structure of 3 IROMP proteins including a 70-kilodalton transferrin receptor, and their potential
and 6 antigenic peptides should be studied in detail as for use as vaccines. Infect. Immun. 58:2875–2881.
Bustin, S. A., V. Benes, T. Nolan, and M. W. Pfaffl. 2005. Quan-
possible components or candidates for a synthetic or titative real-time RT-PCR—A perspective. J. Mol. Endocrinol.
recombinant vaccine against avian Salmonellosis and 34:597–601.
for IgY production. We propose the antigenic peptides Chanana, V., S. Majumdar, P. Ray, M. Sharma, and P. Rishi. 2006.
Coordinated expression and immunogenicity of an outer mem-
identified in this work through 3D structure modeling brane protein from Salmonella enterica serovar Typhi under iron
could be in part responsible for poultry seroprotection. limitation, oxidative stress and anaerobic conditions. J. Biomed.
Sci. 13:303–312.
Clifton-Hadley, F. A., M. Breslin, L. M. Venables, K. A. Sprigings,
ACKNOWLEDGMENTS S. W. Cooles, S. Houghton, and M. J. Woodward. 2002. A labo-
ratory study of an inactivated bivalent iron restricted Salmo-
This work was granted by Colciencias (grant 6570- nella enterica serovars Enteritidis and Typhimurium dual vac-
454-21809, Bogotá, Colombia). The authors thank cine against Typhimurium challenge in chickens. Vet. Microbiol.
María Mercedes Zambrano (Corpogen, Bogotá, Colom- 89:167–179.
bia) for critical reading of the manuscript and María Deléage, G., and B. Roux. 1987. An algorithm for protein second-
ary structure prediction based on class prediction. Protein Eng.
Lucía Gutiérrez (Instituto de Errores Innatos del Meat- 1:289–294.
bolismo, Facultad de Ciencias, Pontificia Universidad Duque-Jamaica, R., A. Arévalo-Galvis, R. A. Poutou-Piñales, and
Javeriana, Bogotá, Colombia) for English editing. A. A. Trespalacios-Rangel. 2010. Sequential statistical improve-
ment of the liquid cultivation of Helicobacter pylori. Helicobacter
15:303–312.
REFERENCES Fernandez-Beros, F. E., C. Gonzáles, M. A. McIntosh, and F. C. Ca-
ballero. 1989. Immune response to the iron-deprivation-induced
Allan, B. J., J. V. Hurk, and A. A. Potter. 1993. Characterization of proteins of Salmonella typhi in typhoid fever. Infect. Immun.
Escherichia coli isolated from cases of avian colibacillosis. Can. 57:1271–1275.
J. Vet. Res. 57:146–151. Finn, R. D., J. Tate, J. Mistry, P. C. Coggill, J. S. Sammut, H. R.
Andrews, S., A. Robinson, and F. Rodríguez. 2003. Bacterial iron Hotz, G. Ceric, K. Forslund, S. R. Eddy, E. L. Sonnhammer, and
homeostasis. FEMS Microbiol. Res. 27:215–237. A. Bateman. 2008. The Pfam protein families database. Nucleic
Banerjee-Bhatnagar, N. B., and C. E. Frasch. 1990. Expression of Acids Res. 36:D281–D288.
Neisseria meningitidis iron-regulated outer membrane proteins,
230 Zárate-Bonilla et al.
Frishman, D., and P. Argos. 1996. Incorporation of non-local inter- under iron-sufficient and iron-restricted conditions. J. Gen. Mi-
actions in protein secondary structure prediction from the amino crobiol. 135:445–451.
acid sequence. Protein Eng. 9:133–142. Nakamura, M., N. Nagamine, T. Takahashi, S. Suzuki, and S. Sato.
Garnier, J., J. F. Gibrat, B. Robson, and R. F. Doolittle. 1996. GOR 1994. Evaluation of the efficacy of a bacterin against Salmonella
secondary structure prediction method version IV. Methods En- enteritidis infection and the effect of stress after vaccination.
zymol. 266:540–553. Avian Dis. 38:717–724.
Garnier, J., D. J. Osguthorpe, and B. Robson. 1978. Analysis of Oke, M., R. Sarra, R. Ghirlando, S. Farnaud, A. R. Gorringe, R.
the accuracy and implications of simple methods for predict- W. Evans, S. K. Buchanan, and F. Lett. 2004. The plug domain
ing the secondary structure of globular proteins. J. Mol. Biol. of a neisserial TonB-dependent transporter retains structural in-
120:97–120. tegrity in the absence of its transmembrane beta-barrel. FEBS
Gast, R. K., and C. W. Beard. 1993. Research to understand and Lett. 564:294–300.
control Salmonella enteritidis in chickens and eggs. Poult. Sci. Pfaffl, M. W. 2001. A new mathematical model for relative quantifi-
72:1157–1163. cation in real-time RT-PCR. Nucleic Acids Res. 29:e45.
Geourjon, C., and G. Deléage. 1994. SOPM: A self-optimized meth- Rabsch, W., U. Methner, W. Voigt, H. Tschape, R. Reissbrodt, and
od for protein secondary structure prediction. Protein Eng. P. H. Williams. 2003. Role of receptor proteins for enterobactin
7:157–164. and 2,3-dihydroxybenzoylserine in virulence of Salmonella enteri-
Geourjon, C., and G. Deléage. 1995. SOPMA: Significant improve- ca. Infect. Immun. 71:6953–6961.
ments in protein secondary structure prediction by consensus Snipes, K. P., L. M. Hansen, and D. C. Hirsh. 1988. Plasma- and
prediction from multiple alignments. Comput. Appl. Biosci. iron-regulated expression of high molecular weight outer mem-
11:681–684. brane proteins by Pasteurella multocida. Am. J. Vet. Res.
Hantke, K., G. Nicholson, W. Rabsch, and G. Winkelmann. 2003. 49:1336–1338.
Salmochelins, siderophores of Salmonella enteric and uropatho- Sood, S., P. Rishi, V. Dhawan, S. Sharma, and N. K. Ganguly.
genic Escherichia coli strains, are recognized by the outer mem- 2005a. Protection mediated by antibodies to iron-regulated out-
brane receptor IroN. Proc. Natl. Acad. Sci. USA 100:3677–3682. er-membrane proteins of S. typhi in a mouse peritonitis model.
King, R. D., and M. J. Sternberg. 1996. Identification and applica- Mol. Cell. Biochem. 273:69–78.