Apéndice

.

p.m.Apéndice APÉNDICE ABREVIATURAS Unidades de medida m nm g Kg µg ng l ml µl nmol pmol M µM nM N h min seg V mV r. g kb pb Compuestos químicos DNA aDNA mtDNA rDNA RNA A T U C G M R S Y W dNTP dATP dTTP dUTP dCTP dGTP DdNTPs DdATP DdTTP DdCTP DdGTP Micrómetro Nanómetro Gramo Kilogramo Microgramo Nanogramo Litro Mililitro Microlitro Nanomol Picomol Molar Micromolar Nanomolar Normal Hora Minuto Segundo Voltios Milivoltios Revoluciones por minuto Gravedad Kilobases Pares de bases Ácido desoxirribonucleico DNA antiguo DNA mitocondrial DNA ribosómico Ácido ribonucleico Adenina Timina Uracilo Citosina Guanina Adenina o Citosina Adenina o Guanina Guanina o Citosina Citosina o Timina Adenina o Timina Desoxinucleótido trifosfato Desoxiadenosina trifosfato Desoxitimidina trifosfato Desoxiuridina trifosfato Desoxicitidina trifosfato Desoxiguanosina tifosfato Didesoxi-nucleótido trifosfato Didesoxi-adenosina trifosfato Didesoxi-timidina trifosfato Didesoxi-citidina trifosfato Didesoxi-guanosina trifosfato 671 .

6-Dihidroxi-Uracilo 5-Hidroxi-Uracilo 8-Hidroxi-Adenina 8-Hidroxi-Guanina Alanina Arginina Ácido aspártico Cisteína Ácido Glutámico Glicina Histidina Hidroxiprolina Isoleucina Leucina Lisina Fenilalanina Prolina Serina Triptófano Tirosina Valina Bromuro de Etidio Ácido etilendiaminotetraacético Isopropyl-ß-D-tiogalactopiranosa Bromuro de fenil tiazolio S-Adenosil Metionina Dodecil sulfato de sodio Tris-Bórico-EDTA Tris-EDTA Hidroximetil aminometano 5-Bromo-4-cloro-3-indol-ß-D-galactopiranosa Uracil DNA Glicosilasa Uracil N Glicosilasa Espectrometría de masas Flash-pirólisis.f.Hidroxi-Hidantoína 5. Cal.C.6 Diamino-5-Formamidopirimidina 2. A. CRS DKP DPCs HPLC HVSI o HVRI 4.6-diOH-Ura 5-OH-Ura 8-OH-Ade 8-OH-Gua Ala Arg Asp Cys Glu Gly His HPro Ile Leu Lys Phe Pro Ser Trp Tyr Val BrEt EDTA IPTG PTB SAM SDS TBE TE Tris X-Gal Enzimas UDG UNG Técnicas MS Py-GC/MS SIM GC-MS Otros A.u.Eva Fernández Domínguez Fapy-Ade Fapy-Gua 5-OH-5-MeHid 5-OH-Hid 5.P. Cromatografía de gases y Espectrometría de masas Monitorización selectiva de iones Cromatografía de gases Antes de Cristo Antes del presente Apurínico Colony forming units (Unidades Formadoras de Colonia) Calibrado Secuencia de Referencia de Cambridge Diketopiperacinas DNA-protein cross links Cromatografía Líquida de Alta Resolución Región o Segmento Hipervariable I del DNA mitocondrial 672 .6 Diamino-4-Hidroxi-5-Formamidopirimidina 5-Hidroxi-5-Metil Hidantoína 5. AP c.

Apéndice HVSII o HVRII IC LBK PPNA PPNB MGB MPD MRCA NCPs numtDNA PCR RMRF SNPs SP STRs Taq TMCRA UPGMA UV µ Región o Segmento Hipervariable II del DNA mitocondrial Colágeno insoluble Linearbandkeramik-Kultur (Cultura cerámica Linear) Neolítico pre-cerámico A Neolítico pre-cerámico B Minor Groove Binding Mean Pairwise differences (Media de las diferencias entre pares de secuencias) Most Recent Common Ancestor (Ancestro Común Más Reciente) Non Collagenous Proteins Nuclear mitochondrial DNA-like sequences (Secuencias nucleares mitocondriales) Reacción en cadena de la polimerasa Factor de respuesta molar relativa Single Nucleotide Polymorphisms Péptido soluble Single Tandem Repeats Termus aquaticus Time of the Most Recent Common Ancestor (Tiempo del Ancestro Común más reciente) Unweighted Pair-Group Method using arithmetic Averages Ultravioleta Tasa de mutación 673 .

Eva Fernández Domínguez 674 .

.

16150 16160 16170 16180 16190 16200 16210 16220 16230 16 ACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTG GACAAGAAAGTACCCCTTCGTCTAAACCCATGGTGGGTTCATAACTGAGTGGGTAGTTGTTGGCGATACATAAAGCATGTAATGACGGTCGGTGGTACTTATAA .

Sign up to vote on this title
UsefulNot useful