VL 1 NB 1

Stem Cell Reports
Editorial Welcome to Stem Cell Repor ts

On behalf of the International Society for Stem Cell Research (ISSCR) and the Stem Cell Reports editorial team, we would like to extend a warm welcome to you and present the inaugural issue of our journal, Stem Cell Reports. Stem Cell Reports is the ISSCRs new journal, a highly visible, open access forum, accelerating the speed with which advances and new ideas are shared and expanded. The mission of our new journal is to deliver signicant, well-documented ndings to the stem cell research community in a timely manner. Stem Cell Reports focuses on shorter, single-point reports in addition to full length articles, and offers a fair peer-review process supervised by leading scientists in the eld. It is our particular interest to cover all areas of stem cell research comprehensively and we are delighted to have received manuscripts reporting research on a wide range of stem and progenitor cell types from varied species and model systems. The current issue presents examples from many of our interest areas: embryonic stem cells and the roles of wnt signaling in determining fate, the conversion of primordial germ cells to pluripotency, studies of telomere length in human mammary gland progenitors, the identity of mouse interfollicular epidermis progenitors, and the role of SOX2-positive neural crest progenitors in skin repair. Furthermore, we have two Resource articles this month, one describing tools for studying transgenesis in axolotl and the other, a compilation of imprinted loci in human induced pluripotent stem cells. The lineup for the second issue is already well advanced and we will follow with monthly issues that will continue to cover a wide range of research from developmental biology, stem and progenitors cells, fate determination, and the genomics and epigenetics of these systems to disease models, tissue engineering, and regenerative medicine. The inaugural issue contains examples of all of our research article formats: Reports, full-length Articles, and Resources. In addition, it features an historical review, perhaps one of the most comprehensive you will ever read, of the science that formed the background to the shared Nobel Prize for Sir John Gurdon and Shinya Yamanaka, ISSCR president 20122013. Starting a new journal is both exciting and challenging. A successful launch relies on scientists submitting, reviewing, and editing manuscriptstaking a leap of faith and really committing their time to making it a success. For Stem Cell Reports, this support has reached far beyond our expectations: we have had nearly 100 submissions since the rst call for papers in December
Stem Cell Reports Editorial Team Atie Gathier (Editorial Assistant, left), Christine Mummery (Editor in Chief, center), Yvonne Fischer (Managing Editor, right).
2012, many of high quality and some real gems; reviewers have been responsive and have invested their energy as altruistically as for established journals; and the ISSCRs Board of Directors, ISSCR members, and the Stem Cell Reports Editorial Board have both reviewed and submitted manuscripts with exceptional loyalty. This rst issue is a testimony to their efforts and also to those of the ISSCRs Publications Committee, which had the foresight to initiate a society stem cell journal and to identify the particular niche Stem Cell Reports could ll. We have been delighted by the support of our publisher, Cell Press, which has guided us through the extremely tight timelines necessary for this inaugural issue to be ready for the ISSCR 11th Annual Meeting in Boston. We are grateful to all authors and referees, and in particular we appreciate their patience and understanding as we, the editorial team, have learned the behind-the-scenes system and occasionally pressed the wrong buttons. We would also like to take this opportunity to introduce the rest of our editorial team. An important aspect of Stem Cell Reports is that the editorial leadership is provided by scientists active in the eld, and we are delighted to introduce a truly international and scientically renowned group of Associate Editors: Nissim Benvenisty, M.D., Ph.D. (Hebrew University, Israel), Thomas Graf, Ph.D. (Center for Genomic Regulation, Spain), Hideyuki Okano, M.D., Ph.D. (Keio University School of Medicine, Japan), and David Scadden, M.D., Ph.D. (Massachusetts General Hospital/Harvard University, USA). We look forward to
Stem Cell Reports j Vol. 1 j 12 j June 4, 2013 j 2013 The Authors 1
Stem Cell Reports

Editorial
hearing about your science and encourage you to approach us at meetings to ask us more about Stem Cell Reports. We hope you will enjoy reading this issue as much as we have enjoyed producing it. We hope, too, that it will inspire you to send us your next manuscript.
Christine Mummery, Ph.D.

Editor in Chief, ISSCR
Yvonne Fischer, Ph.D.

Managing Editor, ISSCR
Atie Gathier
Editorial Assistant, ISSCR http://dx.doi.org/10.1016/j.stemcr.2013.05.003
2 Stem Cell Reports j Vol. 1 j 12 j June 4, 2013 j 2013 The Authors
Stem Cell Reports

Editorial Quantum Leap Year
In 2002, the International Society for Stem Cell Research (ISSCR) was established to provide forums for the exchange of information and ideas relating to stem cells, to strengthen global communication and collaboration between scientists, and to drive forward the eld of stem cell research and its applications to medicine. Last year, the ISSCR entered its second decade and celebrated this milestone in conjunction with the ISSCR10th Annual Meeting, in Yokohama, Japan. We reafrmed our goals and made administrative changes to ensure that we have the appropriate complement of talents in place to maintain our leadership role in promoting scientic excellence in the elds of stem cell research and regenerative medicine. As we enter our second decade, we continue to expand our platforms for communication and education and to explore new avenues for conversation. You are reading one of these todayStem Cell Reports, our new open access journal, owned and operated by the ISSCR, with the Editor-in-Chief and Associate Editors drawn from leading scientists in the eld. We are thrilled to present this inaugural issue of Stem Cell Reports, and we thank the ISSCR Board of Directors, and in particular, the Stem Cell Reports editorial team spear-headed by Christine Mummery, Editor-in-Chief, for their dedicated efforts. As another example, in the past several years, the ISSCR has expanded its meeting offerings to include a regional forum series to complement the annual meetings. The next regional forum will be held in Florence, Italy, September 1518, 2013, with an emphasis on the transition of stem cell research to clinical medicine, followed by a second forum in Suzhou, China, October 1418, 2013, which will be a diverse program including basic through translational science. Our goal is to constantly bring to the eld the latest and most exciting stem cell discoveries, so that the best new science becomes the benchmark. The regional forums are one way to enhance the impact of this science. The annual meeting remains the premier international conference at which the stem cell and translational research community highlight the newest research trends. An incredible breadth and depth of science is offered from scientists, who attend this meeting from more than 55 countries, through plenary, concurrent, and poster sessions and the discussions that surround these. More than half of all this years speakers were selected from abstracts submitted by participants. In addition, the 2013 meeting in Boston will continue to feature one-minute poster teaser presentations during plenary sessions. This format has proved so popular that the Program Committee, building on this concept, added almost
Nancy Witty
60 ve-minute poster brief presentations to the concurrent session schedule to spark conversations that will continue each evening at the poster receptions. Another recent initiative is ISSCR Connect, an online educational portal. The goal of ISSCR Connect is two-fold: rst, to enhance the experience of those attending the ISSCR meeting, and second, to provide members with additional educational opportunities on a year-round basis and expand their access to the ISSCRs annual meeting and regional forums. For meeting attendees, it provides planning tools in advance and access to content after the event. For the annual meeting, concurrent session talks recorded at the meeting are made available for a limited period following the meeting, a valuable feature as the size and breadth of the meeting continues to grow. ISSCR Connect also delivers additional monthly programming on selected new research topics and, for members, access to select talks from meetings they are not able to attend in person. We encourage you to tune in at the end of this month to explore content from the ISSCRs 11th Annual Meeting. As the society has grown over the last ten years, we reached a threshold in which self-management became the best option. After careful consideration by leadership, the society moved into new ofces in August 2012, and the transition of all administrative functions to independent management was completed by the end of the
Stem Cell Reports

Editorial
calendar year. Going forward, the ISSCR will expand its scientic programs, promote clinical translation, and enhance public education with our own dedicated staff. In my eighth year as director, Im delighted to have been part of this step and to ensure that we were able to maintain a high degree of continuity in key staff positions as we made the transition to independence. Heather Rooke, Ph.D., remains Scientic Director, and James Donovan continues as Membership and Meeting Services Director. To complement their strengths, Shelly Staat, with a background in industry, has joined the senior management team as Director of Business Development and Marketing, rounding out the current dedicated full-time staff of 12 located at the headquarters ofce in the Chicago suburb of Skokie, Illinois. The life blood of any organization is its membership, and part of the challenge of moving to stand-alone management has been the migration of the membership support services and database. Although this is a signicant task, it also provides us the opportunity to look closely at our current and potential members, their research interests, career stages, and evolving needs. The Membership Committee, led by Martin Pera (Melbourne, Australia), and supported by a dedicated staff person, have already initiated that review. Starting with the Board of Directors and committee members, and continuing on a country-by-country basis, we are in the process of compiling a comprehensive list of principal investigators in both academic and industry settings, along with their research teams of students and investigators. We have a young and mobile membership, with upward of 40% of our membership in training positions, and we encourage you to send us updated contact information as you take that next career step so we can best serve you and ensure our records are the most accurate reection of this dynamic eld. The ISSCR is governed by a Board of Directors, a crosssection of the eld, in both geography and career stages.
In addition, the ISSCR has a Global Advisory Council (GAC) that has become an increasingly central part of the ISSCRs activities since it was formed in 2008. This last year was also a transition year for this group, as Hiro Ogawa, an international business man who has served on the GAC for several years, accepted the baton from Founding Chair Robert Klein, to lead the advisory council in a new series of initiatives and to bring the councils business acumen, eld expertise, and philanthropic resources to bear on the ISSCRs core goal of delivering effective new medical treatments to patients around the globe. The past year was big for both the eld of stem cell research as well as the ISSCR as a society. In October, the 2012 Nobel Prize in Physiology or Medicine was awarded to Sir John Gurdon and Shinya Yamanaka, ISSCR President (20122013), for their discoveries that mature cells can be reprogrammed to become pluripotent, challenging our views of development and cellular commitment. This award highlighted the roots of stem cell research in developmental biology in juxtaposition with the vision of harnessing the power of stem cell research for the betterment of human health. Ive had the great privilege of working closely with Dr. Yamanaka this year, and Im extremely gratied to say that Shinya is exemplary of those who serve on the Board of Directors and in other leadership positions within this organization. I look forward to introducing Dr. Yamanaka, incoming ISSCR President, Dr. Rossant, and others in major leadership roles in the ISSCR to a broad cross-section of the members during the annual meeting in Boston. A warm welcome to the ISSCRs 11th Annual Meeting and to our inaugural issue of Stem Cell Reports!
Nancy Witty
CEO/Executive Director, ISSCR http://dx.doi.org/10.1016/j.stemcr.2013.05.002
Stem Cell Reports

Review From Stealing Fire to Cellular Reprogramming: A Scientic History Leading to the 2012 Nobel Prize
M. William Lensch1,2,3,* and Christine L. Mummery4
of Pediatrics, Harvard Medical School, 250 Longwood Avenue, Boston, MA 02115, USA of Hematology/Oncology, Howard Hughes Medical Institute/Boston Childrens Hospital, 1 Blackfan Circle, Boston, MA 02115, USA 3Harvard Stem Cell Institute, Holyoke Center, Suite 727W, 1350 Massachusetts Avenue, Cambridge, MA 02138, USA 4Department of Anatomy and Embryology, Leiden University Medical Centre, P.O. Box 9600, 2300 RC Leiden, the Netherlands *Correspondence: mathew.lensch@childrens.harvard.edu http://dx.doi.org/10.1016/j.stemcr.2013.05.001 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Division 1Department
Cellular reprogramming was recently crowned with the award of the Nobel Prize to two of its groundbreaking researchers, Sir John Gurdon and Shinya Yamanaka. The recent link between reprogramming and stem cells makes this appear almost a new eld of research, but its historical roots have actually spanned more than a century. Here, the Nobel Prize in Physiology or Medicine 2012 is placed in its historical context.
org/nobel_prizes/medicine/laureates/2012/) (Figure 1). Gurdon and Yamanakas work mark a new beginning in the study of development, cellular lineage determination, and our understanding of epigenesis. This review will briey summarize milestones in the elds history leading to the 2012 Nobel and offer a reading of tea leaves regarding things to come (for an abbreviated timeline, see Table S1 available online). Before the Beginning As Kuhn might well have observed, the question When did stem cell research begin? is interesting to ponder but difcult to answer. A response depends in part upon dening what one considers as stem cell research. What is clear is that the notion of replacing, repairing, or even regrowing damaged body parts is rooted in antiquity. Although Aeschylus often receives the credit in his fth century work Prometheus Bound, it was actually in the eighth century B.C. work Theogony that the Greek poet Hesiod rst described the legend of Prometheus who gave re to humans and was punished by Zeus by being chained to a rock so that a large eagle could swoop in and devour his liver. The cruelty of Prometheus sentence was compounded by the fact that his liver would fully regenerate by the next day so that the punishment could be repeated. What makes this ancient story incredible is that the liver actually has a tremendous capacity for postresection repair in which over 70% may be surgically removed only to regenerate (for review, see Duncan et al., 2009). In the third century A.D., the twin brothers Damian and Cosmas, later Patron Saints of Physicians, would achieve fame (and martyrdom) by working as healers free of charge. Among their purported deeds was the successful grafting of an entire leg from one person onto another. To the modern reader, this procedure went so far as to include a form of cellular lineage tracing given that the transplanted leg bore dark skin, whereas the recipients esh tone was white. Regardless of the veracity of stories such as these, the point remains that for a very long time, humankind has understood the concept of replacing diseased or damaged tissue with healthy counterparts. It is remarkable
Introduction Research is a gradual process offering ashes of brilliance and occasionally much more, as reward for tenacity. The physicist/historian/philosopher Thomas Kuhn described scientic advance as a series of interrelated bodies of work wherein discovery builds upon discovery (Kuhn, 1970). Kuhn articulated the vexation that arises when attempting to assign priority among scientists for a given breakthrough; one example considered whether it was Priestley or Lavoisier who legitimately discovered oxygen (you be the judge). The incremental nature of investigation also proves difcult when seeking to pin down the exact timing that an individual discovery was made: the so-called Eureka moment. Here, Kuhn discussed Roentgens work leading to the description of X-rays and the inability to dene the moment of discovery along the trajectory of that research. Stem cell research is no less a product of cumulative, integrated effort between and within laboratories. Truly, experiencing the collaborative nature of research is among the greatest pleasures in a scientic career. That said, there are bright lines in the history of any eld, moments in which a particular observation drew away the curtain and set researchers on an exciting new course. In the 112 years since its inception, the Nobel Prize in Physiology or Medicine has recognized the contributions of luminaries within their respective disciplines. Pavlov, Cajal, Fleming, Luria, McClintock, Krebs, and many others, some of whom will be discussed below, were joined in 2012 by Sir John B. Gurdon and Shinya Yamanaka in recognition of their groundbreaking work showing that .mature cells can be reprogrammed to become pluripotent (2012 Nobel Prize winners in medicine, http://www.nobelprize.
Stem Cell Reports

Review
Figure 1. Winners of the 2012 Nobel Prize in Physiology or Medicine: Sir John B. Gurdon and Shinya Yamanaka The photo was taken at the ISSCR-Roddenberry International Symposium on Cellular Reprogramming only 10 days after the announcement of the laureates for 2012. Photo credit: Chris Goodfellow/Gladstone Institutes.
to note that of late, face, hand, even limb transplantations have actually taken place. The years prior to the dawn of the 19th century brought additional advances; no doubt considered unrelated at the time but when looking back with the perfect vision of hindsight, nevertheless dene a continuum of discovery leading to the 2012 Nobels. Among these are the rst publications during the Renaissance describing human teratomas, benign tumors bearing representative tissues from all three somatic germ layers: ectoderm, mesoderm, and endoderm (e.g., Birch and Tyson, 1683; Scultetus, 1658; Yonge, 1706). Today, we understand teratomas to derive from germ cell precursors (Teilum, 1965), arising primarily within the gonad of both sexes but also occurring throughout the mediastinum given the migratory route of primordial germ cells prior to their arrival in the genital ridge during embryogenesis (Witschi, 1948). Given their three germ layer composition, the tumor-initiating cell of a teratoma is termed pluripotent or capable of forming all tissue types found in the adult soma (for review, see Lensch et al., 2007). Flashing forward to the mid-1950s, it was Leroy Stevens working at the Jackson Laboratory who noted that the low frequency of testicular teratoma present in the inbred 129 mouse strain had a genetic basis that might be capable of amplication to the point of study at the cellular level (Stevens and Little, 1954). Stevens work would link the descriptive studies of mid-17th century medical curiosities to the clonal isolation of the rst pluripotent stem cells in mice: the embryonal carcinoma
(EC) cell (Kleinsmith and Pierce, 1964) (Figure 2), which has served as an invaluable resource capable of culture in vitro (Martin and Evans, 1974) and permitting investigators to probe many mysteries of early development (for review, see Andrews, 2002). More on pluripotency momentarily. The Renaissance also marked the rst medically related transfer of cells into a human patient, the unfortunate Mr. Arthur Coga, in the form of blood transfusions using a rather surprising donor: a young sheep (Lower and King, 1667). The invention of this procedure also launched a furious priority of discovery battle between French and English physicians that played out within the pages of the Philosophical Transactions for several issues, despite the fact that animal-into-human blood transfusion proved to be a disappointing clinical practice. Moving ahead less than 100 years, experiments began to be much better dened. Some regard Abraham Trembley as the legitimate forbearer of regeneration research (see Parson, 2004). A winner of the Copley Medal of the Royal Society of London in the year 1743 in recognition of his investigations of freshwater hydrozoans, Trembley would publish his master work in 1744 that detailed the hydras regenerative capacity following experimental dissections of tremendous variety (Trembley, 1744). The work set the stage for the edgling eld of experimental zoology in general and the empirical study of regeneration in particular. Down the Rabbit Hole 1797 was a banner year in developmental biology. Cruikshank published his description of developing staged embryos in vivo within the rabbit fallopian tubes and uterus extending to the early somite stages (Cruikshank, 1797). The work within the Cruikshank paper was performed nearly 20 years prior to publication and stands as a milestone in the eld of embryology. The study was facilitated in part by mentoring and funding from his senior colleague, the renowned scientist and surgeon John Hunter. The study would not have been possible but for improvements in optics, and earlier works detailing the features of the mammalian reproductive system. Cruikshanks paper relies upon and cites prior studies, some in Latin, by Leuwenhoek, Harvey, and De Graaf, among others. It also highlights the importance of using appropriate model organisms in research when seeking to better understand the complexities of mammalian embryonic development. It was the research of yet another rabbit fancier, Walter Heape, that profoundly altered scientic views on gestation and development and in a manner that runs counter to his present scientic obscurity. Working at Cambridge in the 1890s, Heape performed the rst live-embryo transfer experiment when he mated purebred Angora rabbits
Stem Cell Reports

Review
Figure 2. Relationships between Pluripotent Stem Cells and Embryos: 50 Years of History in Mice Pluripotent stem cells can arise from NTderived (cloned) blastocysts, fertilized embryos or teratocarcinomas, spontaneous tumors of the testis, or tumors induced by transferring early embryos to extrauterine sites. ESCs and EC cells will form chimeras if introduced into preimplantation embryos that are transferred to a pseudopregnant female mother. ESCs will be chimeric in the germline and give rise to sperm and eggs, but EC cells do not chimerize the germline. A less stringent test for pluripotency of ESCs than germline contribution is the ability to form benign teratomas after injection in immune-decient mice. This test is also used to demonstrate pluripotency in human ESCs. A more stringent test is tetraploid complementation, where the entire postnatal animal is ESC derived. Teratocarcinomas are thought to derive spontaneously from deregulated primordial germ cells (PGCs) that give rise to the gametes. Pluripotent stem cell lines can also be derived as embryonic germ (EG) cells directly from PGCs. mEC, mouse embryonal carcinoma; mESC, mouse embryonic stem cell; miPSC, mouse induced pluripotent stem cell; mEG, mouse embryonic germ.
(with white, uffy fur), isolated the developing embryos 32 hr later at the four-cell stage, and placed them into the distal end of the fallopian tube of a purebred, Belgian rabbit doe mated for the rst time only 3 hr earlier to a purebred Belgian buck (a breed with short, brown fur) (Heape, 1890). The thinking of the day suggested that the uterine environment of the Belgian might have an inductive effect on the transferred embryos, perhaps contributing characteristics in a horizontal manner, conforming to the views of Lamarck among others, to the gestating Angoras provided they grew in the foster uterus at all. Heapes paper of barely two pages likely caused a stir at the Royal Society when it reported the live birth of four Belgian offspring and two undeniable Angoras, the exact number he had transferred. Heape painstakingly built upon these studies, becoming an acionado of articial insemination tech-
niques as he focused his later efforts on estrus. His work in some ways sounded the starters pistol for later research into entities such as embryonic chimeras and the derivation and culture of mammalian embryonic cell lines in vitro. Heape was also a contemporary of August Weismann ce to the who would not only deliver the coup de gra Lamarckian concept of the transmissibility of acquired characteristics but who would also throw down the proverbial gauntlet within the eld to experimentally dene the genetic basis of developmental specication within a growing organism. Nuclear EquivalenceThe Sine Qua Non of Cellular Reprogramming The University of Freiburgs August Weismann was an intellectual giant and champion of the germ-plasm theory,
Stem Cell Reports

Review
which states that characteristics are inherited only from cells in the germline, not the soma (Weismann, 1893). His 1889 landmark publication falsied Lamarcks view that acquired characteristics, such as somatic mutilations, would be inherited by the offspring of the aficted animal (Weismann, 1889). To prove this, Weismann performed a simple experiment: he cut off the tails of seven female and ve male white mice and then mated them to one another. When their offspring were born, he measured their tail length, recorded it, and then snipped their tails as well. These F1s were raised to adulthood, bred, and their offspring were treated in the same manner. The process was repeated for ve generations and a total of 901 mice. Despite his efforts, Weismann found that tail length did not decline, and whereas he would not state that it never could if there were an innite number of iterations, he condently concluded that over the span of a few generations, acquired mutilations to the soma had no measurable heritability. Whatever shaped subsequent generations, it came from the gametes alone. Turning his attention to development, he then asked a related question: How does the cellular diversity present within a complicated multicellular organism arise from a single starting cell? Others had long wondered the same thing, and among the more prevalent theories was that of preformation that described an unfolding of structures present a priori: many small but incomplete individuals in the gametes that grew larger during development. Such a notion was in tension with tenets of the germ-plasm theory given that determinants must be present within the dividing zygote that would be allocated only to the germline and not the somatic cells. Weismann proposed that as the early embryo cleaved, the genes were divided among daughter cells, with the possible exception of the germline that would by necessity contain an entire complement (termed the idioplasm), and that this series of qualitative divisions was the basis of cellular lineage specication. The mechanisms by which this segregation would take place were difcult to envision, and noted biologists, including Theodor Boveri, were quick to point this out along with additional criticisms. However, such a theory had also been proposed by the experimentalist Wilhelm Roux, who set out to test the hypothesis. Roux reasoned that if qualitative division accounted for different developmental trajectories within an embryo, then early removal of individual cells should prohibit formation of an entire organism. He tested this by pricking one cell of a two-celled frog embryo using a heated needle. Roux found that this procedure compromised the developmental capacity of entire embryos in support of the qualitative division theory (Roux, 1888). Work by others, including Thomas Hunt Morgan (Nobel Prize, 1933) (Morgan, 1895), arrived at similar conclusions though,
importantly, would also suggest that experimental artifacts, such as whether or not one left the damaged cell in contact with the remaining intact cell, urged additional experiments. Among those taking up the question but employing alternative approaches were Oscar Hertwig, Hermann Endres, Amedeo Herlitzka, and Hans Driesch (see Spemann, 1938). Driesch used a different model organism, the sea urchin, and a new technique to disaggregate the blastomeres at the two-cell stage. Employing the method of calcium-depleted sea water devised by the embryologist Curt Herbst, the sea urchin blastomeres were easily separated from one another following gentle agitation and developed into two complete organisms (Driesch, 1891). Not only was this perhaps the rst cloning experiment, it also disagreed with Weismann and Roux. Yet, another approach and model organism would provide the most convincing evidence that Weismanns theory was likely incorrect. Hans Spemann (Nobel Prize, 1935), also of the University of Freiburg, and his colleague Hilde Mangold were dedicated experimentalists interested in a wide variety of developmental phenomenon ranging from eye formation to early embryonic organizers and patterning. The work of Roux et al. was of great interest to Spemann, and he entered the fray using fertilized eggs of the common newt, Triton taeniatus. He also turned to an experimental approach developed by Oscar Hertwig, namely the use of thin, exible bers (ranging from silk threads to the hair from a babys head in practice) to constrict developing embryos into halves. Using this method and building upon earlier attempts by Endres and Herlitzka, Spemann was the rst to clone a developing vertebrate (via forced-twinning, if you will) when he published results demonstrating the complete development of newts originating from the same egg (Spemann, 1928). Spemanns experiment drove the nails into the cofn of Weismann and Rouxs position. The work suggested that the complement of genes in the various cells of developing organisms was the same, a concept termed nuclear equivalence. Although Spemanns experiment fails to explain exactly how cellular lineage specication does occur, it rather importantly shows how it does not. The qualitative division theory was out. Thanks to Spemanns work, we now know that developmental changes arise by epigenesis: the selective restriction of gene expression from among the entire genomic complement present within the many cell and tissue types in the body. Later investigators including the University of Edinburghs Conrad Hal Waddington would eloquently theorize about the effect of epigenetic restriction on cellular identity (Waddington, 1957). Dening the molecular details of lineage specication remains at the cutting edge of current science.
Stem Cell Reports

Review
Ten years later, in his classical work Embryonic Development and Induction (Spemann, 1938), Spemann would issue marching orders to the next wave of researchers seeking to further test the validity of nuclear equivalence when he wrote (on page 211):
Decisive information about this question may perhaps be afforded by an experiment which appears, at rst sight, to be somewhat fantastical . Probably the same effect could be attained if one could isolate the nuclei of the morula and introduce one of them into an egg or an egg fragment without an egg nucleus . This experiment might possibly show that even nuclei of differentiated cells can initiate normal development in the egg protoplasm.
Why didnt Spemann attempt the experiment himself? The answer is that whereas he had ideas for how to isolate nuclei by grinding cells between glass slides, he did not know how to transfer a free nucleus into another cell. The idea would have to wait 14 years to be taken up in earnest by two investigators from Philadelphia. When Fantasy Becomes Reality The story goes that Robert Briggs had not heard of Spemanns fantastical idea. However, a senior colleague of his, the Drosophila geneticist Jack Schultz (who himself had been a student of Morgans), brought the experiment to his attention. Briggs invited a young fellow, the embryologist Thomas J. King, to join him, and together with technical assistance from Marie DiBerardino, they put Spemanns proposal to the test. Like Weismanns determination that the conclusions made from his tail clipping experiments could not be extrapolated beyond the number of generations he had actually tested, Spemann likewise knew that his own data regarding nuclear equivalence extended only as far as the developmental stage of the embryos he had used. Was it possible that at some later developmental stage nuclear equivalence might be invalid? This was the hypothesis tested in Briggs and Kings nuclear transfer (NT) studies. To develop the NT method, the model organism of choice for the majority of the work was the frog Rana pipiens, though among the many clever components in the paper was the intentional construction of R. pipiens/ Rana catesbeiana hybrid nuclei as a validation of the transfer procedure (Briggs and King, 1952). The recipient egg is activated via needle prick, which causes the cytoplasm to rotate and enables the aspiration of the pronucleus with a glass needle. The jelly coating of the egg is then removed, and attention turns to obtaining donor nuclei. Animal pole cells within the donor blastula are individually dissected away from the mass so that single cells may be drawn into a glass pipette with an inner
diameter less than that of the donor cell. Drawing the donor cell into the narrow pipette causes it to rupture, at which point it is injected into the recipient-enucleated egg. The investigators obtained nuclei from the blastula stage of development when the cleaving structure contains thousands of cells. Their data indicate that of 194 eggs injected, 104 cleaved (52.8%), and 63 of these (60.6%) went on to reform complete blastulae. What is more, of 50 complete, reconstituted blastulae that were allowed to develop beyond the stage from which the nuclei had been obtained, roughly three-quarters completed normal gastrulation, and half of these went on successfully beyond the neurula stage, the point at which the neural tube forms. Thus, not only was nuclear equivalence maintained at a stage of organismal development containing thousands of cells, but the nuclei also remained fully capable of guiding integrated development onward in the majority of cases. Caveats of the work, also discussed by the authors, include the transfer of a small amount of blastula cell cytoplasm along with the donor nucleus, which may have inuenced the experimental outcome, perhaps by diluting the much greater volume of egg cytoplasm. Also, and as similarly observed by other experimentalists mentioned above, the interpretations of the work extended only so far as the age of the donor nuclei employed. The use of blastula nuclei, and not those from later stages of development, was intentional in the Briggs and King study because they wished to determine the efciency of the technique using nuclei from an undifferentiated cell type bearing a high probability for supporting full development. Their goal in 1952 was not to see how far they could push the system but whether it would work at all. Still, the study was a tour de force, and the establishment of the NT technique would permit others to ask even bolder questions regarding nuclear equivalence. Among the earliest investigators attempting NT was a group at the University of Oxford that used it in another species of frog, Xenopus laevis (Fischberg et al., 1958). That team included a young graduate student named John Gurdon (Nobel Prize, 2012). NT Comes of Age Gurdon produced a cavalcade of high-impact work using NT to investigate the developmental potency of differentiating nuclei. Among these studies was the demonstration that despite a low frequency of success, highly specialized and differentiated cells from tissues such as the intestinal tract maintained the ability to complement the lost potential of the enucleated egg (Gurdon, 1962). Such NT-derived frogs, proven to be entirely donor nucleus derived via cellular lineage tracing, could even developmentally
Stem Cell Reports

Review
progress to the point of fertility provided that a serial transplantation scheme was employed in which NT embryos derived from intestinal cell donors were permitted to develop to the blastulae stage and then used in a second round of NT. In this subsequent stage, NT blastula-derived nuclei were obtained for another round of NT from which embryos were allowed to develop to adulthood and tested for reproductive capacity (Gurdon and Uehlinger, 1966). The correlation between declining nuclear potency and increasing developmental maturity of donor cells was another key insight (Gurdon, 1960). Despite the inefciency of NT, the technique could be used to generate functioning organisms from additional types of differentiated cells as nuclear donors. Tissues as developmentally mature as keratinocytes (Gurdon et al., 1975) and lymphocytes (Wabl et al., 1975) would nevertheless prove capable of complementing enucleated frog eggs in rare cases. Gurdons pioneering work paved the way for a wealth of studies demonstrating that even mammals like sheep (Campbell et al., 1996; Wilmut et al., 1997) and mice (Wakayama et al., 1998, 2000) could be cloned. In fact, it is important to point out that in examples such as Dolly the sheep (the rst mature mammal to be directly cloned in a single round of NT; Wilmut et al., 1997), and the rst cloned mice (Wakayama et al., 1998), the transferred nuclei were restored or reprogrammed to totipotency, i.e., the ability to form not only all of the cells of the adult organism (as is the case for pluripotency) but also the entire cadre of extraembryonic tissues including the trophectoderm of the placenta. Later studies would sharpen the nuclear equivalency point by demonstrating that cells as fully differentiated as murine B and T lymphocytes were capable of producing monoclonal mice following a multistep procedure wherein NT was performed to generate blastocysts from which embryonic stem cells (ESCs) were derived that in turn were used to chimerize diploid or tetraploid embryos (Hochedlinger and Jaenisch, 2002) (Figure 2). In the case of tetraploid complementation, murine embryos fused at the two-cell stage (yielding a 4n embryo, which contains four haploid genome equivalents) will support the growth of the trophectoderm, but not the inner cell mass of the embryo from which the embryonic mouse arises; transferring diploid (2n) pluripotent stem cells into 4n blastocysts complements their inability to complete development (Nagy et al., 1990). In the case of the tetraploid studies, the lymphocyte origin of the resulting animals was veried by immunoglobulin gene rearrangement signatures in all tissues. Even the nuclei of sensory neurons retain the rare ability to produce mice via a similar, multistep approach and tetraploid complementation, where once again, the origins of the cells in the resulting mice were veried via cellular lineage tracing (Eggan et al., 2004).
A good experiment generates questions as well as answers. Although decades of work provide overwhelming support to the validity of nuclear equivalence, they fail to explain why NT works at all. What is the mechanism by which the egg cytoplasm instructs the incoming nucleus to reset its epigenetic state to a much earlier form? What factors are involved? What are the central genetic regulators of pluripotency or even totipotency? Although many have pondered these same questions, it would be investigators working at Kyoto University in the mid-2000s who offered some rather provocative responses. Before we get to that, it is worth dipping back briey into the history books once again. The First Isolation of Native ESCs Going back to the mouse experiments on teratomas mentioned earlier and the isolation of pluripotent EC cells, it was known that despite being obtained from abnormal tissue growths (see Lensch and Ince, 2007), EC could nevertheless contribute to the soma once transferred into normal embryos (Brinster, 1974). It was a natural step to then consider whether or not pluripotent cells were capable of isolation from normal tissues, i.e., the early, preimplantation embryo. The answer to this question was a resounding yes, and in 1981, Martin Evans (Nobel Prize, 2007) and Matthew Kaufman from the University of Cambridge (Evans and Kaufman, 1981) and their colleague Gail Martin from the University of California-San Francisco (Martin, 1981) independently published papers describing the generation, extended culture, and differentiation capacity of lines of ESCs. For Evans ESC isolations from the 129 mouse strain, a state of diapause or arrest of embryonic development (for review, Lopes et al., 2004) was imposed via ovariectomy 2.5 days after mating. This caused embryos hatched from the zona pellucida to increase their cell numbers somewhat without implantation prior to recovery less than 1 week later. Explanted blastocysts were then cocultured on a feeder layer of immortalized murine broblast STO cells in serum-containing media, yielding lines of cells resembling EC cells but with a normal karyotype. The investigators also demonstrated their developmental capacity via in vitro differentiation as cystic embryoid bodies, teratoma formation in vivo, and, though not detailed in this rst publication, mouse chimeras. Investigators have long been able to also obtain and study the gametes and developing concepti of many other species including humans (e.g., Jordan, 1918). Extensive study of ovulation, fertilization, and embryo transfer (for review, see Biggers, 2012; Johnson, 2010) would prove capable of clinical application when Patrick Steptoe and Robert Edward (Nobel Prize, 2010) assisted the formerly childless Brown family to bring Louise into the world; the
Stem Cell Reports

Review
rst human being in history to arise via in vitro fertilization (IVF) (Steptoe and Edwards, 1978). In 1994, Arif Bongso, an IVF specialist at the University Hospital of Singapore, managed to obtain stem cell-like colonies from surplus IVF embryos (Bongso et al., 1994) but had little experience in culture of pluripotent cells or access to their markers so was unable to establish lines and prove their identity. However, in 1998, James A. Thomson and colleagues from the University of Wisconsin demonstrated that stem cell colonies could likewise be obtained by culturing human embryos, which were generated by IVF for implantation but then donated to research (Thomson et al., 1998). Thomsons group managed to establish these colonies as cell lines. The culture conditions used were similar to those employed for their murine counterparts. A total of 14 inner cell masses were obtained, and ve distinct lines of human ESCs arising from ve different embryos were derived. Each had a normal karyotype and proved capable of teratoma formation in immunodecient murine hosts. Both murine and human ESCs express a variety of markers similar to proteins found in EC cells as well as normal cells present in the early embryo, including TRA-1-60, various stage-specic embryonic antigens (SSEAs), and alkaline phosphatase. ESCs also express telomerase and maintain telomere length provided they are cultured in conditions supporting the maintenance of pluripotency, which for murine ESCs, includes culture medium containing leukemia-inhibitory factor or LIF (Smith et al., 1988; Williams et al., 1988). Beyond the value of their contribution to the growing lexicon of species from which ESCs might be derived, the generation of human ESCs permitted study of the earliest stages of human development in an empirical, hypothesis-driven manner. Never before had it been possible to study human tissue genesis, from the very rst stages of uncommitted precursor cells through the elaboration of differentiated cell types, as it happened in vitro. Furthermore, if combined with NT in a platform where the donor nuclei were obtained from patient biopsies bearing genetic disease, then one might additionally be able to probe the impact of disease-causing genetic lesions on development or even use the technology to dene how to regenerate matched tissue for direct replacement as a cellular therapy. As such, it is impossible to overstate the excitement, potential impact, and value of human ESCs to the study of human development, disease, and decay. Following years of study, human NT was nally successful provided the egg pronucleus was left in place; lines of human NT-derived ES cells were derived albeit containing triploid genomes (Noggle et al., 2011). However, while this review was in press, human cellular reprogramming studies took a leap forward when the laboratory of
Shoukhrat Mitalipov at Oregon Health & Science University published the highly efcient derivation of multiple lines of diploid hESC via NT, a process that was successful (in part) due to the use of 1.25 mM caffeine to protect oocytes from premature activation during spindle removal (Tachibana et al., 2013). What if it were possible to generate disease- and patient-specic lines of human pluripotent stem cells in a manner that did not rely on NT? Cellular Reprogramming Changes the Game A wealth of fascinating research was presented by scientists from around the world at the 2006 meeting of the International Society for Stem Cell Research (ISSCR) in Toronto, Ontario. Among the hundreds of posters and oral presentations delivered that year, the work of two investigators from Kyoto University, Kazutoshi Takahashi and Shinya Yamanaka (Nobel Prize, 2012), would not only fundamentally alter the eld for years to come but with a degree of rapidity unparalleled in modern science. Simply put, their methodological approach to generate lines of induced pluripotent stem or iPS cells was a saltatory breakthrough of massive proportions that took the world of cell and developmental biology by storm. Publishing their full manuscript later that year, the researchers demonstrated that a combination of four retrovirally delivered factors, Oct4, Klf4, Sox2, and cMyc, was capable of reprogramming murine adult and embryonic broblasts to pluripotency (Takahashi and Yamanaka, 2006). Theirs was not the rst time that scientists had demonstrated that nuclear equivalence permits lineage reassignment by forced gene expression. Working in the 1980s at the Fred Hutchinson Cancer Research Center, Harold Hal Weintraub and colleagues had successfully converted mouse broblasts to muscleforming myoblasts via the enforced expression of a master muscle transcription factor they had identied: MyoD (Davis et al., 1987; Lassar et al., 1986; Tapscott et al., 1988). The fulcrum around which reprogramming capability appears to revolve is the correct identication of proximal transcriptional regulators within a given lineage, those capable of imposing a larger transcriptional prole specic to the intended tissue. The team from Kyoto theorized that similarly acting transactivators likely existed in pluripotent cells that given the proper context and culture conditions, might prove capable of reprogramming somatic cells to earlier stages of development. These insights were gleaned from the aforementioned NT studies as well as the use of cell fusion to study the contingencies of phenotype in hybrid cells (Miller and Ruddle, 1976). For several decades prior to the turn of the 21st century, researchers investigated the capacity of various cell types to functionally inuence or reprogram one another following cell fusion (for review, see Graf, 2011). Although
Stem Cell Reports

Review
early attempts to probe the developmental plasticity of fusions between mouse teratocarcinoma-derived EC cells and mature cell types such as broblasts were inconclusive, perhaps due to the specic EC lines used (e.g., Finch and Ephrussi, 1967; Jami et al., 1973), other studies would clearly demonstrate that the resulting hybrids were pluripotent (e.g., Miller and Ruddle, 1976; Andrews and Goodfellow, 1980). Despite abnormal ploidy, cell fusion hybrids were capable of forming multilineage teratomas, a measure of potency arising from the EC component, while simultaneously (and unambiguously) demonstrating continued expression of genes from the fusion partner such as glucose phosphate isomerase (Miller and Ruddle, 1976). Later work showed that mouse ESCs were likewise capable of imposing pluripotency onto hybrids generated using a diverse array of somatic cell fusion partners including T cells (Tada et al., 2001), splenocytes (Matveeva et al., 1998), bone marrow (Terada et al., 2002), and neural progenitors (Ying et al., 2002). Human ESC-broblast fusion products are also pluripotent (Cowan et al., 2005). What is more, despite the fact that all components from each parent cell are present in the resulting hybrid, fusion experiments following density gradient centrifugation to obtain either ESC karyoplasts or cytoplasts revealed that it is not the cytoplasm but rather the nucleus that contains whatever factors are responsible for reactivating embryonic gene expression in the somatic partner (Do and ler, 2004). Identifying these factors would permit Scho virtually any type of cell to be reprogrammed to pluripotency. The approach used by Takahashi and Yamanaka was ingenious and involved compiling a set of 24 candidate factors: genes that were known to be highly associated with pluripotency via prior studies in knockout mice, ES, EC, and germ cells. All 24 factors were delivered to broblasts in a selection-based system in which the gene Fbx15 drove a cassette conferring resistance to the antibiotic neomycin. The choice of the Fbx15 gene was important as though it is expressed in ESCs and the early embryo it is not expressed in broblasts and thus, only reprogrammed cells would be drug resistant. Additionally, Fbx15 knockout mice are viable, and thus, gene targeting to introduce the neo-cassette was unlikely to impair pluripotency while at the same time ensuring that reprogramming-induced expression of Fbx15 would produce an efcient system with a low false-positive rate. The 24-factor approach produced a certain threshold of colony formation that permitted the investigators to initiate a subtraction assay. One by one, single members of the set of 24 were removed to evaluate the remaining 23 in order to identify which genes were indispensable for colony growth. This resulted in the nal set of four Yamanaka factors.
The rst iPS cells met many of the functional standards of mouse ESCs. They contained hypomethylated promoters relative to the parent broblasts for pluripotencyassociated genes including Nanog and Fbx15, grew in colonies in vitro that were morphologically similar to mouse ESCs, expressed SSEA-1 and alkaline-phosphatase, had a normal karyotype, clustered with mouse ESCs and away from broblasts in gene expression microarray analysis, demonstrated expression of tissue-specic markers such as smooth muscle actin and b-III tubulin when differentiated in vitro, formed teratomas when injected into murine hosts, and chimerized recipient embryos as far as E13.5. However, there were important measures of performance that the rst iPS cells failed to meet including that there were no live-born chimeric mice, and no studies were capable of demonstrating denitive germline contribution, even among midgestation embryos. The reprogramming frequency was also very low, hovering somewhere around one colony per 6,000 starting broblasts. By the following year, investigators would rene the approach by driving drug-resistance/selection from other pluripotency-associated genes, a change that permitted live-born chimeras with germline contributions (Maherali et al., 2007; Okita et al., 2007; Wernig et al., 2007). Importantly, the basic four-factor approach remained otherwise unaltered, suggesting that the process likely produced a distribution of cell types reprogrammed to different degrees and capable of isolation or enrichment using alternative techniques such as Fbx15 or Nanog-driven drug selection. The application of cellular reprogramming to human cells followed quite rapidly, also taking place at the conclusion of the year 2007 (Park et al., 2008b, which was published online December 23, 2007; Takahashi et al., 2007; Yu et al., 2007). Interestingly, the human iPS cells from the Thomson lab were generated using a somewhat different combination of factors, namely OCT4, SOX2, NANOG, and LIN28 (Yu et al., 2007). LIN28 is a protein demonstrated to be a central player in the maintenance of pluripotency via the modulation of the let7 family of microRNAs, which in turn regulate a variety of cellular oncogenes (Viswanathan et al., 2008). Apparently, there are many roads leading to pluripotency. Additionally, whereas the cocktail of four genes appears at rst glance to be a fairly simple recipe for imposing such a profound developmental change onto cells, it is worth pointing out that OCT4 and SOX2 each impact hundreds of other genes in an extensive regulatory network (Boyer et al., 2005; Kim et al., 2008; Loh et al., 2006). Considering the goal of being able to generate lines of human pluripotent stem cells that are matched to specic patients, either to study genetic disease or as a possible resource for regenerative therapy, iPS cells have a great
Stem Cell Reports

Review
Figure 3. Derivation and Use of Human Pluripotent Stem Cells Human ES cells (hESCs) and iPS cells (hiPSCs) have immediate applications in modeling disease, drug discovery, and safety pharmacology. Genetic or other correction provides the appropriate control cells for these studies. hESCs can be targeted genetically to create disease models and introduce different mutations on an isogenic background. Alternatively, disease-specic hESCs can be derived from embryos that are rejected after preimplantation genetic diagnosis (PGD). Longer-term applications are thought to be in cell transplantation therapy. The prototype human pluripotent stem cells are EC stem cells (hECs) derived from spontaneous teratocarcinomas. As in mice, pluripotent stem cells can also be derived from primordial germ cells in humans as human embryonic germ cells (hEGCs), but these have usually not become stable lines (data not shown).
deal to offer. The rst lines of disease-specic human iPS cells included a sizeable compendium representing a wide variety of complex, inherited, multifactorial, and singlegene human conditions including Parkinson disease, type I diabetes, Gaucher disease, Down syndrome, and others (Park et al., 2008a) along with those derived from a patient with ALS (Dimos et al., 2008). The renement of iPS cell methods and applications has been nothing short of inspired. Given that these subjects have been extensively reviewed elsewhere, we will not focus upon them here but will provide an overview of the most immediate applications (Figure 3). Observing that between Yamanakas rst announcement of his revolutionary reprogramming methodology in Toronto and his naming as a Nobel Laureate in Physiology or Medicine, along with Sir John Gurdon, a short 6 years later, stands as a testament to the robustness of his approach, its rapid and wide-ranging acceptance within the eld, and the vast array of exciting opportunities it presents to basic science and biomedicine. Looking Ahead Many authors have and will provide conjecture regarding the future of this eld. Among the more provocative twists and turns of late are the papers indicating that cellular reprogramming need not necessarily transit through a pluripotent cell intermediate. Rather direct reprogramming from and to a variety of mature or progenitor cell types is possible via forced expression of sets of lineageassociated genes. Examples include converting broblasts to neurons in mouse cells via the genes Brn2, Myt1l, and Ascl1 (Vierbuchen et al., 2010) and in human cells using a slightly different mix of BRN2 and MYT1L plus the
miR-124 microRNA (Ambasudhan et al., 2011). Again, the outward simplicity of a handful of genes capable of reprogramming cells hides the deeper truth of extensive chromatin rearrangements that take place when cells adopt a new identity. Beyond experiments such as these, it is interesting to wonder what the outer limits of cellular reprogramming might be. Can any type of cell be converted to any other type of cell? Given the correct genetic inducements along with culture conditions capable of fostering cellular intermediates during the transition, perhaps the answer is yes. That said, single cells do exist that present a rather high bar for reprogramming including those with nondiploid genetic content like red blood cells (which have no nucleus at all) and megakaryocytes, which may contain up to 128 or more haploid equivalents because their genome endoreduplicates without cytokinesis during their maturation toward platelet production. Taking this question one step further, and in a more provocative vein, we observe that the mammalian zygote is a single cell with a diploid genome. Might it be possible to one day reprogram adult somatic cells to totipotency? In other words, given the appropriate technology, might every cell in the body acquire the developmental potential of a fertilized egg? Given that cellular reprogramming is based upon changing the gene expression of one cell type to that of another, the answer would have to be no. Why? It is because of the curious state of gene expression in the zygote. It has none. The earliest cellular cleavages and stages of postfertilization development are directed by the action of proteins and mRNAs stored in the egg during oogenesisa process involving meiosis and occurring in a completely maternal
Stem Cell Reports

Review
environment (see Mayer et al., 2000; Stitzel and Seydoux, 2007; Tadros and Lipshitz, 2009). In humans, zygotic gene expression appears to be activated somewhere near to or after the eight-cell stage. In mice, it is even earlier at the two-cell stage, but in the single-cell zygote, the genome is silent. Fascinating recent work in mice shows that at least four preimplantation pluripotent cells are required for developmental progression in utero, though half embryos are capable of being stimulated to duplicate the requisite number of cells via modulation of broblast growth factor (FGF) and Wnt signaling such that forced monozygotic twins may even be produced (rather as Spemann) (Morris et al., 2012). However, though the authors managed to enhance the potency of half embryos, their work did not impose zygotic identity onto single cells. Thus, we end by suggesting that cellular reprogramming to totipotency is not possible. The gauntlet has been thrown down. Final Word The growing interest in stem cells among the scientic community and patient groups led to the formation of the ISSCR by Leonard I. Zon and a few enthusiastic supporters just over 10 years ago. This fully edged society now welcomes almost 4,000 delegates to its annual meeting with thousands more following online from their home labs. Its current president is Shinya Yamanaka. The Society anticipates an exponential growth of the eld in the coming decade and is now ready for its own journal, Stem Cell Reports, which launched at the ISSCRs annual meeting in 2013. It is only tting that the inaugural issue of the journal should include an article that reects upon the history of the eld, celebrates some of its heroes, and looks forward in eager anticipation of future work that will improve the quality of life for those with tissue damage, degeneration, or other forms of disease for which stem cell research promises relief. SUPPLEMENTAL INFORMATION
Supplemental Information includes one table and can be found with this article online at http://dx.doi.org/10.1016/j.stemcr. 2013.05.001.
Q. Daley, Heather Rooke, and Samantha Morris for comments on the manuscript; Lucretia McClure, Master Librarian at the Countway Library of Medicine, for assistance in locating classical works; and the generous suggestions of two anonymous reviewers. The authors regret that a more extensive discussion and bibliography are not possible due to space limitations. M.W.L. additionally thanks Grover C. Bagby for encouraging a lifelong interest in the blood. We also thank Bas Blankevoort for gure design. M.W.L. is supported by a Howard Hughes Medical Institute Investigator Award to George Q. Daley, and C.L.M. is supported by an ERC Advanced Award (STEMCARDIOVASC, ERC-2012-AdG-323182). M.W.L. created the concept and text, and C.L.M. designed the gures and edited the manuscript.
REFERENCES
Ambasudhan, R., Talantova, M., Coleman, R., Yuan, X., Zhu, S., Lipton, S.A., and Ding, S. (2011). Direct reprogramming of adult human broblasts to functional neurons under dened conditions. Cell Stem Cell 9, 113118. Andrews, P.W. (2002). From teratocarcinomas to embryonic stem cells. Philos. Trans. R. Soc. Lond. B Biol. Sci. 357, 405417. Andrews, P.W., and Goodfellow, P.N. (1980). Antigen expression by somatic cell hybrids of a murine embryonal carcinoma cell with thymocytes and L cells. Somatic Cell Genet. 6, 271284. Biggers, J.D. (2012). IVF and embryo transfer: historical origin and development. Reprod. Biomed. Online 25, 118127. Birch, S., and Tyson, E. (1683). An extract of two letters from Mr. Sampson Birch, an Alderman and Apothecary at Stafford, concerning an extraordinary birth in Staffordshire, with reections thereon by Edw. Tyson M.D. Fellow of the Coll. of Physitians, and of the R. Society. Philos. Trans. R. Soc. London 13, 281284. Bongso, A., Fong, C.Y., Ng, S.C., and Ratnam, S. (1994). Isolation and culture of inner cell mass cells from human blastocysts. Hum. Reprod. 9, 21102117. Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., et al. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947956. Briggs, R., and King, T.J. (1952). Transplantation of living nuclei from blastula cells into enucleated frogs eggs. Proc. Natl. Acad. Sci. USA 38, 455463. Brinster, R.L. (1974). The effect of cells transferred into the mouse blastocyst on subsequent development. J. Exp. Med. 140, 1049 1056. Campbell, K.H., McWhir, J., Ritchie, W.A., and Wilmut, I. (1996). Sheep cloned by nuclear transfer from a cultured cell line. Nature 380, 6466. Cowan, C.A., Atienza, J., Melton, D.A., and Eggan, K. (2005). Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells. Science 309, 13691373. Cruikshank, W. (1797). Experiments in which, on the third day after impregnation, the ova of rabbits were found in the fallopian tubes; and on the fourth day after impregnation in the uterus
LICENSING INFORMATION
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
ACKNOWLEDGMENTS
The authors wish to thank the following individuals for helpful discussions relating to the preparation of this work: George
Stem Cell Reports

Review
itself; with the rst appearances of the foetus. Philos. Trans. R. Soc. London 87, 197214. Davis, R.L., Weintraub, H., and Lassar, A.B. (1987). Expression of a single transfected cDNA converts broblasts to myoblasts. Cell 51, 9871000. Dimos, J.T., Rodolfa, K.T., Niakan, K.K., Weisenthal, L.M., Mitsumoto, H., Chung, W., Croft, G.F., Saphier, G., Leibel, R., Goland, R., et al. (2008). Induced pluripotent stem cells generated from patients with ALS can be differentiated into motor neurons. Science 321, 12181221. ler, H.R. (2004). Nuclei of embryonic stem cells Do, J.T., and Scho reprogram somatic cells. Stem Cells 22, 941949. Driesch, H. (1891). Entwicklungsmechanische Studien I. Der Wert der ersten beiden Furchungszellen in der Echinodermenentwickelung. Experimentelle Erzeugung von Teil und Doppelbildungen. Ztschr. f. Wiss. Zool. 53, 160183. Duncan, A.W., Dorrell, C., and Grompe, M. (2009). Stem cells and liver regeneration. Gastroenterology 137, 466481. Eggan, K., Baldwin, K., Tackett, M., Osborne, J., Gogos, J., Chess, A., Axel, R., and Jaenisch, R. (2004). Mice cloned from olfactory sensory neurons. Nature 428, 4449. Evans, M.J., and Kaufman, M.H. (1981). Establishment in culture of pluripotential cells from mouse embryos. Nature 292, 154156. Finch, B.W., and Ephrussi, B. (1967). Retention of multiple developmental potentialities by cells of a mouse testicular teratocarcinoma during prolonged culture in vitro and their extinction upon hybridization with cells of permanent lines. Proc. Natl. Acad. Sci. USA 57, 615621. Fischberg, M., Gurdon, J.B., and Elsdale, T.R. (1958). Nuclear transplantation in Xenopus laevis. Nature 181, 424. Graf, T. (2011). Historical origins of transdifferentiation and reprogramming. Cell Stem Cell 9, 504516. Gurdon, J.B. (1960). Factors responsible for the abnormal development of embryos obtained by nuclear transplantation in Xenopus laevis. J. Embryol. Exp. Morphol. 8, 327340. Gurdon, J.B. (1962). The developmental capacity of nuclei taken from intestinal epithelium cells of feeding tadpoles. J. Embryol. Exp. Morphol. 10, 622640. Gurdon, J.B., and Uehlinger, V. (1966). Fertile intestine nuclei. Nature 210, 12401241. Gurdon, J.B., Laskey, R.A., and Reeves, O.R. (1975). The developmental capacity of nuclei transplanted from keratinized skin cells of adult frogs. J. Embryol. Exp. Morphol. 34, 93112. Heape, W. (1890). Preliminary note on the transplantation and growth of mammalian ova within a uterine foster-mother. Proc. R. Soc. Lond. 48, 457458. Hochedlinger, K., and Jaenisch, R. (2002). Monoclonal mice generated by nuclear transfer from mature B and T donor cells. Nature 415, 10351038. Jami, J., Failly, C., and Ritz, E. (1973). Lack of expression of differentiation in mouse teratoma-broblast somatic cell hybrids. Exp. Cell Res. 76, 191199. Johnson, M.H. (2010). Robert Edwards: Nobel Laureate in Physiology or Medicine, Nobel Lecture/Nobel Prize Symposium
in Honour of Robert G. Edwards. Nobel Foundation, http://www. nobelprize.org/nobel_prizes/medicine/laureates/2010/edwards_ lecture.pdf. Jordan, H.E. (1918). A study of a 7mm. human embryo; with special reference to its peculiar spirally twisted form, and its large aortic cell-clusters. Anat. Rec. 14, 479492. Kim, J., Chu, J., Shen, X., Wang, J., and Orkin, S.H. (2008). An extended transcriptional network for pluripotency of embryonic stem cells. Cell 132, 10491061. Kleinsmith, L.J., and Pierce, G.B., Jr. (1964). Multipotentiality of single embryonal carcinoma cells. Cancer Res. 24, 15441551. Kuhn, T.S. (1970). The Structure of Scientic Revolutions, Second Edition (Chicago: University of Chicago Press). Lassar, A.B., Paterson, B.M., and Weintraub, H. (1986). Transfection of a DNA locus that mediates the conversion of 10T1/2 broblasts to myoblasts. Cell 47, 649656. Lensch, M.W., and Ince, T.A. (2007). The terminology of teratocarcinomas and teratomas. Nat. Biotechnol. 25, 1211, author reply 12111212. Lensch, M.W., Schlaeger, T.M., Zon, L.I., and Daley, G.Q. (2007). Teratoma formation assays with human embryonic stem cells: a rationale for one type of human-animal chimera. Cell Stem Cell 1, 253258. Loh, Y.H., Wu, Q., Chew, J.L., Vega, V.B., Zhang, W., Chen, X., Bourque, G., George, J., Leong, B., Liu, J., et al. (2006). The Oct4 and Nanog transcription network regulates pluripotency in mouse embryonic stem cells. Nat. Genet. 38, 431440. Lopes, F.L., Desmarais, J.A., and Murphy, B.D. (2004). Embryonic diapause and its regulation. Reproduction 128, 669678. Lower, R., and King, E. (1667). An account of the experiment of transfusion, practised upon a man in London. Philos. Trans. R. Soc. 2, 557559. Maherali, N., Sridharan, R., Xie, W., Utikal, J., Eminli, S., Arnold, K., Stadtfeld, M., Yachechko, R., Tchieu, J., Jaenisch, R., et al. (2007). Directly reprogrammed broblasts show global epigenetic remodeling and widespread tissue contribution. Cell Stem Cell 1, 5570. Martin, G.R. (1981). Isolation of a pluripotent cell line from early mouse embryos cultured in medium conditioned by teratocarcinoma stem cells. Proc. Natl. Acad. Sci. USA 78, 76347638. Martin, G.R., and Evans, M.J. (1974). The morphology and growth of a pluripotent teratocarcinoma cell line and its derivatives in tissue culture. Cell 2, 163172. Matveeva, N.M., Shilov, A.G., Kaftanovskaya, E.M., Maximovsky, L.P., Zhelezova, A.I., Golubitsa, A.N., Bayborodin, S.I., Fokina, M.M., and Serov, O.L. (1998). In vitro and in vivo study of pluripotency in intraspecic hybrid cells obtained by fusion of murine embryonic stem cells with splenocytes. Mol. Reprod. Dev. 50, 128138. Mayer, W., Niveleau, A., Walter, J., Fundele, R., and Haaf, T. (2000). Demethylation of the zygotic paternal genome. Nature 403, 501502. Miller, R.A., and Ruddle, F.H. (1976). Pluripotent teratocarcinomathymus somatic cell hybrids. Cell 9, 4555.
Stem Cell Reports

Review
Morgan, T.H. (1895). Half embryos and whole embryos from one of the rst two blastomeres. Anat. Anz. 10, 623638. Morris, S.A., Guo, Y., and Zernicka-Goetz, M. (2012). Developmental plasticity is bound by pluripotency and the Fgf and Wnt signaling pathways. Cell Rep. 2, 756765. cza, E., Diaz, E.M., Prideaux, V.R., Iva nyi, E., Markkula, Nagy, A., Go M., and Rossant, J. (1990). Embryonic stem cells alone are able to support fetal development in the mouse. Development 110, 815821. Noggle, S., Fung, H.L., Gore, A., Martinez, H., Satriani, K.C., Prosser, R., Oum, K., Paull, D., Druckenmiller, S., Freeby, M., et al. (2011). Human oocytes reprogram somatic cells to a pluripotent state. Nature 478, 7075. Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-competent induced pluripotent stem cells. Nature 448, 313317. Park, I.H., Arora, N., Huo, H., Maherali, N., Ahfeldt, T., Shimamura, A., Lensch, M.W., Cowan, C., Hochedlinger, K., and Daley, G.Q. (2008a). Disease-specic induced pluripotent stem cells. Cell 134, 877886. Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H., Lensch, M.W., and Daley, G.Q. (2008b). Reprogramming of human somatic cells to pluripotency with dened factors. Nature 451, 141146. Parson, A.B. (2004). The Proteus Effect: Stem Cells and Their Promise for Medicine, First Edition (Washington, D.C.: Joseph Henry Press). ge zur Entwickelungsmechanik des EmRoux, W. (1888). Beitra ber die ku nstliche Hervorbringung halber Embryonen bryo. U rung einer der beiden ersten Furchungskugeln, durch Zersto ber die Nachentwickelung (Postgeneration) der fehlenden sowie u rperha lfte: Gesammelte Abhandlungen II. Virchows Arch. 114, Ko 419521. Scultetus, J. (1658). Trichiasis admiranda, sive Morbus pilaris mirabilis observatus a Johanne Sculteto (Norimbergae, Germany: literis Michaelis Enderi). Smith, A.G., Heath, J.K., Donaldson, D.D., Wong, G.G., Moreau, J., Stahl, M., and Rogers, D. (1988). Inhibition of pluripotential embryonic stem cell differentiation by puried polypeptides. Nature 336, 688690. Spemann, H. (1928). Die Entwicklung seitlicher und dorso lften bei verzo gerter Kernversorgung. Ztschr. f. ventraler Keimha Wiss. Zool. 132, 105134. Spemann, H. (1938). Embryonic Development and Induction (New Haven, CT: Yale University Press). Steptoe, P.C., and Edwards, R.G. (1978). Birth after the reimplantation of a human embryo. Lancet 2, 366. Stevens, L.C., and Little, C.C. (1954). Spontaneous testicular teratomas in an inbred strain of mice. Proc. Natl. Acad. Sci. USA 40, 10801087. Stitzel, M.L., and Seydoux, G. (2007). Regulation of the oocyte-tozygote transition. Science 316, 407408. Tachibana, M., Amato, P., Sparman, M., Gutierrez, N.M., TippnerHedges, R., Ma, H., Kang, E., Fulati, A., Lee, H.S., Sritanaudomchai,
H., et al. (2013). Human embryonic stem cells derived by somatic cell nuclear transfer. Cell. Published online on May 15, 2013. http://dx.doi.org/10.1016/j.cell.2013.05.006. Tada, M., Takahama, Y., Abe, K., Nakatsuji, N., and Tada, T. (2001). Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells. Curr. Biol. 11, 15531558. Tadros, W., and Lipshitz, H.D. (2009). The maternal-to-zygotic transition: a play in two acts. Development 136, 30333042. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult broblast cultures by dened factors. Cell 126, 663676. Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K., and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human broblasts by dened factors. Cell 131, 861872. Tapscott, S.J., Davis, R.L., Thayer, M.J., Cheng, P.F., Weintraub, H., and Lassar, A.B. (1988). MyoD1: a nuclear phosphoprotein requiring a Myc homology region to convert broblasts to myoblasts. Science 242, 405411. Teilum, G. (1965). Classication of endodermal sinus tumour (mesoblatoma vitellinum) and so-called embryonal carcinoma of the ovary. Acta Pathol. Microbiol. Scand. 64, 407429. Terada, N., Hamazaki, T., Oka, M., Hoki, M., Mastalerz, D.M., Nakano, Y., Meyer, E.M., Morel, L., Petersen, B.E., and Scott, E.W. (2002). Bone marrow cells adopt the phenotype of other cells by spontaneous cell fusion. Nature 416, 542545. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from human blastocysts. Science 282, 11451147. moires pour Servir a ` Lhistoire dun Genre Trembley, A. (1744). Me de Polypes deau Douce (Leiden, the Netherlands: Jean & Herman Verbeek). dhof, T.C., Vierbuchen, T., Ostermeier, A., Pang, Z.P., Kokubu, Y., Su and Wernig, M. (2010). Direct conversion of broblasts to functional neurons by dened factors. Nature 463, 10351041. Viswanathan, S.R., Daley, G.Q., and Gregory, R.I. (2008). Selective blockade of microRNA processing by Lin28. Science 320, 97100. Wabl, M.R., Brun, R.B., and Du Pasquier, L. (1975). Lymphocytes of the toad Xenopus laevis have the gene set for promoting tadpole development. Science 190, 13101312. Waddington, C.H. (1957). The Strategy of the Genes: A Discussion of Some Aspects of Theoretical Biology (London: Allen and Unwin). Wakayama, T., Perry, A.C., Zuccotti, M., Johnson, K.R., and Yanagimachi, R. (1998). Full-term development of mice from enucleated oocytes injected with cumulus cell nuclei. Nature 394, 369374. Wakayama, T., Shinkai, Y., Tamashiro, K.L., Niida, H., Blanchard, D.C., Blanchard, R.J., Ogura, A., Tanemura, K., Tachibana, M., Perry, A.C., et al. (2000). Cloning of mice to six generations. Nature 407, 318319. Weismann, A. (1889). Essays upon Heredity and Kindred Biological Problems, First Edition, Volume 1 (Oxford: Clarendon Press). Weismann, A. (1893). The Germ-Plasm: A Theory of Heredity (New York: Charles Scribners Sons).
Stem Cell Reports

Review
Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger, K., Bernstein, B.E., and Jaenisch, R. (2007). In vitro reprogramming of broblasts into a pluripotent ES-celllike state. Nature 448, 318324. Williams, R.L., Hilton, D.J., Pease, S., Willson, T.A., Stewart, C.L., Gearing, D.P., Wagner, E.F., Metcalf, D., Nicola, N.A., and Gough, N.M. (1988). Myeloid leukaemia inhibitory factor maintains the developmental potential of embryonic stem cells. Nature 336, 684687. Wilmut, I., Schnieke, A.E., McWhir, J., Kind, A.J., and Campbell, K.H. (1997). Viable offspring derived from fetal and adult mammalian cells. Nature 385, 810813.
Witschi, E. (1948). Migration of the germ cells of human embryos from the yolk sac to the primitive gonadal folds. Contrib. Embryol. 32, 6780. Ying, Q.L., Nichols, J., Evans, E.P., and Smith, A.G. (2002). Changing potency by spontaneous fusion. Nature 416, 545548. Yonge, J. (1706). An account of balls of hair taken from the uterus and ovaria of several women; by Mr. James Yonge, F.R.S. communicated to Dr. Hans Sloane, R.S. Secr. Philos. Trans. R. Soc. 25, 2387 2392. Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced pluripotent stem cell lines derived from human somatic cells. Science 318, 19171920.
Stem Cell Reports

Repor t The Interfollicular Epidermis of Adult Mouse Tail Comprises Two Distinct Cell Lineages that Are Differentially Regulated by Wnt, Edaradd, and Lrig1
line Gomez,1 Wesley Chua,1 Ahmad Miremadi,2 Sven Quist,3 Denis J. Headon,4 and Fiona M. Watt1,* Ce
for Stem Cells and Regenerative Medicine, Kings College London, 28th Floor, Tower Wing, Guys Hospital, Great Maze Pond, London SE1 9RT, UK and Waveney Cellular Pathology Network, The Cotman Centre, Norfolk and Norwich University Hospital, Colney Lane, Norwich NR4 7UB, UK 3Clinic of Dermatology and Venereology, Otto-von-Guericke University, Leipziger Strasse, 39120 Magdeburg, Germany 4The Roslin Institute and Royal (Dick) School of Veterinary Studies, University of Edinburgh, Midlothian, EH25 9RG, UK *Correspondence: ona.watt@kcl.ac.uk http://dx.doi.org/10.1016/j.stemcr.2013.04.001 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Norfolk 1Centre
Current models of how mouse tail interfollicular epidermis (IFE) is maintained overlook the coexistence of two distinct terminal differentiation programs: parakeratotic (scale) and orthokeratotic (interscale). Lineage tracing and clonal analysis revealed that scale and interscale are maintained by unipotent cells in the underlying basal layer, with scale progenitors dividing more rapidly than interscale progenitors. Although scales are pigmented and precisely aligned with hair follicles, melanocytes and follicles were not necessary for scale differentiation. Epidermal Wnt signaling was required for scale enlargement during development and for postnatal maintenance of scaleinterscale boundaries. Loss of Edaradd inhibited ventral scale formation, whereas loss of Lrig1 led to scale enlargement and fusion. In wild-type skin, Lrig1 was not expressed in IFE but was selectively upregulated in dermal broblasts underlying the interscale. We conclude that the different IFE differentiation compartments are maintained by distinct stem cell populations and are regulated by epidermal and dermal signals.
INTRODUCTION
Mammalian epidermis is maintained by stem cells that reside in different locations, express keratin 14 (K14), and typically are anchored to the basement membrane (Arwert et al., 2012; Jensen et al., 2009). Under steady-state conditions, epidermal stem cells only give rise to the differentiated cells that are appropriate for their location, but when the tissue is injured or subjected to genetic modication, they can give rise to any differentiated epidermal lineage (Arwert et al., 2012; Jensen et al., 2009). Lineage tracing using a ubiquitous inducible promoter suggests that mouse interfollicular epidermis (IFE) is maintained by a single population of cells that upon division can produce two basal cells, two differentiated cells, or et al., 2010). In one of each (Clayton et al., 2007; Doupe contrast, combined lineage tracing using K14CreER and CreER driven by a fragment of the Involucrin promoter (Inv) suggests that slow-cycling stem cells give rise to more rapidly cycling committed progenitors that subse et al., quently undergo terminal differentiation (Mascre 2012). Such studies rely on clonal analysis of whole mounts of tail epidermis (Braun et al., 2003), but overlook the fact that there are two programs of terminal differentiation (orthokeratotic and parakeratotic) within tail IFE. This raises the question as to whether the basal layer of tail IFE contains cells with uni- or bipotent differentiation capacity. In tail epidermis, the hair follicles (HFs) are arranged in groups of three (triplets) in staggered rows (Braun et al., 2003). The IFE adjacent to the HFs, known as the interscale IFE, undergoes orthokeratotic differentiation, culminating
in the formation of a granular layer in the outermost viable cell layers and loss of nuclei in the cornied, dead cell layers that cover the surface of the skin. Orthokeratotic differentiation is also characteristic of dorsal IFE. In contrast, tail IFE that is not adjacent to the HFs, known as the scale IFE, undergoes parakeratotic differentiation characterized by the lack of a granular layer and retention of nuclei in the cornied layers. Scales, like HFs, are regularly spaced and arranged in rows that form rings around the tail. The infundibulum of each HF connects with the interscale IFE while the hair shafts overlie the scales. At birth, the entire tail epidermis is orthokeratotic (Didierjean et al., 1983; Schweizer and Marks, 1977). Scale formation is rst detected 9 days after birth (Didierjean et al., 1983; Schweizer and Marks, 1977). Little is known about the mechanisms of scale induction and maintenance, although topical application of vitamin A to adult tail skin reversibly converts scales into interscales (Schweizer et al., 1987). In this study, we examined whether the two programs of tail IFE differentiation arise from a common, bipotent population of cells in the basal layer, and identied signaling pathways that regulate scale formation and maintenance.
RESULTS
Development of Scale and Interscale IFE in Postnatal Tail Epidermis To determine when scale and interscale IFE becomes specied, we labeled postnatal tail epidermis with antibodies
Stem Cell Reports

Differentiation in Interfollicular Epidermis
Figure 1. Differentiation of Scale and Interscale IFE (AI) Sagittal sections of WT tail skin. (AC) Hematoxylin and eosin (H&E) staining. (DF) Immunostaining for FLG (red) and K31 (green). (GI) Immunostaining for K10 (red) and AB1653 (green). Insets are single-stained, enlarged views of the boxed areas. Interscale (arrows); scale (arrowheads); DAPI counterstain (blue); dermo-epidermal junction (white dashed lines). (JQ) Whole mounts of WT tail epidermis. (JL) Immunostaining for K2 (red) and AB1653 (green). (MQ) AB1653 immunostaining (green) with phalloidin (red) counterstain. Images were obtained from the anterior part of the tail. (R) Scales are induced along the dorsal midline at P3 and spread laterally to reach the ventral midline by P14. (S and T) Schematics showing sagittal (S) and whole-mount (T) views of scale and interscale IFE in 2-month-old mice. In all panels, scales are green and interscales are red. Scale bars, 100 mm (AL) and 500 mm (MQ). See also Figure S1.
to laggrin (FLG), keratin 10 (K10), and keratin 2 (K2), three markers of orthokeratotic differentiation (Brown and McLean, 2012; Moll et al., 2008). At birth, tail IFE exhibited a continuous granular layer and expressed FLG in the upper spinous layers (Figures 1A and 1D). K10 and K2 were expressed by cells in all of the underlying suprabasal layers (Figure 1G; Figure S1A available online). At postnatal day 9 (P9), there was focal loss of the granular layer (Figures 1B and 1E), with a corresponding loss of K10 and K2 in the underlying suprabasal cells (Figures 1H and S1B), marking the onset of parakeratosis. At 8 weeks, the alternating pattern of parakeratotic scales and orthokeratotic interscales was fully developed (Figures 1C, 1F, 1I, and S1C). We labeled scale IFE with anti-K31, which in other body sites is conned to HFs (Langbein et al., 1999),
and with AB1653, which recognizes caspase 14 and a range of scale proteins, including keratins (Figures S1D S1G and data not shown). There was complete coexpression of K31 and AB1653 antigens in scale cells at all stages of development (Figures S1HS1J). Single cells undergoing scale differentiation (K31+, AB1653+, K10, and K2) appeared in the suprabasal layers between P0 and P3 (Figures 1D, S1K, and S1L; Didierjean et al., 1983). These became cell clusters that expanded laterally and vertically, until by P14 they extended to the outermost, cornied layers (Figures 1E, 1G, 1H, and S1M). Scale and interscale markers were never coexpressed (Figures 1D1L). Scale induction was initially restricted to the tail dorsal midline (Figures 1M, 1N, and S1NS1O) and then expanded laterally, reaching the ventral midline by P14
Stem Cell Reports

Figure 2. Clonal Analysis of Scale and Interscale Epidermis (A and B) Tail epidermal whole mounts of K14CreER 3 CagcatGFP mice immunostained for GFP and K31 at the stages indicated. (B0 ) Analysis of GFP-positive clones in (B). GFP clones: interscale (pink), scale (orange), encompassing scale and interscale (red), and bordering scale without crossing (blue) or HF (solid pink). (B00 ) Enlargement of the boxed region in (B). (C and D) Quantitation of observed and expected clone types (C) and number of cells per clone (D). t test, *p < 0.05, **p < 0.001. Error bars represent SEM. (E) Rates of cell division in different areas. (F) Immunostaining for K31 (red) and pHH3 (green) of WT P9 tail epidermis. (G) Spatial distribution of pHH3 positive cells. z test, *p < 0.05. Error bars represent SD. (H) Legends and color code for (D), (E), and (G). Scale bars, 100 mm. See also Figure S2. (Figures 1O, 1P, and 1R). Individual scales rst formed in front of each HF triplet, gradually enlarging to reach their nal size by 8 weeks (Figures 1Q and S1P). In adult tail epidermis, involucrin expression is largely conned to interscale IFE (Figure S1Q); almost all involucrin-positive cells are suprabasal and the subset of basal cells that express involucrin lie at the scale-interscale bound pez-Rovira et al., 2005). This is also the case for ary (Lo transgenes expressed under the control of the Inv promoter (Carroll et al., 1995; Lapouge et al., 2011; Fig ures S1R and S1S), indicating that InvCreER (Mascre et al., 2012) will label committed progenitors of interscale and not scale. Figures 1S and 1T illustrate schematically the pattern of scale and interscale IFE differentiation. Scales Are Founded by Unipotent Progenitors To investigate whether scale and interscale differentiated cells arise from a common progenitor population, we used K14CreER to induce GFP expression in single cells in the basal layer of CAG-CAT-eGFP mice upon topical application of 4-hydroxy-tamoxifen (4OHT) at P0. By P2, clones of two to four GFP-positive cells were detected throughout the IFE, widely separated by unlabeled cells (Figures 2A and S2AS2D). We scored the location of individual clones in P9 tail epidermal whole mounts (Figures 2B and 2B0 ). If scale and interscale are founded by bipotential basal et al., 2012), cross-boundary clones should cells (Mascre be detected. In contrast, if they are founded by unipotent basal cells, clones should fall in either the scale or interscale area and should not cross boundaries. To calculate
Stem Cell Reports

the expected number of clones of each type if basal cells are bipotential, we determined that scale accounts for 20% of the total surface area of tail IFE at P9, and assumed that the number of clones in a given area is proportional to its size (Supplemental Experimental Procedures; Figures S2E S2G). Only 4% of the clones examined (n = 344) crossed scale boundaries, which is far fewer than predicted by the bipotent progenitor model (p < 1011; Figure 2C). We found that 31% of the clones had edges that coincided with, but did not cross, boundaries (Figure 2C) and were often elongated in shape, suggesting that they were actively excluded from scales (Figure 2B00 ). The rest of the clones were distributed completely inside scale (6%) or interscale (59%) away from the boundaries (Figure 2C). The observed frequency of all clone types was signicantly different from the expected frequency (Figure 2C). Clones in adult mice remained largely restricted to one compartment (Figures S2HS2K). Clones within scales were signicantly larger than interscale clones, and scale clones that contacted the interscale boundary were larger than those that were fully inside the scales (Figures 2D and 2H). Knowing that clones took 7 days to form (from P2 to P9), we calculated the average cell-cycle time in different regions of tail IFE (Supplemental Experimental Procedures). Cells in scales at the interscale boundary divided every 4.5 days, i.e., faster than cells in the center of scales (5.5 days) and in interscales (67 days; Figures 2E and 2H). We conrmed this by scoring the number of phospho-histone H3 (pHH3)-positive cells (Figures 2F2H). Thus, scales expand by proliferating more rapidly than interscale regions, which explains the contour of interscale clones at scale boundaries (Figure 2B00 ). Since we never observed scales that were uniformly positive for GFP, each scale must be polyclonal in origin. We never observed clones extending between HF and IFE, indicating that scales do not originate from HF stem cells (Arwert et al., 2012). Scale and Interscale Patterning Is Independent of Melanocytes The spatiotemporal activation of scale differentiation from the dorsal to the ventral surface of the tail is reminiscent of the migration path taken by neural crest cells early during development (Sommer, 2011). Neural crest cells are melanocyte precursors, and one striking characteristic of scale IFE is that it contains resident pigmented melanocytes (Figure 3C; Didierjean et al., 1983; Schweizer and Marks, 1977). Double-label immunostaining for dopachrome tautomerase (DCT), a melanocyte and melanoblast marker (Tsukamoto et al., 1992), and K31 showed that melanocytes were located in the basal layer of the IFE prior to the onset of scale differentiation (Figures 3A and 3B).
In cKit mutant mice, neural crest cell migration is impaired and the skin lacks melanocytes (Cable et al., 1995), as conrmed by lack of Sox10 expression (Figures 3D and 3E). Scale formation was normal in cKit mutant mice (Figures 3D and 3E), although scales tended to be smaller because the mice were developmentally delayed. Scale and Interscale Patterning Is Independent of HFs Mice with null mutations in the ectodysplasin pathway have hairless tails (Sundberg, 1994). In Edaradd knockout mutants, a transient condensation of epidermal cells (Figures S3A and S3B), which express P-cadherin but lack the early HF marker Sox9 (Nowak et al., 2008; Figures S3C and S3D), occurs at P0 but disappears by P2 (Schmidt-Ullrich et al., 2006). Scale induction in Edaradd knockout mutants was initiated at P10, signicantly later than in wild-type (WT) mice (Figures 3F and 3G). The number and size of the scales were variable and scales formed only on the dorsal surface (Figures 3GJ, and 3M). Nevertheless, the pattern of scale induction was partly conserved (Figure 3I). Those scales that formed did so normally (Figures S3ES3H). We rescued HF formation by crossing Edaradd knockouts with K14Edaradd transgenic mice (Figures 3K and 3L). In contrast, scale induction was not rescued and no scales formed on the ventral midline (Figures 3K and 3L). We conclude that HF and scale induction can be uncoupled, and identify a role for Edaradd in the ventral induction of scales. Wnt Signaling Controls Scale Shape and Maintenance The Wnt pathway regulates lineage selection in postnatal epidermis (Watt and Collins, 2008). Lef1 was upregulated in the basal layer of adult tail scale, but not interscale or dorsal IFE (Figure 4A, arrows; Niemann et al., 2002). This led us to examine K14DNLef1 mice, in which epidermal Wnt signaling is inhibited by dominant-negative Lef1 (Niemann et al., 2002). Initiation of scale formation was delayed to P4, and K14DNLef1 scales were smaller than WT scales (Figure 4B). This correlated with a decrease in the distance between HF rows and, since tail length was normal, an increase in the number of rows of HF (Figure 4C). Although the rst postnatal hair cycle in K14DNLef1 mice is normal, HFs subsequently convert into IFE cysts with ectopic sebocytes (Niemann et al., 2002). From 2 months (Figures 4D4F and S4AS4D), 10% of scales were irregular in shape and fused or absent, and by 9 months up to 25% of scales were lost (Figures S4A S4D). PHH3 labeling in 4-month-old K14DNLef1 epidermis revealed a selective increase in interscale proliferation relative to WT (Figure S4E). We also used a gain-of-function approach in which a constitutively active form of b-catenin (K14DNb-cateninER)
Stem Cell Reports

Figure 3. Scale Formation Occurs in the Absence of Melanocytes and HF (A and B) Immunostaining of WT tail skin sagittal sections with DCT and K31 antibodies. Melanocytes (red arrows); scale differentiation (green arrows); DAPI counterstain (blue). (C) Bright-eld view of WT 2-month-old tail epidermal whole mount showing scale pigmentation. (D and E) Immunostaining for AB1653 (green) and SOX10 (red) in P20 epidermal whole mount of ckit knockout (E) and WT littermate (D) mice. (FJ) Edaradd knockout tail epidermis labeled with AB1653 (green) and phalloidin (red). (F) n = 6 mice, (G) n = 4, (H and I) n = 10, (J) n = 3. (K and L) Two-month-old Edaradd knockout rescued with K14::Edaradd transgene, labeled with AB1653 (green) and phalloidin (red) (n = 5). (M) Diagram of scale induction in Edaradd knockout. Scale bars, 100 mm (AE) and 500 mm (FL). See also Figure S3.
was induced by topical application of 4OHT for 3 weeks to P2 and adult skin. This led not only to induction of ectopic HF (Lo Celso et al., 2004; Silva-Vargas et al., 2005) but also to expansion of scales and loss of denition of scale-interscale boundaries. In some cases, adjacent scales merged with one another (Figures 4G4I and S4FS4H). The changes in scales did not correspond to sites of ectopic HF formation in the IFE (Figures S4I and S4J). Regulation of Scale Size by Lrig1 Lrig1, a negative regulator of EGF receptor signaling, is a marker of HF junctional zone stem cells (Jensen et al., 2009). The Lrig1-positive population does not contribute to the IFE (Jensen et al., 2009), but loss of Lrig1 results in tail IFE hyperproliferation and increased pigmentation
(Jensen et al., 2009). Scales were induced with the same timing in Lrig1 knockout and WT mice (Figures 4J, 4K, 4M, and 4N). However, scales were larger (Figures 4K and 4N) and were fused laterally (Figures 4L and 4O), consistent with the nding that scale epidermis expands by more rapid proliferation compared with interscale IFE (Figure 2E). Lrig1 is not differentially expressed in WT scale and interscale IFE (Jensen et al., 2009). However, at P1, prior to scale formation, Lrig1 was expressed in the upper dermis in a pattern corresponding to the presumptive interscale (Figures 4P and 4Q). Thus, Lrig1 may control the size of the scale compartment by differential expression in the dermis and serve as a template for dening future scale locations.
Stem Cell Reports

Figure 4. Wnt and Lrig1 Signaling Controls Scale Borders (A) WT tail skin labeled with LEF1 and K31 antibodies and DAPI counterstain. (B and C) Differences in scale size (B) and distance between rows of HF (C) in K14DNLef1 and control littermates. Error bars represent SEM. (DO) Immunostaining with AB1653 (green) and phalloidin counterstain (red) of tail epidermal whole mounts: (D) 2-monthold control and (EF) K14DNLef1 littermates (dorsal [E] and ventral [F] views), (G) control and (HI) 4OHT-treated K14DNbcateninER transgenics, Lrig1 knockouts (MO), and WT littermates (JL). (P) LRIG1 immunostaining of P1 WT tail dermis. (Q) AB1653 and LRIG1 immunostaining of WT P5 tail skin. Epidermal basal layer (dotted lines); HF (solid lines); dermal LRIG1 expression (yellow arrows). Scale bars, 100 mm. See also Figure S4.
DISCUSSION
We have shown that scale and interscale IFE is maintained by discrete unipotent populations of basal cells. Each population must include stem cells because both differentiation programs are maintained throughout adult life independently of HF stem cells (Jones et al., 2007). This forces a reappraisal of earlier lineage tracing studies, in particular those that used InvCreER as a marker of IFE pro-
genitors. In tail IFE, almost all involucrin-positive cells are suprabasal and involucrin is only expressed in a subset of pez-Rovira basal cells at the scale-interscale boundary (Lo et al., 2005; Figures S1QS1S). Therefore, InvCreER (Mascre et al., 2012) will label committed progenitors of only one lineage. Our observation of different rates of proliferation in the basal cell layer of tail IFE is consistent with earlier ndings et al., 2012). However, this difference is not due to (Mascre
Stem Cell Reports

slow-cycling stem cells giving rise to rapidly cycling et al., 2012). Instead, scale committed progenitors (Mascre cells maintain a faster rate of division than interscale cells in adult tail skin under homeostatic conditions (Figure S4E). It is interesting that we found basal-layer involucrin-positive cells in the region of most rapid proliferation, since this may prevent unlimited scale expansion and is consistent with studies in human IFE (Watt et al., 1987). Our data call into question the conclusion that differences in clone size within tail IFE are entirely due to chance (Clay et al., 2010). It would be interesting ton et al., 2007; Doupe to initiate lineage tracing in adult mice to document the behavior of the two lineages during epidermal homeostasis. Examination of cKit and Edaradd mutant mice showed that scale formation was regulated independently of melanocytes and HF. Rescue of Edaradd expression in the epidermis restored HF (albeit with altered patterning) but not ventral scale formation. The ligand Eda and its receptor, Edar, are differently patterned in mouse back epidermis (Laurikkala et al., 2002). This suggests that patterned expression of Edaradd in cells that do not express K14 is required for induction of ventral scales. During wound healing, epidermal stem cells can adopt new locations that differ from their location in undamaged epidermis (Arwert et al., 2012), and therefore it would be interesting to discover whether wounding Edaradd mice inuences the location or behavior of the tail IFE populations. Epidermal Wnt signaling regulated scale formation and maintenance. Inhibition of Lef1 resulted in abnormally small scales, correlating with a selective increase in interscale proliferation. Conversely, activation of b-catenin resulted in scale expansion and blurring of interscale boundaries. It would be interesting to perform clonal lineage tracing in these mice and other mice with disturbed scale patterning to gain further insights into the fate of scale and interscale progenitors. We found that the scale compartment expands via proliferation at its edges. Consistent with this nding, loss of Lrig1, which leads to IFE hyperproliferation (Jensen et al., 2009), resulted in expansion and lateral fusion of scales. Since the IFE does not express detectable levels of Lrig1, the patterned expression of Lrig1 in the dermis underlying future interscales may regulate proliferation in the overlying epidermis. Lrig1 and Lef1/b-catenin signaling may act in competition to regulate the pool of scale stem and progenitor cells, with Lrig1 keeping the pool small and Lef1/b-catenin expanding it. Interscale expansion also occurs upon loss of the Notch ligand Dll1 (Estrach et al., 2008) or epidermal deletion pez-Rovira et al., 2005), again correof b1 integrin (Lo sponding to increased proliferation. Together, these re-
sults reveal an interacting network of signaling pathways that act in both the epidermis and dermis to differentially regulate programs of terminal differentiation within tail IFE.
EXPERIMENTAL PROCEDURES
Mice
Procedures were performed under a UK Government Home Ofce license. The WT mice were C57 Bl/6 3 CBA F1. K14-creER (Jax strain, stock number 005107), CAG-CAT-eGFP (Kawamoto et al., 2000), W/ckit mutant (Cable et al., 1995; a gift from I.J. Jackson), crinkled/Edaradd, crinkled::K14::Edaradd (Heath et al., 2009), K14DN-b-cateninER (line D2; Lo Celso et al., 2004), K14DNLef1 (Niemann et al., 2002), Lrig1 null (Suzuki et al., 2002), and Caspase14 null (Denecker et al., 2007; a kind gift from W. Declercq) mice were described previously. InveGFPRac1QL (line 7596) mice express activated Rac1eGFP via the Inv promoter (Carroll et al., 1995; Lapouge et al., 2011). Two-month-old K14DN-b-cateninER mice (n = 8) and WT littermates (n = 7) were treated with 1.5 mg 4OHT in 100 ml acetone three times a week for 3 weeks. P0 K14DN-b-cateninER pups (two litters, 17 pups total) were treated with increasing doses of 4OHT (225 mg to 1.125 mg) on the tail three times a week for 3 weeks. For lineage tracing, K14-CreER 3 CAG-CAT-eGFP mice were treated at P0 with 0.1 mg 4OHT in 10 ml acetone. The tail skin of three pups per litter (n = 7) was harvested 2 days later and the remaining pups were allowed to develop to P9 (n = 19), P15 (n = 3), P31 (n = 3), and P100 (n = 3) prior to collection of tail skin.
Immunohistochemistry
Details regarding antibodies, antigen retrieval, and whole-mount preparation are given in the Supplemental Experimental Procedures. Skin for sectioning was xed in 4% formaldehyde and embedded in parafn. The epidermal whole-mount procedure was described previously (Braun et al., 2003).
Image Capture and Analysis

Microscopy was carried out using a Leica SP5 confocal microscope and LASAF software. Images and z stacks were obtained using 103 dry 0.3 na and 203 dry 0.7 na objectives. K2/AB1653 images for Figures 1J1L were deconvolved using Autodeblur software and three-dimensional views were obtained after deconvolution using Imaris software. Images were optimized globally for brightness, contrast, and color balance using Photoshop CS4 (Microsoft) and assembled into gures with Adobe Illustrator CS4 (Microsoft). Measurements of scale surfaces were performed using ImageJ software.
SUPPLEMENTAL INFORMATION
Supplemental Information includes Supplemental Experimental Procedures and four gures and can be found with this article online at http://dx.doi.org/10.1016/j.stemcr.2013.04.001.
Stem Cell Reports

This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Heath, J., Langton, A.K., Hammond, N.L., Overbeek, P.A., Dixon, M.J., and Headon, D.J. (2009). Hair follicles are required for optimal growth during lateral skin expansion. J. Invest. Dermatol. 129, 23582364. Jensen, K.B., Collins, C.A., Nascimento, E., Tan, D.W., Frye, M., Itami, S., and Watt, F.M. (2009). Lrig1 expression denes a distinct multipotent stem cell population in mammalian epidermis. Cell Stem Cell 4, 427439. Jones, P.H., Simons, B.D., and Watt, F.M. (2007). Sic transit gloria: farewell to the epidermal transit amplifying cell? Cell Stem Cell 1, 371381. Kawamoto, S., Niwa, H., Tashiro, F., Sano, S., Kondoh, G., Takeda, J., Tabayashi, K., and Miyazaki, J. (2000). A novel reporter mouse strain that expresses enhanced green uorescent protein upon Cre-mediated recombination. FEBS Lett. 470, 263268. Langbein, L., Rogers, M.A., Winter, H., Praetzel, S., Beckhaus, U., Rackwitz, H.R., and Schweizer, J. (1999). The catalog of human hair keratins. I. Expression of the nine type I members in the hair follicle. J. Biol. Chem. 274, 1987419884. Lapouge, G., Youssef, K.K., Vokaer, B., Achouri, Y., Michaux, C., Sotiropoulou, P.A., and Blanpain, C. (2011). Identifying the cellular origin of squamous skin tumors. Proc. Natl. Acad. Sci. USA 108, 74317436. Laurikkala, J., Pispa, J., Jung, H.S., Nieminen, P., Mikkola, M., Wang, X., Saarialho-Kere, U., Galceran, J., Grosschedl, R., and Thesleff, I. (2002). Regulation of hair follicle development by the TNF signal ectodysplasin and its receptor Edar. Development 129, 25412553. Lo Celso, C., Prowse, D.M., and Watt, F.M. (2004). Transient activation of beta-catenin signalling in adult mouse epidermis is sufcient to induce new hair follicles but continuous activation is required to maintain hair follicle tumours. Development 131, 17871799. pez-Rovira, T., Silva-Vargas, V., and Watt, F.M. (2005). Different Lo consequences of beta1 integrin deletion in neonatal and adult mouse epidermis reveal a context-dependent role of integrins in regulating proliferation, differentiation, and intercellular communication. J. Invest. Dermatol. 125, 12151227. , G., Dekoninck, S., Drogat, B., Youssef, K.K., Brohee , S., SoMascre tiropoulou, P.A., Simons, B.D., and Blanpain, C. (2012). Distinct contribution of stem and progenitor cells to epidermal maintenance. Nature 489, 257262. Moll, R., Divo, M., and Langbein, L. (2008). The human keratins: biology and pathology. Histochem. Cell Biol. 129, 705733. lsken, J., Birchmeier, W., and Watt, Niemann, C., Owens, D.M., Hu F.M. (2002). Expression of DeltaNLef1 in mouse epidermis results in differentiation of hair follicles into squamous epidermal cysts and formation of skin tumours. Development 129, 95109. Nowak, J.A., Polak, L., Pasolli, H.A., and Fuchs, E. (2008). Hair follicle stem cells are specied and function in early skin morphogenesis. Cell Stem Cell 3, 3343. Schmidt-Ullrich, R., Tobin, D.J., Lenhard, D., Schneider, P., Paus, R., and Scheidereit, C. (2006). NF-kappaB transmits Eda A1/EdaR signalling to activate Shh and cyclin D1 expression, and controls
ACKNOWLEDGMENTS
We thank everyone who provided advice, reagents, and technical support, in particular Ben Simons, Kim Jensen, Ian Jackson, Wim Declercq, Lutz Langbein, and Peter Humphries. This work was funded by an HFSP long-term fellowship (to C.G.) and by grants from the Wellcome Trust, Medical Research Council, and European Union FP7 program (to F.W.). Received: January 7, 2013 Revised: April 19, 2013 Accepted: April 19, 2013 Published: June 4, 2013
REFERENCES
Arwert, E.N., Hoste, E., and Watt, F.M. (2012). Epithelial stem cells, wound healing and cancer. Nat. Rev. Cancer 12, 170180. Braun, K.M., Niemann, C., Jensen, U.B., Sundberg, J.P., Silva-Vargas, V., and Watt, F.M. (2003). Manipulation of stem cell proliferation and lineage commitment: visualisation of label-retaining cells in wholemounts of mouse epidermis. Development 130, 5241 5255. Brown, S.J., and McLean, W.H. (2012). One remarkable molecule: laggrin. J. Invest. Dermatol. 132, 751762. Cable, J., Jackson, I.J., and Steel, K.P. (1995). Mutations at the W locus affect survival of neural crest-derived melanocytes in the mouse. Mech. Dev. 50, 139150. Carroll, J.M., Romero, M.R., and Watt, F.M. (1995). Suprabasal integrin expression in the epidermis of transgenic mice results in developmental defects and a phenotype resembling psoriasis. Cell 83, 957968. , D.P., Klein, A.M., Winton, D.J., Simons, B.D., Clayton, E., Doupe and Jones, P.H. (2007). A single type of progenitor cell maintains normal epidermis. Nature 446, 185189. Denecker, G., Hoste, E., Gilbert, B., Hochepied, T., Ovaere, P., Lippens, S., Van den Broecke, C., Van Damme, P., DHerde, K., Hachem, J.P., et al. (2007). Caspase-14 protects against epidermal UVB photodamage and water loss. Nat. Cell Biol. 9, 666674. Didierjean, L., Wrench, R., and Saurat, J.H. (1983). Expression of cytoplasmic antigens linked to orthokeratosis during the development of parakeratosis in newborn mouse tail epidermis. Differentiation 23, 250255. , D.P., Klein, A.M., Simons, B.D., and Jones, P.H. (2010). The Doupe ordered architecture of murine ear epidermis is maintained by progenitor cells with random fate. Dev. Cell 18, 317323. Estrach, S., Cordes, R., Hozumi, K., Gossler, A., and Watt, F.M. (2008). Role of the Notch ligand Delta1 in embryonic and adult mouse epidermis. J. Invest. Dermatol. 128, 825832.
Stem Cell Reports

post-initiation hair placode down growth. Development 133, 10451057. Schweizer, J., and Marks, F. (1977). A developmental study of the distribution and frequency of Langerhans cells in relation to formation of patterning in mouse tail epidermis. J. Invest. Dermatol. 69, 198204. rstenberger, G., and Winter, H. (1987). Selective Schweizer, J., Fu suppression of two postnatally acquired 70 kD and 65 kD keratin proteins during continuous treatment of adult mouse tail epidermis with vitamin A. J. Invest. Dermatol. 89, 125131. Silva-Vargas, V., Lo Celso, C., Giangreco, A., Ofstad, T., Prowse, D.M., Braun, K.M., and Watt, F.M. (2005). Beta-catenin and Hedgehog signal strength can specify number and location of hair follicles in adult epidermis without recruitment of bulge stem cells. Dev. Cell 9, 121131. Sommer, L. (2011). Generation of melanocytes from neural crest cells. Pigment Cell Melanoma Res. 24, 411421.
Sundberg, J.P. (1994). Handbook of Mouse Mutations with Skin and Hair Abnormalities (Boca Raton, FL: CRC Press). Suzuki, Y., Miura, H., Tanemura, A., Kobayashi, K., Kondoh, G., Sano, S., Ozawa, K., Inui, S., Nakata, A., Takagi, T., et al. (2002). Targeted disruption of LIG-1 gene results in psoriasiform epidermal hyperplasia. FEBS Lett. 521, 6771. Tsukamoto, K., Jackson, I.J., Urabe, K., Montague, P.M., and Hearing, V.J. (1992). A second tyrosinase-related protein, TRP-2, is a melanogenic enzyme termed DOPAchrome tautomerase. EMBO J. 11, 519526. Watt, F.M., and Collins, C.A. (2008). Role of beta-catenin in epidermal stem cell expansion, lineage selection, and cancer. Cold Spring Harb. Symp. Quant. Biol. 73, 503512. Watt, F.M., Boukamp, P., Hornung, J., and Fusenig, N.E. (1987). Effect of growth environment on spatial expression of involucrin by human epidermal keratinocytes. Arch. Dermatol. Res. 279, 335340.
Stem Cell Reports

Repor t The Luminal Progenitor Compartment of the Normal Human Mammary Gland Constitutes a Unique Site of Telomere Dysfunction
Nagarajan Kannan,1,5 Nazmul Huda,2,5 LiRen Tu,2 Radina Droumeva,1 Geraldine Aubert,1 Elizabeth Chavez,1 Ryan R. Brinkman,1 Peter Lansdorp,1,3 Joanne Emerman,4 Satoshi Abe,2 Connie Eaves,1,5,* and David Gilley2,5,*
Fox Laboratory, British Columbia Cancer Agency, Vancouver, BC V5Z 1L3, Canada of Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN 46202-5251, USA 3European Research Institute for the Biology of Ageing, University Medical Center Groningen, and University of Groningen, Antonius Deusinglaan 1, 9713 AV Groningen, The Netherlands 4Department of Cellular and Physiological Sciences, University of British Columbia, Vancouver, BC V6T 1Z3, Canada 5These authors contributed equally to this work. *Correspondence: ceaves@bccrc.ca (C.E.), dpgilley@iu.edu (D.G.) http://dx.doi.org/10.1016/j.stemcr.2013.04.003 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Department 1Terry
Telomeres are essential for genomic integrity, but little is known about their regulation in the normal human mammary gland. We now demonstrate that a phenotypically dened cell population enriched in luminal progenitors (LPs) is characterized by unusually short telomeres independently of donor age. Furthermore, we nd that multiple DNA damage response proteins colocalize with telomeres in >95% of LPs but in <5% of basal cells. Paradoxically, 25% of LPs are still capable of exhibiting robust clonogenic activity in vitro. This may be partially explained by the elevated telomerase activity that was also seen only in LPs. Interestingly, this potential telomere salvage mechanism declines with age. Our ndings thus reveal marked differences in the telomere biology of different subsets of primitive normal human mammary cells. The chronically dysfunctional telomeres unique to LPs have potentially important implications for normal mammary tissue homeostasis as well as the development of certain breast cancers.
INTRODUCTION
Chromosome ends, referred to as telomeres, contain repeat sequences (TTAGGG)n and associated proteins that protect cells from the formation of chromosome end-to-end fusions (Artandi and DePinho, 2010). In normal tissues, such as in the hematopoietic system, where cell turnover is high and continuous throughout life, telomeres are maintained in the most primitive cells at relatively long lengths and then become progressively shorter as the cells differentiate through multiple amplifying divisions and with age (Aubert and Lansdorp, 2008). Epithelial tissues, including the mammary gland in both humans and mice, also undergo extensive turnover, and recent studies indicated that this may involve a similarly organized hierarchical differentiation process (Eirew et al., 2008; Visvader, 2009). To date, analysis of telomere length regulation in normal mammary epithelial cells has been limited to reports of shorter telomeres in luminal cells (Kurabayashi et al., 2008; Meeker et al., 2004), and human telomerase reverse transcriptase (hTERT) messenger RNA (mRNA; Kolquist et al., 1998) in histological sections. However, the presence of telomere fusions was noted in primary mammary epithelial cells after their extensive passage in vitro (Romanov et al., 2001), and we recently reported that telomeredysfunction-specic chromosomal fusions are common in early-stage breast cancers (Tanaka et al., 2012). Here we show that phenotypically separable compartments of
normal human mammary epithelial cells with distinct biological properties have markedly different telomere lengths and telomerase activities. Interestingly, a phenotype that is highly enriched in luminal progenitors (LPs) is uniquely characterized by critically short telomeres, frequent evidence of a telomere-specic DNA damage response (DDR), and an age-related decrease in telomerase activity.
RESULTS AND DISCUSSION

Normal Human Mammary LPs Possess Short Telomeres To examine telomere length in different compartments of normal human breast tissue and possible age-related changes, we isolated four phenotypically distinct subsets of cells at high purities (>95%) from different normal reduction mammoplasty tissue samples obtained from donors of different ages and analyzed them directly, without culture (Figure 1A; Table S1 available online). We examined four subsets of cells: (1) a basal epithelial cell (BC) subset that is highly enriched in cells with bipotent as well as myoepithelial clonogenic activity in vitro (Figure 1B), (2) an LP subset that is similarly enriched in cells with luminal clonogenic activity in vitro (Figure 1B), (3) a third mammary epithelial cell subset that contains exclusively mature luminal cells (LCs) with no clonogenic activity (Figure 1B), and (4) a population consisting of nonepithelial stromal
Stem Cell Reports

Telomere Dysfunction in Breast Luminal Progenitors
A
Depletion of dead/blood/ endothelial cells
DAPI/CD31/CD45
Normal mammary tissue
EpCAM
Single cell dissociation
Staining
Isolation of subsets
LC SC
CFC assay ~10 days
Fix, stain & score Luminal colony
LP BC
Snap freeze for telomere analysis
Basal colony
SSC
CD49f
B
100 Percentage of CFC C
C
12 Telomere length - T RF (kb)
D
BC
12
LP
12
LC
R = 0.5 P < 0.01
12
SC
12 Telomere length - qPCR R (kb)
10
10
10
R = 0.002 10 P = 0.9 8
10
10
0.1
R = 0.05 P = 0.5
R = 0.08 P = 0.3
6 R = 0.75 P < 0.0001 4 4 6 8 10 12
0.01
4 0 25 50 75 0 25 50 75
4 0 25 50 75
4 0 25 50 75
BC
LP
LC
Age (years)
Telomere length - TRF (kb)
ladder HT1080 EEC TC EEC TC BC LP LC SC BC LP LC SC BC LP LC SC
Age 46
31
46
20
26
Unstained BC Stained BC
Unstained LP Stained LP Thymocytes
100 e of maximum Percentage
Thymocytes
BC
Age 46
(kb) 23.1 12.0 10.0 9.0 8.0 7.0 6.0 5.0 4.3 4.0
LP 20
LC 26
80 60 40 20 0 0 200 400 600 800 1000 0 200 400 600 800 1000 Telomere-PNA-FITC probe
3.0
2.4 2.0 0 1.5 100 0 100 0 100 % Maximum BC 1.0 LP
J F
12
200 BC mean 6.3 kb LP mean 3.4 kb 150
TRF
P < 0.001 11 10 9 8 7 6 5 4 BC LP LC SC
G
12
qPCR
P = 0.004 P = 0.004
Telomere length (kb)
Telomere length h (kb)
P < 0.001
10 9 8 7 6 5 4 BC LP LC SC
Frequency
11
100
50
0 0 3 6 9 12 15 18 21 24 27 30
Telomere fluourescene units (x1000)
Figure 1. Telomere Length Alterations in Different Subsets of Cells Present in Normal Human Breast Tissue (A) Process for isolating and characterizing the four subsets of cells studied (after removal of CD45+ hematopoietic and CD31+ endothelial cells), showing examples of colonies obtained from cells in the LP (above) and BC (below) fractions. BCs are dened by their CD49fhiEpCAMneg/low phenotype and contain bipotent and self-renewing mammary stem cells identied by in vivo transplantation assays (legend continued on next page)
Stem Cell Reports

cells (SCs) that are still prominent after the hematopoietic and endothelial cells are removed (Figure 1A). Extracts of each of these four highly puried cell populations were analyzed for telomere length both by quantitative phosphorimage scanning of telomere restriction fragment (TRF) lengths in southern blots (Aviv et al., 2011; Cawthon, 2009) and by quantitative PCR (qPCR; Aviv et al., 2011; Cawthon, 2009; Figures 1C1G). To evaluate telomere length values for individually analyzed cells in the BC and LP subsets, we used ow-uorescent in situ hybridization (Flow-FISH) to examine freshly isolated cells (Rufer et al., 1998; Figure 1H) and quantitative FISH (Q-FISH) to examine metaphases obtained on the proliferating progeny of LPs and BCs present in 3-day adherent cultures of these cells (Poon et al., 1999; Figures 1I and 1J). The striking nding from all of these analyses is the very short average telomere length that uniquely characterizes LP cells, regardless of the age of the donor. The southern data imply that some chromosomes within the LP population likely contain TRFs <3 kb in length (Figure 1F) and this was also evident from the Q-FISH data (Figure 1J). This telomere length has been associated with telomere dysfunction and cell death in the absence of telomerase (Begus-Nahrmann et al., 2012; Hemann et al., 2001). By comparison, the average telomere length of the BCs is considerably longer (68 kb) and also age independent. However, the importance of age as a variable is evident in the terminally differentiated LCs (Figure 1C). Analyses of the matching SCs showed that these cells contain even longer telomeres than any of the
mammary epithelial cells (on average 9 kb by southern blot analysis), and also do not show signicant changes in telomere length with age (Figures 1C and 1E1G). The age-related changes in telomere length observed in the isolated LCs were masked in southern analyses of DNA extracts obtained from unseparated breast tissue (Figure 1E, lane marked TC). This likely reects the low representation of the LCs in whole breast tissue relative to the predominance of other cells (Figure 1A) regardless of donor age. The discovery of short telomeres specic to the LP compartment is notable given that a high proportion of cells with an LP phenotype (up to 48%; Figure 1B) can execute multiple divisions in vitro. LPs Display Evidence of a Telomere-Associated DDR without Telomere Fusions To determine whether the short telomeres characteristic of normal human LPs are sufcient to elicit a DDR, we rst performed microarray analyses on RNA extracted from BC, LP, and LC populations puried from young (premenopausal, 2049 years old, n = 6) and older donors (postmenopausal, 5968 years old, n = 3). Unsupervised hierarchical clustering of the data demonstrated that the cell subset, but not donor age, was a strong classier (Figure 2A). Examination of genes associated with mammary cell differentiation conrmed both expected and novel associations (Figures 2B and 2C). For example, BCs expressed the highest levels of transcripts for smooth muscle actin (ACTA2), TP63, NOTCH4, keratin 4 (KRT4), KRT5,
(Eirew et al., 2008; Lim et al., 2009). BCs also include CFCs that generate mixtures of luminal and myoepithelial cells (bipotent CFCs) as well as CFCs that generate pure myoepithelial cell colonies (myoepithelial CFCs) and mature myoepithelial cells that do not have CFC activity. The CD49fhiEpCAMhi fraction contains mammary cells with features of luminal cells as well as CFCs that produce pure luminal cell colonies at high frequency (Raouf et al., 2008) and accordingly is referred to here as the LP fraction. The third subset of cells have an CD49floEpCAMhi phenotype and are referred to as LCs because they are devoid of growth activity in either in vivo or in vitro assays and are considered to be developmentally downstream of LPs. Note the color code adopted for all subsequent gures: blue, BCs; red, LPs; orange, LCs; gray, SCs. (B) CFC frequencies in the phenotypically dened BC, LP, and LC fractions of 12 of the samples, including several used for telomere length measurements by southern blot (closed circles). (C) TRF length measurements for the different subsets as a function of donor age (n = 13). (D) Correlation of the average TRF length measured by southern blot and qPCR analysis of 28 different DNA extracts (12 different donor samples). (E) Representative southern blot showing the spread of TRFs obtained from BCs, LPs, LCs, and SCs, as well as from initial unseparated mammary cells (epithelial-enriched cells [EECs] and total breast cells [TCs]), and HT1080, a human tumorigenic brosarcoma cell line with very short telomeres. To the right are distributions of TRFs shown as a percentage of the maximum telomere probe signal for the examples represented in the adjacent southern blot. (F) TRF lengths for each of the four subsets from southern blots (mean SEM, 13 different donor samples). (G) qPCR telomere lengths measured for each of the four subsets (mean SEM, seven different donor samples); p values were calculated using a paired two-tailed Students t test. (H) Representative Flow-FISH plots of telomere-specic uorescein-conjugated (CCCTAA)3 PNA uorescence in individually assessed BCs and LPs compared with a spiked-in calf thymocyte standard. The average modal values from three matched pairs of BCs and LPs were 8.9 0.4 and 7.9 0.3, respectively (p < 0.05, one-tailed Students t test). (I) Q-FISH-stained chromosomes of representative BC and LP metaphases. The DAPI channel is labeled as gray and the telomere probe channel is labeled as green. (J) Frequency distribution of telomere uorescence levels measured on 15 metaphases from 3-day cultures of BCs and LPs (treated with colcemid for 2 hr). Mean telomere length was calculated as described previously (Poon et al., 1999).
Stem Cell Reports

A
LC LC LC LC LC LC LC LC LP LP LP LC LP LP LP LP Age in years:20 29 59 49 26 66 68 27 23 68 66 49 26 59 20 27 LP BC BC BC BC BC BC BC 29 27 59 66 68 20 26 29
BC
LC
LP
LP
Color Key
- 2 -1 0 1 2 Value
E
mRNA level
4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 0.5 0.0
BC
P = 0.006
8 7 6 5 4 3 2 1 0
P = 0.01
1.2 1.0
P = 0.03
2.5 2.0
P = 0.05
0.08 0.06 0.04 0.02 0.00
P = 0.002
25 20
P = 0.02
0.12 0.10
P = 0.04
mRNA level
mRNA level
mRNA level
mRNA level
mRNA level
0.8 0.6 0.4 0.2 0.0
1.5 1.0 0.5 0.0
15 10 5 0
BC LP MRE11
BC LP RAD50
BC LP ATM
BC LP ATR
BC LP BLM
BC LP RAP1
mRNA level
0.08 0.06 0.04 0.02 0.00 BC LP DNA-PK
F
12.0 10.0 P = 0.013 6.0 5.0 P = 0.019 4.5 4.0 3.5 3.0 2.5 20 2.0 1.5 1.0 0.5 0.0 P = 0.029 3.0 2.5 P = 0.026 3.5 3.0 P = 0.012 1.4 1.2 P = 0.019 1.4 1.2 P = 0.007
mRN NA level
mRN NA level
mRN NA level
mRN NA level
mRN NA level
mRN NA level
8.0 6.0 4.0 2.0 0.0 BC LP P53
4.0 3.0 2.0 1.0 0.0 BC LP PML
2.0 1.5 1.0 0.5 0.0
2.5 2.0 1.5 1.0 0.5 0.0
1.0 0.8 0.6 0.4 0.2 0.0
mRN NA level
BC LP TBX2
1.0 0.8 0.6 0.4 0.2 0.0 BC LP TBX3
BC ID2
LP
BC LP E2F1
BC LP P14ARF
Figure 2. Distinct Expression Proles of Telomere-Associated Genes in Normal Mammary Epithelial Subpopulations (A) Unsupervised hierarchical clustering of gene-expression data from microarray analyses of puried cell fractions. (B) Unsupervised hierarchical clustering of gene-expression proles of known lineage markers. A heatmap (yellow = upregulated, black = downregulated) demonstrates the relative expression of each marker gene. (C) Venn diagram showing the numbers of signicantly (p < 0.05) differently expressed genes between different subset pairs. (D) Telomere-associated gene-expression proles of the BC and LP subsets. The top 50 differentially expressed telomere-associated genes identied by a search in GO were used to classify BCs and LPs using an unsupervised clustering algorithm. (E) qRT-PCR of DDR gene transcript levels from four samples. (F) qRT-PCR of senescence-associated gene transcripts from ve to eight samples. Error bars represent mean SEM; p values were determined by a paired two-tailed Students t test.
Stem Cell Reports

KRT14, KRT17, vimentin, THY1, and CD44, which are all established BC markers. Similarly, LPs and LCs expressed higher levels of transcripts than the BCs for many known luminal markers (CD24, MUC1, KRT18, KRT19, EPCAM, NOTCH3, and GATA3). LPs also expressed the highest levels of prominin1 (CD133), KIT, and ALDH1A transcripts, as predicted by the literature (Eirew et al., 2012; Lim et al., 2009; Raouf et al., 2008). LCs expressed the highest levels of ZNF703 (Holland et al., 2011), estrogen receptor-a (ESR1), trefoil factor 3 (TFF3), and KRT8, which have been associated with luminal-type mammary cancers (Lim et al., 2009). The progenitor-enriched BC and LP subsets also displayed increased epidermal growth factor receptor (EGFR) transcripts consistent with their requirement for EGF to support their clonogenic activity in vitro. Using the Gene Ontology (GO) database (http://www. geneontology.org), we identied 50 telomere-associated genes that are expressed in LPs at signicantly different levels than in BCs (Figure 2D). Expression of 13 of these genes was elevated in LPs, and these included several DDR genes (MRE11, RAD50, ATM, ATR, and BLM). ATM is the primary activator of DNA double-strand break repair and requires the early initiation factor MRN complex that is composed of MRE11, RAD50, and NBS1 (Uziel et al., 2003). Higher expression of MRE11, RAD50, ATM, ATR, and BLM in LPs as compared with BCs was conrmed in quantitative RT-PCR (qRT-PCR) analyses of additional samples (Figure 2E). In contrast, RAP1 and DNA-PK were more highly expressed in the BCs. DDR gene products in the MRN complex have identied roles in the repair of DNA double-strand breaks (van den Bosch et al., 2003) and have also been reported to localize at telomeres following induction of telomere dysfunction in various cell line models (Stracker and Petrini, 2011). To determine whether LPs and BCs would show differences in telomere-associated DDR sensors, we xed freshly isolated LPs and BCs; stained them with antibodies to NBS1, RAD50, g-H2AX, 53BP1, MRE11, and TRF2 (a protein that specically localizes to telomeres [Tomlinson et al., 2006] and also served as a permeabilization control); and then examined individual nuclei by confocal imaging. Importantly, in spite of the lower levels of TRF2 transcripts in LPs, TRF2 protein could be readily detected immunochemically at telomere foci in these cells as well as in BCs. We found that NBS1, RAD50, g-H2AX, and 53BP1 were essentially undetectable in the nuclei of BCs but strongly present in the nuclei of all LPs examined, where they were consistently colocalized with TRF2 (10 telomere dysfunction-induced foci [TIFs] per LP nucleus; Figures 3A3C). MRE11 was detectable and colocalized with TRF2 in some BC nuclei, but signicantly less so than in LP nuclei (p < 0.00001; Figure 3). The MRE11 present at the telomeres of
BCs may reect the known role of MRE11 in conventional telomere maintenance (Zhu et al., 2000). In contrast, the high levels of g-H2AX, 53BP1, and other early DDR proteins at the telomeres of LPs suggests that throughout adult life, at least some of these cells experience biologically signicant consequences of telomere dysfunction. Interestingly, however, neither telomere-associated repeat (TAR)-fusion PCR analyses (Tanaka et al., 2012) of freshly isolated LPs and BCs (Figure 3D) nor examination of the metaphases prepared for the Q-FISH analyses from the LPs (and BCs) revealed any evidence of telomere fusions (Figure 1I). This suggests that the very short telomeres of at least some cells in the LP compartment must prevent their further progression through the cell cycle, and possibly explains why higher frequencies of LPs with in vitro clonogenic activity have not been achievable (Eirew et al., 2008; Raouf et al., 2008; Figure 1B). It was previously suggested that maintenance of mammary epithelial cells in vitro leads to a progressive increase in TIFs, with the induction of senescence following the accumulation of ve or more TIFs per cell (Kaul et al., 2012). As with replicative cellular senescence, telomere shortening and cellular responses to consequent DNA damage may thus act primarily as a tumor-suppressive mechanism in mammary LPs (Campisi, 2011). Although senescence programs relevant to human cells in vivo have not yet been established, increased lysosomal content and altered expression of several genes have both been associated with senescence in various cell line models. Fluorescence-activated cell sorting (FACS) analysis of LPs and BCs with LysoTracker dye showed the LPs to have a higher lysosomal content (Figure S1). Likewise, higher expression of P14, P53, PML, ID2, and E2F1, and decreased expression of TBX2 and TBX3 (genes designated as senescence associated in GO) were also evident in our present and previously published transcriptome data sets (Figures S2 and S3). These gene-expression ndings were conrmed by qRT-PCR (Figure 3F). Thus, LPs may be predisposed to events that confer oncogenic properties on cells that acquire critically short telomeres, but appear to be protected from such events, at least to some extent, by activation of mechanisms that cause them to exit the cell cycle and/or senesce. The short telomere length of the LPs and their high frequency of TIFs may be particularly relevant in light of recent studies that implicated these cells in the development of BRCA1-associated breast cancers, and showed that malignant cells had a transcriptional prole similar to that of normal LPs even though they exhibited a BC phenotype (Lim et al., 2009; Proia et al., 2011). Since an association of short telomeres with increased sensitivity to other sources
Stem Cell Reports

A
5 m
NBS1
5 m
MRE11
5 m
RAD50
5 m
H2AX
5 m
53BP1
B
5 m
TRF2
H2AX
53BP1
Merge
Merge
BC
30 20 10 0
BC
P < 0.001 0 001
LP
30 20 10
LP
BC
LP
30 20 10
BC
LP
P<0 0.001 001
BC
30 20 10
LP
P < 0.001 0 001
BC
30 20 10
LP
30
BC
LP
P < 0.001 0 001
NBS1
MRE11
P < 0.001 0 001
RAD50
H2AX
53BP1
P < 0.001 0 001
H2AX
Total foci
Total foci
LP
20 10 0
BC LP
BC
LP
BC
LP
0
BC
LP
0
BC
30
NBS1 / TRF2
P < 0.001
30 20 10
MRE11 / TRF2
P < 0.001
30 20 10
RAD50 / TRF2
P < 0.001
30 20 10 0
H2AX / TRF2
P < 0.001
30 20 10 0
53BP1 / TRF2
P < 0.001
30
H2AX / 53BP1
P < 0.001
Co-foci
20 10 0
BC LP
Co-foci
LP
29 Positive Negative 58
20 10 0
BC
48 27
0
BC
LP
0
BC
LP
BC LP
BC
LP
BC
LP
:Age
C
Percentage of cells
100
D
TRF2 / NBS1 TRF2 / MRE11 TRF2 / H2AX TRF2 / 53BP1
BC LP BC LP BC LP BC LP
50
TRF2 / RAD50 53BP1 / H2AX
0
0-3 4-6 7-9 10 - 12 13 - 15 16 - 18 19 - 21 22 - 24
Number of co-foci
Figure 3. Detection of TIFs in the Nuclei of Normal Human Mammary LPs but Not BCs (A) Upper panels: Representative images of single BC and LP nuclei, showing differential colocalization of TRF2 with NBS1, MRE11, RAD50, g-H2AX, and 53BP1. Middle panels: The total number of TIFs per nucleus (>50 nuclei examined for each DDR gene). Lower panels: The frequency of affected BC and LP nuclei, with average values indicated by the black bars in each case. (B) Representative images of BCs and LPs, showing differential colocalization of g-H2AX with 53BP1. The total numbers of g-H2AX/53BP1 foci in LPs and BCs are presented in dot plots and the average values are shown as black bars. (C) Frequency of BCs and LPs displaying colocalized foci of NBS1, MRE11, RAD50, g-H2AX, and 53BP1 with TRF2. (D) TAR-Fusion PCR performed on BCs and LPs isolated from four different samples obtained from donors of various ages. Positive control: DNA from human BJ E6/E7 foreskin broblast cells with telomere crisis. Negative control: DNA from primary human BJ foreskin broblast. of DNA damage has been reported (Berardinelli et al., 2012; Wong et al., 2000), it will be of interest to determine whether this extends to LPs or whether other mechanisms override such a relationship. hTERT Expression and Telomerase Activity Are Upregulated in LPs but Decline with Age hTERT, the catalytic (and limiting) component of telomerase activity, is absent from most differentiated somatic human cells (Shay and Bacchetti, 1997), including normal breast tissue (Shay and Bacchetti, 1997; Tanaka et al., 2012). Given our nding of short telomeres and evidence of a DDR in the LPs, we asked whether hTERT expression and activity are detectable in these cells (Figure 4). Using the telomere repeat amplication protocol (TRAP) assay (Herbert et al., 2006), we found that the level of telomerase activity in LPs approached that previously observed in telomerase-dependent malignant HeLa cells (Shay and Wright, 2010), but detected no activity in the three other subsets (Figures 4A and 4B). Interestingly, the telomerase activity in LPs was particularly elevated in younger women and then declined 5-fold with age (Figure 4C), consistent with the parallel age-associated reduction of LC telomere length (Figure 1C). qRT-PCR measurements of hTERT mRNA levels (Figure 4D) and confocal imaging of telomere-associated hTERT expression (Figures 4E and 4F) conrmed that hTERT expression in the LPs was consistently (80% of LPs) and selectively elevated (Figure 4D). These studies also show that the hTERT present in LPs is associated with their telomeres, as evidenced by the
Stem Cell Reports

Figure 4. Telomerase Expression and Activity in Normal Human Mammary Epithelial Cell Subsets P < 0.001 (A) Representative gel comparing the telo16 merase activity of BCs, LPs, LCs, and SCs 12 assessed by the TRAP assay using non8 denatured lysates of HT1080 and HeLa cells as a positive control, and heat-inactivated 4 (HI) cellular lysate and CHAPS detergent 0 buffer in the absence of cellular lysate as BC LP LC SC IC negative controls. IC, internal control. (B) Comparison of TRAP activity measurements obtained on all four subsets from C all 12 samples analyzed expressed as a BC LP LC SC 25 25 25 25 percentage of the activity in HeLa cells. R = 0.1 R = 0.07 R = 0.5 20 20 20 20 Values shown are the mean SEM. P = 0.3 P = 0.8 P = 0.06 (C) Distribution of the individual telome15 15 15 15 rase activity measurements shown in (B), 10 10 10 10 but displayed for each subset as a function R = 0.5 of the age of the donor. The p value shows 5 5 5 5 P = 0.009 age association signicance. 0 0 0 0 (D) hTERT transcript levels measured by qRT0 25 50 75 0 25 50 75 0 25 50 75 0 25 50 75 PCR analyses of each of the four subsets by Age (years) comparison with HeLa cells. Extracts of BCs, LCs, SCs, and mammary DAPICD31+CD45+ hTERT / TRF2 D E F co-foci (LIN) cells (three samples) did not contain 100 10-1 TRF2 hTERT merge detectable RNA levels. Values shown for LPs are 80 5 m the mean SEM from the same three samples. 10-2 BC 60 (E) Representative confocal laser micro40 10-3 scope images of the nuclei of puried 20 LP permeabilized BCs and LPs stained with -4 10 0 BC LP SYTOX Blue and differently labeled antibodies to hTERT (in red) or TRF2 (green), or both. Colocalized foci are yellow. (F) Frequency of BC and LP nuclei that demonstrated colocalized hTERT+TRF2+ foci (yellow). Values are the mean SEM of multiple nuclei from three different donors (p < 0.0001, paired two-tailed Students t test).
HT1080 HeLa HI CHAPS
24
BC LP LC SC
hTERT mRNA
RTA (%)
RTA (%)
LP
LC
SC
LIN
BC
frequency of intranuclear hTERT+TRF2+ foci seen (approximately three foci per nucleus in 80% of the LPs; Figures 4E and 4F). The decreasing levels of telomerase activity seen in the LPs of older women is not inconsistent with the ageindependent telomere lengths of LPs because the latter are likely sustained long term by their continuous derivation from more primitive cell types in the BC compartment (Eirew et al., 2008). Additionally, LP cells with critically short telomere lengths may be eliminated by exit from the cell cycle through a senescence pathway (Campisi, 2011; Hemann et al., 2001). However, the decreasing levels of telomerase activity seen in the LPs of older women may affect their ability to generate LCs, since LPs are thought to be LC precursors. On the other hand, the relatively high levels of telomerase activity found in LPs may have novel, telomere-length-independent roles, as suggested by others (Elenbaas et al., 2001; Hemann et al., 2001;
HeLa
Percent of cells
Kiyono et al., 1998; Park et al., 2009; Sharma et al., 2003; Smith et al., 2003). Our ndings also raise the interesting possibility that the changes in telomere length regulation and their sequelae in the LP subset of cells in the normal human mammary gland may occur in the transit-amplifying compartment of other epithelial cell populations where an analogous differentiation hierarchy exists. It will thus be of interest to elucidate the intrinsic and exogenous factors that appear to link these changes to the control of differentiation in normal human mammary cells.
Cells and Colony-Forming Cell Assays
Histologically conrmed normal, anonymized tissue from 37 women undergoing cosmetic reduction mammoplasties (Table S1) was obtained according to procedures approved by the
Stem Cell Reports

University of British Columbia Ethics Board and then processed and cryopreserved in 6% DMSO-containing medium (Stingl et al., 2005). Thawed cells were labeled with different uorochrome-conjugated antibodies (listed in Table S2) and DAPI to enable highly puried subsets to be isolated by FACS (>95% after a single sort and >98% after a second re-sort, as determined by further ow cytometric analysis) using either an Inux-II or ARIA FACS (Becton Dickinson) as described in detail previously (Eirew et al., 2008). The same results were obtained from both single- and double-sorted cells and therefore were pooled. Colony-forming cell (CFC) assays were performed in dishes precoated with 1.6% Matrigel (BD Biosciences) in SF7 medium with 5% fetal bovine serum (STEMCELL Technologies), 20 mM ROCK inhibitor (Reagents Direct), and irradiated feeders.
second derivative maximum method. These values were then converted to protein concentrations (mg/mL) as an indicator of telomerase activity by the t-points method using LightCycler 480 software (1.5.0; Roche) and an HT1080 standard curve, and then expressed as relative values using an extract of HeLa cells as a reference.
Confocal Laser Microscopy and Image Analysis

Cells were cytospun onto slides, rinsed with PBS, xed with 4% formaldehyde (Thermo Scientic, Rockland, IL, USA), permeabilized with 0.2% Triton X-100 (Sigma-Aldrich, St. Louis, MO, USA), and blocked with 6% BSA (Fraction V; Fisher Scientic) in PBS. The cells were then incubated with various antibodies at room temperature for 1 hr, washed in PBS, and incubated with secondary antibodies (listed in Table S2) as recommended by the manufacturer. After further washing with PBS, nuclei were labeled with SYTOX Blue (Invitrogen), mounted with Qmount (Invitrogen), and imaged on an Olympus FV1000MPE confocal/ multiphoton microscope using FV-ASW 3.0 Viewer software.
Telomere Length Measurements

Genomic DNA isolated using QIAamp DNA Blood Mini Kits (QIAGEN) was digested with HaeIII, HinfI, and RsaI, and DNA fragments were separated by electrophoresis on 0.8% SeaKem LE agarose gels (Lonza) and hybridized with 32P-labeled (TTAGGG)4. Blots were scanned with a PhosphorImager (Molecular Dynamics) and mean TRF lengths were determined (Huda et al., 2007, 2009). qPCR measurements (Cawthon, 2009) were performed in triplicate in 15 ml reaction volumes with reaction conditions of 10 min at 94 C, two cycles for 10 s each at 94 C and 15 s at 49 C, followed by 35 cycles at 94 C for 10 s each, 62 C for 15 s, and 74 C for 30 s with uorescence signal acquisition. Automated multicolor Flow-FISH was performed as previously described (Baerlocher et al., 2006). Q-FISH with Cy3-labeled (CCCTAA)3 peptide nucleic acid (PNA) probes and analysis of telomere length from digital images were performed as previously described (Poon et al., 1999) on metaphases obtained from 3-day cultures (CFC assay conditions) initiated with matched LPs and BCs (15 metaphases each) isolated from one of the samples used for southern analysis.
qRT-PCR
Complementary DNA (cDNA) was generated from Trizol extracts using the Quantiscript RT Fastlane cDNA kit (QIAGEN). The primers used for qRT-PCR are listed in Table S3. Samples were subjected in triplicate to 40 amplication cycles (10 s at 95 C, 20 s at 60 C, and 30 s at 72 C). Two negative controls (one in which no cDNA template was added and one in which no RT treatment was applied) were included in each experiment. Gene transcript levels were calculated using the DDCt method (Livak and Schmittgen, 2001), with TATA box-binding protein (TBP) expression used as a loading control.
Microarray Analysis
RNA in Trizol was repuried using the RNeasy Micro kit (QIAGEN), and preparations with an RNA integrity number of R8.0 were prepared using the Agilent One-Color Microarray-Based Exon Analysis Low Input Quick Amp WT Labeling Kit v1.0. Aliquots of 25 ng total RNA were used to generate Cyanine-3-labeled complementary RNA, which was then hybridized on 8 3 60K Agilent Whole Human Genome Oligo Microarrays (Design ID 028004) and scanned at 3 mm resolution in an Agilent DNA microarray scanner and data processed using Agilent Feature Extraction 10.10. The processed signal was quantile normalized with Agilent GeneSpring 11.5.1 and analyzed using the opensource language R.
TAR-Fusion PCR
Genomic DNA was isolated by the salt precipitation method, and TAR-Fusion qPCR was carried out as previously described (Tanaka et al., 2012) using a two-step touchdown PCR in a 20 ml reaction mixture including 50 ng of DNA, multiple primers, 10% 7-Deaza-dGTP (Roche Diagnostics), and Advantage GC Genomic LA Polymerase Mix (Clontech). To calculate the percentage of telomere fusions detectable by TAR-Fusion PCR, we used the general equation C(n, 2) + n, where n is the number of unique chromosomal ends. The total number of detectable fusion combinations was 154 and the coverage rate was 14.2%.
TRAP Assays
TRAP assays were performed on 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (CHAPS) extracts containing 0.25 mg of total protein using the TRAPeze telomerase detection kit (Millipore), and PCR products were resolved by electrophoresis in 12.5% polyacrylamide gels and visualized by SYBR Green phosphorimaging as previously described (Herbert et al., 2006). TRAP activity was then quantied using a LightCycler 480 II (Roche) and cross-point (Cp) values were determined using the
ACCESSION NUMBERS
The GEO accession number for the transcriptome data sets reported in this paper is GSE37223.
Supplemental Information includes three tables and three gures and can be found with this article online at http://dx.doi.org/ 10.1016/j.stemcr.2013.04.003.
Stem Cell Reports

This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Campisi, J. (2011). Cellular senescence: putting the paradoxes in perspective. Curr. Opin. Genet. Dev. 21, 107112. Cawthon, R.M. (2009). Telomere length measurement by a novel monochrome multiplex quantitative PCR method. Nucleic Acids Res. 37, e21. Eirew, P., Stingl, J., Raouf, A., Turashvili, G., Aparicio, S., Emerman, J.T., and Eaves, C.J. (2008). A method for quantifying normal human mammary epithelial stem cells with in vivo regenerative ability. Nat. Med. 14, 13841389. Eirew, P., Kannan, N., Knapp, D.J.H.F., Vaillant, F., Emerman, J.T., Lindeman, G.J., Visvader, J.E., and Eaves, C.J. (2012). Aldehyde dehydrogenase activity is a biomarker of primitive normal human mammary luminal cells. Stem Cells 30, 344348. Elenbaas, B., Spirio, L., Koerner, F., Fleming, M.D., Zimonjic, D.B., Donaher, J.L., Popescu, N.C., Hahn, W.C., and Weinberg, R.A. (2001). Human breast cancer cells generated by oncogenic transformation of primary mammary epithelial cells. Genes Dev. 15, 5065. Hemann, M.T., Strong, M.A., Hao, L.Y., and Greider, C.W. (2001). The shortest telomere, not average telomere length, is critical for cell viability and chromosome stability. Cell 107, 6777. Herbert, B.-S., Hochreiter, A.E., Wright, W.E., and Shay, J.W. (2006). Nonradioactive detection of telomerase activity using the telomeric repeat amplication protocol. Nat. Protoc. 1, 15831590. Holland, D.G., Burleigh, A., Git, A., Goldgraben, M.A., PerezMancera, P.A., Chin, S.-F., Hurtado, A., Bruna, A., Ali, H.R., Greenwood, W., et al. (2011). ZNF703 is a common Luminal B breast cancer oncogene that differentially regulates luminal and basal progenitors in human mammary epithelium. EMBO Mol. Med. 3, 167180. Huda, N., Tanaka, H., Herbert, B.-S., Reed, T., and Gilley, D. (2007). Shared environmental factors associated with telomere length maintenance in elderly male twins. Aging Cell 6, 709713. Huda, N., Tanaka, H., Mendonca, M.S., and Gilley, D. (2009). DNA damage-induced phosphorylation of TRF2 is required for the fast pathway of DNA double-strand break repair. Mol. Cell. Biol. 29, 35973604. Kaul, Z., Cesare, A.J., Huschtscha, L.I., Neumann, A.A., and Reddel, R.R. (2012). Five dysfunctional telomeres predict onset of senescence in human cells. EMBO Rep. 13, 5259. Kiyono, T., Foster, S.A., Koop, J.I., McDougall, J.K., Galloway, D.A., and Klingelhutz, A.J. (1998). Both Rb/p16INK4a inactivation and telomerase activity are required to immortalize human epithelial cells. Nature 396, 8488. Kolquist, K.A., Ellisen, L.W., Counter, C.M., Meyerson, M.M., Tan, L.K., Weinberg, R.A., Haber, D.A., and Gerald, W.L. (1998). Expression of TERT in early premalignant lesions and a subset of cells in normal tissues. Nat. Genet. 19, 182186. Kurabayashi, R., Takubo, K., Aida, J., Honma, N., Poon, S.S.S., Kammori, M., Izumiyama-Shimomura, N., Nakamura, K.-i., Tsuji, E.-i., Matsuura, M., et al. (2008). Luminal and cancer cells in the breast show more rapid telomere shortening than myoepithelial cells and broblasts. Hum. Pathol. 39, 16471655.
ACKNOWLEDGMENTS
We thank A. Bates, D. Wilkinson, D. Ko, W. Xu, and A. Haegert for excellent technical assistance, and Drs. J. Sproul and N. Van Laeken for assistance in obtaining mammoplasty tissue. N.K. held a Canadian Breast Cancer Foundation Postdoctoral Fellowship. This work was supported by a grant to C.E. from the Canadian Breast Cancer Research Alliance funded by the Canadian Cancer Society, by grants to R.B. from the Terry Fox Research Institute and the Terry Fox Foundation, and by grants to D.G. from the Indiana University Cancer Center, the American Cancer Society, the Showalter Foundation, the Susan G. Komen Foundation, the Avon Foundation, the Flight Attendant Medical Research Institute, and the Indiana Genomics Initiative (INGEN). INGEN of Indiana University is supported in part by Lilly Endowment, Inc. N.K., N.H., C.E., and D.G. conceptualized and designed the study. N.K. isolated cells and RNA for most experiments and conducted progenitor assays. N.H. conducted most of the biochemical and imaging analysis and contributed to writing the manuscript. R.D. and R.B. contributed to microarray analysis. P.L., G.A., and E.C. generated the FlowFISH and Q-FISH data. J.E. helped organize accrual of the mammoplasty tissue. L.T. and S.A. helped with biochemical studies and data presentation. N.K., C.E., and D.G. wrote the manuscript, which was then critiqued and approved by all authors. Received: January 26, 2013 Revised: April 24, 2013 Accepted: April 25, 2013 Published: June 4, 2013
REFERENCES
Artandi, S.E., and DePinho, R.A. (2010). Telomeres and telomerase in cancer. Carcinogenesis 31, 918. Aubert, G., and Lansdorp, P.M. (2008). Telomeres and aging. Physiol. Rev. 88, 557579. Aviv, A., Hunt, S.C., Lin, J., Cao, X., Kimura, M., and Blackburn, E. (2011). Impartial comparative analysis of measurement of leukocyte telomere length/DNA content by Southern blots and qPCR. Nucleic Acids Res. 39, e134. Baerlocher, G.M., Vulto, I., de Jong, G., and Lansdorp, P.M. (2006). Flow cytometry and FISH to measure the average length of telomeres (ow FISH). Nat. Protoc. 1, 23652376. Begus-Nahrmann, Y., Hartmann, D., Kraus, J., Eshraghi, P., Scheffold, A., Grieb, M., Rasche, V., Schirmacher, P., Lee, H.W., Kestler, H.A., et al. (2012). Transient telomere dysfunction induces chromosomal instability and promotes carcinogenesis. J. Clin. Invest. 122, 22832288. Berardinelli, F., Nieri, D., Sgura, A., Tanzarella, C., and Antoccia, A. (2012). Telomere loss, not average telomere length, confers radiosensitivity to TK6-irradiated cells. Mutat. Res. 740, 1320.
Stem Cell Reports

Lim, E., Vaillant, F., Wu, D., Forrest, N.C., Pal, B., Hart, A.H., Asselin-Labat, M.-L., Gyorki, D.E., Ward, T., Partanen, A., et al.; kConFab. (2009). Aberrant luminal progenitors as the candidate target population for basal tumor development in BRCA1 mutation carriers. Nat. Med. 15, 907913. Livak, K.J., and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-D D C(T)) Method. Methods 25, 402408. Meeker, A.K., Hicks, J.L., Gabrielson, E., Strauss, W.M., De Marzo, A.M., and Argani, P. (2004). Telomere shortening occurs in subsets of normal breast epithelium as well as in situ and invasive carcinoma. Am. J. Pathol. 164, 925935. Park, J.-I., Venteicher, A.S., Hong, J.Y., Choi, J., Jun, S., Shkreli, M., Chang, W., Meng, Z., Cheung, P., Ji, H., et al. (2009). Telomerase modulates Wnt signalling by association with target gene chromatin. Nature 460, 6672. Poon, S.S., Martens, U.M., Ward, R.K., and Lansdorp, P.M. (1999). Telomere length measurements using digital uorescence microscopy. Cytometry 36, 267278. Proia, T.A., Keller, P.J., Gupta, P.B., Klebba, I., Jones, A.D., Sedic, M., Gilmore, H., Tung, N., Naber, S.P., Schnitt, S., et al. (2011). Genetic predisposition directs breast cancer phenotype by dictating progenitor cell fate. Cell Stem Cell 8, 149163. Raouf, A., Zhao, Y., To, K., Stingl, J., Delaney, A., Barbara, M., Iscove, N., Jones, S., McKinney, S., Emerman, J., et al. (2008). Transcriptome analysis of the normal human mammary cell commitment and differentiation process. Cell Stem Cell 3, 109118. Romanov, S.R., Kozakiewicz, B.K., Holst, C.R., Stampfer, M.R., Haupt, L.M., and Tlsty, T.D. (2001). Normal human mammary epithelial cells spontaneously escape senescence and acquire genomic changes. Nature 409, 633637. Rufer, N., Dragowska, W., Thornbury, G., Roosnek, E., and Lansdorp, P.M. (1998). Telomere length dynamics in human lymphocyte subpopulations measured by ow cytometry. Nat. Biotechnol. 16, 743747. Sharma, G.G., Gupta, A., Wang, H., Scherthan, H., Dhar, S., Gandhi, V., Iliakis, G., Shay, J.W., Young, C.S.H., and Pandita,
T.K. (2003). hTERT associates with human telomeres and enhances genomic stability and DNA repair. Oncogene 22, 131146. Shay, J.W., and Bacchetti, S. (1997). A survey of telomerase activity in human cancer. Eur. J. Cancer 33, 787791. Shay, J.W., and Wright, W.E. (2010). Telomeres and telomerase in normal and cancer stem cells. FEBS Lett. 584, 38193825. Smith, L.L., Coller, H.A., and Roberts, J.M. (2003). Telomerase modulates expression of growth-controlling genes and enhances cell proliferation. Nat. Cell Biol. 5, 474479. Stingl, J., Emerman, J.T., and Eaves, C.J. (2005). Enzymatic dissociation and culture of normal human mammary tissue to detect progenitor activity. Methods Mol. Biol. 290, 249263. Stracker, T.H., and Petrini, J.H.J. (2011). The MRE11 complex: starting from the ends. Nat. Rev. Mol. Cell Biol. 12, 90103. Tanaka, H., Abe, S., Huda, N., Tu, L., Beam, M.J., Grimes, B., and Gilley, D. (2012). Telomere fusions in early human breast carcinoma. Proc. Natl. Acad. Sci. USA 109, 1409814103. Tomlinson, R.L., Ziegler, T.D., Supakorndej, T., Terns, R.M., and Terns, M.P. (2006). Cell cycle-regulated trafcking of human telomerase to telomeres. Mol. Biol. Cell 17, 955965. Uziel, T., Lerenthal, Y., Moyal, L., Andegeko, Y., Mittelman, L., and Shiloh, Y. (2003). Requirement of the MRN complex for ATM activation by DNA damage. EMBO J. 22, 56125621. van den Bosch, M., Bree, R.T., and Lowndes, N.F. (2003). The MRN complex: coordinating and mediating the response to broken chromosomes. EMBO Rep. 4, 844849. Visvader, J.E. (2009). Keeping abreast of the mammary epithelial hierarchy and breast tumorigenesis. Genes Dev. 23, 25632577. Wong, K.K., Chang, S., Weiler, S.R., Ganesan, S., Chaudhuri, J., Zhu, C., Artandi, S.E., Rudolph, K.L., Gottlieb, G.J., Chin, L., et al. (2000). Telomere dysfunction impairs DNA repair and enhances sensitivity to ionizing radiation. Nat. Genet. 26, 8588. ster, B., Mann, M., Petrini, J.H.J., and de Lange, T. Zhu, X.-D., Ku (2000). Cell-cycle-regulated association of RAD50/MRE11/NBS1 with TRF2 and human telomeres. Nat. Genet. 25, 347352.
Stem Cell Reports

Repor t Sox2-Mediated Regulation of Adult Neural Crest Precursors and Skin Repair
Adam P.W. Johnston,1,5 Sibel Naska,1,2,5 Karen Jones,1 Hiroyuki Jinno,1,4,6 David R. Kaplan,2,3 and Freda D. Miller1,3,4,*
in Developmental and Stem Cell Biology in Cell Biology Hospital for Sick Children, Toronto, ON M5G 1L7, Canada 3Department of Molecular Genetics 4Department of Physiology University of Toronto, Toronto, ON M5G 1X5, Canada 5These authors contributed equally to this work. 6Present address: Asahi Kasei Corporation, Oita 870-0396, Japan *Correspondence: fredam@sickkids.ca http://dx.doi.org/10.1016/j.stemcr.2013.04.004 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Program 1Program
Nerve-derived neural crest cells are essential for regeneration in certain animals, such as newts. Here, we asked whether they play a similar role during mammalian tissue repair, focusing on Sox2-positive neural crest precursors in skin. In adult skin, Sox2 was expressed in nerveterminal-associated neural crest precursor cells (NCPCs) around the hair follicle bulge, and following injury was induced in nerve-derived cells, likely dedifferentiated Schwann cell precursors. At later times postinjury, Sox2-positive cells were scattered throughout the regenerating dermis, and lineage tracing showed that these were all neural-crest-derived NCPCs. These Sox2-positive NCPCs were functionally important, since acute deletion of Sox2 prior to injury caused a decrease of NCPCs in the wound and aberrant skin repair. These data demonstrate that Sox2 regulates skin repair, likely by controlling NCPCs, and raise the possibility that nerve-derived NCPCs may play a general role in mammalian tissue repair.
INTRODUCTION
Insights into potential mechanisms for the regulation of mammalian tissue repair have come from studies of animals that can regenerate limbs, tails, and even the spinal cord, such as amphibians and reptiles. One major conclusion from these studies is that tissue regeneration requires nerve innervation (Kumar and Brockes, 2012). These ndings have led to the idea that peripheral nerves may regulate tissue repair in mammals. This possibility has important implications because every tissue in the body is innervated. Indirect support for this intriguing idea comes from recent studies showing that innervation regulates the biology of some adult tissue precursors (Yamazaki et al., 2011; Brownell et al., 2011). How might nerves regulate tissue repair and regeneration? In newts, neural-crest-derived Schwann cells migrate into the regenerating limb and secrete factors that regulate mesenchymal cell proliferation and regeneration itself (Kumar and Brockes, 2012). In mammals, nerve injury leads to a dramatic dedifferentiation of Schwann cells into a precursor cell state, which is important for appropriate nerve regeneration (Jessen and Mirsky, 2008). Here, we asked whether nerve-derived neural crest precursor cells (NCPCs) play a role in mammalian tissue repair, focusing on adult murine skin. We describe nerve-associated NCPCs in adult skin and show that NCPCs contribute to the regenerating dermis in a Sox2dependent fashion, and that when Sox2 is ablated, this
NCPC response is perturbed concomitantly with aberrant skin repair. Thus, Sox2 regulates skin repair, likely via its actions in Sox2-positive NCPCs, suggesting that nerve-derived NCPCs may play a general role in promoting mammalian tissue repair.
RESULTS
Sox2 Denes Nerve Terminal-Associated NCPCs in Adult Skin We rst dened Sox2-expressing skin populations using mice with EGFP knocked in to the Sox2 allele (Sox2+/EGFP mice; Ellis et al., 2004). Immunostaining of back skin at 8 weeks, when hair follicles are in telogen, showed that Sox2-EGFP was limited to some highly distinctive cells around the bulge region of virtually all hair follicles (Figure 1A) as well as scattered K8-positive Merkel cells (Figure S1A available online), which were previously reported to express Sox2 (Driskell et al., 2009). Since previous studies identied NCPC activity in the bulge (Sieber-Blum and Hu, 2008; Amoh et al., 2005), we asked whether these Sox2-EGFP-positive cells expressed p75NTR, nestin, and S100b, all markers for NCPCs. Immunostaining showed that they coexpressed these proteins (Figures 1A1C). Moreover, immunostaining for the synaptic protein synapsin1 showed that they were localized with axon terminals innervating the bulge (Figure 1D). These Sox2-EGFP-positive cells (which
Stem Cell Reports
Sox2 Regulates Skin Repair
Figure 1. Sox2-Positive NCPCs in Intact and Injured Adult Murine Back Skin (AD) Telogen hair follicles in uninjured back skin from 8-week-old Sox2+/EGFP mice immunostained for Sox2-EGFP (Sox2EGFP; green in all panels), and for nestin (A), p75NTR (B), S100b (C), or synapsin (D; all red). Double-positive cells (yellow) are indicated by arrows. In (A), the boxed area is shown at higher magnication to the right. (E) Telogen hair follicle of an 8-week-old Sox2+/EGFP;Wnt1-Cre;R26TdT/+ mouse immunostained for Sox2-EGFP (Sox2EGFP; green) and TdTomato (Wnt1Cre; red) showing a double-positive NT cell (yellow, arrow). Arrowheads denote skin nerves positive for only the Wnt1-Cre reporter. (F) Telogen hair follicle of an 8-week-old Dermo1Cre+;R26YFP/+ mouse immunostained for nestin (red) to identify NT cells and YFP (Dermo1Cre; green). Dotted lines delineate the bulge. (GI) Adult Sox2+/EGFP mouse skin adjacent to a punch wound 5 days postinjury, immunostained for Sox2-EGFP (Sox2EGFP; green) and p75NTR (G and H) or S100b (I; both red). Double-labeled (yellow) NT cells and skin nerves are denoted with arrowheads and arrows, respectively. (H) A skin nerve cut in cross-section, dened by the dotted oval. (JQ) Regenerating skin of Sox2+/EGFP mice 9 days (JO) or 30 days (PR) postinjury, immunostained for Sox2EGFP (Sox2EGFP; green) and p75NTR (K and Q), S100b (L and R), nestin (M), PGP9.5 (N), or BrdU (O; all red). In (O), mice were treated with BrdU daily commencing at the time of injury. (J and P) Overviews of the wound site, with the dotted line dening the epidermal/dermal boundary. IN indicates sections from injured animals, and the arrows denote double-labeled (yellow) cells, except for (N), where arrows and arrowheads denote EGFP-positive NCPCs that are associated or not associated with PGP9.5-positive axons, respectively. All sections are counterstained with Hoechst 33258 (blue) to show nuclei. Scale bars in all panels, 25 mm, except (E), 50 mm; (G), (I), (J), and (P), 100 mm. See also Figure S1.
we call nerve terminal [NT] cells) were also present in anagen hair follicles at 4 weeks of age, when Sox2-EGFP was also expressed in mesenchymal hair follicle precursors (Figure S1BS1E), as we previously reported (Biernaskie et al., 2009). We performed lineage tracing to conrm that NT cells were neural-crest derived, crossing Sox2+/EGFP animals and mice carrying a Wnt1-Cre transgene (which marks neural crest progeny) and a oxed TdTomato reporter gene in the Rosa26 locus. Immunostaining of back skin from 8-weekold Sox2+/EGFP;Wnt1-cre;R26TdT/+ mice showed that TdTomato was expressed in Sox2-EGFP-positive NT cells
and in EGFP-negative neural crest cells, including skin nerve cells (Figure 1E) and melanocytes (data not shown). To conrm that NT cells are of neural crest and not dermal origin, we also analyzed Dermo1Cre/+;R26YFP/+ mice in which Cre recombinase is knocked in to one allele of the Dermo1 transcription factor gene, which is expressed in dermal but not epidermal or neural-crest-derived cells (Yu et al., 2003). In these mice, nestin-positive NT cells did not express YFP (Figure 1F), but almost all dermal cells were yellow uorescent protein (YFP) positive, including the telogen hair follicle dermal papilla and sheath cells (Figure S1F). Thus, Sox2 denes a unique population of
Stem Cell Reports
Figure 2. Lineage Tracing to Dene the Origins of Sox2-Positive NCPCs within Regenerating Skin (AC) Regenerating skin from adult Sox2+/EGFP;Wnt1-Cre;R26TdTomato/+ mice 9 days postinjury, immunostained for Sox2EGFP (Sox2EGFP; green), TdTomato (Wnt1Cre; red), and p75NTR (B) or S100b (C; both pseudocolored white), with arrows denoting triple-labeled cells. (DF) Regenerating skin from Wnt1-Cre; R26TdTomato/+ mice 30 days postinjury, immunostained for TdTomato (Wnt1Cre; red) and p75NTR (E) or S100b (F; both green). Arrows denote double-labeled cells. (G and H) Regenerating skin from adult Sox2+/EGFP;Dermo1Cre/+;R26TdTomato/+ mice 9 days postinjury, immunostained for Sox2EGFP (Sox2EGFP; green) and TdTomato (Dermo1Cre; red). IN indicates sections from injured animals. Scale bars, 100 mm (A, D, and G) and 25 mm (all other panels).
neural-crest-derived NT cells in hair follicles that persist during all stages of the hair cycle. Sox2-Positive NCPCs Contribute to the Regenerating Dermis following Skin Injury To ask whether Sox2 was induced in dedifferentiated NCPCs in skin nerves following tissue injury, we performed full-thickness punch wounds on 8-week-old Sox2+/EGFP mice. Immunostaining 5 days postinjury identied many Sox2-EGFP-positive nerve cells that coexpressed p75NTR and S100b (Figures 1G1I). At 79 days postinjury, many Sox2-EGFP-positive cells were also scattered throughout the regenerating dermis (Figure 1J). Virtually all of these coexpressed p75NTR and S100b (Figures 1K and 1L), and many expressed nestin (Figure 1M), consistent with an NCPC phenotype. Some, but not all, of these NCPCs were associated with axons that had sprouted into the healing tissue and expressed the axonal marker PGP9.5 (Figure 1N). Moreover, many were proliferating: when bromodeoxyuridine (BrdU) was administered once a day commencing at the time of injury; 11% of the Sox2EGFP-positive cells were BrdU positive by 9 days (Figure 1O). In contrast, the vast majority of Sox2-EGFP-positive NT cells in hair follicles did not incorporate BrdU over this time course. These Sox2-EGFP-positive, NCPClike cells persisted within the healed dermis for at least 4 weeks (Figure 1P), during which time they maintained their expression of p75NTR and S100b (Figures 1Q and 1R). We denitively established that the Sox2-EGFP-positive cells within the wound were neural-crest derived by
performing punch wounds on Sox2+/EGFP;Wnt1-Cre; R26TdTomato/+ mice. At 9 days postinjury, virtually all Sox2-EGFP-positive cells within the wound were positive for TdTomato and coexpressed p75NTR and S100b (Figures 2A2C). These neural-crest-derived cells were still present within the regenerated dermis at 30 days postinjury (Figures 2D2F). Similar experiments with Dermo1Cre/+; R26TdTomato/+ mice crossed to Sox2+/EGFP mice showed that none of the Sox2-EGFP-positive cells coexpressed the Dermo1 reporter (Figures 2G and 2H). Most Sox2-Positive NCPCs within the Regenerating Dermis Are Induced to Express Sox2 Following Injury The above data indicate that there are several potential sources of NCPCs within injured skin, including NT cells, which always express Sox2, and cutaneous nerve cells, which are induced to express Sox2 following injury (Merkel cells are not neural-crest derived; Van Keymeulen et al., 2009). To ask which of these potential sources contributed Sox2-expressing NCPCs to the regenerating dermis, we performed lineage tracing with a mouse in which CreERT2 is knocked in to the Sox2 locus (Sox2CreERT2/+ mice; Arnold et al., 2011). We crossed these to R26TdTomato/+ mice and exposed them to tamoxifen to induce Cre-mediated recombination of the reporter gene in Sox2-positive cells. We did this either 3 weeks before a punch wound, thereby inducing expression of TdTomato in Sox2-positive NT cells and Merkel cells (Figures 3A and 3B), or at the time of injury, thereby inducing TdTomato in Sox2-expressing cells within the injured nerve (Figures 3C and 3D), in addition
Stem Cell Reports
Figure 3. Lineage Tracing Demonstrates that Most NCPCs in the Regenerating Dermis Are Induced to Express Sox2 Following Injury (AK) Regenerating skin from adult Sox2CreERT2/+;R26TdTomato/+ mice that were induced with tamoxifen either 3 weeks prior to injury (A, B, G, and I) or at the time of injury (CF, H, J, and K). Skin was immunostained for TdTomato (Sox2CreER; red) and cell-type-specic markers (green). Arrows denote double-labeled (all panels except FH) or single-labeled (FH) cells. (A and B) Skin of pretreated mice on the day of injury, immunostained for the NT marker nestin (Nes; A) or the Merkel cell marker K8 (B). (CF) Skin of mice treated with tamoxifen at the time of injury 9 days postinjury. (C and D) A nerve (C) and telogen hair follicle (D) adjacent to the wound site. (E and F) A telogen hair follicle (E) and Merkel cells (F, arrows) far from the wound site. (G and H) Low-magnication views of the wound bed 9 days postinjury in mice treated before (G) or at the time of (H) injury. (IK) Sections similar to those shown in (G) and (H) from mice treated before (I) or at the time of (J and K) injury were double labeled for p75NTR (I and J) or S100b (K). Scale bars, 100 mm (G and H) and 25 mm (all other panels).
to NT cells and Merkel cells (Figures 3D3F). No other cells in the skin were labeled under either condition. We then compared the number and phenotype of TdTomato-positive cells within the regenerating dermis 9 days postinjury. In mice treated with tamoxifen before the injury, relatively few TdTomato-positive cells were present in the wound bed (Figure 3G). In contrast, in mice treated with tamoxifen at the time of injury, many TdTomato-positive cells were scattered throughout the regenerating dermis (Figure 3H), as seen with the Sox2EGFP reporter (Figure 1J). In both cases, virtually all of the TdTomato-positive cells expressed p75NTR and S100b (Figures 3I3K), consistent with an NCPC phenotype. Thus, some NCPCs within the wound bed originate from NT cells, but most derive from NCPCs that are induced to express Sox2 following injury, likely from cutaneous nerves since other neural crest cells within the skin
(such as melanocytes) do not express Sox2 either before or after injury (data not shown). Consistent with this interpretation, when tamoxifen was given at the time of injury, many TdTomato-positive cells appeared to be migrating from local nerves into the wound bed (Figure 3C). Acute Deletion of Sox2 in Adult Mice Dysregulates the NCPC Response and Causes Aberrant Skin Repair To ask whether Sox2-positive NCPCs were functionally important for skin repair, we conditionally deleted Sox2 in adult mice and asked whether this impaired wound healing. Specically, we crossed Sox2/ mice to mice expressing a constitutively expressed CreERT2 in the Rosa26 locus (Sox2/;R26 CreERT2/+ mice; Seibler et al., 2003, Taranova et al., 2006). We injected mice with tamoxifen at 9 months of age, conrmed that this caused recombination of the
Stem Cell Reports
oxed Sox2 alleles in the skin (Figure 4A), and performed punch wounds 5 weeks later. Measurement of these punch wounds showed that Sox2 ablation signicantly decreased the rate of wound closure over 9 days relative to three different control groups (Figure 4B). Morphological analysis (Figure 4C) conrmed this decit: Sox2/;R26 CreERT2/+ mice treated with tamoxifen were signicantly impaired with regard to the epithelial gap, wound width, and dermal tissue regeneration relative to controls (Figures 4D4F). Moreover, the proportion of proliferating, Ki67-positive cells in the regenerating dermis was robustly decreased (Figures 4G and 4H). Decits in wound healing were also observed in Sox2 heterozygous mice (Figure S2), supporting the conclusion that Sox2 is necessary for skin repair. Since NCPCs are the only cells within the regenerating skin that express Sox2, these ndings suggest that the decreased skin repair is due to a decit in NCPCs. To test this idea, we quantied the relative proportion of p75NTR-positive NCPCs in the regenerating dermis (Figure 4I). This analysis showed that despite the larger wound area when Sox2 was conditionally ablated (1.62 0.27 mm2 in Sox2/;R26 CreERT2/+ mice treated with oil versus 2.57 0.59 mm2 in Sox2/;R26 CreERT2/+ mice treated with tamoxifen), the area covered by p75NTR-positive cells and their relative density were both decreased 2- to 3-fold (Figures 4J and 4K). Immunostaining for SOX2 on adjacent sections conrmed that in the Sox2/;R26 CreERT2/+ mice treated with oil, many cells within the wound bed and adjacent nerves were SOX2 positive, whereas positive cells were not observed in either the wound or nerves in the Sox2/;R26CreERT2/+ mice treated with tamoxifen. Thus, Sox2 regulates the NCPC response to tissue injury, and this response is necessary for appropriate skin repair.
DISCUSSION
The data presented here support a number of conclusions. First, we identify a population of Sox2-positive neural-crestderived NT cells around the hair follicle bulge. These cells express an NCPC phenotype and contribute cells to the regenerating dermis following skin injury. Second, we show that skin injury induces expression of Sox2 in skin nerve cells (likely dedifferentiated Schwann cells), and that these cells likely provide the major source of NCPCs in the regenerating dermis. Third, we show that Sox2 is important for this NCPC response, because when Sox2 is genetically ablated, the number of NCPCs within the regenerating dermis is reduced 2- to 3-fold. Finally, we show that an aberrant NCPC injury response, caused by genetic ablation of Sox2, is coincident with signicant decits in skin repair. Thus, Sox2-positive NCPCs contribute to the regenerating dermis. This contribution depends upon normal levels of
Sox2, and when this injury response is perturbed, skin repair is aberrant. One question that arises from this work involves the nature of the NT cells. We show here that these bulge-associated cells are located at nerve terminals, that they resemble NCPCs phenotypically, and that they contribute cells to the regenerating skin. Intriguingly, previous publications have identied NCPC stem cell activity in the hair follicle bulge region (Sieber-Blum and Hu, 2008; Amoh et al., 2005). Moreover, during development, NCPCs migrate into the skin via nerves, where they contribute melanocytes to hair follicles (Adameyko et al., 2009). We therefore propose that NT cells are NCPCs that arrive in the embryonic skin via nerves, are maintained in a precursor state by their hair follicle niche, and function as a reservoir of adult NCPC activity. A second question involves the origin of the Sox2-positive NCPCs within the regenerating dermis. The Sox2CreERT2-mediated lineage tracing shows that a large majority of these NCPCs are induced to express Sox2 following skin injury. Because the only neural-crestderived skin cells that express Sox2 following injury are NT cells and cutaneous nerve cells, it is likely that many of these NCPCs derive from the injured nerve, perhaps from dedifferentiated Schwann cell precursors that express Sox2 (Parrinello et al., 2010; Jessen and Mirsky, 2008). It is, however, formally possible that these Sox2-positive NCPCs originate outside of the skin and are trafcked into the regenerating dermis from a distance, perhaps via the circulation. Importantly, our ndings dene a role for NCPCs in promoting skin repair. How then do NCPCs regulate skin repair? Based upon work in amphibians (Kumar and Brockes, 2012), we propose that following injury, nervederived, Sox2-positive NCPCs proliferate and migrate together with adjacent mesenchymal cells into injured tissues (e.g., the skin), where they secrete growth factors that regulate mesenchymal cell proliferation and potentially other aspects of wound healing. We also posit that (1) the initial NCPC proliferation and migration are Sox2 dependent (data shown here; Le et al., 2005), and (2) at later repair stages, NCPCs in the injured tissue associate with newly grown axons, differentiate into mature Schwann cells, and once again comprise an essential component of skin nerve innervation. In such a model, nerve-derived NCPCs play two essential roles: they act in a paracrine fashion to enhance tissue repair, and they provide a source of Schwann cells for the newly remodeled innervation. Intriguingly, nerves innervate every tissue in the body, and Schwann cell dedifferentiation is a general response to nerve injury, raising the possibility that nerve-derived NCPCs may play a role in promoting mammalian tissue repair throughout the body.
Stem Cell Reports
Figure 4. Genetic Ablation of Sox2 in Adult Mice Causes Aberrant Skin Repair Concomitantly with Decits in the NCPC Injury Response (AK) Sox2/;R26CreERT2/+ mice were treated with tamoxifen (Sox2/;Cre+Tam, n = 7) or vehicle (Sox2/;Cre+Oil, n = 6) at 9 months, and punch wounds were performed 5 weeks later. As additional controls, wild-type mice of the same genetic background were treated with tamoxifen (C57/Bl6+Tam, n = 7) or oil (C57/Bl6+Oil, n = 5). (A) Genomic DNA PCR analysis showing the 297 nt product from the intact oxed allele, and the 589 nt product generated from the oxed allele after Cre-mediated recombination. (B) Extent of wound closure 39 days postinjury. Two-way ANOVA; *p < 0.05 for group effect. (C) Representative hematoxylin-and-eosin-stained section through the center of the wound bed 9 days postinjury showing the epithelial gap (EG), wound width (WW), and regenerating dermal tissue (RDT). (legend continued on next page)
Stem Cell Reports
Animals and Tamoxifen Treatments
This study was approved by the HSC Animal Care Committee in accordance with CCAC guidelines. Sox2+/EGFP (Ellis et al., 2004), Dermo1Cre/+ (Yu et al., 2003), Wnt1-Cre (Danielian et al., 1998), Sox2CreERT2/+ (Arnold et al., 2011), R26TdTomato/ (Madisen et al., 2010), R26YFP/ (Srinivas et al., 2001), Sox2/ (Taranova et al., 2006), and R26CreERT2/+ (Seibler et al., 2003) mice are described in the Supplemental Experimental Procedures. Mice were injected intraperitoneally daily for 5 consecutive days with tamoxifen (3 mg/day) or with sunower oil. Punch wounds were performed as previously described (Biernaskie et al., 2009; Supplemental Experimental Procedures), and in some experiments, 100 mg/kg BrdU was injected daily commencing on the day of injury.
Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
ACKNOWLEDGMENTS
We thank Derek van der Kooy, Brian DeVeale, and Michael Sefton for their intellectual input, and Smitha Paul, Benigno Aquino, Vania Ariosa, and Lily Morikawa for technical advice and assistance. This work was funded by CIHR grant MOP-64211 to F.D.M. A.P.W.J. is funded by an Ontario Stem Cell Initiative fellowship, F.D.M. and D.R.K. hold Canada Research Chairs, and F.D.M. is an HHMI International Research Scholar. Received: February 14, 2013 Revised: April 29, 2013 Accepted: April 30, 2013 Published: June 04, 2013
Tissue Preparation and Immunostaining

We performed morphometric analysis on parafn-embedded sections and immunouorescence on cryosections (Biernaskie et al., 2009). Fluorescence images were captured by confocal microscopy. For further details and antibodies, see the Supplemental Experimental Procedures.
REFERENCES
Adameyko, I., Lallemend, F., Aquino, J.B., Pereira, J.A., Topilko, P., ller, T., Fritz, N., Beljajeva, A., Mochii, M., Liste, I., et al. (2009). Mu Schwann cell precursors from nerve innervation are a cellular origin of melanocytes in skin. Cell 139, 366379. Amoh, Y., Li, L., Katsuoka, K., Penman, S., and Hoffman, R.M. (2005). Multipotent nestin-positive, keratin-negative hair-follicle bulge stem cells can form neurons. Proc. Natl. Acad. Sci. USA 102, 55305534. Arnold, K., Sarkar, A., Yram, M.A., Polo, J.M., Bronson, R., Sengupta, S., Seandel, M., Geijsen, N., and Hochedlinger, K. (2011). Sox2(+) adult stem and progenitor cells are important for tissue regeneration and survival of mice. Cell Stem Cell 9, 317329. Biernaskie, J., Paris, M., Morozova, O., Fagan, B.M., Marra, M., Pevny, L., and Miller, F.D. (2009). SKPs derive from hair follicle precursors and exhibit properties of adult dermal stem cells. Cell Stem Cell 5, 610623. Brownell, I., Guevara, E., Bai, C.B., Loomis, C.A., and Joyner, A.L. (2011). Nerve-derived sonic hedgehog denes a niche for hair follicle stem cells capable of becoming epidermal stem cells. Cell Stem Cell 8, 552565. Danielian, P.S., Muccino, D., Rowitch, D.H., Michael, S.K., and McMahon, A.P. (1998). Modication of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase. Curr. Biol. 8, 13231326.
Quantitative Analyses and Statistics

Wound closure (calculated as the percentage of healed area relative to the initial wound size) and quantitative morphometric analyses (performed on central sections where wound diameter was largest) are described in the Supplemental Experimental Procedures. The proportion of Ki67-positive cells was measured at the leading edges of the newly formed dermis, and the p75NTR-positive cell area was measured throughout the entire dermal portion of the wound bed. Quantitative analyses were performed blind. Statistics were obtained using Students t test (one- or two-tailed as appropriate) or one- or two-way ANOVA as indicated in the text. Error bars indicate SEM.
Supplemental Information includes two gures and Supplemental Experimental Procedures and can be found with this article online at http://dx.doi.org/10.1016/j.stemcr.2013.04.004.
This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative
(DF) Sections similar to that in (C) were analyzed for the epithelial gap (D), wound width (E), and new dermal tissue (F). Students t test; *p < 0.05 for the comparison between Sox2/;Cre+Tam and controls (the three control groups were pooled because they were statistically similar). (G and H) Sections similar to that in (C) were immunostained for Ki67, and the percentage of positive cells at the leading edge of the regenerating dermis (ovals in G, magnied in the right panel) was quantied (H). Arrows indicate Ki67-positive cells. One-way ANOVA; ***p = 0.0001 relative to control groups; n = 5 C57/Bl6+Oil, 3 C57Bl6+Tam,4 Sox2/;Cre+Oil, 7 Sox2/;Cre+Tam. (IK) Sections adjacent to those used for proliferation analysis were immunostained for p75NTR (I) and analyzed for the total area (J) and density (K) of p75NTR-positive cells in the wound bed. Arrows in the inset indicate p75NTR-positive cells. Students t test; *p < 0.05; n = 4 Sox2/;Cre+Oil and 7 Sox2/;Cre+Tam. Scale bars, 1 mm (C), 500 mm and 125 mm (G, right and left panels, respectively), 85 mm (I), and 45 mm (inset). See also Figure S2.
Stem Cell Reports
Driskell, R.R., Giangreco, A., Jensen, K.B., Mulder, K.W., and Watt, F.M. (2009). Sox2-positive dermal papilla cells specify hair follicle type in mammalian epidermis. Development 136, 28152823. Ellis, P., Fagan, B.M., Magness, S.T., Hutton, S., Taranova, O., Hayashi, S., McMahon, A., Rao, M., and Pevny, L. (2004). SOX2, a persistent marker for multipotential neural stem cells derived from embryonic stem cells, the embryo or the adult. Dev. Neurosci. 26, 148165. Jessen, K.R., and Mirsky, R. (2008). Negative regulation of myelination: relevance for development, injury, and demyelinating disease. Glia 56, 15521565. Kumar, A., and Brockes, J.P. (2012). Nerve dependence in tissue, organ, and appendage regeneration. Trends Neurosci. 35, 691699. Le, N., Nagarajan, R., Wang, J.Y.T., Araki, T., Schmidt, R.E., and Milbrandt, J. (2005). Analysis of congenital hypomyelinating Egr2Lo/ Lo nerves identies Sox2 as an inhibitor of Schwann cell differentiation and myelination. Proc. Natl. Acad. Sci. USA 102, 2596 2601. Madisen, L., Zwingman, T.A., Sunkin, S.M., Oh, S.W., Zariwala, H.A., Gu, H., Ng, L.L., Palmiter, R.D., Hawrylycz, M.J., Jones, A.R., et al. (2010). A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Nat. Neurosci. 13, 133140. Parrinello, S., Napoli, I., Ribeiro, S., Wingeld Digby, P., Fedorova, M., Parkinson, D.B., Doddrell, R.D., Nakayama, M., Adams, R.H., and Lloyd, A.C. (2010). EphB signaling directs peripheral nerve regeneration through Sox2-dependent Schwann cell sorting. Cell 143, 145155.
ter-Luks, B., Andreas, S., Kern, H., Hennek, Seibler, J., Zevnik, B., Ku T., Rode, A., Heimann, C., Faust, N., Kauselmann, G., et al. (2003). Rapid generation of inducible mouse mutants. Nucleic Acids Res. 31, e12. Sieber-Blum, M., and Hu, Y. (2008). Epidermal neural crest stem cells (EPI-NCSC) and pluripotency. Stem Cell Rev. 4, 256260. Srinivas, S., Watanabe, T., Lin, C.-S., William, C.M., Tanabe, Y., Jessell, T.M., and Costantini, F. (2001). Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev. Biol. 1, 4. Taranova, O.V., Magness, S.T., Fagan, B.M., Wu, Y., Surzenko, N., Hutton, S.R., and Pevny, L.H. (2006). SOX2 is a dose-dependent regulator of retinal neural progenitor competence. Genes Dev. 20, 11871202. Van Keymeulen, A., Mascre, G., Youseff, K.K., Harel, I., Michaux, C., De Geest, N., Szpalski, C., Achouri, Y., Bloch, W., Hassan, B.A., and Blanpain, C. (2009). Epidermal progenitors give rise to Merkel cells during embryonic development and adult homeostasis. J. Cell Biol. 187, 91100. Yamazaki, S., Ema, H., Karlsson, G., Yamaguchi, T., Miyoshi, H., Shioda, S., Taketo, M.M., Karlsson, S., Iwama, A., and Nakauchi, H. (2011). Nonmyelinating Schwann cells maintain hematopoietic stem cell hibernation in the bone marrow niche. Cell 147, 1146 1158. Yu, K., Xu, J., Liu, Z., Sosic, D., Shao, J., Olson, E.N., Towler, D.A., and Ornitz, D.M. (2003). Conditional inactivation of FGF receptor 2 reveals an essential role for FGF signaling in the regulation of osteoblast function and bone growth. Development 130, 3063 3074.
Stem Cell Reports

Repor t WNT3 Is a Biomarker Capable of Predicting the Denitive Endoderm Differentiation Potential of hESCs
Wei Jiang,1,2,3,* Donghui Zhang,6 Nenad Bursac,6 and Yi Zhang1,2,3,4,5,*
Hughes Medical Institute in Cellular and Molecular Medicine 3Division of Hematology/Oncology, Department of Pediatrics, Boston Childrens Hospital 4Department of Genetics Harvard Medical School, 25 Shattuck Street, Boston, MA 02115, USA 5Harvard Stem Cell Institute, WAB-149G, 200 Longwood Avenue, Boston, MA 02115, USA 6Department of Biomedical Engineering, Duke University, 3000 Science Drive, Hudson Hall 136, Durham, NC 27708, USA *Correspondence: wei.jiang@childrens.harvard.edu (W.J.), yzhang@genetics.med.harvard.edu (Y.Z.) http://dx.doi.org/10.1016/j.stemcr.2013.03.003 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Program 1Howard
Generation of functional cells from human pluripotent stem cells (PSCs) through in vitro differentiation is a promising approach for drug screening and cell therapy. However, the observed large and unavoidable variation in the differentiation potential of different human embryonic stem cell (hESC)/induced PSC (iPSC) lines makes the selection of an appropriate cell line for the differentiation of a particular cell lineage difcult. Here, we report identication of WNT3 as a biomarker capable of predicting denitive endoderm (DE) differentiation potential of hESCs. We show that the mRNA level of WNT3 in hESCs correlates with their DE differentiation efciency. In addition, manipulations of hESCs through WNT3 knockdown or overexpression can respectively inhibit or promote DE differentiation in a WNT3 level-dependent manner. Finally, analysis of several hESC lines based on their WNT3 expression levels allowed accurate prediction of their DE differentiation potential. Collectively, our study supports the notion that WNT3 can serve as a biomarker for predicting DE differentiation potential of hESCs.
INTRODUCTION
Human embryonic stem cells (hESCs) and induced pluripotent stem cells (iPSCs) are promising cell sources for cell therapy due to their capacity for unlimited self-renewal as well as pluripotency (Robinton and Daley, 2012). Currently, various in vitro differentiation protocols have been developed for the generation of different functional cell types. However, each of these differentiation protocols is typically developed based on one or a limited number of hESC lines and may not be applicable to other cell lines (Cohen and Melton, 2011). Indeed, different hESC and iPSC lines exhibit substantial variation in their capacity to differentiate into different cell lineages (Bock et al., 2011; Osafune et al., 2008). A recent genome-wide gene-expression analysis of a large collection of hESC and iPSC lines generated a scorecard based on the expression level of 500 lineage-specic genes (Bock et al., 2011). However, this method is technically complicated and not economical for routine laboratory studies. Thus, a simple and economical experimental approach for accurately predicting hESC and iPSC differentiation potentials is needed. In addition, a recent study demonstrated that expression of the miR-371-3 cluster can predict the neural differentiation propensity of human PSCs (hPSCs; Kim et al., 2011), which suggests that the lineage-specic differentiation potential can be predicted with the use of simple biomarkers. Here, we utilized a well-established denitive endoderm (DE) differentiation
system (DAmour et al., 2005; Jiang et al., 2007) that has also been demonstrated to work very well in our lab (Jiang et al., 2013), and established WNT3 as a biomarker capable of predicting the DE differentiation potential of hESCs.
RESULTS AND DISCUSSION

To identify a biomarker capable of predicting the hESC differentiation potential, we collected all of the hESC lines in the Zhang lab (HES2, HES3, HUES8, H9.1, H9.2, and MEL-1) and subjected them to a commonly used DE differentiation protocol (DAmour et al., 2005; Jiang et al., 2013). We previously conrmed that CD184 and CD117 doublepositive cells could mark DE cells via an activin-A-based hESC differentiation protocol (Jiang et al., 2013), which is consistent with other reports (Nostro et al., 2011; Pan et al., 2011). Hence, we measured the DE differentiation efciency by quantifying the percentage of CD184 and CD117 double-positive cell populations using ow cytometry. Consistent with previous reports (Bock et al., 2011; Osafune et al., 2008), we observed a variable efciency for DE differentiation ranging from 15.4% for H9.2 to 95.3% for MEL-1 (Figure 1A). Further analysis of the differentiation potential of the H9 cell lines maintained in different labs using the same differentiation protocol revealed a variable differentiation efciency (Figure S1A available online). In addition, we also observed a variable
Stem Cell Reports
WNT3 and Endoderm Differentiation Potential
Figure 1. The WNT3 Level in hESCs Correlates with the DE Differentiation Potential (A) Different hESC lines have different capacities for DE differentiation. The efciency of DE differentiation was measured by the percentage of CD184 and CD117 double-positive cells after 4 days of induction. (B) WNT3 messenger RNA (mRNA) levels in undifferentiated hESCs correlate with their DE differentiation efciency after 4 days of induction. HES3, H9.2, MEL-1 (MG3) cultured with feeder, HUES8 cultured with Matrigel-mTeSR1, and H9.1 and HES2 cultured under both conditions were used in the differentiation assays. Shown is one representative result of three independent experiments. (C) Immunouorescent staining images show a correlation between WNT3 levels in hESCs and SOX17 or FOXA2 expression after 4 days of DE differentiation. See also Figure S1. differentiation efciency of each cell line when it was maintained under different culturing conditions (Figure S1B). Collectively, these results suggest that the differentiation potential of hESCs is affected not only by their genetic background but also by other factors, including accumulated genetic and epigenetic changes during long-term culturing. To identify a molecular marker that can serve as an indicator of the differentiaion potential of the cell lines tested, we analyzed the expression levels of a group of genes in hESCs that include pluripotent transcription factors, modulators of various signaling pathways known to be involved in DE differentiation (Mfopou et al., 2010), and epigenetic factors implicated in DE differentiation (Jiang et al., 2013). Among the genes analyzed, the expression level of WNT3 in hESCs has the best correlation with the DE differentiation potential (Figures 1B, 1C, and
Stem Cell Reports
S1C), suggesting that the WNT3 expression level in hESCs is a potential biomarker for predicting the DE differentiation potential. If the WNT3 expression level in hESCs is a true predictor of the potential for DE differentiation, we anticipated that manipulation of the WNT3 level in hESCs should affect their DE differentiation capacity. To test for this possibility, we designed ve different small hairpin RNAs (shRNAs) that target different regions of WNT3 and generated ve stable WNT3 knockdown HUES8 sublines. We rst conrmed that knockdown of WNT3 does not affect hESC maintenance, as the expression of the pluripotent factors was maintained in these WNT3 knockdown HUES8 sublines (Figure S2A). We then subjected the parental HUES8 line and derived sublines to the same differentiation protocol and determined their DE differentiation efciency, which ranged from 10% to 80%, by quantifying the percentage of CD184 and CD117 double-positive cells. Interestingly, when the differentiation efciency of these HUES8 sublines was plotted against the WNT3 levels in the undifferentiated cell state, we observed an excellent correlation (Figure 2A). Next, we asked whether the differentiation potential of a poor hESC line with a low DE differentiation potential could be improved by enforced expression of WNT3. To this end, we constructed a doxycycline-inducible WNT3 overexpression lentiviral vector and transfected it into H9.2, one of the hESC lines with a low endogenous WNT3 level and low DE differentiation potential (Figure 1). We rst conrmed that doxycycline is able to induce WNT3 expression in this modied H9.2 hESC line in a doxycycline dosage-dependent manner (Figure S2B). We then conrmed that doxycycline treatment does not alter the expression of pluripotent genes (OCT4, NANOG, and SOX2) or AXIN2, a marker of canonical WNT/beta-catenin activity (Figure S2B). This indicates that transient overexpression of WNT3 alone does not affect hESC maintenance, and that WNT3 is functionally different from WNT signaling pathway activation, which could induce hESCs to differentiate (Davidson et al., 2012). After 4 days of culturing under different concentrations of doxycycline, these cells were subjected to DE differentiation (without doxycycline). We found that doxycyclineinduced WNT3 expression in undifferentiated H9.2 cells improved their differentiation efciency, and, more importantly, the improvement occurred in a WNT3 dosagedependent manner (Figure 2B). Collectively, the above results support our observation that the DE differentiation potential correlates with WNT3 expression levels in hESCs. To evaluate the predictive potential of WNT3, we performed the same differentiation experiment at Duke University using all of the hESC/hiPSC lines available in the Bursac lab (including hESC lines HES3 [NKX2-5-GFP], H7, and H9 and MEL-1 [NKX2-5-GFP], and hiPSC line
JT16). We rst analyzed the WNT3 expression level in these cell lines by quantitative PCR (qRT-PCR), which allowed us to rank order these cell lines based on their WNT3 expression levels. We then subjected these cell lines to differentiation and quantied their differentiation efciencies. In almost perfect agreement with our prediction, we found that the differentiation efciency is highly correlated with the WNT3 levels of these hESC/hiPSC lines (Figure 2C), conrming the predictive capacity of WNT3. To further support our cell-surface-marker-based uorescence-activated cell sorting (FACS) results, we analyzed the expression of endoderm lineage markers and pluripotent genes after DE differentiation. We chose two hESC lines (H7 [low WNT3] and MEL-1 [high WNT3]) based on their endogenous WNT3 expression levels. The results shown in Figure 2D clearly demonstrate that the expression levels of a panel of DE marker genes are higher in MEL-1 compared with the H7 cell line, suggesting a correlation between their DE differentiation potential and the endoderm marker gene-expression levels in hESCs. Activin/Nodal-SMAD2/3 signaling is necessary and sufcient for human endoderm induction (Brown et al., 2011; DAmour et al., 2005), but many other signaling pathways, particularly the WNT signaling pathway (Bone et al., 2011; Hay et al., 2008), also modulate DE differentiation (Mfopou et al., 2010). We recently reported that WNT signaling exhibited a biphasic role in modulating DE differentiation of hESCs, as treatment with either the WNT agonist Wnt3a at the beginning of differentiation or the WNT antagonist XAV 939 at a later stage of differentiation, or both, could increase DE differentiation (Jiang et al., 2013). To test whether the capacity of the WNT3 expression level in hESCs to predict the DE differentiation potential would still be applicable under these differentiation conditions, we assayed four differentiation conditions with ve different hESC lines (HUES8, HES2, HES3, H9.1, and MEL-1). The results shown in Figure 2E demonstrate that the WNT3 expression levels in hESCs were still correlated with their DE differentiation efciency under the different differentiation conditions (Figure 2E). These results indicate that although different differentiation protocols might result in variable differentiation efciency, the predictive capacity of the WNT3 expression level in hESCs is not affected by differentiation conditions. Thus far, we have demonstrated an excellent correlation between WNT3 levels in hESCs and their DE differentiation potential. However, it is not clear whether the variable WNT3 levels in hESC lines can also serve as a predictor when the hESCs are subjected to differentiation for other lineages. To address this question, we further characterized the WNT3-depleted HUES8 line. First, qRT-PCR analysis demonstrated that WNT3 knockdown upregulated neuroectoderm lineage marker gene expression when treated under the neuroectoderm differentiation condition
Stem Cell Reports
Figure 2. WNT3 Is a Functional Biomarker for Predicting the DE Differentiation Potential (A) WNT3 levels in control and various knockdown HUES8 sublines correlate with their DE differentiation efciency. Five shRNAs and one control shRNA were used to generate HUES8 sublines. (B) Overexpression of WNT3 in the H9.2 hESC line in the undifferentiated state can improve the DE differentiation efciency. The improvement correlates with the level of WNT3 expression. (C) Independent verication of the predictive potential of WNT3 using different hPSC lines maintained in a different lab. hiPSC line JT16 and hESC lines HES3 (NKX25-GFP), H9, MEL-1 (NKX2-5-GFP), and H7 cultured on feeder or dened E8 system were used in this assay. (D) qRT-PCR analysis of the expression of endoderm lineage genes and pluripotent genes after DE differentiation. Two cell lines, H7 and MEL-1, were chosen for this analysis based on their endogenous WNT3 expression levels in the undifferentiated state. Shown is one representative result (with SD from three technical replicates) of two independent experiments. (E) Four previously described protocols (Jiang et al., 2013) were used to differentiate hESCs into DE, and the correlations between the WNT3 expression level of undifferentiated hESCs and the DE differentiation efciency were analyzed. The four protocols included the following treatments in a serum-free medium: (1) A - > A (Activin A only for 4 days); (2) AW - > A (Activin A and Wnt3a for 2 days followed by Activin A only for another 2 days); (3) A - > AX (Activin A only for 2 days followed by Activin A and XAV 939 for another 2 days); and (4) AW - > AX (Activin A and Wnt3a for 2 days followed by Activin A and XAV 939 for another 2 days). See also Figure S2. (Figure S2C). Second, immunostaining revealed that WNT3 knockdown increased the PAX6- or NESTIN-positive neural lineage cell population when the cells were subjected to further neural differentiation (Figure S2D). These data suggest that WNT3 knockdown in hESCs can increase their neuroectoderm differentiation potential. We then evaluated the effect of WNT3 knockdown in hESCs on their potential for differentiation toward the mesendoderm lineage, the common precursor for mesoderm and DE. qRT-PCR analysis demonstrated that WNT3 knockdown in hESCs resulted in impaired activation of mesendoderm marker gene expression after a 1.5 day differentiation treatment (Figure S2E). Moreover, variable cardiomyocyte (mesoderm derivate) differentiation efciency was observed among the different hESC lines, with MEL-1 (highest WNT3 level) generating more beating cells than H9 and H7 when they were subjected to the same differentiation procedure (data not shown). This result is consistent with the observation that MEL-1 exhibited the highest DE differentiation potential (Figure 2C). Collectively, these
Stem Cell Reports
Figure 3. Dox-Induced WNT3 Expression in hESCs Correlates Positively with the Expression Level of a Panel of Factors Important for Endoderm Differentiation (A) qRT-PCR analysis demonstrates that Dox-induced WNT3 expression in hESCs correlates with the expression of a panel of factors important for DE differentiation. However, the increased levels of the endoderm factors are not sufcient to drive DE differentiation. Data are shown with the SD from three biological replicates. The p value by Students t test compared with no dox is shown as #p > 0.05, *p < 0.05, **p < 0.01. Differentiated DE samples serve as control. (B) Statistically signicant correlations between the mRNA levels of the endoderm maker genes NODAL, MIXL1, and EOMES in hESCs and the DE differentiation efciency of the various hESC lines. (C) Hypothetic model explaining how the WNT3 level in hESCs might be able to predict the DE differentiation potential. Left panel: The pluripotency of hESCs is independent of WNT3, and variable WNT3 expression levels exist in hESC lines. Right panel: hESCs with higher WNT3 expression. Key endoderm lineage factors are upregulated, which may render the hESCs poised for DE differentiation pending downregulation of the pluripotent factors by other differentiation signals. See also Figure S3.
results raised the possibility that WNT3 levels in hESCs may predict not only the DE differentiation potential but also the mesoderm (positive correlation) and neuroectoderm (negative correlation) differentiation potentials. Further studies are needed to quantitatively evaluate the correlation between the WNT3 expression level in hESCs and their differentiation potential for mesoderm and neuroectoderm lineages. To begin to understand why the WNT3 levels in hESCs can serve as a biomarker for predicting the DE differentiation potential, we asked whether higher levels of WNT3 in hESCs can alter the expression levels of key
DE differentiation genes. To this end, we induced the expression of WNT3 at different levels using the inducible WNT3-overexpression hESC line (Figure S2B). Although WNT3 overexpression did not signicantly alter the expression levels of pluripotent genes (Figure S2B), it upregulated a panel of key endoderm lineage genes, including EOMES, FOXA2, GATA6, GSC, MIXL1, NODAL and SOX17. However, the expression levels of these genes were still much lower compared with those in differentiated DE (Figure 3A). Interestingly, the expression levels of these endoderm genes in the various hESC lines generally correlated with their DE differentiation
Stem Cell Reports
potential (Figures 3B and S3A). NODAL, MIXL1, and EOMES exhibited a statistically signicant correlation (p < 0.05; Figure 3B), although it was not as good as that of WNT3 based on the coefcient R2 value (Figure 1B). Importantly, EOMES (EOMESODERMIN), which interacts with SMAD2/3 to initiate the transcriptional network governing endoderm formation, has been reported to mark the onset of endoderm specication (Teo et al., 2011). These data suggest that WNT3mediated upregulation of key DE differentiation genes could predispose hESCs to DE differentiation. However, it is currently unclear how WNT3 upregulation leads to higher levels of endoderm marker gene expression in hESCs. The facts that the expression level of AXIN2, a canonical WNT signaling pathway marker, did not exhibit a signicant change in WNT3-overexpression hESCs (Figure S2B), and that no signicant correlation between AXIN2 and DE differentiation capacity was observed (Figure S1C) suggest that the canonical WNT signaling pathway may not be the key factor behind WNT3s capacity to predict the DE differentiation potential. Consistent with this notion, treatment of hESCs with Wnt3a, a WNT agonist, did not signicantly alter DE differentiation efciency (Figures S3B and S3C). The use of recombinant WNT3 protein may help convert poor hESC lines with a low DE differentiation potential into good ones with a high DE differentiation potential. Although the exact mechanism by which WNT3 levels in hESCs predict their differentiation potential is not known, we propose a working model that can explain all of our data so far (Figure 3C). It has been established that the identity of hESCs is mainly determined by the core pluripotency regulatory networks (Boyer et al., 2005). Variable levels of lineage factors, such as WNT3, can be tolerated in hESCs, which is supported by the fact that knockdown or overexpression of WNT3 in hESCs does not affect pluripotent gene expression (Figure S2). However, it is likely that higher levels of WNT3 could result in upregulation of multiple factors critical for DE differentiation, rendering the hESCs poised for DE differentiation. Upon receiving other differentiation signals that downregulate the pluripotency transcription network, hESCs could initiate differentiation toward DE. Consistent with this hypothesis, a recent study demonstrated that although constitutive overexpression of SOX17 in hESCs does not affect hESC maintenance, it can guin et al., restrict hESCs to DE lineage differentiation (Se 2008). In summary, we have identied WNT3 as a biomarker capable of predicting the DE differentiation potential of hESC lines. WNT3 appears to be a functional marker, because the DE differentiation potential can be modulated by altering WNT3 levels in hESCs. Our study establishes a simple method for predicting the DE differentiation poten-
tial of hESCs, which should facilitate efforts to understand and generate endoderm cell lineages.
hESC Maintenance and DE Differentiation
hESC line HUES8 was cultured in Matrigel-coated dishes with mTeSR1 medium (STEMCELL Technologies) according to the manufacturers instructions. hESC line MEL-1 and HES3 with INS-GFP reporter (Micallef et al., 2012) were cultured on mitomycin C inactivated mouse embryonic broblast (iMEF) with regular hESC medium (Dulbeccos modied Eagles medium [DMEM]/F12, 20% (vol/vol) knockout serum replacement, 1% (vol/vol) nonessential amino acids, 1% (vol/vol) GlutaMax, 1% (vol/vol) penicillin-streptomycin, 55 mM b-mercaptoethanol supplemented with 8 ng/ml FGF2 (PeproTech)). Three H9 lines of different origin (H9.1 from the Zhang lab, H9.2 from the Bursac Lab, and H9.3 from the Deng lab (Peking University; Jiang et al., 2007) and the HES2 line were cultured either on iMEF with regular hESC medium or on Matrigel-coated dishes with mTeSR1 medium. Only those cells with undifferentiated morphology were used for the DE differentiation assay. For Figures 2C and 2D, the hESC lines H7, H9, MEL-1, and HES3 with NKX2-5-GFP reporter (Elliott et al., 2011), and hiPSC line JT-16 were cultured on iMEF with regular hESC medium. H7 cultured on dened Essential 8 Medium (Invitrogen) was also used in one experiment. The experiments shown in Figure 2C and 2D were performed in the Bursac lab. For DE differentiation, routinely cultured hESCs with undifferentiated morphology were replated into Matrigel-coated multiwell plates with ESC medium. To measure the correlation between gene expression and DE differentiation efciency, we used half of the cells for gene-expression analysis and the other half for the subsequent DE differentiation assay. One day later, the cells were washed twice with DMEM/F12 and then cultured for 4 days in basal medium (DMEM/F12, 55 mM 2-mercaptoethanol, 1% [vol/vol] nonessential amino acids, 0.5% [vol/vol] B27 without vitamin A [Invitrogen], 0.25% [vol/vol] N2 [Invitrogen]) supplemented with 100 ng/ml recombinant human activin A (PeproTech) or other growth factors or chemicals (available upon request; murine Wnt3a [PeproTech, 50 ng/ml] and XAV 939 [Tocris, 1 mM]) were used for Figure 2E). The medium was changed every day.
Statistical Analysis
All data are representative of three or more experiments. Errors are the standard deviation (SD) of averaged results. Correlation analysis was performed with GraphPad Prism software, and R2 and p values are presented. Briey, the coefcient of determination, R2, was calculated to determine how well a regression line t the set of data. The signicance (probability) of the correlation coefcient was determined from the t statistic, which indicates whether the observed correlation coefcient would have occurred by chance if the true correlation was zero. More detailed information can be found in Supplemental Experimental Procedures, and details regarding the primers used in this work are provided in Table S1.
Stem Cell Reports
Supplemental Information includes three gures, one table, and Supplemental Experimental Procedures and can be found with this article online at http://dx.doi.org/10.1016/j.stemcr. 2013.03.003.
Davidson, K.C., Adams, A.M., Goodson, J.M., McDonald, C.E., Potter, J.C., Berndt, J.D., Biechele, T.L., Taylor, R.J., and Moon, R.T. (2012). Wnt/b-catenin signaling promotes differentiation, not self-renewal, of human embryonic stem cells and is repressed by Oct4. Proc. Natl. Acad. Sci. USA 109, 44854490. Elliott, D.A., Braam, S.R., Koutsis, K., Ng, E.S., Jenny, R., Lagerqvist, E.L., Biben, C., Hatzistavrou, T., Hirst, C.E., Yu, Q.C., et al. (2011). NKX2-5(eGFP/w) hESCs for isolation of human cardiac progenitors and cardiomyocytes. Nat. Methods 8, 10371040. Hay, D.C., Fletcher, J., Payne, C., Terrace, J.D., Gallagher, R.C., Snoeys, J., Black, J.R., Wojtacha, D., Samuel, K., Hannoun, Z., et al. (2008). Highly efcient differentiation of hESCs to functional hepatic endoderm requires ActivinA and Wnt3a signaling. Proc. Natl. Acad. Sci. USA 105, 1230112306. Jiang, W., Shi, Y., Zhao, D., Chen, S., Yong, J., Zhang, J., Qing, T., Sun, X., Zhang, P., Ding, M., et al. (2007). In vitro derivation of functional insulin-producing cells from human embryonic stem cells. Cell Res. 17, 333344. Jiang, W., Wang, J., and Zhang, Y. (2013). Histone H3K27me3 demethylases KDM6A and KDM6B modulate denitive endoderm differentiation from human ESCs by regulating WNT signaling pathway. Cell Res. 23, 122130. Kim, H., Lee, G., Ganat, Y., Papapetrou, E.P., Lipchina, I., Socci, N.D., Sadelain, M., and Studer, L. (2011). miR-371-3 expression predicts neural differentiation propensity in human pluripotent stem cells. Cell Stem Cell 8, 695706. Mfopou, J.K., Chen, B., Sui, L., Sermon, K., and Bouwens, L. (2010). Recent advances and prospects in the differentiation of pancreatic cells from human embryonic stem cells. Diabetes 59, 20942101. Micallef, S.J., Li, X., Schiesser, J.V., Hirst, C.E., Yu, Q.C., Lim, S.M., Nostro, M.C., Elliott, D.A., Sarangi, F., Harrison, L.C., et al. (2012). INS(GFP/w) human embryonic stem cells facilitate isolation of in vitro derived insulin-producing cells. Diabetologia 55, 694706. Nostro, M.C., Sarangi, F., Ogawa, S., Holtzinger, A., Corneo, B., Li, X., Micallef, S.J., Park, I.H., Basford, C., Wheeler, M.B., et al. (2011). Stage-specic signaling through TGFb family members and WNT regulates patterning and pancreatic specication of human pluripotent stem cells. Development 138, 861871. Osafune, K., Caron, L., Borowiak, M., Martinez, R.J., Fitz-Gerald, C.S., Sato, Y., Cowan, C.A., Chien, K.R., and Melton, D.A. (2008). Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotechnol. 26, 313315. Pan, Y., Ouyang, Z., Wong, W.H., and Baker, J.C. (2011). A new FACS approach isolates hESC derived endoderm using transcription factors. PLoS ONE 6, e17536. Robinton, D.A., and Daley, G.Q. (2012). The promise of induced pluripotent stem cells in research and therapy. Nature 481, 295305. guin, C.A., Draper, J.S., Nagy, A., and Rossant, J. (2008). EstablishSe ment of endoderm progenitors by SOX transcription factor expression in human embryonic stem cells. Cell Stem Cell 3, 182195. Teo, A.K., Arnold, S.J., Trotter, M.W., Brown, S., Ang, L.T., Chng, Z., Robertson, E.J., Dunn, N.R., and Vallier, L. (2011). Pluripotency factors regulate denitive endoderm specication through eomesodermin. Genes Dev. 25, 238250.
ACKNOWLEDGMENTS
We thank Dr. Edouard Stanley (Monash University) for the MEL-1 (MG3) and HES3 cell lines, Dr. Sean Wu (Stanford University) for the iPSC JT16 line, and Mr. Damian Sendler for a critical reading of the manuscript. This work was supported by NIH grants U01DK089565 to Y.Z. and R01-HL104326 and R21-HL095069 to N.B. W.J. is supported by a JDRF postdoctoral fellowship. Y.Z. is an investigator of the Howard Hughes Medical Institute. The authors declare no competing nancial interests. Received: January 22, 2013 Revised: March 18, 2013 Accepted: March 20, 2013 Published: June 4, 2013
REFERENCES
Bock, C., Kiskinis, E., Verstappen, G., Gu, H., Boulting, G., Smith, Z.D., Ziller, M., Croft, G.F., Amoroso, M.W., Oakley, D.H., et al. (2011). Reference maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144, 439452. Bone, H.K., Nelson, A.S., Goldring, C.E., Tosh, D., and Welham, M.J. (2011). A novel chemically directed route for the generation of denitive endoderm from human embryonic stem cells based on inhibition of GSK-3. J. Cell Sci. 124, 19922000. Boyer, L.A., Lee, T.I., Cole, M.F., Johnstone, S.E., Levine, S.S., Zucker, J.P., Guenther, M.G., Kumar, R.M., Murray, H.L., Jenner, R.G., et al. (2005). Core transcriptional regulatory circuitry in human embryonic stem cells. Cell 122, 947956. Brown, S., Teo, A., Pauklin, S., Hannan, N., Cho, C.H., Lim, B., Vardy, L., Dunn, N.R., Trotter, M., Pedersen, R., and Vallier, L. (2011). Activin/Nodal signaling controls divergent transcriptional networks in human embryonic stem cells and in endoderm progenitors. Stem Cells 29, 11761185. Cohen, D.E., and Melton, D. (2011). Turning straw into gold: directing cell fate for regenerative medicine. Nat. Rev. Genet. 12, 243252. DAmour, K.A., Agulnick, A.D., Eliazer, S., Kelly, O.G., Kroon, E., and Baetge, E.E. (2005). Efcient differentiation of human embryonic stem cells to denitive endoderm. Nat. Biotechnol. 23, 15341541.
Stem Cell Reports

Ar ticle WNT3A Promotes Hematopoietic or Mesenchymal Differentiation from hESCs Depending on the Time of Exposure
Karin Gertow,1,4 Claire E. Hirst,1,3 Qing C. Yu,1,3 Elizabeth S. Ng,1,2,3 Lloyd A. Pereira,1,3,5 Richard P. Davis,1,6 Edouard G. Stanley,1,2 and Andrew G. Elefanty1,2,*
Immunology and Stem Cell Laboratories, Monash University, Wellington Road, Clayton, Victoria 3800, Australia Childrens Research Institute, The Royal Childrens Hospital, Flemington Road, Parkville, Victoria 3052, Australia 3These authors contributed equally to this work 4Present address: KTH (Royal Institute of Technology), AlbaNova University Center, School of Biotechnology, SE-106 91 Stockholm, Sweden 5Present address: Differentiation and Transcription Laboratory, Peter MacCallum Cancer Centre and the Pathology Department, The University of Melbourne, Parkville, Victoria 3052, Australia 6Present address: Department of Anatomy and Embryology, Leiden University Medical Centre, P.O. Box 9600, 2300 RC Leiden, the Netherlands *Correspondence: andrew.elefanty@mcri.edu.au http://dx.doi.org/10.1016/j.stemcr.2013.04.002 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Murdoch 1Monash
We investigated the role of canonical WNT signaling in mesoderm and hematopoietic development from human embryonic stem cells (hESCs) using a recombinant human protein-based differentiation medium (APEL). In contrast to prior studies using less dened culture conditions, we found that WNT3A alone was a poor inducer of mesoderm. However, WNT3A synergized with BMP4 to accelerate mesoderm formation, increase embryoid body size, and increase the number of hematopoietic blast colonies. Interestingly, inclusion of WNT3A or a GSK3 inhibitor in methylcellulose colony-forming assays at 4 days of differentiation abrogated blast colony formation but supported the generation of mesospheres that expressed genes associated with mesenchymal lineages. Mesospheres differentiated into cells with characteristics of bone, fat, and smooth muscle. These studies identify distinct effects for WNT3A, supporting the formation of hematopoietic or mesenchymal lineages from human embryonic stem cells, depending upon differentiation stage at the time of exposure.
INTRODUCTION
WNT signaling is involved in multiple processes during early development, including the maintenance and/or proliferation of stem and progenitor populations, cell fate specication, segmentation, and dorsal-ventral patterning (Logan and Nusse, 2004). During gastrulation in the mouse, WNT signaling plays a critical role in the generation of mesoderm, with Wnt3-null embryos failing to form a primitive streak (Liu et al., 1999), the structure from which hematopoietic progenitors and all other mesodermal and endodermal lineages emerge (Kinder et al., 1999). The role of WNT signaling has also been examined at later stages of hematopoietic development. Mouse knockout studies indicate that WNT3A is required for the maintenance of long-term hematopoietic stem cell (HSC) and multipotent progenitors and that WNT3A is the critical ligand that activates canonical WNT signaling in fetal liver HSCs (Luis et al., 2010). These ndings are in agreement with earlier work suggesting WNT3A can preserve the immature phenotype of HSCs in vitro or can induce stem cell characteristics in hematopoietic progenitors (Malhotra et al., 2008). Indeed, recent studies utilizing mice carrying hypomorphic alleles of the Apc gene, which binds the WNT signaling intermediate, b-catenin, showed that WNT levels regulate HSCs as well as myeloid and T lymphoid progenitors (Luis et al., 2011). These investigators determined that increasing levels of WNT signaling enhanced T cell differentiation and eventually
depleted HSCs due to reduced self-renewal (Luis et al., 2011). Although difcult to study in vivo, the critical early stages of hematopoietic lineage commitment and development can be modeled in vitro using embryonic stem cell (ESC) differentiation. Studies have conrmed that WNT signaling is required for mesoderm formation from differentiating ESCs and for the subsequent emergence of hematopoietic progenitors from mouse (Cheng et al., 2008; Gadue et al., 2006; Jackson et al., 2010; Lako et al., 2001; Lengerke et al., 2008; Lindsley et al., 2006; Nakanishi et al., 2009; Nostro et al., 2008) and human (Murry and Keller, 2008; Sumi et al., 2008; Vijayaragavan et al., 2009; Wang and Nakayama, 2009; Woll et al., 2008) ESCs. The literature cited above underscores the requirement for WNT signaling at different points during the genesis of the hematopoietic system. However, many prior differentiation studies included either stromal layers or undened media components (Cheng et al., 2008; Gadue et al., 2006; Lako et al., 2001; Lindsley et al., 2006; Vijayaragavan et al., 2009; Woll et al., 2008), raising the possibility that some of the observed effects of WNTs resulted from complex interactions with unknown factors. To address this issue, we developed a dened medium (APEL) that allows the activity of exogenously added factors to be assessed free from the inuence of uncharacterized media components, including bovine serum albumin (BSA), knockout serum replacer (KOSR), or serum (Ng et al., 2008).
Stem Cell Reports

WNT3A Promotes Blood and Mesenchyme from hESCs
In this study, we employed APEL-based differentiation to assess the contribution of WNT signaling to hematopoietic development from human embryonic stem cells. Although mesoderm formation was dependent upon WNT signals, WNT3A alone was an inefcient inducer of mesoderm. However, WNT3A synergized strongly with BMP4 to generate MIXL1+ mesoderm from which hematopoietic blast colonies were generated in semisolid media. Surprisingly, the inclusion of WNT3A in the methylcellulose abrogated blast colony development and led instead to the formation of mesenchymal colonies, denoted mesospheres. These studies highlight the importance of the timing of growth factor exposure during development and show how WNT signaling during different temporal windows promotes either hematopoietic or mesenchymal differentiation.
RESULTS
We examined the role of WNT signaling during the differentiation of human ESCs (hESCs) in APEL medium toward hematopoietic cells. To evaluate the role of WNT during mesoderm formation, hESCs were differentiated as spin embryoid bodies (EBs) (Ng et al., 2008), supplemented with WNT3A and/or BMP4. To facilitate the analysis, we employed two hESC lines (HES3 MIXL1GFP/w and MEL1 MIXL1GFP/w) in which GFP reports expression of MIXL1, a homeobox gene whose expression is restricted to mesoderm and endoderm precursors in the primitive streak (Davis et al., 2008). In contrast to the results of previous studies that employed BSA-, KOSR-, or N2B27-containing media (Gadue et al., 2006; Nakanishi et al., 2009; Sumi et al., 2008; Wang and Nakayama, 2009), we found that WNT3A alone was a poor inducer of mesendoderm, with few cells expressing MIXL1-GFP at day 4 (d4) (Figures 1A and 1B; Figures S1A and S1B available online). Instead, WNT3A-only-treated EBs resembled those formed in absence of growth factors, with approximately 80% of cells retaining high levels of the undifferentiated hESC/epiblast marker, E-CADHERIN (Figures 1B, 1C, and S1C). Indeed, transcriptional proling indicated that EBs formed in WNT3A alone displayed a very similar pattern of gene expression to EBs formed in the absence of growth factors (Figure S1D). Nevertheless, in line with previous data from mouse and human ESC studies (Gadue et al., 2006; Jackson et al., 2010; Nostro et al., 2008; Sumi et al., 2008; Wang and Nakayama, 2009; Woll et al., 2008), we found that mesoderm induction by BMP4 was not only antagonized by NOGGIN and dependent on NODAL signaling, but was also WNT dependent, since inclusion of either FZD8 or DKK1 signicantly reduced MIXL1-GFP expression (Figures 1D and S1E).
Analysis of d4 EBs revealed a strong synergy between WNT3A and BMP4, with 82% 2% of cells treated with both growth factors expressing MIXL1-GFP, compared to 32% 5% and 2.5% 0.8% GFP+ cells in cultures treated with 10 ng/ml of BMP4 alone or 100 ng/ml of WNT3A alone, respectively (Figure 1C). Induction of MIXL1-GFP was associated with a parallel increase in expression of the primitive streak and early mesoderm marker, plateletderived growth factor receptor (PDGFR)a (Davis et al., 2008), and a reciprocal reduction in the proportion of E-CADHERIN+ cells. Similar responses were observed in both independent MIXL-GFP hESC lines (Figure S1C). Inhibitor studies conrmed that mesoderm induction in hESCs by the combination of WNT3A and BMP4 was also inhibited by antagonists of BMP, NODAL, and WNT signaling (Figures 1D and S1E). In agreement with this nding, microarray analysis demonstrated that BMP4- or WNT3A/BMP4-induced EBs expressed BMPs, NODAL, and WNT genes (Figure 1E), consistent with our observations that endogenously produced growth factors in differentiating mouse ESCs provided paracrine or autocrine mesoderm inducing signals (Jackson et al., 2010). The increased expression of these genes in WNT3A/BMP4-treated hESCs was explicable by the higher proportion of MIXL1-GFP+ cells generated under this condition. Microarray analysis indicated that this subpopulation expressed growth factor genes at the highest levels (Figure S1F). Previous reports have suggested that WNTs modulate BMP signaling by promoting C-terminal phosphorylation of SMAD1/5, key components of the BMP signal transduction pathway (Fuentealba et al., 2007). Therefore, we compared the phosphorylation of SMAD1/5 in EBs formed in the combination of WNT3A/BMP4 to those differentiated with either factor alone (Figures 1F and S1G). This analysis conrmed that WNT3A led to SMAD1/5 phosphorylation and the combination of 100 ng/ml WNT3A and 10 ng/ml BMP4 resulted in levels of SMAD1/5 phosphorylation that exceeded those seen in EBs treated with either factor alone and was comparable to the SMAD1/5 phosphorylation observed in EBs formed in 30 ng/ml BMP4. Collectively, these results suggested that enhanced BMP4 signaling might be in part responsible for the synergistic activity of WNT3A during BMP4-induced hESC differentiation. However, the fact that WNT3A alone was unable to efciently induce MIXL1 expression also indicated that signaling involving SMAD1/5 intermediates was not sufcient for robust mesoderm induction. Given that transforming growth factor (TGF)-b family proteins also signal via MAPK pathways in a SMAD-independent fashion (Derynck and Zhang, 2003), we examined the effects of ERK and p38 inhibition on the induction of MIXL1-GFP by BMP4 and WNT3A/BMP4. Interestingly, while inhibition of ERK by U0126 reduced the frequency
Stem Cell Reports

Figure 1. WNT3A Synergizes with BMP4 to Induce Mesoderm (A) Bright-eld and epiuorescence images showing MIXL1-GFP expression in d4 EBs formed in WNT3A/BMP4 (WB) and BMP4 (B) but not in WNT3A alone (W). Scale bar, 200 mm. (B) Representative ow cytometric proles of E-CADHERIN and MIXL1-GFP expression in d4 EBs differentiated in APEL medium supplemented with no growth factors (N), WNT3A (W), BMP4 (B), or WNT3A/BMP4 (WB) as indicated. The percentage of cells in each quadrant is shown in upper right of each panel. (C) Histogram representing the mean frequency of MIXL1-GFP, E-CAD, and PDGFRa-expressing cells assayed by ow cytometry at d4 in EBs formed in the indicated growth factors. Data represent the mean SEM from 7 to 12 independent experiments. B and WB groups were compared using Students t test. *p < 0.01; **p < 0.001. (D) Histogram representing the mean frequency of MIXL1-GFP-expressing cells assayed at d4 in EBs formed in BMP4 with or without WNT3A and NOGGIN (300 ng/ml), SB431542 (4 mM), FZD8 (2 mg/ml), or DKK1 (1 mg/ml). Data represent the mean SEM from three to ve independent experiments. Groups with and without inhibitor were compared using Students t test. *p < 0.05; **p < 0.01. (E) Heatmap showing mean signal intensity of BMPs, NODAL, and WNTs in d4 EBs differentiated in the indicated growth factors. The scale in arbitrary units is shown. (F) Western blot examining the phosphorylation of SMAD1/5 in hESCs treated for 30 min with the growth factor combinations shown. Blots were probed with anti-b-actin antibodies to indicate that equal amounts of protein were loaded in each track. N, no growth factors; W, WNT3A; B, BMP4; WB, WNT3A/BMP4; P-SMAD 1/5, SMAD 1/5 phosphorylated on Ser463/465. (G) Histogram representing the mean frequency of MIXL1-GFP-expressing cells assayed at d4 in EBs formed in BMP4 with or with out WNT3A and the ERK inhibitor, U0126 (10 mM) or the p38 inhibitor, SB203580 (10 mM). Data represent the mean SEM from three independent experiments. Groups with and without inhibitor were compared using Students t test. *p < 0.05. See also Figures S1, S2, and Tables S1 and S2.
Stem Cell Reports

Figure 2. WNT3A Accelerates BMP4-Dependent Mesoderm Differentiation and Enhances EB Size (A) Representative ow cytometry proles showing the percentage of MIXL1-GFP+, E-CAD+, CXCR4+, and PDGFRa+ cells in d4 EBs differentiated in APEL medium supplemented with the indicated growth factors. These proles form part of the time-course experiment shown in (B). The fraction of cells present in each quadrant is indicated. (B) Graphical representation of ow cytometry data showing the percentage of MIXL1-GFP+, E-CAD+, and PDGFRa+ cells in EBs differentiated in APEL medium supplemented with the growth factors indicated at different time points. The concentration of growth factors in ng/ml is indicated. Data are shown from one representative experiment, with an independent example shown in Figure S3A. (C) Histogram representing the mean cell number per EB at d4 in cultures induced with the growth factor combinations indicated. Data represent the mean SEM from ve independent experiments. Groups were compared using Students t test. *p < 0.05. N, no growth factors; W, WNT3A; B, BMP4; WB, WNT3A/BMP4. See also Figure S3. of MIXL1-GFP+ cells, differentiation was augmented by inhibiting p38 MAPK with SB203580 (Figure 1G). A recent report suggested that treatment with WNT3A primed cells to primitive endoderm in mouse ESCs and enhanced visceral endoderm differentiation (Price et al., 2012). In order to determine whether a similar situation existed in hESCs, we compared the transcriptional proles of the small percentage of GFP+ cells that could be isolated from MIXL1-GFP hESCs differentiated in WNT3A for 4 days with the gene expression patterns of GFP+ cells sorted from parallel cultures stimulated by a combination of WNT3A/BMP4 (Figures S2AS2C). Consistent with the reported mouse ESC data, we observed enhanced expression of endodermal genes such as FOXA1, FOXA2, SOX17, CCKBR, APOA2, and CXCR4 in the WNT3A-induced GFP+ cells, while the GFP+ cells puried from the WNT3A/BMP4
cultures expressed higher levels of primitive streak and mesoderm associated genes (Figure S2C; Tables S1 and S2). Time-course analysis indicated that MIXL1-GFP hESCs differentiated in APEL supplemented with the combination of WNT3A and BMP4 more rapidly gained GFP and PDGFRa expression and more rapidly lost E-CADHERIN expression compared with cells treated with BMP4 alone (Figures 2A, 2B, and S3A). In the examples shown, differentiation proceeded rapidly and the accelerated onset of PDGFRa and MIXL1 expression and the loss of surface E-CADHERIN were evident by days 2 and 3 of differentiation. These conditions did not induce signicant expression of surface CXCR4, a marker often used as an early indicator of endodermal differentiation. In addition to the synergy observed between WNT3A and BMP4 in enhancing the rate of mesoderm formation, d4 EBs formed
Stem Cell Reports

Figure 3. Transcriptional Proles Conrm Accelerated Differentiation in WNT3A/BMP4 EBs (A) Flow cytometry plots showing the position of gates used for sorting experiments based on E-CADHERIN and MIXL1-GFP expression in d4 EBs differentiated in APEL medium supplemented with BMP4 (B) and WNT3A/BMP4 (WB). The percentage of cells falling into each quadrant is shown. (B) Histogram showing the mean percentage of cells in E-CADHERIN- (E) and MIXL1GFP- (G) expressing populations. Data represent the mean SEM from four independent experiments. B and WB groups were compared using Students t test. *p < 0.05. (CE) Comparison of transcriptional proles of sorted cell populations shown in (A) and (B) derived from BMP4- and WNT3A/BMP4stimulated cultures. Enhanced dots outside the parallel red lines indicate probe sets differing by R3-fold from the mean. (F) Heatmap showing the expression of transcription factors upregulated in d4 WNT3A/BMP4 EG+ cells. These primitive streak or posterior mesodermal genes were frequently expressed at a similar level in the corresponding BMP4 sorted fraction. The scale for mean signal intensity in arbitrary units is shown. (G) Venn diagram illustrating the overlap between the differentially expressed probe sets in the sorted populations identied in (C)(E). The genes recognized by the EG+ and E+G+ probe sets and their level of expression are listed in Tables S3 and S4. See also Figures S4 and S5.
in WNT3A/BMP4 containing medium were 2-to 3-fold larger, suggesting that WNT3A contributed to increased proliferation or decreased cell death (Figures 2C and S3B). We disaggregated d4 EBs and ow-sorted populations on the basis of E-CADHERIN and MIXL1-GFP expression (Figures 3A, 3B and S4). Day 4 EBs formed in WNT3A/BMP4containing medium included a larger percentage of cells with a more mature phenotype (EG+) than was observed in EBs differentiated in BMP4. Comparison of transcriptional proles of the sorted cell populations revealed that genes expressed by corresponding fractions were very similar in both the BMP4- and WNT3A/BMP4-treated EBs, consistent with the notion that WNT3A primarily accelerated the differentiation observed with BMP4 alone (Figures 3C3E and S5AS5H). Examination of the transcription factors whose expression was most highly upre-
gulated in the WNT3A/BMP4 EG+ cells revealed that they were primitive streak or posterior mesodermal genes that were frequently expressed at a similar level in the corresponding BMP4 sorted fraction (Figure 3F). Of the small number of genes whose transcription differed by R3-fold between the two treatment groups (39, 51, and 93 out of 48,701 probe sets for E+G, E+G+, and EG+ fractions) (Figure 3G), most were upregulated in the WNT3A/BMP4-treated EBs (37, 43, and 61 probe sets, respectively). In the GFP+ fractions, these included transcripts for the WNT8 inhibitor RGS4 and for genes associated with anterior lateral and paraxial mesoderm, such as ACTC1, CDX2, LHX8, C6ORF32, and LUM, consistent with the role of WNT signaling in cardiac and somitic differentiation (Cohen et al., 2008; Geetha-Loganathan et al., 2008) (Tables S3 and S4).
Stem Cell Reports

Figure 4. WNT3A Positively Inuences Hematopoietic Development (A) Representative images showing hemangioblast colonies in methylcellulose cultures derived from d4 EBs formed in APEL medium supplemented with BMP4 (B) or WNT3A/BMP4 (WB). Scale bar, 100 mm. (B) Histogram showing the mean frequency of hemangioblast colony-forming cells (BlCFCs) in methylcellulose cultures seeded with cells from B and WB unsorted populations and the indicated sorted fractions. (C) Percentage of the Bl-CFCs that fall within each sorted fraction. (D) Histogram showing the mean frequency of Bl-CFCs in methylcellulose cultures seeded with cells from B and WB unsorted populations after 2 or 3 days of differentiation. Data in (B)(D) represent the mean SEM from three to four independent experiments. Paired B and WB groups (BD) were compared using Students t test. Asterisks indicate samples in which statistically signicant differences in Bl-CFC frequency between B and WB differentiated cultures were observed (p < 0.05 in B and p < 0.01 in D). We compared the frequency of hematopoietic blast colony forming cells (Bl-CFCs) in d4 EBs cultured in BMP4 alone and in WNT3A/BMP4. We have previously demonstrated that these mesodermally derived precursors displayed the capacity to differentiate into erythroid cells, endothelium, and smooth muscle (Davis et al., 2008; Yu et al., 2012), similar to results in mouse and human ESCs reported by other laboratories (Choi et al., 1998; Kennedy et al., 2007) and to hemangioblasts isolated from the mouse embryo (Huber et al., 2004). Examination of their hematopoietic potential revealed that d4 EBs formed in WNT3A/ BMP4 medium generated Bl-CFCs at a slightly higher frequency than those differentiated in BMP4 alone (49 12 and 27 11 Bl-CFC/104 d4 EB cells, respectively), although the differences were not statistically signicant (Figures 4A and 4B). Since they were cultured in MC supplemented with erythropoietin (EPO), most blast colonies contained a predominance of primitive erythroid cells (Figure 4A). Given their larger size, these data suggested that d4 EBs formed in WNT3A/BMP4 generated 5-fold greater number of Bl-CFCs per input hESC than those differentiated in BMP4 alone. Most Bl-CFCs were found in the MIXL1GFP+ fractions as expected (Davis et al., 2008), with the highest frequency and greatest proportion in the EG+ population (Figures 4B and 4C). In d4 WNT3A/BMP4 cultures, nearly 20% of the Bl-CFCs were localized to the most differentiated MIXL1-GFP dim (EGd) cells, a population not present in BMP4-only-treated cultures at that time. To test the hypothesis that the combination of WNT3A/BMP4 accelerated the generation of hematopoietic mesoderm, we performed experiments to examine Bl-CFC frequency at d2 and d3 of differentiation. While the maximal frequency of Bl-CFC in BMP4-induced cultures was seen at d3 of differentiation, inclusion of WNT3A accelerated the generation of these precursors such that maximal frequency was observed earlier, after just 2 days (Figure 4D). To determine whether the WNT3A/BMP4 combination ultimately generated a greater frequency of more mature hematopoietic cells and progenitors, we analyzed d4 EBs that had been cultured for a further 79 days in medium supplemented with BMP4, vascular endothelial growth factor (VEGF), stem cell factor (SCF), interleukin (IL)-3, and EPO (Figures 5A5C). In cultures initiated in either no growth factor or WNT3A alone, only small numbers of hematopoietic or endothelial cells were generated, as evidenced by a low percentage of cells expressing CD31, CD34, and CD45 and the detection of infrequent hematopoietic CFCs in methylcellulose (Figures 5A5C). Conversely, a much higher percentage of hematopoietic cells were generated in cultures initiated in BMP4, and the inclusion of WNT3A further enhanced hematopoietic differentiation. Although the proportion of CD31+ and CD34+ was similar in cultures initiated in the presence of WNT3A/BMP4 or BMP4, the frequency of CD45+ cells and CFCs were consistently higher in WNT3A/ BMP4-treated EBs (Figures 5B and 5C). Thus, the synergy between WNT3A and BMP4 during the rst 4 days of EB differentiation and mesoderm formation resulted in an augmented generation of hematopoietic cells a week later, underscoring the importance of WNTsignaling at the earliest commitment steps during hESC-derived hematopoiesis. Because many growth factors function in a context-dependent manner, we explored the effects of adding WNT3A to
Stem Cell Reports

Figure 5. WNT3A Synergizes with BMP4 to Enhance Generation of Hematopoietic Progenitor Cells (A) Representative ow cytometry proles comparing the expression of CD31, CD34, and CD45 in d11 cultures derived from d4 EBs formed in the presence of the indicated growth factors. Cultures were supplemented with VEGF and SCF and received additional BMP4, VEGF, SCF, IL-3, and EPO from d4, as outlined in Table S1. Immunoglobulin (Ig)G-APC and IgG-PE represent the isotype control staining. The percentage of cells falling within each region is shown. (B) Histograms summarizing data examining the percentage of cells positive for each antibody at d11d13 of differentiation. Data represent the mean SEM from three independent experiments. Analysis using one-way ANOVA with Bonferroni post test indicated that cultures treated with different combinations of WNT3A and BMP4 growth factors differed signicantly as measured by the percentage of cells expressing CD31 (p < 0.01), CD34 (p < 0.005), and CD45 (p < 0.05). (C) Frequency of hematopoietic CFCs in methylcellulose cultures seeded with cells at d1113 differentiated under the indicated growth factor conditions (n = 3 independent experiments). The mean CFC frequencies were signicantly different between culture groups (p < 0.05), using one-way ANOVA with Bonferroni post test. the MC on the growth of Bl-CFCs. In cultures containing a combination of hematopoietic growth factors (VEGF, SCF, IL-3, IL-6, thrombopoietin [TPO], EPO, and FLT3L), 0.2%0.6% of cells derived from EBs differentiated with BMP4 or WNT3A/BMP4 generated Bl-CFC colonies at d4
(Figures 6A6D). Strikingly, addition of WNT3A to the methylcellulose dramatically reduced the frequency of hematopoietic blast colonies and instead supported the growth of compact, mesodermal colonies, termed mesospheres, at a similar frequency (0.4%0.6%) to that observed for BlCFCs (Figures 6A, 6B, 6E6G, S6A, and S6B). However, because mesospheres and blast colonies required mutually exclusive culture conditions, it was not possible to determine if they arose from common progenitor. We also demonstrated that the effects of adding WNT3A to the methylcellulose could be replicated with (20 Z,30 E)-6-bromoindirubin-30 -oxime (BIO), a canonical WNT signaling agonist that inhibits GSK3 (Figures S7A and S7B). Gene proling revealed that the WNT3A- and BIOinduced mesospheres contained cells that expressed early mesodermal genes such as FOXF1, MEOX1, PDGFR, HAND1, and SNAI2 and were highly enriched for transcripts associated with chondrocyte and bone differentiation, such as DLK1, LUM, MGP, COL15A1, COL3A1, FRZB, ITGA5, and CDH11 as well as many other extracellular matrix (ECM) proteins (Figure 7A; Table S5). Notably, several ECM proteins upregulated in WNT and BIO mesospheres (TNC, DCN, and FMOD) were recently shown to be highly expressed in OP9 cells engineered to constitutively express WNT3A (Ichii et al., 2012). The gene expression proles of WNT and BIO mesospheres were very similar, with 689/979 (70%) of the probe sets upregulated in BIO mesospheres also upregulated in WNT mesospheres (Figures S7C and S7D; Table S5). These gene expression proles suggested nonhematopoietic mesodermal lineage potentials for the mesospheres. Indeed, we subsequently demonstrated that the mesospheres could differentiate toward adipocyte (marked by oil red O droplets and expression of FABP-4), osteoblast (marked by the formation of alizarin red aggregates and OSTEOCALCIN expression), and smooth muscle (marked by smooth muscle actin [SMA] expression) lineages (Figures 7B7G). Whether the mesospheres contained multipotent progenitors or lineage restricted precursors for additional mesenchymal lineages remains to be determined.
DISCUSSION
We explored the role of WNT signaling during hematopoietic differentiation from hESCs in APEL medium, identifying distinct activities at different stages of differentiation. First, WNT was required for the induction of mesoderm, an outcome anticipated from prior published literature, including our own studies in differentiating mouse ESCs (Gadue et al., 2006; Jackson et al., 2010; Lengerke et al., 2008; Murry and Keller, 2008; Woll et al., 2008). We conrmed the requirement for BMP and NODAL signals
Stem Cell Reports

Figure 6. WNT3A Addition to Methylcellulose Cultures Suppresses Hematopoiesis and Promotes Mesodermal Colony Development from d4 EBs (A) Frequency of hematopoietic Bl-CFCs in methylcellulose cultures containing hematopoietic growth factors with (+) or without () WNT3A addition to the methylcellulose. Cultures were seeded with cells derived from d4 EBs from the HES3-MIXL1GFP/w hESC line grown without added growth factors (N), or in the presence of WNT3A (W), BMP4 (B), or WNT3A/BMP4 (WB). (B) Colony frequency was normalized to methylcellulose cultures supplemented with hematopoietic growth factors alone, demonstrating the suppressive effect of WNT3A. Data in (A) and (B) represent the mean SEM of four independent experiments. WNT3A (+) and () groups in (B) were compared using Students t test. *p < 0.01; **p < 0.001. (C and D) Bright-eld images showing the morphology of hemangioblast colonies formed in (C) BMP4-and (D) WNT3A/BMP4stimulated d4EBs that were disaggregated and cultured with hematopoietic growth factors (see Table S1). Scale bar, 100 mM.
in mesoderm differentiation and demonstrated that inhibition of ERK and p38 MAP kinases mediated inhibitory or stimulatory signals, respectively, downstream of BMP4 that impacted on MIXL1-GFP expression. Our observation that ERK inhibition reduced mesoderm induction by BMP is consistent with the nding of Zhang and colleagues, who demonstrated BMP4-mediated ERK activation suppressed neural differentiation of mouse ESCs (Zhang et al., 2010). Studies have shown that BMP4-induced ERK phosphorylation was required in other cellular contexts, including BMP4-dependent capillary sprouting in HUVECs and stabilization of Runx2 expression during osteoblast differentiation of C2C12 cells (Jun et al., 2010; Zhou et al., 2007). Similar to our ndings, opposing actions of ERK and p38 MAPK were reported for other mesodermal lineages. For example, ERK inhibition enhanced chondrogenesis in chick limb bud mesenchyme, while p38 inhibition had the opposite effect (Oh et al., 2000). Similarly, BMP4-stimulated generation of VEGF in mouse osteoblast-like MC3T3E1 cells was reduced in the presence of p38 inhibition but was unaffected by blocking ERK (Tokuda et al., 2003). Although WNT3A in isolation was a poor mesoderm inducer in hESCs differentiated in APEL medium, it synergized with BMP4 to efciently induce MIXL1-GFP+ mesoderm, increasing the yield of Bl-CFCs and hematopoietic CFCs. Our data complement studies in which specic roles for BMP and WNT signaling during the formation of hematopoietic mesoderm from mouse ESCs were identied (Gadue et al., 2006; Jackson et al., 2010; Lengerke et al., 2008; Nostro et al., 2008). In contrast to our ndings, a number of studies have demonstrated that primitive streak induction in differentiating mouse ESCs could be mediated by WNT3A alone (Gadue et al., 2006; Jackson et al., 2010; Nostro et al., 2008). While there may be differences between mouse and human ESC differentiation, we speculate that this discrepancy may reect the inuence of components of mouse ESC differentiation medium that are absent from APEL (such as BMP-like activity associated with serum or BSA). This hypothesis is consistent with the observed reduction in the hematopoietic-inducing activity of
(E and F) Bright-eld images of nonhematopoietic mesodermal colonies (mesospheres) formed in methylcellulose cultures supplemented with WNT3A. Cysts (F) were frequently observed. Scale bar, 200 mm. (G) Frequency of hematopoietic blast colonies (Bl-CFC) and mesospheres (Meso) from EBs grown in the presence of either BMP4 (B) or WNT3A/BMP4 (WB) for 4 days that were subsequently disaggregated and cultured in methylcellulose containing hematopoietic growth factors with (+) or without () WNT3A addition to the methylcellulose. Results from representative experiments using HES3- and MEL1-MIXL1GFP/w cell lines are shown. See also Figures S6 and S7.
Stem Cell Reports

Figure 7. WNT3A-Induced Mesospheres Differentiate to Osteogenic, Adipogenic, and Smooth Muscle Lineages (A) Heatmap showing that WNT3A- and BIO-induced mesospheres were enriched for transcripts associated with chondrocyte and bone differentiation. The expression of most of these genes differed in sorted d4 WNT3A/BMP GFP+ and GFP fractions. The scale in arbitrary units is shown. (BG) Immunocytochemical and histochemical analysis of WNT3Ainduced mesodermal colonies recultured and subjected to mesenchymal stem cell differentiation toward osteogenic and adipogenic fates. FABP-4 (B) and oil red O (G) reactivity conrmed adipogenic potential and osteogenic potential was conrmed by expression of OSTEOCALCIN (C, arrows) and alizarin red staining (F). The presence of smooth muscle was shown by SMA immunoreactivity (D). (E) IgG control for (B)(D). Scale bars, 50 mM (B and D), 100 mM (C and G), and 200 mM (E and F). (H) Model illustrating that the effects of WNT3A during mesoderm differentiation depend on the time of exposure. WNT3A synergizes with BMP4 to increase mesodermal differentiation. Methylcellulose cultures from BMP4- and WNT3A/BMP4-induced EBs stimulated with VEGF without addition of WNT3A or BIO form hemangioblast colonies, while cultures with WNT3A or BIO do not form hematopoietic colonies, but form mesospheres capable of differentiation toward bone, fat, and smooth muscle. See also Table S5.
WNT3A by the BMP antagonist NOGGIN when human ESCs were differentiated in BSA-based medium (Wang and Nakayama, 2009). The synergy between WNT3A and BMP4 in the generation of human hematopoietic cells was consistent with the observations that BMP4 induced ventral-posterior mesoderm and subsequently directed mesodermal cells toward a blood fate by activating WNT3A signaling and Cdx gene expression in mouse ESCs (Lengerke et al., 2008). Similarly, Nostro et al. showed that BMP4 had a strong posteriorizing effect on mesendodermal progenitors (Nostro et al., 2008), an effect that was likely to promote the generation of hematopoietic progenitors. Our study complements this work, showing that synergy between WNT3A and BMP during mesoderm induction enhanced the subsequent formation of hematopoietic progenitors through an increased rate of differentiation toward MIXL1+ mesendoderm and by an increase in cell numbers within EBs. Other studies have examined the role of noncanonical and canonical WNT signaling during different stages of hematopoietic development from human pluripotent stem cells. Woll and colleagues examined the inuence of WNT1, WNT5, and the WNT inhibitor, DKK1, on hematopoietic development from hESCs (Woll et al., 2008). Using stromal cell coculture, they demonstrated that hematoendothelial precursors were suppressed by DKK1, while their development was accelerated following exposure to WNT1, but not WNT5. The results of their study suggested
Stem Cell Reports

that canonical but not noncanonical signaling supported the development of a hemogenic precursor, but did not specically address the stage of differentiation at which the WNT signaling was required (Woll et al., 2008). Our results, indicating synergy between canonical WNT and BMP4 signaling in the generation of hemangioblasts, are consistent with these data. Conversely, results from a second study examining hematopoietic development from hESCs argued that noncanonical signaling by WNT11 was important in guiding hESC differentiation toward mesoderm, while canonical signaling mediated by WNT3A acted only later in differentiation to promote proliferation of hematopoietic progenitors (Vijayaragavan et al., 2009). This latter observation is consistent with studies demonstrating a regulatory role of canonical WNT signaling on hematopoietic stem and progenitor cells in mouse bone marrow (Luis et al., 2011; Trowbridge et al., 2010). Indeed, recent studies examining factors regulating hematopoietic regeneration in the zebrash and mouse demonstrated the requirement for both BMP and WNT signals (Trompouki et al., 2011). Although it is difcult to readily reconcile all the ndings from these studies, the data could be interpreted to suggest that there may be several windows during which WNT signaling differentially affects hematopoietic development. First, we have shown that the early addition of WNT3A synergistically expanded and accelerated the development of BMP4-induced hematopoietic mesoderm, but that the clonal growth of hemangioblast colonies required the removal of WNT3A. This is analogous to the sequential roles of WNT during cardiogenesis elucidated in vertebrate embryos and differentiating mouse and human ESCs (Mummery et al., 2012; Tzahor, 2007). Second, canonical WNT signaling promotes the growth of hematopoietic stem cells and committed hematopoietic progenitors, both during development and in the adult. Finally, the complexity of WNT interactions inuencing hematopoiesis is increased by recent data that indicate that WNT signaling also impacts on the bone marrow stromal niche, inducing secretion of a range of mediators that inuence hematopoietic stem and progenitor activity (Ichii et al., 2012). Concomitant with its suppressive effect on blast colony formation, the inclusion of WNT3A, or the WNT agonist BIO, in methylcellulose cultures promoted the emergence of colonies we termed mesospheres (Figure 7H). These colonies were capable of osteogenic, adipogenic, and smooth muscle differentiation and were enriched for mesoderm markers including APLNR, PDGFRA, PDGFRB, FOXF1, HAND1, SNAI2, and CDH11, reminiscent of the mesenchymal stromal cells (MSCs) differentiated from hESCs reported by a number of laboratories (Karlsson et al., 2009). In contrast to mesospheres, that emerged in
serum-free MC in response to WNT3A, most hESC-MSCs were derived in medium supplemented with serum or serum replacer plus FGF2. It is interesting to speculate on the relationship between mesosphere-forming cells and a mesoderm-derived precursor cell, the mesenchymoangioblast, that gives rise to endothelium and mesenchymal stem cells (Slukvin and Vodyanik, 2011; Vodyanik et al., 2010). Interestingly, formation of mesenchymal cells was inhibited by VEGF, which has been postulated to block the necessary endothelial-mesenchymal transition (EndMT) (Medici and Olsen, 2012; Slukvin and Vodyanik, 2011). In contrast, mesosphere development in methylcellulose cultures occurred in the presence of VEGF. A plausible hypothesis linking the WNT3A dependence of mesospheres with the prior ndings of Slukvin and colleagues, is that WNT3A stimulated the endothelial-mesenchymal transition from a mesenchymoangioblast-derived VEGF-dependent angiogenic precursor, thus overcoming the inhibitory effect of VEGF on EndMT. There is evidence for involvement of WNT signaling in both epithelial-mesenchymal transitions (Wu et al., 2012) and EndMT (von Gise and Pu, 2012), with canonical WNT signaling required for the endocardialmesenchymal transition during endocardial cushion formation in mice (Liebner et al., 2004). However, an alternative hypothesis would postulate that mesospheres represent the expanded progeny of a distinct mesenchymal progenitor cell that did not pass through an endothelial precursor stage. In summary, our data demonstrate that modulation of the timing of WNT signaling plays a critical role in the genesis of the hematopoietic system and the formation of other mesodermal derivatives. It will be of interest to determine whether this temporally dependent action of WNT involves altering the fate of a common precursor or the selection specic progenitors from a pool of cells with a spectrum of different potentials.
The experiments using human embryonic stem cells performed in this study were approved by the Monash University Human Research Ethics Committee (2002/225MC).
Cell Culture, Differentiation, and Flow Cytometric Analysis

MIXL1-GFP reporter lines (HES3 MIXL1GFP/w and MEL1 MIXL1GFP/w) were passaged as previously described (Davis et al., 2008) and differentiated as spin EBs in APEL medium (Ng et al., 2008) supplemented with growth factors or inhibitors as indicated in the Supplemental Experimental Procedures. Methylcellulose (MC) hematopoietic colony-forming assays were performed in serum-free MC as described (Ng et al., 2008). For hematopoietic differentiation cultures, d4 EBs were cultured for 79 days on gelatinized 6-well dishes in AEL
Stem Cell Reports

medium (Ng et al., 2008) containing growth factors as listed in the Supplemental Experimental Procedures. Flow cytometric analysis (FACSCalibur BD) and cell sorting (FACSDiva BD) employing the antibodies listed in the Supplemental Experimental Procedures was performed as described (Davis et al., 2008).
Western Blotting and Global Gene Expression

Nuclear extraction and western blotting were performed as described (Lim et al., 2009) using antibodies listed in the Supplemental Experimental Procedures. Total RNA (RNeasy kit, QIAGEN) was amplied, labeled, and hybridized to Human WG-6v2.0 Sentrix or HT-12v3 BeadChips (Illumina) by the Australian Genome Research Facility (http://www.agrf.org.au/). Data were analyzed with Beadstudio Gene Expression Module v3.4 (Illumina) using average normalization across all samples and differential expression analysis using GeneSpring GX10 (Agilent Technologies).
NHMRC. K.G. designed and performed experiments, collected, analyzed and interpreted data, made gures, and wrote the manuscript; L.A.P., E.S.N., C.E.H., and Q.C.Y. designed and performed experiments and made gures; R.P.D. contributed reagents and analytical tools; E.G.S. and A.G.E. designed experiments, collected, analyzed and interpreted data, made gures, provided nancial support, and wrote the manuscript. A.G.E., E.G.S., and E.S.N. entered into consultancy agreements with STEMCELL Technologies after the completion of work in this manuscript. No support from the company was provided for these studies. Received: March 26, 2013 Revised: April 21, 2013 Accepted: April 22, 2013 Published: June 4, 2013
REFERENCES
Cheng, X., Huber, T.L., Chen, V.C., Gadue, P., and Keller, G.M. (2008). Numb mediates the interaction between Wnt and Notch to modulate primitive erythropoietic specication from the hemangioblast. Development 135, 34473458. Choi, K., Kennedy, M., Kazarov, A., Papadimitriou, J.C., and Keller, G. (1998). A common precursor for hematopoietic and endothelial cells. Development 125, 725732. Cohen, E.D., Tian, Y., and Morrisey, E.E. (2008). Wnt signaling: an essential regulator of cardiovascular differentiation, morphogenesis and progenitor self-renewal. Development 135, 789798. Davis, R.P., Ng, E.S., Costa, M., Mossman, A.K., Sourris, K., Elefanty, A.G., and Stanley, E.G. (2008). Targeting a GFP reporter gene to the MIXL1 locus of human embryonic stem cells identies human primitive streak-like cells and enables isolation of primitive hematopoietic precursors. Blood 111, 18761884. Derynck, R., and Zhang, Y.E. (2003). Smad-dependent and Smadindependent pathways in TGF-beta family signalling. Nature 425, 577584. Fuentealba, L.C., Eivers, E., Ikeda, A., Hurtado, C., Kuroda, H., Pera, E.M., and De Robertis, E.M. (2007). Integrating patterning signals: Wnt/GSK3 regulates the duration of the BMP/Smad1 signal. Cell 131, 980993. Gadue, P., Huber, T.L., Paddison, P.J., and Keller, G.M. (2006). Wnt and TGF-beta signaling are required for the induction of an in vitro model of primitive streak formation using embryonic stem cells. Proc. Natl. Acad. Sci. USA 103, 1680616811. Geetha-Loganathan, P., Nimmagadda, S., Scaal, M., Huang, R., and Christ, B. (2008). Wnt signaling in somite development. Ann. Anat. 190, 208222. Huber, T.L., Kouskoff, V., Fehling, H.J., Palis, J., and Keller, G. (2004). Haemangioblast commitment is initiated in the primitive streak of the mouse embryo. Nature 432, 625630. Ichii, M., Frank, M.B., Iozzo, R.V., and Kincade, P.W. (2012). The canonical Wnt pathway shapes niches supportive of hematopoietic stem/progenitor cells. Blood 119, 16831692. Jackson, S.A., Schiesser, J., Stanley, E.G., and Elefanty, A.G. (2010). Differentiating embryonic stem cells pass through temporal
Mesenchymal Differentiation
Colonies formed in MC cultures supplemented with 100 ng/ml WNT3A or 5 mM (20 Z,30 E)-6-bromoindirubin-30 -oxime (BIO) (Calbiochem) were assayed for osteogenic and adipogenic potential using the Human Mesenchymal Stem Cell Functional Identication Kit (R&D Systems) according to the manufacturers instructions. Cells generated using this assay were analyzed by immunouorescence using anti-SMA (BD Biosciences), antiOSTEOCALCIN, and anti-FABP-4 antibodies (R&D Systems), the histochemical stain alizarin red, and lipophilic dye oil red O (Sigma-Aldrich).
ACCESSION NUMBERS
The Array Express (http://www.ebi.ac.uk/arrayexpress/) accession number for the microarray data reported here is E-MEXP-2495.
Supplemental Information includes Supplemental Experimental Procedures, seven gures, and ve tables and can be found with this article online at http://dx.doi.org/10.1016/j.stemcr.2013.04. 002.
ACKNOWLEDGMENTS
The authors thank Robyn Mayberry and Amanda Bruce for provision of cells and Andrew Fryga and Darren Ellemor for ow cytometric sorting. This work was supported by the Australian Stem Cell Centre, Stem Cells Australia, the Juvenile Diabetes Research Foundation, the Qatar National Research Foundation, and the National Health and Medical Research Council (NHMRC) of Australia. E.G.S. and A.G.E. are Senior Research Fellows of the
Stem Cell Reports

windows that mark responsiveness to exogenous and paracrine mesendoderm inducing signals. PLoS ONE 5, e10706. Jun, J.H., Yoon, W.J., Seo, S.B., Woo, K.M., Kim, G.S., Ryoo, H.M., and Baek, J.H. (2010). BMP2-activated Erk/MAP kinase stabilizes Runx2 by increasing p300 levels and histone acetyltransferase activity. J. Biol. Chem. 285, 3641036419. Karlsson, C., Emanuelsson, K., Wessberg, F., Kajic, K., Axell, M.Z., Eriksson, P.S., Lindahl, A., Hyllner, J., and Strehl, R. (2009). Human embryonic stem cell-derived mesenchymal progenitors-Potential in regenerative medicine. Stem Cell Res. (Amst.) 3, 3950. Kennedy, M., DSouza, S.L., Lynch-Kattman, M., Schwantz, S., and Keller, G. (2007). Development of the hemangioblast denes the onset of hematopoiesis in human ES cell differentiation cultures. Blood 109, 26792687. Kinder, S.J., Tsang, T.E., Quinlan, G.A., Hadjantonakis, A.K., Nagy, A., and Tam, P.P. (1999). The orderly allocation of mesodermal cells to the extraembryonic structures and the anteroposterior axis during gastrulation of the mouse embryo. Development 126, 4691 4701. Lako, M., Lindsay, S., Lincoln, J., Cairns, P.M., Armstrong, L., and Hole, N. (2001). Characterisation of Wnt gene expression during the differentiation of murine embryonic stem cells in vitro: role of Wnt3 in enhancing haematopoietic differentiation. Mech. Dev. 103, 4959. Lengerke, C., Schmitt, S., Bowman, T.V., Jang, I.H., Maouche-Chretien, L., McKinney-Freeman, S., Davidson, A.J., Hammerschmidt, M., Rentzsch, F., Green, J.B., et al. (2008). BMP and Wnt specify hematopoietic fate by activation of the Cdx-Hox pathway. Cell Stem Cell 2, 7282. Liebner, S., Cattelino, A., Gallini, R., Rudini, N., Iurlaro, M., Piccolo, S., and Dejana, E. (2004). Beta-catenin is required for endothelial-mesenchymal transformation during heart cushion development in the mouse. J. Cell Biol. 166, 359367. Lim, S.M., Pereira, L., Wong, M.S., Hirst, C.E., Van Vranken, B.E., Pick, M., Trounson, A., Elefanty, A.G., and Stanley, E.G. (2009). Enforced expression of Mixl1 during mouse ES cell differentiation suppresses hematopoietic mesoderm and promotes endoderm formation. Stem Cells 27, 363374. Lindsley, R.C., Gill, J.G., Kyba, M., Murphy, T.L., and Murphy, K.M. (2006). Canonical Wnt signaling is required for development of embryonic stem cell-derived mesoderm. Development 133, 37873796. Liu, P., Wakamiya, M., Shea, M.J., Albrecht, U., Behringer, R.R., and Bradley, A. (1999). Requirement for Wnt3 in vertebrate axis formation. Nat. Genet. 22, 361365. Logan, C.Y., and Nusse, R. (2004). The Wnt signaling pathway in development and disease. Annu. Rev. Cell Dev. Biol. 20, 781810. Luis, T.C., Naber, B.A., Fibbe, W.E., van Dongen, J.J., and Staal, F.J. (2010). Wnt3a nonredundantly controls hematopoietic stem cell function and its deciency results in complete absence of canonical Wnt signaling. Blood 116, 496497. Luis, T.C., Naber, B.A., Roozen, P.P., Brugman, M.H., de Haas, E.F., Ghazvini, M., Fibbe, W.E., van Dongen, J.J., Fodde, R., and Staal, F.J. (2011). Canonical wnt signaling regulates hematopoiesis in a dosage-dependent fashion. Cell Stem Cell 9, 345356.
Malhotra, S., Baba, Y., Garrett, K.P., Staal, F.J., Gerstein, R., and Kincade, P.W. (2008). Contrasting responses of lymphoid progenitors to canonical and noncanonical Wnt signals. J. Immunol. 181, 39553964. Medici, D., and Olsen, B.R. (2012). The role of endothelial-mesenchymal transition in heterotopic ossication. J. Bone Miner. Res. 27, 16191622. Mummery, C.L., Zhang, J., Ng, E.S., Elliott, D.A., Elefanty, A.G., and Kamp, T.J. (2012). Differentiation of human embryonic stem cells and induced pluripotent stem cells to cardiomyocytes: a methods overview. Circ. Res. 111, 344358. Murry, C.E., and Keller, G. (2008). Differentiation of embryonic stem cells to clinically relevant populations: lessons from embryonic development. Cell 132, 661680. Nakanishi, M., Kurisaki, A., Hayashi, Y., Warashina, M., Ishiura, S., Kusuda-Furue, M., and Asashima, M. (2009). Directed induction of anterior and posterior primitive streak by Wnt from embryonic stem cells cultured in a chemically dened serum-free medium. FASEB J. 23, 114122. Ng, E.S., Davis, R., Stanley, E.G., and Elefanty, A.G. (2008). A protocol describing the use of a recombinant protein-based, animal product-free medium (APEL) for human embryonic stem cell differentiation as spin embryoid bodies. Nat. Protoc. 3, 768776. Nostro, M.C., Cheng, X., Keller, G.M., and Gadue, P. (2008). Wnt, activin, and BMP signaling regulate distinct stages in the developmental pathway from embryonic stem cells to blood. Cell Stem Cell 2, 6071. Oh, C.D., Chang, S.H., Yoon, Y.M., Lee, S.J., Lee, Y.S., Kang, S.S., and Chun, J.S. (2000). Opposing role of mitogen-activated protein kinase subtypes, erk-1/2 and p38, in the regulation of chondrogenesis of mesenchymes. J. Biol. Chem. 275, 56135619. Price, F.D., Yin, H., Jones, A., van Ijcken, W., Grosveld, F., and Rudnicki, M.A. (2012). Canonical wnt signaling induces a primitive endoderm metastable state in mouse embryonic stem cells. Stem Cells 31, 752764. Slukvin, I.I., and Vodyanik, M. (2011). Endothelial origin of mesenchymal stem cells. Cell Cycle 10, 13701373. Sumi, T., Tsuneyoshi, N., Nakatsuji, N., and Suemori, H. (2008). Dening early lineage specication of human embryonic stem cells by the orchestrated balance of canonical Wnt/beta-catenin, Activin/Nodal and BMP signaling. Development 135, 29692979. Tokuda, H., Hatakeyama, D., Shibata, T., Akamatsu, S., Oiso, Y., and Kozawa, O. (2003). p38 MAP kinase regulates BMP-4-stimulated VEGF synthesis via p70 S6 kinase in osteoblasts. Am. J. Physiol. Endocrinol. Metab. 284, E1202E1209. Trompouki, E., Bowman, T.V., Lawton, L.N., Fan, Z.P., Wu, D.C., DiBiase, A., Martin, C.S., Cech, J.N., Sessa, A.K., Leblanc, J.L., et al. (2011). Lineage regulators direct BMP and Wnt pathways to cellspecic programs during differentiation and regeneration. Cell 147, 577589. Trowbridge, J.J., Guezguez, B., Moon, R.T., and Bhatia, M. (2010). Wnt3a activates dormant c-Kit(-) bone marrow-derived cells with short-term multilineage hematopoietic reconstitution capacity. Stem Cells 28, 13791389.
Stem Cell Reports

Tzahor, E. (2007). Wnt/beta-catenin signaling and cardiogenesis: timing does matter. Dev. Cell 13, 1013. , M., Ramos-Mejia, V., Moon, Vijayaragavan, K., Szabo, E., Bosse R.T., and Bhatia, M. (2009). Noncanonical Wnt signaling orchestrates early developmental events toward hematopoietic cell fate from human embryonic stem cells. Cell Stem Cell 4, 248262. Vodyanik, M.A., Yu, J., Zhang, X., Tian, S., Stewart, R., Thomson, J.A., and Slukvin, I.I. (2010). A mesoderm-derived precursor for mesenchymal stem and endothelial cells. Cell Stem Cell 7, 718729. von Gise, A., and Pu, W.T. (2012). Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ. Res. 110, 16281645. Wang, Y., and Nakayama, N. (2009). WNT and BMP signaling are both required for hematopoietic cell development from human ES cells. Stem Cell Res. (Amst.) 3, 113125. Woll, P.S., Morris, J.K., Painschab, M.S., Marcus, R.K., Kohn, A.D., Biechele, T.L., Moon, R.T., and Kaufman, D.S. (2008). Wnt
signaling promotes hematoendothelial cell development from human embryonic stem cells. Blood 111, 122131. Wu, C.Y., Tsai, Y.P., Wu, M.Z., Teng, S.C., and Wu, K.J. (2012). Epigenetic reprogramming and post-transcriptional regulation during the epithelial-mesenchymal transition. Trends Genet. 28, 454463. Yu, Q.C., Hirst, C.E., Costa, M., Ng, E.S., Schiesser, J.V., Gertow, K., Stanley, E.G., and Elefanty, A.G. (2012). APELIN promotes hematopoiesis from human embryonic stem cells. Blood 119, 6243 6254. Zhang, K., Li, L., Huang, C., Shen, C., Tan, F., Xia, C., Liu, P., Rossant, J., and Jing, N. (2010). Distinct functions of BMP4 during different stages of mouse ES cell neural commitment. Development 137, 20952105. Zhou, Q., Heinke, J., Vargas, A., Winnik, S., Krauss, T., Bode, C., Patterson, C., and Moser, M. (2007). ERK signaling is a central regulator for BMP-4 dependent capillary sprouting. Cardiovasc. Res. 76, 390399.
Stem Cell Reports

Ar ticle Rebuilding Pluripotency from Primordial Germ Cells
Harry G. Leitch,1,2 Jennifer Nichols,1,3 Peter Humphreys,1 Carla Mulas,1,4 Graziano Martello,1 Caroline Lee,2 Ken Jones,1 M. Azim Surani,1,2,3 and Austin Smith1,4,*
Trust-Medical Research Council Stem Cell Institute Trust/Cancer Research UK Gurdon Institute of Cancer and Developmental Biology 3Department of Physiology, Development, and Neuroscience 4Department of Biochemistry University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, UK *Correspondence: ags39@cam.ac.uk http://dx.doi.org/10.1016/j.stemcr.2013.03.004 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Wellcome 1Wellcome
Mammalian primordial germ cells (PGCs) are unipotent progenitors of the gametes. Nonetheless, they can give rise directly to pluripotent stem cells in vitro or during teratocarcinogenesis. This conversion is inconsistent, however, and has been difcult to study. Here, we delineate requirements for efcient resetting of pluripotency in culture. We demonstrate that in dened conditions, routinely 20% of PGCs become EG cells. Conversion can occur from the earliest specied PGCs. The entire process can be tracked from single cells. It is driven by leukemia inhibitory factor (LIF) and the downstream transcription factor STAT3. In contrast, LIF signaling is not required during germ cell ontogeny. We surmise that ectopic LIF/STAT3 stimulation reconstructs latent pluripotency and self-renewal. Notably, STAT3 targets are signicantly upregulated in germ cell tumors, suggesting that dysregulation of this pathway may underlie teratocarcinogenesis. These ndings demonstrate that EG cell formation is a robust experimental system for exploring mechanisms involved in reprogramming and cancer.
INTRODUCTION
In sexually reproducing organisms germ cells provide the continuous link between the generations, delivering the genetic and epigenetic information required to construct a new organism (Surani, 2007). Primordial germ cells (PGCs) represent the founder cells of the germline lineage. In mice, they are induced from Oct4- (also known as Pou5f1) positive pluripotent epiblast cells at the onset of gastrulation. By E7.5, PGCs are said to be specied, coincident with the expression of Stella (also known as Dppa3, Pgc7) (McLaren and Lawson, 2005; Saitou et al., 2002). During normal development, PGCs behave as unipotent progenitors and produce only germ cells. Yet, they express pluripotency genes until after colonization of the genital ridges (Surani et al., 2007). Signicantly, PGCs can give rise to pluripotent tumors in ectopic sites and they can serve as the cell of origin of testicular teratocarcinomas (Stevens, 1967). Ex vivo PGCs can directly give rise to pluripotent stem cell lines known as embryonic germ (EG) cells (Matsui et al., 1992; Resnick et al., 1992). Like embryonic stem (ES) cells, EG cells are genetically normal and are capable of contributing to chimeras (Labosky et al., 1994; Stewart et al., 1994). The process by which PGCs convert to pluripotency is erratic and poorly characterized. Three growth factors are reported to play key roles; stem cell factor (SCF), leukemia inhibitory factor (LIF), and basic broblast growth factor (bFGF). Individually, each factor positively inuences PGC proliferation and/or survival (Dolci et al., 1991; Godin et al., 1991; Matsui et al., 1991), but in combination they facilitate conversion to EG cells. Only LIF plays a role in sub-
sequent self-renewal of EG cells. bFGF is important during the rst day of culture but not thereafter, suggesting it may trigger the conversion process (Durcova-Hills et al., 2006). bFGF appears to act though the PI3K/AKT pathway because it is not required for EG cell formation from Pten deletion mutants (Kimura et al., 2003) or if AKT is hyperactivated (Kimura et al., 2008). Retinoic acid (RA) and forskolin (FK), two potent PGC mitogens, can substitute for bFGF in EG cell derivation (Koshimizu et al., 1996), as can the histone deacetylase inhibitor trichostatin A (Durcova-Hills et al., 2008). However, whether the activity of these factors is direct or mediated through induction of FGFs or other factors remains unclear due to the complex culture conditions, which include serum, feeders, and heterogeneous somatic cells. Previously, we showed that addition of two small molecule inhibitors of mitogen-activated protein kinase (MAPK) signaling and glycogen synthase kinase 3 (GSK3) (2i) (Ying et al., 2008) enables reliable generation of EG cells from mouse and rat PGCs (Leitch et al., 2010; Blair et al., 2012). However, undened components should be eliminated to delineate the individual contributions of signaling molecules and pathways that mediate the derestriction of PGCs to pluripotency. Here, we develop a dened culture system and exploit this to clarify pathway requirements and in addition to track the PGC to EG cell conversion at the single cell level.
RESULTS
EG Cell Derivation Does Not Require Serum or Feeders EG cells can be obtained after plating PGCs directly in 2i/LIF on feeders (Leitch et al., 2010). Past attempts to
Stem Cell Reports

Rebuilding Pluripotency from Primordial Germ Cells
culture PGCs without feeders have resulted in rapid cell death within 24 hr (De Felici et al., 1998). We therefore investigated whether addition of known PGC-supportive factors might increase proliferation and viability. Posterior regions of mouse E8.5 embryos were trypsinized and plated in 2i/LIF, with the addition of bFGF, SCF, RA, and FK (henceforth referred to collectively as four factors4Fs) for the rst 2 days only. In these feeder-free conditions, EG cell lines were readily obtained. However the addition of the 4Fs resulted in substantial growth of somatic cells (data not shown) calling into the question the cell-autonomous ability of PGCs to produce EG cells. Therefore, we used ow cytometry to obtain a pure population of PGCs (Figures S1A and S1B available online). This approach enabled accurate calculation of derivation efciency (percentage of PGCs forming colonies), which on bronectin approached 4% (Figure S1C.) Previously, it has been suggested that inhibition of MAPK has a negative effect on PGC proliferation (De Miguel et al., 2002). Therefore, we plated equal numbers of ow-sorted PGCs on bronectin in either 2i/LIF or GSK3 inhibitor plus LIF (CH/LIF). Over the rst 72 hr, many more PGCs were evident per cluster in the CH/LIF cultures; however, many, although not all, of the cells downregulated the Oct4-DPE-GFP reporter that is active in both PGCs and EG cells. By 7 days, only a small number of EG cell colonies were present in CH/ LIF compared with 2i/LIF (Figure 1A). These colonies in CH/LIF were partially differentiated, but they had a tightly packed core with EG cell morphology and after picking cells could be expanded in 2i/LIF indistinguishably from other EG cells. These results indicate that while MAPK inhibition contributes substantially to the production of EG cells, it may impair the initial viability of PGCs. We therefore investigated whether delayed inhibition of MAPK may reduce early cell death and improve overall conversion efciency. We plated 250 ow-sorted PGCs on bronectin in CH/LIF plus 4Fs, with or without PD, for the rst 48 hr and thereafter transitioned to 2i/LIF by half-medium changes (Figure 1B). After 12 days, 72 Oct4-DPE-GFP colonies were obtained in cultures initiated in CH, compared with only six from 2i (Figure 1C). In the course of scoring these plates, we also noted that some EG cell colonies were clustered together, raising the possibility that single PGCs may produce more than one colony (see later). However, even when colony clusters are scored as single conversion events, deferring addition of PD for 48 hr leads to a 10fold increase in yield (Figure 1C). All subsequent experiments were thus performed using these conditions unless otherwise stated. We investigated formation of EG cells from gonadal PGCs at E11.5. From 2,000 PGCs per well, we recovered a maximum of seven EG cells colonies per well (Figure 1D).
The conversion frequency of 1/286 is some 50-fold lower than for E8.5 PGCs. This is consistent with previous reports of increasing refractoriness as development progresses (Durcova-Hills and Capel, 2008; Labosky et al., 1994). EG cells have never been derived from before E8.0 even though PGCs are specied at E7.5 (Labosky et al., 1994; McLaren and Lawson, 2005). To test whether early PGCs are competent to produce EG cells, we collected embryos at the early/ midallantoic bud stage, excluding late head-fold stage embryos. We dissected the posterior section of 23 embryos carrying the Oct4-DPE-GFP transgene and were able to recover 98 GFP-positive cells by ow cytometry (Figure 1H). After 10 days of culture, we obtained a total of 13 EG cell colonies. Three colonies appeared close together and another two were doublets (Figures 1E and 1H). Assuming clustered colonies derive from one starting cell gives a corrected conversion frequency of 10/98. Importantly, GFP-negative cells did not yield any colonies. However, the expression of the Oct4-DPE-GFP transgene is not completely restricted to PGCs at this time point (Yoshimizu et al., 1999). To conrm that the colonies obtained were derived from PGCs rather than late epiblast or other cells, we repeated the experiment using Blimp1-GFP or StellaGFP reporters. From ve E7.5 Blimp1-GFP embryos, we obtained 2,000 GFP-positive cells. As only 2040 PGCs are present at this stage, the majority of these cells were presumably visceral endodermal where Blimp1 is also expressed (Ohinata et al., 2005). Indeed, we observed many patches of endodermal-like cells growing in the cultures (Figure 1F). However, we also obtained 15 EG cell colonies in eight distinct clusters (Figures 1F and 1H). These colonies were Blimp1-GFP negative at the end of the experiment, which is expected because BLIMP1 is rapidly downregulated during EG derivation (Durcova-Hills, et al., 2008), and the expression of Blimp1 in ES cells in 2i/LIF is negligible (Figure 1F; Marks et al., 2012). Stella-GFP is upregulated around E7.5 specically in PGCs (Payer et al., 2006). In two separate experiments, we were able to isolate 45 and 47 Stella-GFP-positive PGCs that produced eight and ten colony clusters, respectively, representing an EG-cellderivation efciency of approximately 20% (Figures 1G and 1H). Overall, these ndings are comparable to EG cell generation from puried E8.5 PGCs. To conrm the identity and potency of E7.5 EG cells, we produced chimeras. We rst introduced a DsRed reporter transgene to StellaGFP-derived EG cells using the PiggyBac system. EG cells stably transfected with a DsRed expression construct (Guo et al., 2009) were injected into blastocysts and transferred to recipient pseudopregnant hosts. Pregnant females were sacriced at midgestation, and four out of nine embryos exhibited widespread chimerism (Figure 1I). Unlabeled EG cells were also injected into blastocysts, transferred to pseudopregnant hosts, and left to term. Coat color
Stem Cell Reports

Figure 1. Efcient EG Cell Derivation in Dened Conditions without Serum or Feeders (A) Histogram showing EG-cell-colony frequency in 2i/LIF versus CH/LIF. The four factors (4Fs), bFGF, SCF, FK, and RA, were added for the rst 48 hr of culture. Error bars denote SE of two biological replicates. **p < 0.01, Students t test. (B) Schematic of derivation protocol. PGCs were plated in CH/LIF plus 4Fs, with or without PD for the rst 48 hr. All cultures were subsequently fed with 2i/LIF. (C) Quantitation of EG-cell-colony frequency in each condition. (D) Histogram showing EG-cell-colony formation from E11.5 PGCs in 2i/LIF and CH/LIF. The four factors (4Fs), bFGF, SCF, FK, and RA, were added for the rst 48 hr of culture. All cultures were subsequently fed with 2i/LIF. Error bars denote SE of three biological replicates. Phase and uorescence images show a primary E11.5 EG cell colony. (EG) FACS plot showing gated GFP-positive E8.5 PGCs and phase-contrast and uorescence images of primary EG cell colonies derived from (E) Oct4-DPE-GFP embryos, (F) Blimp1-GFP embryos, and (G) Stella-GFP embryos. (H) Summary of E7.5 EG-cell-derivation experiments. (I) Bright-eld and uorescence images of E11.5 chimeric embryos made from aggregations of E7.5 EG cells carrying a constitutively active DsRed reporter transgene. (J) Coat color chimeras generated with agouti E7.5 EG cells injected into C57BL/6 blastocysts (upper panel) and an adult chimera with C57BL/6 mate and brown pup, indicating transmission of the EG cell genome (lower panel). Scale bars, 100 mm. See also Figure S1 and Table S1.
chimerism was evident in 5/15 pups (Figure 1J; Table S1). One of these chimeras was test mated and gave germline transmission (Figure 1J). We conclude that from specication PGCs have the capacity to form pluripotent EG cell lines. Single PGCs Efciently Give Rise to EG Cells To establish if isolated PGCs are capable of forming EG cells, individual Oct4-DPE-GFP-positive PGCs from E8.5 embryos were ow-sorted into 96-well plates containing CH/LIF plus 4Fs with or without PD (Figure 2A). Each
well was examined by microscopy 4 hr after deposition, and none was found to contain more than one cell, although some mitotic gures were observed. Twentyfour hours after deposition, each well was again examined, and cells were present in 56/96 and 61/96 wells with or without PD, respectively (Figure 2B). As above, cultures were transitioned to 2i/LIF by daily half-medium changes from 48 hr. After 12 days, each well was assessed for the presence of EG cells (Figure 2B). In the plate initiated in 2i, there were three positive wells, one containing two colonies. In the CH/LIF plate, 12 cells (18%) yielded EG
Stem Cell Reports

Figure 2. EG Cell Derivation from Single PGCs (A) Schematic of derivation protocol. Oct4-DPE-GFP-positive PGCs were deposited singly into each well of a 96-well plate, in medium containing CH/LIF+4Fs with or without PD. After 48 hr, cultures were transitioned to 2i/LIF by daily half-medium changes. (B) Summary of results obtained from each 96-well plate. (C) Single frames from time-lapse movie of EG cell derivation. Arrow denotes PGC that produces all nine EG cells colonies. Cells with PGClike morphology proliferate up until approximately 85 hr. By 112.5 hr, extensive cell death is evident. At 154.5 hr, small colonies are evident and have expanded by 179 hr. The nal image shows Oct4-DPE-GFP expression in EG cell colonies at 179 hr. See also Movie S1. (D) Coat color chimera (generated with agouti EG cells derived from a colony in C) with C57BL/6 mate and all brown litter, indicating successful germline transmission. See also Figure S2 and Table S1. colonies and ve contained more than one colony. We note that if total colonies are divided by the number of PGCs plated, then the calculated derivation efciency would be 31.1%. Thus, the enumeration method routinely used for bulk culture experiments overestimates the actual number of starting PGCs that convert. We carried out time-lapse analyses to visualize the process of EG cell generation and observe how multiple colonies may be produced. Ten PGCs were plated in each well of a 96-well plate and the progeny of single PGCs tracked over 179 hr. We observed that in clones that generated EG cells many sister cells died. We also found several
Stem Cell Reports

instances of single PGCs giving rise to multiple EG cell colonies. These generally arose independently from separate daughter cells rather than by colony splitting (Figure 2C; Movie S1). We picked ten colonies originating from different PGCs, and ve derived from the same PGC. All could readily be expanded as EG cell lines. One was injected into blastocysts and gave rise to coat color chimeras (Figure 2D; Table S1). A chimera was test mated and exhibited germline transmission (Figure 2E), conrming naive pluripotent identity and functionality. Signaling Requirements for EG Cell Formation Next, we investigated the stimuli required to enable conversion of PGCs to EG cells. Sorted PGCs were cultured as above but with individual factors removed. Withdrawal of forskolin had no effect, but without initial exposure to SCF or RA there was a signicant reduction in colony numbers (Figure 3A). Fewer colonies were also obtained without bFGF. Thus, all three of these factors contribute to the starting period of EG cell derivation though none is essential. Interestingly, although LIF has been reported to increase the survival and proliferation of PGCs (Matsui et al., 1991), we did not observe an overt effect on PGC survival or proliferation during the early stages of culture (Figure 3B), and EG-cell-colony formation is not signicantly affected by the absence of LIF during the rst 48 hr of culture (Figure 3C). However, colony number is reduced if LIF is withheld for a further 24 hr, and most signicantly, in the continuous absence of LIF no colonies are obtained (Figure 3A). We assessed the duration of LIF stimulation required to enable conversion. When LIF is present from the start and removed by medium washout after 72 hr, a small number of colonies are obtained. The yield increases after 96 hr in LIF and further after 120 hr (Figure 3D). However, medium change may not be sufcient to completely eliminate the LIF signal. Therefore, we combined LIF removal with addition of an inhibitor of Janus-associated kinases (JAK) to block ongoing signaling (Figure 3D). Under these conditions, no colonies are recovered unless prior LIF stimulation has been maintained for 144 and 192 hr exposure is needed to reach control efciency (Figure 3D). These ndings indicate that prolonged LIF stimulation between 48 and 192 hr is required to maximize EG cell formation. STAT3 is the key mediator of LIF effects both on ES cell self-renewal (Matsuda et al., 1999; Niwa et al., 1998) and in EpiSC and somatic cell reprogramming (Bao et al., 2009; van Oosten et al., 2012; Yang et al., 2010). We compared the expression pattern of LIF/STAT3 targets (Bourillot et al., 2009) in single-cell RNA-seq data sets from E8.5 PGCs and ES cells (Hackett et al., 2012; Tang et al., 2010). The expression of 37 annotated STAT3 target genes was signicantly enriched in ES cells (Welchs t test, p < 0.01)
(Figure 3E). This is consistent with a requirement to activate LIF signaling and targets for PGC conversion. We used immunostaining to detect the emergence of KLF4, a validated LIF/STAT3 target and pluripotency factor (Hall et al., 2009; Li et al., 2005; Niwa et al., 2009), which has previously been shown to be upregulated during EG cell derivation (Durcova-Hills et al., 2008; Nagamatsu et al., 2012) (Figure 3F). Positive cells were rst detected at 96 hr, but, in contrast to established EG cell cultures in 2i/LIF, KLF4 expression is mosaic within colonies (Figure 3F). This heterogeneity is manifest even after 120 hr, although colonies with a more homogenous KLF4 staining pattern can also be observed by this stage (Figure 3F). These observations indicate that KLF4 expression develops asynchronously and is progressively consolidated during EG cell formation. To establish whether STAT3 function is in fact required for EG cell derivation, we performed knockdown experiments during the conversion process using small interfering RNA (siRNA). The efciency and specicity of siRNAs was conrmed in ES cells (Figure S2). PGCs were plated in CH plus 4Fs in the absence of LIF for 30 hr prior to siRNA transfection. Following transfection, culture medium was changed to 2i/LIF and colonies were counted after 12 days. Transfection was associated with some cellular toxicity, reducing the colony yield from control siGFP-transfected cells by approximately 50% (Figure 3G). However, over and above this effect, STAT3 knockdown abolished EG-cell-colony formation completely in each of several independent experiments (Figure 3G). We conclude that STAT3 is required to mediate conversion of PGCs to EG cells. STAT3 Targets Are Upregulated in Germ Cell Tumors The preceding results suggest that signaling through the LIF/STAT3 pathway is low or absent in PGCs and that activation of STAT3 targets drives regeneration of pluripotency during EG cell derivation. PGCs can be the cells of origin during teratocarcinogenesis, and many pluripotency genes are found to be upregulated in human germ cell tumors (Oosterhuis and Looijenga, 2005). We therefore investigated the expression of the STAT3 targets in a human germ cell tumor (GCT) microarray data set (Korkola et al., 2006; West et al., 2009). We found widespread upregulation of these target genes in GCTs compared with low expression in normal testes (Figure 4A). We used these STAT3 target genes to construct a KEGG pathway (Savatier STAT3 targets) and found this to be the fth most upregulated pathway when comparing all GCTs with normal testes (Figure 4B). However, only a subset of human GCTs is thought to undergo teratocarcinogenesis (Oosterhuis and Looijenga, 2005). Of these, embryonal carcinomas contain a pluripotent cell compartment and exhibit a
Stem Cell Reports

Figure 3. LIF/STAT3 Drives Acquisition of Pluripotency (A) Histogram showing EG-cell-colony numbers obtained from ow-sorted PGCs plated either in CH/LIF+4Fs (control) or with the indicated factor removed. After 48 hr, cultures were transitioned to 2i/LIF (or 2i only in the LIF condition) by daily half-medium changes (mean SEM, *p < 0.05, **p < 0.01, and ***p < 0.001, ANOVA with Dunnetts post hoc, here and for all other gures, unless otherwise stated) (n = 12). (B) Phase-contrast image after 65.2 hr in minus LIF and plus LIF conditions, showing the daughter cells derived from single PGCs. (C) Histogram showing EG-cell-colony numbers obtained from ow-sorted PGCs plated in CH+4Fs. After 48 hr, cultures were transitioned to 2i by daily half-medium changes. LIF was added either from the start of the experiment (0 hr) or at the time indicated, and maintained thereafter (n = 12). (D) Histogram showing EG-cell-colony numbers obtained from ow-sorted PGCs. At the times indicated, either LIF was removed by changing the medium (gray bars) or LIF was removed and a JAK inhibitor added (blue bars). In the control, LIF was present throughout (n = 8). (legend continued on next page)
Stem Cell Reports

gene expression prole similar to human ES cells (Sperger et al., 2003). Notably, STAT3 target genes are the second most upregulated KEGG pathway in embryonal carcinoma (EC) samples, second only to ribosome (Figure S3A). Mixed GCTs often contain an EC component and STAT3 targets are ranked fourth of the upregulated pathways in this group (Figure S3B). Teratomas consist only of differentiated cell types and have low expression of pluripotency-associated genes (Figure 4A) but are believed to pass through a pluripotent cell intermediate. Intriguingly, they still exhibit a strong enrichment for STAT3 target genes (Figure S3C). Reactivation of pluripotency does not occur in seminomas (Oosterhuis and Looijenga, 2005), which retain expression of germline genes (Figure 4A). Consistently, STAT3 targets are less enriched in the seminoma samples, and also in yolk sac tumors, the etiology of which remains unclear (Figures S3D and S3E). These data suggest that STAT3 activation may be a primary lesion in germ cell tumors that transit through pluripotency.
DISCUSSION
Mammalian primordial germ cells are considered unipotent, giving rise only to the gametes. Indeed, the sperm and egg represent two of the most overtly differentiated cell phenotypes. Yet, these two specialized cells regain access to the entire embryonic and extraembryonic differentiation programs following fertilization and zygotic reprogramming. Immature cells of the germline can also acquire pluripotency through nonphysiological routes, ex vivo formation of EG cells and multipotent germline stem cells (Kanatsu-Shinohara et al., 2004), or in vivo teratocarcinogenesis. However, those events have previously been obtained at low frequency in complex environments. Here, we demonstrate that 10%30% of single mouse PGCs can convert to pluripotent EG cells in well-dened conditions. This is comparable to the efciency of ES cell derivations reported from single epiblast cells (Brook and Gardner, 1997; Rugg-Gunn et al., 2012) and challenges the notion that PGCs are an intrinsically committed unipotent lineage. PGC identity depends on the activity of determinants such as Blimp1 (Ohinata et al., 2005), Prdm14 (Yamaji
et al., 2008), and Tcfap2c (Weber et al., 2010). However, PGC specication is also associated with reexpression or upregulation of core pluripotency transcription factors including Nanog, Sox2, and Klf2 (Kurimoto et al., 2008). These factors are thought to be essential in PGCs (Chambers et al., 2007; Kehler et al., 2004; Yamaguchi et al., 2009), although their role remains unclear. Their presence may mean that pluripotency is not extinguished in PGCs as in other postgastrulation lineages (Osorno et al., 2012), but could instead lie dormant. Derivation of EG cell lines from the rst specied PGCs at E7.5 is consistent with the idea that latent pluripotency may be a necessary feature of the germline. The efciency of EG cell generation does decrease during PGC development however, falling by more than an order of magnitude at E11.5. Interestingly, this coincides temporally with widespread epigenome modications (Hajkova et al., 2008). Nonetheless, a rudiment of pluripotency is retained in later germline development as evidenced by the ability to derive a type of pluripotent stem cell from spermatogonial stem cells (Kanatsu-Shinohara et al., 2004; Ko et al., 2009). In feeder-free cultures with 4Fs and GSK3 inhibition, we observed that PGCs exhibit features of locomotor cells, such as cell extension and lamellopodia (Movie S1). This motile phenotype persists throughout the early proliferative phase of culture for approximately 72 hr. After this time, cell death is progressive, and only cells undergoing conversion to EG cells continue to proliferate extensively. However, cell loss is heterogeneous and occasional cells with PGC morphology survive until much later time points. This raises the intriguing possibility that it may be feasible to sustain PGC proliferation and survival without EG cell formation. In this context, it might be productive to omit LIF while employing GSK3 inhibition. LIF does not appear important for initial PGC culture but is specically required to drive EG cell conversion. Inhibition of MAPK signaling is also not required for the initial 48 hr of PGC culture, in fact, is deleterious during that period. Our observations suggest that EG cell formation can be divided into two discrete phases: an initial 48 hr period of PGC adaptation to culture that is promoted by bFGF, RA, SCF, and GSK3 inhibition and a subsequent period of fate conversion over 6 days. The second
(E) Mean reads per million (RPM) of STAT3 target genes in Oct4-positive ES cells (Tang et al., 2010) and E8.5 PGCs (Hackett et al., 2012) reveals a higher expression in ES cells than PGCs. (F) OCT4 and KLF4 immunostaining of an established EG cell line and nascent EG cell colonies after 96 or 120 hr in culture. At 120 hr KLF4 staining exhibits either heterogenous (i) or homogenous (ii) staining patterns. All cells in eld were OCT4 positive; DAPI omitted for clarity. Scale bar 100 mm. (G) Histogram indicating EG-cell-derivation efciency, relative to an untransfected control, following transfection with two independent siRNAs targeting STAT3 and a negative control siRNA (siGFP) (error bars denote SEM, ***p < 0.001, ANOVA with Newman-Keuls post hoc, n = 2).
Stem Cell Reports

Figure 4. STAT3 Targets Are Upregulated in Germ Cell Tumors (A) Heatmap of STAT3 target gene expression in adult germ cell tumors. Primary data are from Korkola et al. (2006). Samples were clustered according to the prevalent histology. Additional genes involved in pluripotency, LIF-signaling pathway, and PGC development are provided as a reference. mixed GCT, mixed germ cell tumors; S, seminoma; EC, embryonal carcinoma; YST, yolk-sac tumor; CC, choriocarcinoma; Tera, teratoma; T, normal testis. (B) NTk and NEk values for KEGG pathways enriched in tumor samples over normal testis. STAT3 target genes were fed into the algorithm as a KEGG pathway (Savatier STAT3 targets, colored in red) for unbiased analysis of enrichment over other pathways. The standard JAK-STAT KEGG pathway is shown in green. The top 20 most enriched pathways are shown below order by average rank. (C) Model depicting PGC conversion to pluripotency in two different contexts. In vitro, the LIF/STAT3 pathway is the key requirement for generation of EG cells. We further propose that in vivo activation of STAT3 drives the formation of the pluripotent cells that constitute embryonal carcinoma or give rise to teratomas, the pluripotent GCTs. See also Figure S3.
Stem Cell Reports

phase is driven by LIF stimulation and MAPK inhibition, which is augmented by inhibition of GSK3. A key goal for future studies will be to elucidate the temporal pattern of STAT3 target gene induction and delineate the synergy with MAPK inhibition that reconstructs the full pluripotency and self-renewal circuit (Nichols and Smith, 2012). The intersection between these two pathways also appears crucial to achieve authentic induced pluripotency by somatic cell reprogramming (Silva et al., 2008; Sridharan et al., 2009; van Oosten et al., 2012; Yang et al., 2010). Elucidating the process of EG cell formation may therefore illuminate generally the acquisition of pluripotency. Given the proven ability of transcription factors to articially induce pluripotency in somatic cells (Takahashi and Yamanaka, 2006), the high expression of these factors in the germline (Kurimoto et al., 2008) raises the question of how PGCs are constrained from becoming pluripotent and thereby tumorigenic in vivo. Our ndings point to the primacy of LIF/STAT3 signaling in driving fate conversion. We propose that activation of the STAT3 pathway in PGCs can result in reacquisition of pluripotency in two contextsin vitro enabling the derivation of EG cells and in vivo allowing the formation of pluripotent GCTs (Figure 4C). The observation that STAT3 targets are underrepresented in PGCs suggests that the pathway is normally either silent or is antagonized. Indeed the LIF receptor gp130 is not required during PGC development (Molyneaux et al., 2003). This may be an important safeguard against acquisition of ectopic pluripotency. STAT3 targets are upregulated in those GCTs that have a pluripotent compartment, or that have transited through a pluripotent state, suggesting that this pathway may play a previously unappreciated role in teratocarcinogenesis. This may merit further investigation, notably because inhibitors of the Jak/Stat pathway are being developed as chemotherapeutic agents against hematological and solid tumors (Liu et al., 2012; OShea et al., 2013; s-Cardama et al., 2011). Although, GCTs are generQuinta ally responsive to cisplatin therapy, resistance does occur particularly in teratomas (Oosterhuis and Looijenga, 2005) and conceivably might be reduced by targeting the STAT3 pathway in combination therapy. Finally, re-evaluation of PGCs as a robust source of pluripotent stem cells and the pivotal role played by LIF in the conversion process raises the possibility that the early human germline might be a promising source of LIF-responsive pluripotent stem cells. We speculate that rebuilding pluripotency directly from in vivo or in vitro derived human PGCs may allow capture of the hypothetical human naive state (De Los Angeles et al., 2012), which has so far proved elusive starting from preimplantation embryos.
Animal studies were authorized by a UK Home Ofce Project License and carried out in a Home Ofce-designated facility.
EG Cell Culture
For routine culture, EG cells were maintained in 2i/LIF medium on laminin (10 mg/ml, Sigma) or gelatin-coated plates. 2i/LIF medium comprise the MEK inhibitor PD0325901 (PD) 1 mM, the GSK3 inhibitor CHIR99021 (CH) 3 mM, and mouse LIF 10 ng/ml (prepared in house) in N2B27 medium (Ying et al., 2003) (Stem Cells, SCS-SF-NB-02). Cells were expanded by dissociation with trypsin and replating every 23 days.
EG-Cell-Derivation Medium
Derivations were performed in N2B27 (Ying et al., 2003) with the following additives as indicated: LIF, CH, PD (all as above), bFGF 25 nM (prepared in house), retinoic acid (RA) 2 mM (Invitrogen), forskolin (FK) 10 mM (Sigma), stem cell factor (SCF) 100 ng/ml (R&D), and JAK inhibitor 1 1 mM (Calbiochem). N2B27 was batch tested for EG cell derivation. Plates were coated with human plasma bronectin (Millipore, 1520 mg/ml in PBS, for 1 hr at 37 C) or precoated collagen IV plates (BD, Biocoat) were used, as indicated.
EG Cell Derivation
E7.5, E8.5, and E11.5 EG cell lines were established from embryos produced by crossing mixed background Oct4-DPE-GFP transgenic males (Yoshimizu et al., 1999) with strain 129 female mice. EG cell derivations from E8.5 embryos were performed essentially as described previously (Leitch et al., 2010). In brief, the posterior fragment of the embryo containing PGCs was dissected free of the extraembryonic membranes and trypsinized to a single cell suspension. Cells were collected by centrifugation. Cells were resuspended in derivation medium and either plated in two 2 cm2 wells per starting embryo or ltered and sorted using a MoFlo high-speed cell sorter (Dako Cytomation). Sorted PGCs were deposited directly into cell culture plates precoated with the indicated ECM protein (as above) and containing derivation medium. PGCs were plated at a density of approximately 12.5 cell per cm2, or as indicated. In all experiments, sorted GFP-negative somatic cells were cultured in parallel, and pluripotent cell colonies were not observed. E7.5 EG cell lines were derived from the above cross, as well as embryos produced by crossing mixed background Blimp1-GFP (Ohinata et al., 2005) or Stella-GFP BAC (Payer et al., 2006) transgenic males with strain 129 female mice. Embryos were dissected at 10 a.m., and embryos more advanced than the midallantoic bud stage (Downs and Davies, 1993) were excluded. The posterior fragment containing PGCs was dissected and processed as above for uorescence activated cell sorting (FACS). GFP-positive cells were sorted as above and plated at a density of 12.5 cells per cm2 on bronectin-coated dishes in CH/LIF plus bFGF, RA, SCF, and FK (4Fs). After 48 hr cultures were transitioned to 2i/LIF medium by daily half-medium changes. E11.5 EG cell colonies were obtained by dissecting E11.5 gonads and purifying PGCs by FACS, as above. Sorted PGCs were plated at a density of
Stem Cell Reports

1,000 cells per cm2, and EG cell derivation was performed as for E7.5. Time-lapse imaging was performed using a Leica DMI7000.
Piggybac Transposition
E7.5 Stella-GFP EG cells (1 3 106) were transfected using Lipofectamine 2000 (Invitrogen) with 4 mg of the PiggyBac vector pCAGDsRed-IRES-Zeocin plus 2 mg of pCAGPBase (Wang et al., 2008). The Lipofectamine/DNA complex was applied to the cells in 2i/LIF for 7 hr and then removed and replaced with fresh medium. After 48 hr, Zeocin was added at a concentration of 100 mg/ml to select for stable transfectants. The cells were passaged three times over 7 days and Zeocin-resistant cells were ow-sorted. The brightest 20% DSRED-expressing cells were passaged as a stable pool for morula aggregation.
around the median. Pathway analysis was performed using the sigPathway package (http://bioconductor.org/packages/release/ bioc/html/sigPathway.html). To create a customized gene set object, the G le specic for the human microarray used in this study, hgu133a (Tian et al., 2005), was modied to include a Savatier STAT3 targets category, containing the probes for the reported STAT3 target genes. The NTk and NEk enrichment values obtained for KEGG pathways were plotted against each other, and the pathways were ordered by average rank.
Supplemental Information includes three gures, one table, and one movie and can be found with this article online at http://dx. doi.org/10.1016/j.stemcr.2013.03.004.
RNAi Experiments
siRNAs were transfected at a nal concentration of 40 nM using Lipofectamine RNAiMAX (Invitrogen). For a 24-well plate (2 cm2), we used 1 ml of transfection reagent, 1 ml of 20 mM siRNA solution, and 400 ml of N2B27 medium. PGCs were sorted and plated on bronectin-coated plates 30 hr before transfection. The medium was changed after 10 hr incubation. STAT3 siRNAs were purchased from QIAGEN (catalog numbers are indicated in parentheses): siSTAT3_1 (SI01435287), siSTAT3_2 (SI01435294), siSTAT3_3 (SI01435301), and siSTAT3_4 (SI01435308). GFP siRNAs were custom made (target sequence: GCAAGCTGACCTG AAGTTCA).
ACKNOWLEDGMENTS
We thank Sam Jameson, Keith Savill, and staff for excellent animal husbandry; Nigel Miller (Department of Pathology, University of Cambridge) for ow cytometry support; and Bill Manseld and tienne Dumeau for chimera generation. We thank Petra Charles-E Hajkova, Kirsten McEwen, and Ian Adams for helpful discussions. We thank Marko Hyvonen for production of recombinant LIF. This study was funded by the Biotechnology and Biological Sciences Research Council and the Medical Research Council of the United Kingdom and by the Swiss National Science Foundation Sinergia program. A.S. is a Medical Research Council Professor. Received: January 31, 2013 Revised: March 22, 2013 Accepted: March 23, 2013 Published: June 4, 2013
Chimera Production
Midgestation chimeras were generated by morula aggregation of uorescent E7.5 EG cells with E2.5 embryos (Nagy et al., 2003). Term chimeras were produced by microinjection of E7.5 or E8.5 EG cells (agouti) into C57Bl/6 blastocysts (Nagy et al., 2003).
Immunostaining
Immunostaining was performed using standard protocols. Briey, cells were xed in 4% paraformaldehyde for 10 min, blocked, and permeabilized in PBS, 0.1% Triton X-100, and 1% BSA. Primary antibodies were incubated in the same buffer overnight at 4 C. Secondary antibodies were incubated for 1 hr at room temperature. Plates were washed 3 3 15 min in PBS after primary and secondary antibody incubations. Nuclei were stained with DAPI. Primary antibodies were: OCT4 (BD, 1:200) and KLF4 (R&D Systems, 3:500). Nuclei were stained with DAPI. Alexa Fluor secondary antibodies (Invitrogen) were used at 1:500 dilution.
REFERENCES
Bao, S., Tang, F., Li, X., Hayashi, K., Gillich, A., Lao, K., and Surani, M.A. (2009). Epigenetic reversion of post-implantation epiblast to pluripotent embryonic stem cells. Nature 461, 12921295. ., Humphreys, Blair, K., Leitch, H.G., Manseld, W., Dumeau, C.-E P., and Smith, A.G. (2012). Culture parameters for stable expansion, genetic modication and germline transmission of rat pluripotent stem cells. Biology Open 1, 5865. Bourillot, P.-Y., Aksoy, I., Schreiber, V., Wianny, F., Schulz, H., Hummel, O., Hubner, N., and Savatier, P. (2009). Novel STAT3 target genes exert distinct roles in the inhibition of mesoderm and endoderm differentiation in cooperation with Nanog. Stem Cells 27, 17601771.
Reanalysis of Published RNA-seq and Microarray Data

STAT3 targets (Bourillot et al., 2009) were compared between RNA-seq data sets for Oct4-positive ES cells (Tang et al., 2010) and E8.5 PGCs (Hackett et al., 2012) and mean reads per million (RPM) depicted as a scatterplot. Previously published microarray data of adult germ cell tumors (Korkola et al., 2006) were obtained from GEO (accession number GSE3218). Raw data les were analyzed in R/Bioconductor with the affy package and RMA normalized. To construct the heatmap, the normalized values of STAT3 target gene expression were log2 transformed and centered
Stem Cell Reports

Brook, F.A., and Gardner, R.L. (1997). The origin and efcient derivation of embryonic stem cells in the mouse. Proc. Natl. Acad. Sci. USA 94, 57095712. Chambers, I., Silva, J., Colby, D., Nichols, J., Nijmeijer, B., Robertson, M., Vrana, J., Jones, K., Grotewold, L., and Smith, A. (2007). Nanog safeguards pluripotency and mediates germline development. Nature 450, 12301234. De Felici, M., Pesce, M., Giustiniani, Q., and Di Carlo, A. (1998). In vitro adhesiveness of mouse primordial germ cells to cellular and extracellular matrix component substrata. Microsc. Res. Tech. 43, 258264. De Los Angeles, A., Loh, Y.-H., Tesar, P.J., and Daley, G.Q. (2012). ve human pluripotency. Curr. Opin. Genet. Dev. Accessing na 22, 272282. De Miguel, M.P., Cheng, L., Holland, E.C., Federspiel, M.J., and Donovan, P.J. (2002). Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer. Proc. Natl. Acad. Sci. USA 99, 1045810463. Dolci, S., Williams, D.E., Ernst, M.K., Resnick, J.L., Brannan, C.I., Lock, L.F., Lyman, S.D., Boswell, H.S., and Donovan, P.J. (1991). Requirement for mast cell growth factor for primordial germ cell survival in culture. Nature 352, 809811. Downs, K.M., and Davies, T. (1993). Staging of gastrulating mouse embryos by morphological landmarks in the dissecting microscope. Development 118, 12551266. Durcova-Hills, G., and Capel, B. (2008). Development of germ cells in the mouse. Curr. Top. Dev. Biol. 83, 185212. Durcova-Hills, G., Adams, I.R., Barton, S.C., Surani, M.A., and McLaren, A. (2006). The role of exogenous broblast growth factor-2 on the reprogramming of primordial germ cells into pluripotent stem cells. Stem Cells 24, 14411449. Durcova-Hills, G., Tang, F., Doody, G., Tooze, R., and Surani, M.A. (2008). Reprogramming primordial germ cells into pluripotent stem cells. PLoS ONE 3, e3531. Godin, I., Deed, R., Cooke, J., Zsebo, K., Dexter, M., and Wylie, C.C. (1991). Effects of the steel gene product on mouse primordial germ cells in culture. Nature 352, 807809. Guo, G., Yang, J., Nichols, J., Hall, J.S., Eyres, I., Manseld, W., and Smith, A. (2009). Klf4 reverts developmentally programmed restriction of ground state pluripotency. Development 136, 10631069. Hackett, J.A., Sengupta, R., Zylicz, J.J., Murakami, K., Lee, C., Down, T.A., and Surani, M.A. (2012). Germline DNA demethylation dynamics and imprint erasure through 5-hydroxymethylcytosine. Science 339, 448452. Hajkova, P., Ancelin, K., Waldmann, T., Lacoste, N., Lange, U.C., Cesari, F., Lee, C., Almouzni, G., Schneider, R., and Surani, M.A. (2008). Chromatin dynamics during epigenetic reprogramming in the mouse germ line. Nature 452, 877881. Hall, J., Guo, G., Wray, J., Eyres, I., Nichols, J., Grotewold, L., Morfopoulou, S., Humphreys, P., Manseld, W., Walker, R., et al. ppel factors (2009). Oct4 and LIF/Stat3 additively induce Kru to sustain embryonic stem cell self-renewal. Cell Stem Cell 5, 597609.
Kanatsu-Shinohara, M., Inoue, K., Lee, J., Yoshimoto, M., Ogonuki, N., Miki, H., Baba, S., Kato, T., Kazuki, Y., Toyokuni, S., et al. (2004). Generation of pluripotent stem cells from neonatal mouse testis. Cell 119, 10011012. Kehler, J., Tolkunova, E., Koschorz, B., Pesce, M., Gentile, L., , H., Nagy, A., McLaughlin, K.J., Scho ler, H.R., Boiani, M., Lomel and Tomilin, A. (2004). Oct4 is required for primordial germ cell survival. EMBO Rep. 5, 10781083. , H., Asada, Kimura, T., Suzuki, A., Fujita, Y., Yomogida, K., Lomel N., Ikeuchi, M., Nagy, A., Mak, T.W., and Nakano, T. (2003). Conditional loss of PTEN leads to testicular teratoma and enhances embryonic germ cell production. Development 130, 16911700. Kimura, T., Tomooka, M., Yamano, N., Murayama, K., Matoba, S., Umehara, H., Kanai, Y., and Nakano, T. (2008). AKT signaling promotes derivation of embryonic germ cells from primordial germ cells. Development 135, 869879. Ko, K., Tapia, N., Wu, G., Kim, J.B., Bravo, M.J.A., Sasse, P., Glaser, T., Ruau, D., Han, D.W., Greber, B., et al. (2009). Induction of pluripotency in adult unipotent germline stem cells. Cell Stem Cell 5, 8796. Korkola, J.E., Houldsworth, J., Chadalavada, R.S., Olshen, A.B., Dobrzynski, D., Reuter, V.E., Bosl, G.J., and Chaganti, R.S. (2006). Down-regulation of stem cell genes, including those in a 200-kb gene cluster at 12p13.31, is associated with in vivo differentiation of human male germ cell tumors. Cancer Res. 66, 820827. Koshimizu, U., Taga, T., Watanabe, M., Saito, M., Shirayoshi, Y., Kishimoto, T., and Nakatsuji, N. (1996). Functional requirement of gp130-mediated signaling for growth and survival of mouse primordial germ cells in vitro and derivation of embryonic germ (EG) cells. Development 122, 12351242. Kurimoto, K., Yabuta, Y., Ohinata, Y., Shigeta, M., Yamanaka, K., and Saitou, M. (2008). Complex genome-wide transcription dynamics orchestrated by Blimp1 for the specication of the germ cell lineage in mice. Genes Dev. 22, 16171635. Labosky, P.A., Barlow, D.P., and Hogan, B.L. (1994). Mouse embryonic germ (EG) cell lines: transmission through the germline and differences in the methylation imprint of insulin-like growth factor 2 receptor (Igf2r) gene compared with embryonic stem (ES) cell lines. Development 120, 31973204. Leitch, H.G., Blair, K., Manseld, W., Ayetey, H., Humphreys, P., Nichols, J., Surani, M.A., and Smith, A. (2010). Embryonic germ cells from mice and rats exhibit properties consistent with a generic pluripotent ground state. Development 137, 22792287. Li, Y., McClintick, J., Zhong, L., Edenberg, H.J., Yoder, M.C., and Chan, R.J. (2005). Murine embryonic stem cell differentiation is promoted by SOCS-3 and inhibited by the zinc nger transcription factor Klf4. Blood 105, 635637. Liu, X., Guo, W., Wu, S., Wang, L., Wang, J., Dai, B., Kim, E.S., Heymach, J.V., Wang, M., Girard, L., et al. (2012). Antitumor activity of a novel STAT3 inhibitor and redox modulator in non-small cell lung cancer cells. Biochem. Pharmacol. 83, 14561464. Marks, H., Kalkan, T., Menafra, R., Denissov, S., Jones, K., Hofemeister, H., Nichols, J., Kranz, A., Stewart, A.F., Smith, A., and Stunnenberg, H.G. (2012). The transcriptional and epigenomic foundations of ground state pluripotency. Cell 149, 590604.
Stem Cell Reports

Matsuda, T., Nakamura, T., Nakao, K., Arai, T., Katsuki, M., Heike, T., and Yokota, T. (1999). STAT3 activation is sufcient to maintain an undifferentiated state of mouse embryonic stem cells. EMBO J. 18, 42614269. Matsui, Y., Toksoz, D., Nishikawa, S., Nishikawa, S., Williams, D., Zsebo, K., and Hogan, B.L. (1991). Effect of Steel factor and leukaemia inhibitory factor on murine primordial germ cells in culture. Nature 353, 750752. Matsui, Y., Zsebo, K., and Hogan, B.L. (1992). Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture. Cell 70, 841847. McLaren, A., and Lawson, K.A. (2005). How is the mouse germ-cell lineage established? Differentiation 73, 435437. Molyneaux, K.A., Schaible, K., and Wylie, C. (2003). GP130, the shared receptor for the LIF/IL6 cytokine family in the mouse, is not required for early germ cell differentiation, but is required cell-autonomously in oocytes for ovulation. Development 130, 42874294. Nagamatsu, G., Kosaka, T., Saito, S., Takubo, K., Akiyama, H., Sudo, T., Horimoto, K., Oya, M., and Suda, T. (2012). Tracing the conversion process from primordial germ cells to pluripotent stem cells in mice. Biol. Reprod. 86, 182. Nagy, A., Gertsenstein, M., Vintersten, K., and Behringer, R. (2003). Manipulating the Mouse Embryo (New York: Cold Spring Harbor Laboratory Press). Nichols, J., and Smith, A. (2012). Pluripotency in the embryo and in culture. Cold Spring Harb. Perspect. Biol. 4, a008128. Niwa, H., Burdon, T., Chambers, I., and Smith, A. (1998). Selfrenewal of pluripotent embryonic stem cells is mediated via activation of STAT3. Genes Dev. 12, 20482060. Niwa, H., Ogawa, K., Shimosato, D., and Adachi, K. (2009). A parallel circuit of LIF signalling pathways maintains pluripotency of mouse ES cells. Nature 460, 118122. OShea, J.J., Holland, S.M., and Staudt, L.M. (2013). JAKs and STATs in immunity, immunodeciency, and cancer. N. Engl. J. Med. 368, 161170. Ohinata, Y., Payer, B., OCarroll, D., Ancelin, K., Ono, Y., Sano, M., Barton, S.C., Obukhanych, T., Nussenzweig, M., Tarakhovsky, A., et al. (2005). Blimp1 is a critical determinant of the germ cell lineage in mice. Nature 436, 207213. Oosterhuis, J.W., and Looijenga, L.H.J. (2005). Testicular germ-cell tumours in a broader perspective. Nat. Rev. Cancer 5, 210222. Osorno, R., Tsakiridis, A., Wong, F., Cambray, N., Economou, C., Wilkie, R., Blin, G., Scotting, P.J., Chambers, I., and Wilson, V. (2012). The developmental dismantling of pluripotency is reversed by ectopic Oct4 expression. Development 139, 22882298. Payer, B., Chuva de Sousa Lopes, S.M., Barton, S.C., Lee, C., Saitou, M., and Surani, M.A. (2006). Generation of stella-GFP transgenic mice: a novel tool to study germ cell development. Genesis 44, 7583. s-Cardama, A., Kantarjian, H., Cortes, J., and Verstovsek, S. Quinta (2011). Janus kinase inhibitors for the treatment of myeloproliferative neoplasias and beyond. Nat. Rev. Drug Discov. 10, 127140.
Resnick, J.L., Bixler, L.S., Cheng, L., and Donovan, P.J. (1992). Long-term proliferation of mouse primordial germ cells in culture. Nature 359, 550551. Rugg-Gunn, P.J., Cox, B.J., Lanner, F., Sharma, P., Ignatchenko, V., McDonald, A.C.H., Garner, J., Gramolini, A.O., Rossant, J., and Kislinger, T. (2012). Cell-surface proteomics identies lineagespecic markers of embryo-derived stem cells. Dev. Cell 22, 887901. Saitou, M., Barton, S.C., and Surani, M.A. (2002). A molecular programme for the specication of germ cell fate in mice. Nature 418, 293300. Silva, J., Barrandon, O., Nichols, J., Kawaguchi, J., Theunissen, T.W., and Smith, A. (2008). Promotion of reprogramming to ground state pluripotency by signal inhibition. PLoS Biol. 6, e253. Sperger, J.M., Chen, X., Draper, J.S., Antosiewicz, J.E., Chon, C.H., Jones, S.B., Brooks, J.D., Andrews, P.W., Brown, P.O., and Thomson, J.A. (2003). Gene expression patterns in human embryonic stem cells and human pluripotent germ cell tumors. Proc. Natl. Acad. Sci. USA 100, 1335013355. Sridharan, R., Tchieu, J., Mason, M.J., Yachechko, R., Kuoy, E., Horvath, S., Zhou, Q., and Plath, K. (2009). Role of the murine reprogramming factors in the induction of pluripotency. Cell 136, 364377. Stevens, L.C. (1967). Origin of testicular teratomas from primordial germ cells in mice. J. Natl. Cancer Inst. 38, 549552. Stewart, C.L., Gadi, I., and Bhatt, H. (1994). Stem cells from primordial germ cells can reenter the germ line. Dev. Biol. 161, 626628. Surani, M.A. (2007). Germ cells: the eternal link between generations. C. R. Biol. 330, 474478. Surani, M.A., Hayashi, K., and Hajkova, P. (2007). Genetic and epigenetic regulators of pluripotency. Cell 128, 747762. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult broblast cultures by dened factors. Cell 126, 663676. Tang, F., Barbacioru, C., Bao, S., Lee, C., Nordman, E., Wang, X., Lao, K., and Surani, M.A. (2010). Tracing the derivation of embryonic stem cells from the inner cell mass by single-cell RNA-Seq analysis. Cell Stem Cell 6, 468478. Tian, L., Greenberg, S.A., Kong, S.W., Altschuler, J., Kohane, I.S., and Park, P.J. (2005). Discovering statistically signicant pathways in expression proling studies. Proc. Natl. Acad. Sci. USA 102, 1354413549. van Oosten, A.L., Costa, Y., Smith, A., and Silva, J.C. (2012). JAK/ STAT3 signalling is sufcient and dominant over antagonistic cues for the establishment of naive pluripotency. Nat. Commun. 3, 817. Wang, W., Lin, C., Lu, D., Ning, Z., Cox, T., Melvin, D., Wang, X., Bradley, A., and Liu, P. (2008). Chromosomal transposition of PiggyBac in mouse embryonic stem cells. Proc. Natl. Acad. Sci. USA 105, 92909295. fer, S., Weber, S., Eckert, D., Nettersheim, D., Gillis, A.J.M., Scha Kuckenberg, P., Ehlermann, J., Werling, U., Biermann, K., Looijenga, L.H.J., and Schorle, H. (2010). Critical function of AP-2 gamma/TCFAP2C in mouse embryonic germ cell maintenance. Biol. Reprod. 82, 214223.
Stem Cell Reports

West, J.A., Viswanathan, S.R., Yabuuchi, A., Cunniff, K., Takeuchi, A., Park, I.-H., Sero, J.E., Zhu, H., Perez-Atayde, A., Frazier, A.L., et al. (2009). A role for Lin28 in primordial germ-cell development and germ-cell malignancy. Nature 460, 909913. Yamaguchi, S., Kurimoto, K., Yabuta, Y., Sasaki, H., Nakatsuji, N., Saitou, M., and Tada, T. (2009). Conditional knockdown of Nanog induces apoptotic cell death in mouse migrating primordial germ cells. Development 136, 40114020. Yamaji, M., Seki, Y., Kurimoto, K., Yabuta, Y., Yuasa, M., Shigeta, M., Yamanaka, K., Ohinata, Y., and Saitou, M. (2008). Critical function of Prdm14 for the establishment of the germ cell lineage in mice. Nat. Genet. 40, 10161022. Yang, J., van Oosten, A.L., Theunissen, T.W., Guo, G., Silva, J.C.R., and Smith, A. (2010). Stat3 activation is limiting for
reprogramming to ground state pluripotency. Cell Stem Cell 7, 319328. Ying, Q.-L., Stavridis, M., Grifths, D., Li, M., and Smith, A. (2003). Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture. Nat. Biotechnol. 21, 183186. Ying, Q.-L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453, 519523. Yoshimizu, T., Sugiyama, N., De Felice, M., Yeom, Y.I., Ohbo, K., ler, H.R., and Matsui, Y. Masuko, K., Obinata, M., Abe, K., Scho (1999). Germline-specic expression of the Oct-4/green uorescent protein (GFP) transgene in mice. Dev. Growth Differ. 41, 675684.
Stem Cell Reports

Resource Identication of Novel Imprinted Differentially Methylated Regions by Global Analysis of Human-Par thenogenetic-Induced Pluripotent Stem Cells
Yonatan Stelzer,1,4 Daniel Ronen,1,4 Christoph Bock,2,3 Patrick Boyle,2 Alexander Meissner,2,3,* and Nissim Benvenisty1,*
Cell Unit, Department of Genetics, Institute of Life Sciences, The Hebrew University, Givat-Ram, Jerusalem 91904, Israel Institute of MIT and Harvard, Cambridge, MA 02142, USA 3Department of Stem Cell and Regenerative Biology, Harvard University, Cambridge, MA 02138, USA 4These authors contributed equally to this work *Correspondence: alexander_meissner@harvard.edu (A.M.), nissimb@cc.huji.ac.il (N.B.) http://dx.doi.org/10.1016/j.stemcr.2013.03.005 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Broad 1Stem
Parental imprinting is an epigenetic phenomenon by which genes are expressed in a monoallelic fashion, according to their parent of origin. DNA methylation is considered the hallmark mechanism regulating parental imprinting. To identify imprinted differentially methylated regions (DMRs), we compared the DNA methylation status between multiple normal and parthenogenetic human pluripotent stem cells (PSCs) by performing reduced representation bisulte sequencing. Our analysis identied over 20 previously unknown imprinted DMRs in addition to the known DMRs. These include DMRs in loci associated with human disorders, and a class of intergenic DMRs that do not seem to be related to gene expression. Furthermore, the study showed some DMRs to be unstable, liable to differentiation or reprogramming. A comprehensive comparison between mouse and human DMRs identied almost half of the imprinted DMRs to be species specic. Taken together, our data map novel DMRs in the human genome, their evolutionary conservation, and relation to gene expression.
INTRODUCTION
Parental imprinting is a form of epigenetic regulation by which genes are expressed from only one of the two parental alleles. In humans, loss of imprinting is associated with several diseases (e.g., Prader-Willi/Angelman syndromes) and malignancies (e.g., Wilms tumor) (Yamazawa et al., 2010). The generation of mouse embryos containing only maternal (parthenogenetic) or paternal (androgenetic) alleles (McGrath and Solter, 1984; Surani and Barton, 1983; Surani et al., 1984) demonstrated the importance of imprinting for restricting asexual form of reproduction in placental mammals. Parthenogenesis may occur naturally in humans resulting in parthenogenetic ovarian teratomas. We have recently generated human-parthenogeneticinduced pluripotent stem cells (PgHiPSCs) by reprogramming of parthenogenetic ovarian teratomas (Stelzer et al., 2011). Studying the gene expression of PgHiPSCs enabled us to identify novel paternally expressed genes (PEGs), and to study the developmental potential of these cells (Stelzer et al., 2011). Differential marking of DNA methylation in the gametes is considered the hallmark mechanism controlling parental imprinting as it establishes germline DMRs (gDMRs), which are then maintained throughout the life of the embryo (Proudhon et al., 2012; Reik et al., 2001; Smith et al., 2012). In the past few years, global surveys of imprinted DMRs in the mouse were reported (Hiura et al., 2010; Kelsey et al., 1999; Proudhon et al., 2012; Singh et al., 2011), and recently DNA methylation analysis at single-base resolution, performed on reciprocal crosses of
inbred-mice, identied dozens of novel DMRs (Xie et al., 2012). In humans, however, due to ethical and technical limitations, only few low-resolution surveys were achieved thus far (Choufani et al., 2011). Moreover, the vast majority of DMRs in humans were identied by association with certain diseases or by sharing synteny with mouse DMRs. In this study, we aimed to perform a comprehensive analysis of imprinted DMRs in humans. We thus analyzed global DNA methylation of our PgHiPSCs and their parental broblasts by reduced representation bisulte sequencing (RRBS) (Gu et al., 2011; Meissner et al., 2008) and compared the methylation signature to that of a large panel of human embryonic stem cells (HESCs) and induced pluripotent stem cells (HiPSCs) (Bock et al., 2011).
RESULTS
Analysis of Known Imprinted DMRs in Human Pluripotent Stem Cells Parthenogenetic cells lack the paternal allele and are therefore expected to exhibit differential methylation patterns in imprinted DMRs when compared to normal biparental cells. Notably, comparing the DNA methylation signature can equally identify maternal DMRs (mDMRs), which are expected to show hypermethylation and paternal DMRs (pDMRs), which will exhibit hypomethylation when compared to normal cells (Figure S1A available online). Recently, a similar approach was used to identify epigenetic variation of known imprinted DMRs (Nazor et al., 2012). To
Stem Cell Reports

Imprinted DMRs in Parthenogenetic iPS Cells
Table 1. Analysis of Previously Identied Human Imprinted DMRs

Chromosome chr1 chr2 chr6 chr7 chr7 chr7 chr10 chr11 chr11 chr11 chr11 chr14 chr15 chr15 chr16 chr19 chr20 chr20 chr20 chr20 chr20 chr20 Locus DIRAS3 ZDBF2 PLAGL1 GRB10 PEG10/SGCE MEST INPP5F H19 H19 ICR IGF2 DMR1 KCNQ1OT1 MEG3 AS-ICR SNURF-SNRPN NAT15,ZNF597 PEG3 BLCAP,NNAT L3MBTL GNASXL NESPAS GNAS1A GNAS1A - exon 1 CGI Yes Yes No Yes No Yes Yes Yes Yes No Yes No Yes Yes Yes Yes Yes Yes Yes No Yes No Diff (ES-PG) 0.12 0.22 0.20 0.29 0.51 0.27 0.25 0.21 0.38 0.12 0.23 0.35 0.48 0.47 0.30 0.14 0.16 0.23 0.19 0.57 0.21 0.13 Parent of Origin M P M M M M M P P P M P M M P M M M M M M M
List of previously identied imprinted DMRs. CGI, CpG island; M, maternal; P, paternal. See also Figure S3.
carry out a comprehensive study of DNA methylation in PgHiPSCs, we performed RRBS on four iPSC lines derived from two independent parthenogenetic teratoma cell lines, which were shown to exhibit a complete homozygote diploid genome (Stelzer et al., 2011). Similar analysis was performed on the parental parthenogenetic teratoma cell lines. The data were then ltered and evaluated through bioinformatic analysis (Bock et al., 2010), yielding highcoverage reads and reproducible results (Figure S1B). We next compared the global DNA methylation proles of PgHiPSCs, their parental cells with previously published data sets including 20 samples of HESCs, 12 samples of HiPSCs, and six samples of normal human broblasts
(Bock et al., 2011). This large data set of undifferentiated and differentiated cells has previously enabled the identication of epigenetic changes associated with X inactivation (Mekhoubad et al., 2012) and was now utilized as a reference for a comprehensive study of epigenetic changes associated with parental imprinting in the different cell types. Unsupervised hierarchical clustering demonstrated that the undifferentiated pluripotent stem cells share a distinct epigenetic signature, which distinguishes them from mature parthenogenetic and normal somatic cells (Figure S2A). We then analyzed the status of methylation of known imprinted DMRs (Table 1). Since loss of imprinting is associated with disease and malignancies, perturbations in imprinted DMRs may affect the therapeutic potential of HESCs. We therefore studied the heterogeneity of known imprinted DMRs in HESCs (Figure 1A). While most of the DMRs examined maintain stable hemimethylation values in wild-type samples (average methylation calls [AMCs] between 0.3 and 0.7), few DMRs (PEG3, DIRAS3, and ZDBF2) show more variable values in the pluripotent stem cells. This effect does not seem to correlate with culture passaging as the variability was evident even in low-passage HESCs (Figure S2B). We next asked whether reprogramming of somatic cells to pluripotency affects the methylation levels of known DMRs. In agreement with our previous study on the stability of imprinted genes in HiPSCs (Pick et al., 2009), the vast majority of DMRs maintain hemimethylation values, thus demonstrating striking similarities between HiPSCs and HESCs (Figure 1B). However, the three DMRs that exhibit the highest levels of variation in HESCs show loss of imprinting in HiPSCs and are consistently hypermethylated in these cells. This can be due to loss of imprinting in the parental broblasts, or, alternatively, imply that these DMRs are more susceptible to aberrant methylation during reprogramming. To distinguish between the two options, we examined the methylation levels of these DMRs in the parental somatic cells (Figure S2C). Our results show that, while PEG3 and DIRAS3 DMRs exhibit loss of imprinting already in the parental cells, the ZDBF2 DMR may be prone to perturbations that are due to the reprogramming process. Studying the methylation levels of DMRs in 16-day-old embryoid bodies (EBs), that were differentiated from HESCs, further emphasized that in vitro differentiation resulted in loss of the DMR in DIRAS3 and PEG3 sites (Figure 1C). We next compared the methylation levels of known DMRs between PgHiPSCs and HESCs. Unlike normal HiPSCs, the parthenogenetic HiPSCs can be distinguished from HESCs in virtually all imprinted DMRs examined (Figure 1D), and are either hypermethylated (AMC >0.7) or hypomethylated (AMC <0.3) in comparison to the hemimethylation state of the HESCs (AMC between 0.3 and 0.7). For example, the two well-studied imprinted DMR loci
Stem Cell Reports

Figure 1. Genome-wide Analysis of Imprinted DMRs in PSCs (A) Box-plot analysis showing distribution of DNA methylation in 20 HESCs lines in known imprinted DMRs. DMRs are ordered according to the levels of heterogeneity (x axis). (BD) Average methylation calls SE of different cell types in known imprinted DMRs. DMRs are ordered by chromosome numbers (x axis); small arrows pointing to DMRs that are perturbed in the different cell types. (E and F) Regional view of KCNQ1 and H19 known DMR. Average methylation values for wild-type PSCs (blue) and PgHiPSCs (red) of all CpG calls. Green track indicates the difference between hemimethylated (AMC between 0.3 and 0.7) wild-type PSCs and PgHiPSCs CpGs. Shown are signicant putative CTCF binding sites in H1 ES cells from the ENCODE project (depicted in black rectangles, p value < 1 3 105) and CpG islands (UCSC) in dark-blue rectangles. See also Figures S1 and S2.
KCNQ1OT and IGF2-H19 are either hypermethylated (mDMR, Figure 1E) or hypomethylated (pDMR, Figure 1F) in the PgHiPSCs, in comparison to being hemimethylated in the biparental cells. Genome-wide Search for Novel Imprinted DMRs In order to identify novel imprinted DMRs throughout the genome, we rst veried the integrity of our data by studying the methylation values of previously discovered DMRs. Out of 22 well-established imprinted DMRs, 18 are either hypermethylated or hypomethylated in the PgHiPSCs in comparison to HESCs (methylation difference >0.15). Of the four known DMRs that could not be identied in our
analysis, three also show loss of imprinting in the normal PSCs (e.g., PEG3), and one lost the imprint upon reprogramming of the parthenogenetic somatic cells into PgHiPSCs (e.g., GNAS, Figures S2D and S2E, respectively). We next searched for hemimethylation regions in both HESCs and HiPSCs and compared them to the methylation status in PgHiPSCs. In addition, we focused on regions in which the difference in DNA methylation levels between PgHiPSCs and HESCs was greater than 0.2 (see Experimental Procedures). Aberrant changes in DNA methylation, arising during the establishment of HiPSCs, are a major concern when aiming to identify epigenetic differences between normal and parthenogenetic PSCs. We
Stem Cell Reports

Table 2. Human Imprinted DMRs Identied in This Study

Chromosome DMRs in known imprinted regions chr11 chr14 chr15 chr15 chr15 chr16 chr20 chr20 DMRs syntenic to mouse chr8 chr15 chr15 DMRs in clusters chr1 chr1 DMRs in unknown regions chr1 chr5 chr7 chr9 chr9 chr10 chr13 chr17 Locus TH,ASCL2 DIO3 WHAMMP3,NIPA1 PWRN2 LOC100289656 FLYWCH1 L3MBTL GNAS TRAPPC9 NDN MAGEL2 NBPF NBPF TMEM51 TSPAN17,UNC5A TMEM176A/ B RCL1 ZNF322B INPP5A TSC22D1 MIR301A CGI Yes Yes Yes Yes Yes Yes No Yes Yes Yes Yes Yes Yes Yes Yes No Yes Yes Yes No No Diff 0.45 0.31 0.23 0.23 0.27 0.23 0.26 0.27 0.30 0.22 0.37 0.20 0.29 0.38 0.51 0.30 0.41 0.31 0.22 0.31 0.43 Parent of Origin P P P P P M M M M M M P P M P P P M M M M Differential Gene Expression Yes No No No No Yes No No No Yes Yes No No Yes No Yes No No Yes No Yes
List of new imprinted DMRs identied in this study. CGI, CpG island; M, maternal; P, paternal; Diff, difference in DNA methylation values between normal HESCs and PgHiPSCs. Differential gene expression was calculated according to the ratio in RPKM (reads per kilobase of exon model per million mapped reads) between normal and parthenogenetic cell. Fold change >2 is indicated.
therefore studied multiple HiPSC lines, derived from different sources. Furthermore, we ltered out regions of recurrent aberrant reprogramming, which were previously mapped in iPS cell lines derived from distinct tissues (Lister et al., 2011). This analysis identied 21 novel DMRs: eight of which are located in well-known imprinted regions (three of which are in the Prader-Willi/Angelman region), three are known to be imprinted in mice, and two appear in a cluster, a common phenomenon for imprinted genes (Ferguson-Smith, 2011) (Table 2, permutation test, p value = 0.011). These clustered DMRs are of specic interest as they reside in the Neuroblastoma breakpoint family (NBPF), suggesting that parental imprinting may be involved in the acquisition of the disease. Eight novel DMRs appear in regions not previously suggested to be im-
printed. This type of novel DMR had good sequencing coverage and showed high levels of consistency between different samples of the same cell type (Table 2, permutation test, p value = 0.0059, see Experimental Procedures). To link between DNA methylation and gene expression on a genome-wide scale, we performed RNA sequencing (RNA-seq) in two independent PgHiPSC lines and two normal HESC and HiPSC lines. Our experiment yielded highly reproducible results and deep coverage reads. Parthenogenetic cells lack the paternal genome and consequently PEGs are expected to show downregulation when compared to normal biparental cells. Interestingly, we could identify ve differentially expressed genes between PgHiPSCs and normal PSCs within 200 kb of the novel DMRs, strengthening the notion that they are potentially
Stem Cell Reports

novel imprinted genes (Figure S2F). Notably, of our 21 novel imprinted DMRs (Figure S3) ve are in the PraderWilli/Angelman region, two of which are located in the promoters of known PEGs (NDN and MAGEL2) and are considered secondary DMRs, resulting from the maternal gDMRs in this region, and three are novel DMRs residing in yet-uncharacterized regions of this locus (Figure S4A). As the complex phenotypes in both Prader-Willi and Angelman patients are still poorly understood (Mann and Bartolomei, 1999), it will be of great interest to analyze the status of these DMRs in patients. Characterization of Imprinted DMRs Identies a Novel Class of Intergenic DMRs The transcription factor CTCF is a known regulator of several imprinted loci (Bell and Felsenfeld, 2000; Bell et al., 1999; Hark et al., 2000). Intriguingly, when we analyzed chromatin immunoprecipitation sequencing (ChIP-seq) results of CTCF binding sites in HESCs (Consortium, 2011), we could identify signicant enrichments (p value < 1 3 105) for CTCF binding sites in proximity to many of the novel DMRs (15/21, Figures 2A and S3), but could not nd this enrichment for other pluripotent transcription factors. Using locus-specic bisulte sequencing, we conrmed two of the novel DMRs, WHAMMP3 and TAPPC9, as paternal and maternal DMRs, respectively (Figure 2B). Studying the stability of the novel imprinted DMRs in different cell types identied that all of the novel DMRs show striking similarities in methylation levels between HESCs and HiPSCs, but differ signicantly from the PgHiPSCs (Figures 2C and 2D). Moreover, the vast majority of the novel DMRs are highly stable in both the undifferentiated and differentiated state (Figure 2E). A notable exception is the newly identied DMR in the L3MBTL locus, which similarly to DIRAS3 and PEG3 shows loss of imprinting following in vitro differentiation (Figure 2E). We next aimed to globally examine the properties of all imprinted DMRs identied in this study (n = 43). Plotting the chromosomal distribution of all imprinted DMRs elucidates that only a few chromosomes lack parental imprinting marks in humans (Figure 3A). The distribution of DMRs suggests that there are four genomic clusters of imprinted DMRs (IGF2-H19, DLK1-DIO3, SNURF-SNRPN, and GNAS loci), which probably result from differential gene expression (secondary DMRs) originating from the gDMRs in these loci. Two clusters (chromosomes 11 and 15) are marked by both paternal and maternal DMRs, while the two other clusters (chromosomes 14 and 20) are either complete maternal or paternal. Close examination of all imprinted DMRs (Figure 3B) shows that approximately 20% of all DMRs are not associated with genes (intragenic regions) or gene promoters and are located in intergenic region (>4 kb of any nearby gene),
a signicant enrichment to the previously identied group of DMRs (Figure S4B). Studying the distance between the intergenic DMRs to their nearest gene reveals that, unlike the previously identied DMRs (Figure S4C), some intergenic DMRs are located as far as 10 kb from their nearest genes (Figure 3C). Moreover, the vast majority of the intergenic DMRs that reside in gene-poor regions are of paternal origin (pDMRs, Figure 3D), which is in agreement with previous reports (Bartolomei and FergusonSmith, 2011). To link gene expression and DNA methylation at imprinted DMRs, we analyzed our RNAseq data and compared between normal PSCs and PgHiPSCs. First, we focused on promoter and intragenic DMRs. This class of imprinted DMRs are predicted to regulate the expression of their nearby genes. However, as some imprinted DMRs were previously shown to affect genes in cluster (e.g., SNRPN intron-2 DMR), we included all genes that are within 200 kb from the DMRs. Comparing this group of genes to that of all expressed genes in PSCs shows that most genes that are associated with imprinted DMRs are downregulated in the PgHiPSCs (Figure 3E; Table S1). However, few known PEGs (e.g., INPP5F, GRB10, and MEST), and some putative imprinted genes identied in this study, are expressed at high levels in the PgHiPSCs (Table S1), while their associate imprinted DMR is hypermethylated. This suggests that some of the putative imprinted genes are tissue specic and will start to be expressed from only one of the two parental alleles at a later stage in development (Frost and Moore, 2010). It was recently shown that DNA methylation in intragenic regions may serve as alternative promoters in a tissue-specic manner (Maunakea et al., 2010); it will thus be of interest to study the monoallelic expression of these putative imprinted genes in different adult tissues. We next examined the group of novel intergenic imprinted DMRs that are located more than 10 kb from the nearest gene (Table S2). Here, we expanded our gene-expression analysis to include genes that are within 1 Mb of the DMR, in order to allow the discovery of long-range regulatory effects. Surprisingly, none of the novel intergenic DMRs had any effect on gene expression in PSCs (Figure 3F; Table S2) and thus could be classied as a novel class of intergenic imprinted DMRs. Altogether, our gene-expression analysis in the pluripotent state could document only few novel imprinted genes, suggesting that some of the novel DMRs may regulate other processes beside gene expression or are regulated in a tissuespecic manner. Comprehensive Comparison between Mouse and Human Imprinted DMRs Mice serve as a good model for studying parental imprinting in humans. We therefore aimed to conduct a comprehensive comparison between mouse and human
Stem Cell Reports

C A B
Figure 2. Genome-wide Analysis of Imprinted DMRs in PSCs (A) Regional view of two representative new DMR, TRAPPC9 and WHAMMP3. Average methylation values for wild-type HESCs (blue) and PgHiPSCs (red) of all CpG calls. Green track indicates the difference between hemimethylated (AMC between 0.3 and 0.7) wild-type PSCs and PgHiPSCs CpGs. Shown are signicant putative CTCF binding sites in H1 ES cells from the ENCODE project (depicted in black rectangles, p value < 1 3 105) and CpG islands (UCSC) in dark-green rectangles. See also Figure S3. (B) Bisulte sequencing validation of pDMR (WHAMMP3, upper panel) and mDMR (TRAPPC9, lower panel) was conducted on normal independent PSC not included in the original analysis and PgHiPSCs lines. (CE) Methylation values (y axis) SE in various cell types across the different imprinted DMRs (x axis); small arrows pointing to DMRs that are perturbed in the different cell types. (C) Comparison between HESCs and HiPSCs demonstrate the striking similarities between the two cell types. (D) Comparison between HESCs and the PgHiPSCs showing the differences between the two cell types in methylation values, as the PgHiPSCs are either hypermethylated (AMC >0.7) or hypomethylated (AMC <0.3) in comparison to hemimethylation state (AMC between 0.3 and 0.7) of the biparental cells. (E) Analysis of methylation in 16-day-old EBs differentiated from HESCs, demonstrating that the newly identied imprinted DMRs are highly stable following in vitro differentiation. Notable exception is the DMR in the L3MBTL locus, which is consistently hypomethylated in the differentiated cells.
imprinted DMRs. We rst examined mouse DMRs that were systematically identied in previous studies, focusing on DMRs that share synteny between mouse and human genomes and had sufcient coverage of reads in our cells. We also studied the corresponding genomic organization of mouse DMRs in which synteny was partial or not present in the human genome in order to identify putative human DMRs. Our data suggest that more
than a third of the previously identied mouse imprinted DMRs do not have an equivalent DMR in the human genome (Figure 4A; Table S3). We next took advantage of a recently established single-base resolution analysis of DNA methylation in the mouse (Xie et al., 2012), to compare between mouse novel imprinted DMRs and the DMRs identied in our study. Strikingly, our analysis shows almost half of all imprinted DMRs are species
Stem Cell Reports

D A
Figure 3. Characterization of Imprinted DMRs Identied in This Study (A) Chromosomal distribution of the 43 imprinted DMRs. (B) Pie chart representing the different genomic properties of all imprinted DMRs. (C) Distribution of distances of the imprinted intergenic DMRs to their nearest gene. (D) Percentage of maternal and paternal DMRs; all DMRs identied (left bar) and the subset of intergenic DMRs (right panel). (E and F) Distribution of expression ratios between normal PSCs and PgHiPSCs; x axes represent the log2 fold change between normal PSCs and PgHiPSCs, and y axes represent the distribution of frequencies for each of the samples; values for individual genes are represented by small vertical lines on the x axes; Verticals segmented red lines represent 2-fold in expression ratio. (E) Blue, genes associated with intragenic mDMRs (n = 64); black, all expressed genes (>30 reads, n = 13,223). See also Table S1. (F) Orange, genes associated with intergenic DMRs (>10 kb from the nearest gene, n = 23); black, all expressed genes. See also Figure S4 and Table S2. specic (Figure 4B; Table S3). Genomic synteny analysis shows that some of the mouse-specic imprinted DMRs, such as Commd1/Zrsr1 DMR, lack a syntenic region in humans (Figure 4C). Since most of the studies so far were conducted in mouse, only four human-specic DMRs were identied to date. In this study, we could add 17 novel human-specic DMRs. Close examination of the data reveals that some of these DMRs may have acquired the imprint after diverging from the mouse and human common ancestor, as they share synteny with regions in which imprinted DMR was not identied in the mouse (Figure 4D).
Stem Cell Reports

DISCUSSION
In this study, we identied altogether 21 novel imprinted DMRs, including a novel class of intergenic DMRs, which reside in regions with no apparent imprinted genes in PSCs. This class of imprinted DMRs either may regulate genes in a tissue-specic manner, thus adding to the complexity of parental regulation in the adult tissues, or these parental marks regulate genes that are yet to be discovered. Notably, both WHAMMP3 and LOC100289656, intergenic pDMRs in the Prader-Willi/ Angelman region, are located in close proximity to a cluster of piRNAs. This class of regulatory small noncoding RNAs was previously linked with parental imprinting (Watanabe et al., 2011), and thus it is attractive to suggest that this specic cluster of genes is expressed in a monoallelic fashion. The previously identied complex three-dimensional organization of the genome (Lieberman-Aiden et al., 2009) also suggests that this class of intergenic DMRs may interact with genes located in remote regions, thus regulating them in trans. Alternatively, it is plausible that this novel class of intergenic DMRs regulates other processes beside gene expression. As it was previously suggested, parental imprinting may be involved in marking the parental genomes for recombination (Pardo-Manuel de Villena et al., 2000). It will thus be of great interest to study whether these intergenic DMRs may serve as hot spots for genetic processes such as recombination. The use of mouse model systems has greatly enhanced our understanding of parental imprinting. Yet, some genes that are imprinted in the mouse are not imprinted in the human orthologous gene (Bartolomei and Ferguson-Smith, 2011). Moreover, some mouse models fail to recapitulate phenotypes associated with human-imprinted syndromes (Mann and Bartolomei, 1999). Strikingly, our data imply that more than 50% of mouse- and human-imprinted DMRs are species specic. In addition, some of these DMRs (e.g., WHAMMP3 and LOC100289656) reside in loci, which are associated with known human diseases such as Prader-Willi and Angelman syndromes. Therefore, our results emphasize the importance of studying imprinted DMRs in human. In addition, our analysis identied that several imprinted DMRs are consistently perturbed in HESCs and HiPSCs and thus should be carefully evaluated if these cells are to be used for clinical applications. Furthermore, as loss of imprinting was correlated before with different types of cancers, it will be worthy to study the differential methylation status of both previously identied and novel imprinted DMRs in tumor cell types. The genomic coverage of RRBS is 10%; however, it covers the majority of CpG islands (CGIs) and promoters in the human genome (Harris et al., 2010). As the vast majority of previously identied imprinted DMRs reside
Figure 4. Synteny Analysis between Mouse and Human Imprinted DMRs (A) DNA methylation analysis of previously identied mouse DMRs in human syntenic regions. See also Table S3. (B) Vann diagram demonstrating species-specic imprinted DMRs in known DMRs (upper panel), and in novel DMRs (lower panel) identied either by Xie et al. (2012) (left subset) or in our study (right subset). Bottom numbers represent the number of speciesspecic DMRs (left and right) and shared DMRs among species. See also Table S3. (C and D) (C) Synteny analysis of mouse-specic DMR in the Commd1/Zrsr1, and (D) the human-specic DMRs WHAMMP3 and LOC100289656 that resides in the Prader-Willi/Angelman region.
Stem Cell Reports

Table 3. Bisulte Sequencing Primer List

DMR Bisulte Seq TRAPPC9 WHAMMP3 Forward Primer GGTTTTAGTAGTATTAGGTA GAGATTTTATTTTAAGTATTTA Reverse Primer AAACTCTTTACCCTATAAAT CTAAAACCCAACCCTACTTCTATC
in CGIs and promoters (82%, Figure S4D), our methodology is highly informative for identifying novel imprinted DMRs throughout the human genome. Future studies, using whole genome single-base resolution analysis of DNA methylation, will elucidate whether additional imprinted DMRs are also present in CpG-poor regions. In conclusion, we conducted a comprehensive analysis of imprinted DMRs in humans, identifying multiple novel DMRs, many of them not associated with gene expression. Our data shed light on the extent of the phenomenon of parental imprinting, suggesting that it may play a more extensive role than was previously thought.
regions in normal broblasts. Finally, we included only regions that met the following criteria: (1) methylation difference between PgHiPSCs and HESCs >0.2; (2) methylation difference between PgHiPSCs and HiPSCs >0.15; and (3) methylation difference between parthenogenetic teratomas and normal broblasts >0.15.
Statistical Analysis
In order to faithfully identify DMRs, all reduced representation bisulte sequencing (RRBS) regions with missing values were removed. In addition, as X inactivation results in large-scale differential methylation between the active and inactive X chromosomes both sex chromosomes were removed from the analysis, leaving 235,080 informative regions. Statistical signicance of the identied DMRs was assessed by random permutations of samples between groups and recalculation of the average methylation and statistical values for each region. Permutated data sets were subject to the same criteria used to identify the DMRs and were generated until 20 random data sets gave at least the same number of DMRs as the original data set. p value was calculated as the probability of receiving the same number of hits in random data sets.
Genomic DNA Isolation
Total genomic DNA was extracted from the parthenogenetic iPS and teratoma cells using genomic DNA extraction kit (Real Biotech Corporation) according to the manufacturers protocol.
Reduced Representation Bisulte Sequencing

Reduced representation bisulte sequencing libraries were generated as previously described in Gu et al. (2011). Raw data were analyzed using the bioinformatic pipeline described in Bock et al. (2010).
PCR Bisulte Sequencing

Genomic DNA (2 mg) was bisulte-converted using EZ DNA methylation-Gold kit (Zymo Research), according to the manufacturers instructions. PCRs were performed using Faststart Taq DNA polymerase (Roche) using primers designed to amplify suspected DMRs. Following amplication, PCR products were cleaned using Gel/PCR DNA fragments extraction kit (Geneaid) and ligated into pGEM T-Easy vector (Promega) and transformed into DH5a bacteria subjected to white/blue screen. Positive colonies were picked, and plasmid DNA was extracted for sequencing using Geneaid high-speed plasmid mini kit (New Taipei City, Taiwan). For a full list of primers, see primer list in Table 3.
Bioinformatic Analysis
To identify novel imprinted DMRs throughout the genome, we searched for hemimethylated regions in both HESCs and HiPSCs and compared them to the methylation values of the parthenogenetic samples (difference between PgHiPSCs and HESCs was >0.2). A series of lters was implied in order to avoid false-positive hits. Specically, only regions that exhibited low variation between all CpGs (SD < 0.2 in at least 60% of the samples for each cell type) were considered. Further ltering was performed by verifying high levels of consistency between the samples in each group (SD for average regional methylation value <0.2). Next, in order to rule out false DMRs created by aberrant reprogramming (Lister et al., 2011), all regions in which there was no agreement between PgHiPSCs and their parental broblasts (difference between parthenogenetic and teratoma <0.2) were ltered out. Next, a more stringent approach was used in order to condently identify imprinted DMRs in previously unknown imprinted regions. Thus, in addition to the above-mentioned criteria only regions with more than four shared CpGs and with minimal coverage of ve reads among all samples were used in this study. As imprinted DMRs are maintained throughout the development of the embryo, we also looked for hemimethylated
High-Throughput Sequencing
Total RNA was extracted using MirVana microRNA isolation kit (Ambion Inc) according to the manufacturers protocol. Complementary DNA libraries were established following ribosomal RNA (rRNA) depletion (RiboMinus Invitrogen). The SOLiD (version 3.5) sequencing system (Life Technologies) was used to generate 35-bp-long reads. Following barcode matching of the samples, reads were aligned to UCSC complete build (GRCh37/hg19) genome. All sequences that matched RNA contaminants such as transfer RNA, rRNA, and DNA repeats were subsequently ltered. Reads for each transcript was calculated in RPKM (reads per kilobase of exon model per million mapped reads) units, to obtain normalization of the number of reads relative to their transcript length.
Stem Cell Reports

ACCESSION NUMBERS
The GEO accession number for the RRBS data reported in this paper is GSE47088.
Supplemental Information includes four gures and three tables and can be found with this article online at http://dx.doi.org/10. 1016/j.stemcr.2013.03.005.
Choufani, S., Shapiro, J.S., Susiarjo, M., Butcher, D.T., Grafodatskaya, D., Lou, Y., Ferreira, J.C., Pinto, D., Scherer, S.W., Shaffer, L.G., et al. (2011). A novel approach identies new differentially methylated regions (DMRs) associated with imprinted genes. Genome Res. 21, 465476. Consortium, E.P.; ENCODE Project Consortium. (2011). A users guide to the encyclopedia of DNA elements (ENCODE). PLoS Biol. 9, e1001046. Ferguson-Smith, A.C. (2011). Genomic imprinting: the emergence of an epigenetic paradigm. Nat. Rev. Genet. 12, 565575. Frost, J.M., and Moore, G.E. (2010). The importance of imprinting in the human placenta. PLoS Genet. 6, e1001015. Gu, H., Smith, Z.D., Bock, C., Boyle, P., Gnirke, A., and Meissner, A. (2011). Preparation of reduced representation bisulte sequencing libraries for genome-scale DNA methylation proling. Nat. Protoc. 6, 468481. Hark, A.T., Schoenherr, C.J., Katz, D.J., Ingram, R.S., Levorse, J.M., and Tilghman, S.M. (2000). CTCF mediates methylation-sensitive enhancer-blocking activity at the H19/Igf2 locus. Nature 405, 486489. Harris, R.A., Wang, T., Coarfa, C., Nagarajan, R.P., Hong, C., Downey, S.L., Johnson, B.E., Fouse, S.D., Delaney, A., Zhao, Y., et al. (2010). Comparison of sequencing-based methods to prole DNA methylation and identication of monoallelic epigenetic modications. Nat. Biotechnol. 28, 10971105. Hiura, H., Sugawara, A., Ogawa, H., John, R.M., Miyauchi, N., Miyanari, Y., Horiike, T., Li, Y., Yaegashi, N., Sasaki, H., et al. (2010). A tripartite paternally methylated region within the Gpr1-Zdbf2 imprinted domain on mouse chromosome 1 identied by meDIP-on-chip. Nucleic Acids Res. 38, 49294945. Kelsey, G., Bodle, D., Miller, H.J., Beechey, C.V., Coombes, C., Peters, J., and Williamson, C.M. (1999). Identication of imprinted loci by methylation-sensitive representational difference analysis: application to mouse distal chromosome 2. Genomics 62, 129138. Lieberman-Aiden, E., van Berkum, N.L., Williams, L., Imakaev, M., Ragoczy, T., Telling, A., Amit, I., Lajoie, B.R., Sabo, P.J., Dorschner, M.O., et al. (2009). Comprehensive mapping of long-range interactions reveals folding principles of the human genome. Science 326, 289293. Lister, R., Pelizzola, M., Kida, Y.S., Hawkins, R.D., Nery, J.R., Hon, G., Antosiewicz-Bourget, J., OMalley, R., Castanon, R., Klugman, S., et al. (2011). Hotspots of aberrant epigenomic reprogramming in human induced pluripotent stem cells. Nature 471, 6873. Mann, M.R., and Bartolomei, M.S. (1999). Towards a molecular understanding of Prader-Willi and Angelman syndromes. Hum. Mol. Genet. 8, 18671873. Maunakea, A.K., Nagarajan, R.P., Bilenky, M., Ballinger, T.J., DSouza, C., Fouse, S.D., Johnson, B.E., Hong, C., Nielsen, C., Zhao, Y., et al. (2010). Conserved role of intragenic DNA methylation in regulating alternative promoters. Nature 466, 253257. McGrath, J., and Solter, D. (1984). Completion of mouse embryogenesis requires both the maternal and paternal genomes. Cell 37, 179183.
ACKNOWLEDGMENTS
The authors would like to thank Tamar Golan-Lev for her assistance with the graphic design. N.B. is the Herbert Cohn Chair in Cancer Research. This research was supported by The Legacy Heritage Biomedical Program of the Israel Science Foundation (grant No. 1252/12), and by the Centers of Excellence Legacy Heritage Biomedical Science Partnership (grants No. 1801/10). D.R. is supported by the Lady Davis Fellowship Trust and the Israel Cancer Research Fund. A.M. is a New York Stem Cell Foundation Robertson Investigator. Part of this work was funded by NIH grants (U01ES017155 and P01GM099117) and The New York Stem Cell Foundation. Received: January 29, 2013 Revised: March 27, 2013 Accepted: March 28, 2013 Published: June 4, 2013
REFERENCES
Bartolomei, M.S., and Ferguson-Smith, A.C. (2011). Mammalian genomic imprinting. Cold Spring Harb. Perspect. Biol. 3. http:// dx.doi.org/10.1101/cshperspect.a002592. Bell, A.C., and Felsenfeld, G. (2000). Methylation of a CTCF-dependent boundary controls imprinted expression of the Igf2 gene. Nature 405, 482485. Bell, A.C., West, A.G., and Felsenfeld, G. (1999). The protein CTCF is required for the enhancer blocking activity of vertebrate insulators. Cell 98, 387396. ller, F., Simmer, F., Bock, C., Tomazou, E.M., Brinkman, A.B., Mu ger, N., Gnirke, A., Stunnenberg, H.G., and Meissner, A. Gu, H., Ja (2010). Quantitative comparison of genome-wide DNA methylation mapping technologies. Nat. Biotechnol. 28, 11061114. Bock, C., Kiskinis, E., Verstappen, G., Gu, H., Boulting, G., Smith, Z.D., Ziller, M., Croft, G.F., Amoroso, M.W., Oakley, D.H., et al. (2011). Reference Maps of human ES and iPS cell variation enable high-throughput characterization of pluripotent cell lines. Cell 144, 439452.
Stem Cell Reports

Meissner, A., Mikkelsen, T.S., Gu, H., Wernig, M., Hanna, J., Sivachenko, A., Zhang, X., Bernstein, B.E., Nusbaum, C., Jaffe, D.B., et al. (2008). Genome-scale DNA methylation maps of pluripotent and differentiated cells. Nature 454, 766770. Mekhoubad, S., Bock, C., de Boer, A.S., Kiskinis, E., Meissner, A., and Eggan, K. (2012). Erosion of dosage compensation impacts human iPSC disease modeling. Cell Stem Cell 10, 595609. Nazor, K.L., Altun, G., Lynch, C., Tran, H., Harness, J.V., Slavin, I., ller, F.J., Wang, Y.C., Boscolo, F.S., et al. Garitaonandia, I., Mu (2012). Recurrent variations in DNA methylation in human pluripotent stem cells and their differentiated derivatives. Cell Stem Cell 10, 620634. n, E., and Sapienza, Pardo-Manuel de Villena, F., de la Casa-Espero C. (2000). Natural selection and the function of genome imprinting: beyond the silenced minority. Trends Genet. 16, 573579. Pick, M., Stelzer, Y., Bar-Nur, O., Mayshar, Y., Eden, A., and Benvenisty, N. (2009). Clone- and gene-specic aberrations of parental imprinting in human induced pluripotent stem cells. Stem Cells 27, 26862690. , R., Ajjan, S., Cowley, M., Iranzo, J., CarbaProudhon, C., Dufe josa, G., Saadeh, H., Holland, M.L., Oakey, R.J., Rakyan, V.K., et al. (2012). Protection against de novo methylation is instrumental in maintaining parent-of-origin methylation inherited from the gametes. Mol. Cell 47, 909920. Reik, W., Dean, W., and Walter, J. (2001). Epigenetic reprogramming in mammalian development. Science 293, 10891093. Singh, P., Wu, X., Lee, D.H., Li, A.X., Rauch, T.A., Pfeifer, G.P., , P.E. (2011). Chromosome-wide analysis of Mann, J.R., and Szabo
parental allele-specic chromatin and DNA methylation. Mol. Cell. Biol. 31, 17571770. Smith, Z.D., Chan, M.M., Mikkelsen, T.S., Gu, H., Gnirke, A., Regev, A., and Meissner, A. (2012). A unique regulatory phase of DNA methylation in the early mammalian embryo. Nature 484, 339344. Stelzer, Y., Yanuka, O., and Benvenisty, N. (2011). Global analysis of parental imprinting in human parthenogenetic induced pluripotent stem cells. Nat. Struct. Mol. Biol. 18, 735741. Surani, M.A., and Barton, S.C. (1983). Development of gynogenetic eggs in the mouse: implications for parthenogenetic embryos. Science 222, 10341036. Surani, M.A., Barton, S.C., and Norris, M.L. (1984). Development of reconstituted mouse eggs suggests imprinting of the genome during gametogenesis. Nature 308, 548550. Watanabe, T., Tomizawa, S., Mitsuya, K., Totoki, Y., Yamamoto, Y., Kuramochi-Miyagawa, S., Iida, N., Hoki, Y., Murphy, P.J., Toyoda, A., et al. (2011). Role for piRNAs and noncoding RNA in de novo DNA methylation of the imprinted mouse Rasgrf1 locus. Science 332, 848852. Xie, W., Barr, C.L., Kim, A., Yue, F., Lee, A.Y., Eubanks, J., Dempster, E.L., and Ren, B. (2012). Base-resolution analyses of sequence and parent-of-origin dependent DNA methylation in the mouse genome. Cell 148, 816831. Yamazawa, K., Ogata, T., and Ferguson-Smith, A.C. (2010). Uniparental disomy and human disease: an overview. Am. J. Med. Genet. C. Semin. Med. Genet. 154C, 329334.
Stem Cell Reports

Resource Germline Transgenic Methods for Tracking Cells and Testing Gene Function during Regeneration in the Axolotl
Shahryar Khattak,1,2 Maritta Schuez,1,2 Tobias Richter,1 Dunja Knapp,1,2 Saori L. Haigo,2,4 n,1,2 Kristyna Hradlikova,1,2 Annett Duemmler,1,2 Ryan Kerney,3 Tatiana Sandoval-Guzma 1,2, and Elly M. Tanaka *
Planck Institute of Molecular Cell Biology and Genetics, 01307 Dresden, Germany t Dresden, DFG Center for Regenerative Therapies, 01307 Dresden, Germany Universita 3Biology Department, Gettysburg College, Gettysburg, PA 17325-1400, USA 4Present address: Department of Biochemistry & Biophysics, University of California, San Francisco, San Francisco, CA 94158-2156, USA *Correspondence: elly.tanaka@crt-dresden.de http://dx.doi.org/10.1016/j.stemcr.2013.03.002 This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial-No Derivative Works License, which permits non-commercial use, distribution, and reproduction in any medium, provided the original author and source are credited.
2Technische 1Max
The salamander is the only tetrapod that regenerates complex body structures throughout life. Deciphering the underlying molecular processes of regeneration is fundamental for regenerative medicine and developmental biology, but the model organism had limited tools for molecular analysis. We describe a comprehensive set of germline transgenic strains in the laboratory-bred salamander Ambystoma mexicanum (axolotl) that open up the cellular and molecular genetic dissection of regeneration. We demonstrate tissue-dependent control of gene expression in nerve, Schwann cells, oligodendrocytes, muscle, epidermis, and cartilage. Furthermore, we demonstrate the use of tamoxifen-induced Cre/loxP-mediated recombination to indelibly mark different cell types. Finally, we inducibly overexpress the cellcycle inhibitor p16INK4a, which negatively regulates spinal cord regeneration. These tissue-specic germline axolotl lines and tightly inducible Cre drivers and LoxP reporter lines render this classical regeneration model molecularly accessible.
INTRODUCTION
Generations of biologists have been fascinated by salamander limb and tail regeneration. Important grafting experiments delineated the fundamental tissue interactions involved that provide a rich basis for a molecular understanding of regeneration (Bryant and Iten, 1977; Dunis and Namenwirth, 1977; Steen, 1968; Stocum, 1975; Wallace and Wallace, 1973) (for reviews, see Nacu and Tanaka, 2011; Stocum and Cameron, 2011). For example, after limb amputation, cells from the muscle, connective tissue, skeletal, peripheral nerve, and epidermis all contribute to the progenitor cell zone, called the blastema, which will reconstitute all limb tissues. The progenitors from these diverse tissues remain largely separate and show divergent behaviors, for example, during limb patterning (Kragl et al., 2009; Nacu et al., 2013). Therefore, a mechanistic understanding of regeneration requires the control of gene expression in specic cell types. Furthermore, because genes involved in regeneration may also be implemented during development, inducible gene expression is important. Although several vertebrate models of regeneration are available, there are compelling reasons to study regeneration in the salamander. First, the graftability of salamander tissue provides a uniquely powerful approach to lineage trace cells and to test cell-autonomous versus -nonautonomous events (Muneoka et al., 1986; Pescitelli and Stocum, 1980). Second, the distinct anatomy of the zebrash n from the tetrapod limb limits what we can infer from ns
to limbs (Sordino et al., 1995). Xenopus, a valuable molecular model of regeneration, regenerates the developing hindlimb only prior to metamorphosis (for review, see Yakushiji et al., 2009). This regeneration occurs before full differentiation and could involve progenitor cell sources distinct from those utilized to regenerate a fully differentiated limb (Dent, 1962). Therefore, it is important to study regeneration in multiple vertebrates. Detailed molecular analysis of regeneration has been difcult because it is an adult phenotype with a complex starting point involving the response of many tissues to injury. It is likely that only a subset of cells in any given adult tissue contributes to the blastema. Electroporation of plasmid DNAs and morpholinos has been used to analyze important phenotypes during salamander limb regeneration, but this technique provides transient, variable transfection (Echeverri and Tanaka, 2005; Kumar et al., 2007; Mercader et al., 2005). Adenovirus, vaccinia virus, and pseudotyped retrovirus have also been applied, but the limited cargo size and toxicity have limited their use and have not yet been widely adopted (Kawakami et al., 2006; Morrison et al., 2010; Roy et al., 2000; Whited et al., 2013). Sustained expression from genomic integration is extremely important for the study of salamander limb regeneration. Successful germline transgenesis has been reported for axolotl (Sobkow et al., 2006) and has been applied to the Japanese newt and Iberian ribbed newt (Casco-Robles et al., 2010; Hayashi et al., 2013). Moreover, germline EGFP and nuclear Cherry-expressing transgenic axolotls were used in combination with tissue
Stem Cell Reports

Axolotl Transgenics for Inducible Gene Expression
grafting to provide important proof that the regenerating limb blastema is a mixed population of tissue-restricted progenitors (Kragl et al., 2009). For further molecular dissection of regeneration, however, conditional induction of gene expression in a time and/or cell-type-dependent fashion is essential. Recently, Whited and colleagues described a system to induce gene expression in axolotls using an IPTG system, whereas this system is promising for acute control of gene expression, the continuous presence of inducer is required to sustain expression that could limit its use for cell tracking during regeneration (Whited et al., 2012). It is not yet known how well the system can be combined with cell-type-specic control of gene expression. Furthermore, the effectiveness of the system was not shown in germline-transmitted F1 animals where fullgenomic integration of the transgene may alter its expression properties. In larval axolotls, full-limb regeneration occurs over 23 weeks, whereas in fully adult animals, the process can take over 10 weeks. Therefore, a sustainable gene induction system such as the Cre/loxP system would be valuable for regeneration studies, but tamoxifen-inducible systems were characterized as too leaky for axolotl transgenics (Whited et al., 2012). Here, we describe tissue- and time-dependent control of gene expression in germline transgenic axolotls via Cre/loxP methodology. We provide a set of germline transgenic animals driving the GFP reporter behind different cell-type-specic promoters relevant for regeneration research. We further employ Cre/loxP to conditionally initiate gene expression in a time and cell-type-specic manner. As a proof of principle for phenotype analysis, we demonstrate the inducible overexpression of the tumor suppressor p16INK4a. It has been proposed that the p16INK4a/ ARF locus rst arose in mammals and is not present in the salamander, a potential basis for the restricted regeneration capacities of mammals (Pajcini et al., 2010). By CRE-mediated induction of p16INK4a, we show that it suppresses axolotl spinal cord regeneration. These tools make the axolotl amenable for molecular analysis of regeneration.
RESULTS
Tissue-Specic Germline Transgenic Reporter Strains Because grafting experiments indicated that each tissue contributes uniquely to regeneration (Kragl et al., 2009), a molecular analysis of regeneration requires controlling gene expression specically in different tissues. We implemented tissue-specic promoters from different animal species to successfully establish germline transgenic axolotl strains showing faithful, cell-type-specic expression of the EGFP gene (Table 1; Figure 1). Transgenic strains were produced by injection of plasmid or BAC DNA into one- to
two-cell embryos as previously described (Khattak et al., 2009; Sobkow et al., 2006). Injected animals were grown to larval stages and examined via uorescence protein expression for the extent of expression. Only animals with apparently greater than 80% expression along the body were raised to sexual maturity and then mated to nontransgenic mates (see Table 1 for numerical details for each transgenic strain). The F1 progenies were examined for EGFP expression in the expected cell/tissue types as live whole mounts. To conrm specicity and penetrance of expression, limbs and tails were cross-sectioned and immunostained for respective proteins. We only propagated strains that showed strict colocalization of the EGFP with the respective marker proteins and no extraneous expression. We found this to be an important aspect of the screening process because random integration of the transgenic constructs leads to position effects that can yield mosaicism in the progeny. To generate germline transgenic lines expressing EGFP in neurons, we implemented the mouse bIII-tubulin regulatory sequences by injecting a previously characterized mouse BAC construct in which the gene for a GAP43-EGFP fusion protein sequence had been integrated with its own poly(A) signal downstream of the coding sequence (Attardo et al., 2008). Injection was performed without SceI meganuclease, and 12 animals out of 343 injected eggs showed neural-specic expression over large portions of the body (approximately >80% of cells) (Table 1). Six animals were grown up for germline transmission and mated to a nontransgenic mate. One of the animals displayed a germline transmission rate of 24%. Figure 1A shows whole-mount images of a live F1 progeny showing GFP signal in nerve bers. To conrm the specicity of expression to neurons, we immunostained tail and limb sections for bIII-tubulin (Figures S1A and S1B available online). Excellent (100%) colocalization of EGFP signal with immunouorescence signal was observed, conrming the specic expression of the transgene. Abundant expression was observed in the spinal cord (arrow), as well as the dorsal root ganglion (arrowhead) and peripheral nerve tracts (asterisks) (Figure S1A), indicating that central and peripheral neurons expressed the transgene. For marking of glial cells including oligodendrocytes and Schwann cells, we implemented the mouse CNP promoter (Glaser et al., 2005). After coinjection of the construct with SceI meganuclease, we obtained 7 strongly expressing F0 animals out of 758 originally injected. Three were mated, and all showed germline transmission. Figure 1B shows the nerve tracts expressing EGFP in the limb of a typical live F1 animal. Out of the three mated founders, the F1 progeny of one had uniform EGFP expression in putative Schwann cells and oligodendrocytes, whereas the progeny of the other two founders showed mosaic EGFP expression.
Stem Cell Reports

Table 1. Summary of Germline Transgenic Axolotls

Germline Transmission Rate (No. of Founders Raised and Mated/No. that Went Germline) Details of Constructs
Genotypes Ubiquitous Transgenic Lines CAGGs: EGFP CAGGs: CherryNuc CAGGs: LP-EGFP-LP-Cherry CAGGs: LP-EGFP-LP-Tomato
References
15/6 19 Raised and 4 mated/4 11 Raised and 7 mated/7 20 Raised and 2 mated/2
CAGGs promoter driving EGFP CAGGs promoter driving nuclear Cherry CAGGs promoter driving oxed EGFP cassette followed by Cherry CAGGs promoter driving oxed EGFP cassette followed by Tomato CAGGs promoter driving oxed EGFP cassette followed by p16INK4A and Cherry CAGGs promoter driving ert2-Cre-ert2 and nuclear EGFP
Sobkow et al. (2006) Kragl et al. (2009)
CAGGs: LP-EGFP-LP-p16-T2A-Cherry 9 Raised and 4 mated/2 CAGGs: ER-Cre-ER-T2A-EGFP-nuc Tissue-Specic Transgenic Lines B3Tubulin: EGFP CNP: EGFP Col2a1: EGFP KRT12: EGFP CarAct: EGFP AxSox2:cre-ert2-T2A-GFP Col2A1:ER-Cre-ER-T2A-EGFP-nuc 6/1 7 Raised and 3 mated/3 6/2 4/1 8 Raised and 3 mated/3 5/1 5/1 3/3
Mouse bIII-tubulin BAC with membrane localized EGFP Mouse 20 30 -cyclic nucleotide 30 -phosphodiesterase (CNP) promoter driving EGFP Xenopus collagen 2 a 1 promoter driving EGFP Xenopus keratin 12 promoter fragment driving EGFP Xenopus cardiac actin promoter driving EGFP Axolotl Sox2 genomic clone with cre-ert2GFP-nuc integrated instead of the ORF Xenopus Col2A1 promoter driving ert2-Cre-ert2 and nuclear EGFP
Attardo et al. (2008) Glaser et al. (2005) Kerney et al. (2010) Suzuki et al. (2010) Ogino et al. (2006)
Kerney et al. (2010)
The limbs and tails of F1 progeny from the uniform founder were cross-sectioned and immunostained with an anti-MBP antibody conrming high (100%) colocalization of EGFP signal with MBP+ structures (Figures 1B, S1C, and S1D). EGFP expression was observed in both the central spinal cord (arrow) (Figure S1C), as well as in DRG (arrowhead) and peripheral nerve tracts (asterisks) of the tail and limb (Figures S1C and S1D), indicating that oligodendrocytes and Schwann cells expressed the transgene. Higher-magnication confocal imaging of a nerve tract in the limb conrmed expression of EGFP in the nucleus and cytoplasm of MBP+ cells wrapping around the axon (Figure S1E). To label other tissues important in regeneration, such as epidermis, muscle, and cartilage, we employed previously characterized Xenopus promoters driving EGFP, namely Keratin12:EGFP, CarAct:EGFP, and Col2a1:EGFP (Kerney et al., 2010; Ogino et al., 2006; Suzuki et al., 2010). The Keratin: EGFP animals express EGFP exclusively in the skin
(Figures 1C, S1F, and S1G), whereas the CarAct:EGFP transgenics show robust expression in the myosin heavy-chainexpressing muscle and not in the PAX7-positive satellite cells, indicating faithful muscle-specic expression (Figures 1D, S1H, and S1I). The Col2a1:EGFP line shows expression in cartilage cells, for example, of the larval limb (Figure 1E). To further propagate these conrmed lines, F1 progenies were raised to sexual maturity and crossed with white nontransgenic hosts to check for germline transmission and specic uniform EGFP expression in F2 progeny. The F1 male and females were mated to establish homozygous lines that result in 100% transgenic progeny when mated to a nontransgenic animal (Table 1). Application: Tracking Neurons and Muscle during Limb Regeneration The ingrowth of nerves is an essential aspect of limb regeneration (Kumar and Brockes, 2012), but the process has so far been followed by quantitative electron microscopy
Stem Cell Reports

Figure 1. Transgenic Axolotls with Celltype-Specic Transgene Expression of EGFP (A) Live axolotl larva expressing membranetethered EGFP in neurons under the control of mouse bIII-tubulin promoter. (B) Limb of live transgenic axolotl expressing EGFP in Schwann cells. The transgenic animal is expressing EGFP under the control of mouse CNP promoter and marking all myelin-positive cells in the body. (C) Xenopus Keratin 12 promoter driving EGFP in epidermis of live axolotl. Here, a limb image is shown. (D) Fluorescence image of limb on a live animal showing EGFP expression in muscle driven by the Xenopus Cardiac Actin (Car Act) promoter. (E) Limb of live transgenic axolotl where Xenopus Col2a1 promoter is driving EGFP in cartilage. Scale bars, 1 mm (B, D, and E) and 2 mm (A and C). See also Figure S1.
and immunouorescence. The optical clarity of the white axolotl strain allows visualization of uorescent cells in live animals (Echeverri et al., 2001). Here, to demonstrate the feasibility of following axonal outgrowth during limb regeneration, we amputated limbs of larval bIIItub:GAP43-EGFP animals and followed them over time in the same live animal (Figures 2A2C). During regeneration, we observed ingrowth of thin axonal bers already in the early 6 day blastema (Figure 2A). Further inltration of axons was observed by the Notch stage of regeneration (Figure 2B) and consolidation of larger axonal bundles inltrating the forming digits at the Palette stage (Figure 2C). These data indicate that robust innervation occurs early during blastema formation, and ber termini extend well toward the distal epithelium. In the future, more detailed imaging studies can elucidate the dynamics of nerveepithelial interactions that are crucial for proper limb outgrowth (Kumar et al., 2007; Mullen et al., 1996). Another important aspect of limb regeneration is determination of proximal versus distal identity. It was recently shown that skeletal/connective tissue-derived blastema cells regenerate limb elements only more distal to the amputation plane, whereas muscle-derived blastema cells have the potential to regenerate muscle tissue
of all limb segments (Nacu et al., 2013). In the previous studies, muscle labeling was performed by grafting of presomitic mesoderm from constitutively expressing CAGGs:EGFP donor embryos into white hosts. Here, we demonstrate the utility of the CarAct:EGFP transgenic animal for revealing the potency of muscle to regenerate cells in all limb segments. To track muscle versus other limb tissues, a CarAct:EGFP animal was rst crossed to the CAGGs:Cherry nuc animal (expresses nuclear Cherry in all cells) to generate double-transgenic CarAct:EGFP; CAGGs:Cherry nuc that express both transgenes. Midbud hand blastemas were grafted onto the upper-arm stump of a white host animal, in a classic intercalation assay (Figure 2D) (Iten and Bryant, 1975; Stocum, 1975). Limbs of normal morphology regenerated (Figure 2E). Examination of uorescence signal showed that the musclespecic EGFP signal (that comes only from the transplanted wrist blastema) was observed in muscle of upper limb, lower limb, and hand (Figures 2D and 2E). In contrast, the nuclear Cherry signal, which in whole mount is most noticeable in the skin-derived cells, was largely conned to the hand. These results show that muscle progenitors from a hand blastema can form upper- and lower-arm muscle.
Stem Cell Reports

Figure 2. In Vivo Tracking of Nerves and Muscle during Normal and Intercalary Limb Regeneration (AC) Live tracking of growing nerves in a bIIItub:GAP43-EGFP transgenic animal. Nerves as seen in a 6 day limb blastema (A), early digitforming (Notch) stage (B), and late digit (Palette)-regeneration stage (C) of the same animal. The dashed white lines in (A) and (C) represent the amputation plane. (D) Scheme of hand blastema transplantation to follow EGFP muscle versus other cell types during intercalary regeneration. A doubletransgenic (CAGGs:Cherrynuc;CarAct:EGFP) hand blastema was transplanted onto an upper-arm stump of a nontransgenic white mutant host and allowed to regenerate. (E) Regenerated limb from the double-transgenic hand blastema graft. The white dashed line shows the amputation plane of the host stump (to where the hand blastema was transplanted). Muscle bers (green) are present in upper-arm regions during intercalary regeneration, whereas the cherry-positive cells largely populate the hand region of the regenerate. Scale bars, 100 mm (A), 200 mm (B), 300 mm (C), and 1 mm (E). Use of Cre/loxP System for Tissue and Time-Dependent Control of Gene Expression To study regeneration, an inducible expression system is important for two reasons. First, when using genetic fate mapping, irreversible activation of marker expression in a given cell type is important because the cell expressing a given marker gene in the mature tissue may, during regeneration, turn off the marker. Second, when studying gene function, inducible expression is important because genes functioning in regeneration may also have earlier roles in development. Considering the long timescales of regeneration, a system that induces sustained expression would be desirable. We therefore focused on testing the Cre/loxP system. We rst generated a germline transgenic loxP reporter strain where the CAGGs promoter drives a oxed EGFP-STOP cassette followed by the Cherry gene- CAGGs:LP-EGFP-STOP-LP-Cherry (Figure S2). A total of 11 putative founders were raised to sexual maturity. Seven were mated to white nontransgenic hosts, and all yielded germline transmission with a frequency in the range of 5.4%54%. Only one founder had mosaic EGFP expression as determined by cross-sectioning the limbs and tails of F1 progeny and staining the sections with DAPI to ascertain that EGFP is expressed in every cell. To evaluate whether CRE-mediated recombination can work on the genomically inserted transgene, we electroporated a Cre expression plasmid into the mature limb and tail of the F1 progeny of loxP reporter. After 3 days, we observed robust Cherry expression only in animals that had received Cre plasmid (Figures S2D and S2H), and not in control unelectroporated animals (Figures S2B and S2F). No Cherry expression was observed when PBS and/or empty plasmid (pUC19) was electroporated into the tail and limb of the loxP reporter animal. Similarly, no spontaneous Cherry expression was observed after limb/tail amputation and
Stem Cell Reports

during regeneration of the PBS/pUC19 electroporated animals (Figure S3). Interestingly, coelectroporation of the split Cre constructs (Casanova et al., 2003) together also induced robust recombination and Cherry expression, whereas electroporation of the single constructs did not, bringing up the possibility of making CRE activity dependent on expression of two promoters (Figure S4). Cell-type-Dependent Control of Cre Activity in Sox2+ Neural Stem Cells We next sought to control Cre expression in a cell-type-specic manner. We isolated a 15 kb genomic clone for the axolotl Sox2 gene that is expressed in the neural stem cells of the CNS (Li et al., 1998; McHedlishvili et al., 2012; Zappone et al., 2000). The clone included 11.68 kb upstream of the coding sequence, the Sox2 coding sequence and 2.66 kb downstream sequence of the coding sequence. Recombineering was used to incorporate a Cre ERT2-T2A-nucGFP cassette by replacing the Sox2 coding sequence. The resulting construct was injected into eggs together with SceI meganuclease. Cre-ERT2 is a highly used method for induction of CRE activity via the tamoxifen metabolite, 4-hydroxytamoxifen (4-OHT) (Metzger and Chambon, 2001). F1 progeny from a germline-transmitting animal showed robust expression of nuclear GFP in the ventricular, SOX2+ cells of the brain (Figures 3C3G0 ). When crossed to the CAGGs:LP-EGFP-STOP-LP-Cherry reporter, the F1 progeny displayed strong Cherry expression in the brain even in the absence of tamoxifen, indicating leaky but cell-type-specic activity of the CRE-ERT2 (Figures 3I and 3J). Because recombination was occurring continuously even in the absence of tamoxifen, the distribution of Cherry+ cells was broader than the nucGFP because the SOX2+ cells and their progeny expressed the Cherry gene (Figures 3J3M0 ). From these experiments, we can conclude that cell-type-specic expression of CRE activity in neural stem cells is achievable but that the CRE-ERT2 is not sufciently stringent for tamoxifen-induced activity, showing spontaneous recombination (Figure 3). ERT2-Cre-ERT2 Fusions Provide Nonleaky TamoxifenInducible Cre-Mediated Gene Expression in Axolotl To achieve tighter temporal induction of CRE activity, we assayed a number of induction systems for driving the Cre gene, including Tet-on/off, GBD, Gal80ts, Gal4VP16/ aUAS, and a double fusion to the ERT2 sequences (Garc n and Guillou, 2006; Mallo, 2006; McGuire et al., Ot 2003; Verrou et al., 1999), by electroporation of plasmids for these systems into limb tissue. Most systems displayed problems such as leakiness or toxicity. For example, dexamethasone was toxic to the animals. Two versions of the Tet-on system were tested: the Tet-on advanced transactiva-
tor (rtTA2S-M2) (Urlinger et al., 2000) yielded signicant Cre recombination in the absence of doxycycline (Figures S5A and S5B). The improved reverse tetracycline transactivator (irtTA) fused to the ligand binding domain of mutated glucocorticoid receptor (irtTA-GBD*) (Anastassiadis et al., 2010) showed less leakiness than rtTA2S-M2, but dexamethasone was toxic (Figures S5C and S5D). The temperature-sensitive repressor Gal80Ts that binds and blocks the Gal4-mediated transcription at 18 C and allows transcription at 30 C has been used in Drosophila (Pavlopoulos and Akam, 2011). Electroporation of Gal80Ts into the axolotl limb of loxP reporter along with Gal4-UAS-Cre still yielded Cre recombination at 18 C (Figures S5E and S5F). We therefore reexplored the control of CRE by the ERT2 sequences and tamoxifen. As expected, in limbs electroporated with a CAGGs:Cre-ERT2 expression plasmid, we observed strong Cherry expression in the absence of tamoxifen (Figures S5G and S5H). Therefore, we tried a number of means to attenuate the CRE-ERT activity including fusion with a nuclear export signal and fusion with a ubiquitinylation signal, but neither decreased the background activity sufciently (Figures S5 IS5L). However, we found that the ERT2-Cre-ERT2 fusion (Zhang et al., 1996) did elicit tight, tamoxifen-inducible CRE activity, as seen by no Cherry expression after the electroporation of the construct in the absence of tamoxifen (Figures S5M and S5N) but robust expression of Cherry after electroporation and subsequent tamoxifen induction (Figures S6O and S6P). We therefore produced a germline transgenic CAGGs: ERT2-Cre-ERT2-T2A-nuc-EGFP (Cre-2xERT2) animal (Figures 4A and 4B). When double-CAGGs:ERT2-Cre-ERT2-T2Anuc-EGFP/+;CAGGs:loxP-EGFP-STOP-loxP-Cherry/+ animals were bred (Figure 4C), we observed no recombination prior to 4-OHT induction (Figures 4D and 4F). After a single intraperitoneal injection of 4-OHT, we observed robust Cherry expression as assayed in limb and tail tissue (Figures 4E and 4G). Some EGFP expression persisted after induction even in Cherry-positive cells. This is presumably due to the loxP reporter harboring multiple integrated copies of the transgene or due to perdurance of the GFP. We conclude that the ERT2-Cre-ERT2 fusion provides tight, temporal control of gene expression in the axolotl. Tamoxifen-Inducible Expression in CollagenIIExpressing Vertebral Cells To combine cell-type-specic and temporal induction of gene expression, we placed the ERT2-Cre-ERT2-T2A-nucEGFP cassette behind the Xenopus Col2a1 promoter that drives expression in skeletal cells (see Figure 1E), and germline-transmitting animals were produced. Five putative founders were raised to sexual maturity, and one transmitted through the germline showing nuclear EGFP
Stem Cell Reports

Figure 3. Neural Stem Cell Expression via AxSox2:Cre-ERT2-nucGFP and Marking of Neural Stem Cell Descendents via CREMediated Recombination (A) Scheme of double transgenic used to label SOX2+ cells in the brain. LoxP reporter (CAGGs:loxP-EGFP-loxP-Cherry) was crossed with a transgenic axolotl where the Cre-ERT2 gene is under the control of the axolotl Sox2 promoter. (B) Bright-eld image of head of Sox2: CreERT2 transgenic animal line (F1s) (C) EGFP uorescence image of the head shown in (B) showing brain-specic expression. (DG) Immunostaining of head cross-section of Sox2: Cre-ERT2 driver animal. nucGFP expression is seen in (D), SOX2 immunouorescence is in (E), nuclei are stained for DAPI in (F), and (G) shows the merged image. (G0 ) Higher-resolution image of inset in (G) showing colocalization of EGFP signal with immunostaining for SOX2 in the ventricular zone of the brain section. (H) Bright-eld image of head of doubletransgenic animal, AxSox2:Cre-ERT2-nucGFP; CAGGs:loxP-EGFP-loxP-Cherry. (I) Cherry uorescence image of the head shown in (H). Clear Cherry uorescence is seen in brain without tamoxifen administration. (JM) Cross-section of head of AxSox2:CreERT2-nucGFP; CAGGs:loxP-EGFP-loxP-Cherry showing expression in Cherry (J), SOX2 immunouorescence (K)-positive cells in the brain. (L) shows DAPI+ nuclei, whereas (M) is the merged image. A broader uorescence is seen compared to the nucGFP signal in the AxSox2:Cre-ERT2-nucGFP driver, indicating that Sox2+ cells have contributed to new neurogenesis in the brain. (M0 ) Higher-resolution inset of (M) brain section showing Cherry-positive cells in SOX2+ cells as well as their putative descendants. Scale bars, 2 mm (C and I), 200 mm (G and M), and 30 mm (G0 and M0 ). expression in cartilage of F1 progeny when crossed with white nontransgenic host. In this animal, the head and tail cartilage showed particularly strong expression of the transgene. The germline-transmitting animal was crossed to the loxP reporter animals (Figure 5A). In the F1, double-transgenic progeny, no Cherry expression was observed in the head or tail tissue prior to tamoxifen administration (Figures 5B and 5D). After tamoxifen induction, bright areas of Cherry-positive cells were observed in the head cartilage and in the notochord/cartilage ventral to the spinal cord (Figures 5C and 5E). In conclusion, we have demonstrated that cell-type and temporal control of gene expression is efcient and possible in germline transgenic axolotl lines. This will be useful to track cells during axolotl regeneration and development. Use of Tamoxifen-Inducible Cre/loxP System to Overexpress p16INK4a The Cre/loxP system is a potentially powerful tool to test the role of molecular pathways during regeneration by overexpression of genes. It has been proposed that one rationale
Stem Cell Reports

for the robust regeneration in the salamander is its lack of the growth inhibitor gene products p16INK4a/ARF. We therefore aimed to apply Cre/loxP-based induction to determining the effect of p16INK4a overexpression during regeneration. Temporal control of gene expression was important because the p16INK4a may be expected to strongly repress cell division during normal development. To overexpress p16INK4a during regeneration, we fused the human p16INK4a sequences with T2A-Cherry and cloned the fusion construct behind the oxed GFP cassette (oxed p16Cherry). In order to elicit induction of p16INK4A expression just prior to regeneration, this animal was crossed to a 4-OHT-inducible CAGGs:ERT2-Cre-ERT2-T2A-nuc-EGFP transgenic animal (Figure 6A). p16INK4A gene expression was initiated with a single intraperitoneal injection of 4-OHT. Cherry expression was observed 5 days after 4-OHT induction in double-transgenic animals (Figure 6C), and p16INK4A ectopic expression was independently conrmed using an antibody against human p16 (data not shown). Tails from Cherry-expressing and -nonexpressing control animals were amputated, followed, and the length of regenerated spinal cord was measured as a discrete indicator of regeneration (Figures 6B and 6C). At 4 days after tail amputation, a signicant inhibition of spinal cord regeneration was observed in animals overexpressing human p16INK4A (Figure 6D).
DISCUSSION
Here, we have contributed a number of tools and insights into the use of germline transgenic animals for salamander regeneration research by generating germline transgenic animals for cell-type-specic control of gene expression. By employing BACs, heterologous promoters, and axolotl genomic sequences, we have generated a set of animals that drives EGFP in different cell types of the nervous systemneurons (bIII-tubulin), glia (Cnp), and neural stem cells (Sox2). These will provide an invaluable resource for studying brain and spinal cord, as well as peripheral nerve regeneration in these animals. We have also generated animals driving EGFP in muscle, cartilage, and epidermis. Importantly, we have combined cell-type-specic expression with tight temporal control of gene expression using
Figure 4. Tight Temporal Control of Cre/loxP-Mediated Gene Expression Using the ERT2-cre-ERT2 System (A) Schematic diagram of the Cre driver. The CAGGs promoter is driving the ERT2-cre-ERT2-T2A-nuc-EGFP cassette. (B) Limb of CAGGs:ERT2-Cre-ERT2-T2A-EGFP-nuc transgenic animal in green and red channel. (C) Schema of mating between CAGGs:loxP-EGFP-loxP-Cherry and CAGGs:ERT2-Cre-ERT2-T2A-EGFP-nuc animals.
(D and F) Limb and tail of a double-transgenic (CAGGs:loxP-EGFPloxP-Cherry; CAGGs:ERT2-Cre-ERT2-T2A-EGFP-nuc) animal showing EGFP and Cherry expression levels before tamoxifen induction. (E and G) Robust Cherry expression is observed in limb and tail of double-transgenic (CAGGs:loxP-EGFP-loxP-Cherry; CAGGs:ERT2-CreERT2-T2A-EGFP-nuc) animals after administration of 4-OHT. Scale bars, 1 mm (B and DF) and 500 mm (G). See also Figures S2, S3, S4, and S5.
Stem Cell Reports

Figure 5. Temporal Induction of Gene Expression in Co2A1+ Cells Using Col2A1:ERT2-Cre-ERT2-T2A-EGFP-nuc Transgenic Axolotls (A) Scheme of mating between loxP reporter animal (CAGGs:loxPEGFP-STOP-loxP-Cherry) and the driver animal (Col2A1:ERT2-Cre-ERT2T2A-EGFP-nuc). (B and D) Double-transgenic animal shows no Cherry uorescence in head (B) and tail (D) before tamoxifen induction. High-exposure times were used for imaging so that overall tissue architecture could be seen. (C and E) Double-transgenic head (C) and tail (E) images after tamoxifen induction. Clear Cherry expression is observed only in the skeletal elements of the head and vertebral column in the tail. Halfexposure time from control (C and E) was used. (FI) Cross-section of head showing colocalization of Cherry (F) with Collagen type II antibody staining (G). DAPI delineates nuclei in blue. (I) represents merged image. (J) High-resolution image of inset marked in (I) showing Cherrypositive cells associated with Col2A1 staining in head cartilage. Scale bars, 2 mm (C, E, and I) and 100 mm (J). the Cre/loxP system. These are critical tools for the molecular analysis of regeneration because cells from several different tissues contribute to the blastema and remain as distinct progenitor cell pools during regeneration (Kragl et al., 2009). Furthermore, the marker used to initiate gene expression in the mature tissue may not be maintained during regeneration. Therefore, the Cre/loxP system is particularly valuable for regeneration studies. A critical aspect of the Cre/loxP or any induction system is leakiness of the inducer. We therefore scanned a number of means to tightly induce the CRE activity. In contrast to Whited et al. (2012), we observe strict tamoxifen-inducible gene expression when employing the doubly regulated ERT2Cre-ERT2 sequences in F0 and after germline transmission to F1 in combination with ubiquitous promoters (CAGGs) or a tissue-specic promoter (COL2A1). We can speculate on several sources for the difference in leaky versus nonleaky expression in the two settings. First, we have observed that injection liquids present in the glass microinjection needle (such as plasmid DNAs for transgenesis or tamoxifen for injection into the animals) are often left behind in the micropipette holder after use, and these reagents can be carried over into subsequent injections with new glass microcapillaries via aerosol. Therefore, if several plasmids are screened in sequence, the presence of contaminating Cre-ERT2 DNA from previous injections remaining behind in the micropipette holder and then being transferred to new microcapillaries could have confounded the previous results. Similarly, use of the microinjection device for tamoxifen injection yielded background recombination when the DMSO control sample was injected after the tamoxifen samples without cleaning the micropipette holder in between, but not vice versa. We therefore clean
Stem Cell Reports

Figure 6. Inducible Overexpression of the Cell-Cycle Inhibitor p16INK4 Represses Spinal Cord Regeneration (A) To overexpress human p16INK4A, a transgenic animal was made where the p16INK4A-T2A-Cherry gene was cloned behind a oxed GFP cassette (CAGGs:loxP-EGFPSTOP-loxP-p16INK4AT2A-Cherry). This animal was crossed with a transgenic animal where the 4-OHT-inducible Cre was driven by the ubiquitous CAGGs promoter (CAGGs:ERT2-CreERT2-T2A-EGFP-nuc). The progenies of this mating were screened and injected intraperitoneally with 4-OHT and examined live for induction of Cherry expression 5 days later. (B and C) Phenotype of single-transgenic control and double-transgenic experimental animals ectopically expressing p16INK4A, following 4-OHT intraperitoneal injection and tail amputation. No Cherry induction is seen in single-transgenic animals (B), whereas the double-transgenic animals induced Cherry expression (C). Images were taken 4 days after tail amputation. White dotted lines indicate the amputation plane; white arrows demarcate the extent of ependymal tube outgrowth. (D) Quantitation of the regenerate spinal cord outgrowth in p16INK4A-expressing transgenic animals and nonexpressing controls. The length of the ependymal tube is signicantly reduced in the p16INK4Aexpressing animals (paired t-test and the Mann-Whitney U test, p <0.001). Scale bars, 1 mm (B and C). the micropipette holder between each round of injections. A second potential source of apparent leakiness for ERT2Cre-ERT2 systems could be the quality of the local water because the animals are aquatically raised and constantly exposed to water. The presence of estrogen mimics in the animal water supply could confound the results, and therefore, the use of a carefully controlled water supply is recommended. Another important technical aspect for transgenesis in this system is careful, cellular level monitoring of the germline transmission. Because the transgenes integrate randomly in the genome, position effects result in differences in expression of the same construct among different integrants. We therefore screen the F1 progeny of germline-transmitting strains by histological/immunouorescence analysis to conrm the specicity and completeness of the expression. For example, when generating constructs driven by the CAGGs promoter, which should be expressed in every cell type, we observe some F0 founders whose progeny show no expression in specic cell types such as satellite cells or neuronal cells. We therefore always drive a uorescent reporter gene behind the transgene and analyze the tissues of interest for appropriate expression. We have demonstrated the ability to interrogate gene function during tail regeneration via inducible overexpression of the human p16INK4a gene. It has been proposed that the p16INK4a/ARF locus rst arose in mammals and is not present in animals like the salamander, a potential basis for the restricted regeneration capacities of mammals (Pajcini et al., 2010). Here, we have tested if expression of the p16INK4a gene represses regeneration when induced ubiquitously prior to regeneration onset. Indeed, we observed a signicant retardation of spinal cord regeneration in overexpressing the p16INK4a gene, consistent with an antiregenerative function for this gene. These animals could in the future be used to understand the differing downstream responses in p16INK4a-expressing or -nonexpressing cells.
Stem Cell Reports

These transgenic tools in combination with the growing amount of axolotl sequence data that incorporate nextgeneration sequencing results from our own and other labs for contig assemblies of the axolotl transcriptome and some genomic sequences (Habermann et al., 2004; Monaghan et al., 2009; Putta et al., 2004; Smith et al., 2009) open up new possibilities to parlay this classical regeneration system into a molecular genetic system to investigate the mechanistic basis of regeneration in a vertebrate and its restriction in other animals.
screened for EGFP expression in brain and raised to sexual maturity.
Generation of CAGGs:loxP-EGFP-STOP-loxPp16INK4A-T2A-Cherry and COL2A1:ERT2-Cre-ERT2T2A-EGFP-nls Transgenic Animals

To generate CAGGs:loxP-eGFP-STOP-loxP-p16INK4A-T2A-Cherry T2 and COL2A1:ER -Cre-ERT2-T2A-EGFP-nls transgenic axolotls, Tol2CAGGs:loxP-EGFP-STOP-loxP-p16INK4A-T2A-Cherry and Tol2-COL2A1: ERT2-Cre-ERT2-T2A-EGFP-nls constructs were coinjected with Tol2 transposase mRNA into the fertilized one-cell-stage white axolotl eggs and selected using the methods described above. Immunostaining was performed to conrm expression of human p16Ink4A using a mouse monoclonal antibody against p16 (Santa Cruz Biotechnology; #sc-56330). To detect collagenII a1-specic expression, a mouse anti-chicken Collagen type II antibody was used (Millipore; # MAB 8887).
Axolotl Care and Transgenesis
Animal experiments were performed after approval by the Landesdirektion Saxony, Board of Animal Welfare. Animals were bred in Dresden, Germany, and kept in local tap water at 18 C. The water quality was controlled every day for temperature, pH, ammonia levels, and water consumption. Juveniles and adult animals were kept in continuous ow towers outtted with particle lters, charcoal lters, and UV lters. Larvae were kept in small plastic tubs with change of fresh water every second day. Larvae were fed Artemia daily, whereas juvenile and adult animals were fed sh pellets. Transgenic axolotls were generated as described (Khattak et al., 2009; Sobkow et al., 2006). Briey, one-cell-stage embryos were collected and manually dejellied and kept at 4 C until injections were performed. Plasmids that harbored SceI meganuclease target sites anking the expression cassette were coinjected with the SceI meganuclease enzyme (New England Biolabs). Although the SceI meganuclease increased efciency of transgenesis as previously described, it was not absolutely necessary for generation of transgenics. Swimming larvae were anesthetized in 0.01% ethyl-p-aminobenzoate (benzocaine; Sigma-Aldrich) for screening based on uorescence and were screened on an Olympus SZX16 stereomicroscope. Selected embryos were raised for sexual maturity (males 79 months and females 1215 months) and mated with nontransgenic white animals to check for germline transmission. The vectors used to generate transgenic axolotls are described in Table 1.
Distal Limb Blastema Transplantation

Blastema donors (56-cm axolotls) were double transgenics of the genotype: Car Act:EGFP; CAGGs:nucCherry. Recipients were their nontransgenic white siblings. Donors were amputated through the forearm wrist. Nine days later, recipients were amputated through the proximal half of the stylopod, and protruding bones were trimmed. Immediately, the donors wrist blastema was cut off and transferred in the same proximal-distal orientation onto the recipients stump. Animals were left asleep on a wet tissue with 0.01% benzocaine for the following 13 hr before placing them back into tap water to recover and regenerate lost limb structures.
DNA Electroporation and 4-OHT Injection

Circular Cre expression plasmid DNA (0.5 mg/ml) was electroporated in the limb and/or spinal cord as previously described (Echeverri and Tanaka, 2003; McHedlishvili et al., 2007). For 4-OHT injections, larvae were anesthetized in 0.01% benzocaine and weighed. 4-OHT (Sigma-Aldrich; catalog # H7904 or #H6278) was diluted in DMSO to obtain a stock of 10 mg/ml. Stock aliquots were stored at 80 C until use. Fast Green (Sigma-Aldrich; F7258) was added to the thawed solution just prior to injection. A total of 50 mg/g body weight of 4-OHT was injected intraperitoneally in the ventral trunk. After injection, larvae were covered with a blanket of wet tissue for hydration for 2030 min at room temperature until returning them to tap water.
Generation of AxSox2:Cre-ERT2 Transgenic Animals

An Ambystoma mexicanum (axolotl) lambda genomic library (Stratagene) was expanded in the lab using the manufacturers protocol. Axolotl Sox2 gene-specic primers were designed to screen the primary, secondary, and tertiary pools of the library as described by Israel (1993) with minor modications. Briey, the 440 pools (50,000 clones each) were screened by PCR, but no colony hybridization was done, rather the tertiary pools were further diluted down to isolate a single positive plaque. The isolated axolotl genomic DNA was recombined into a plasmid backbone, and the resulting plasmid was subjected to a second step of recombineering where the Sox2 open reading frame was replaced by the Cre-ERT2-T2A-EGFP-nls gene using a liquid-recombineering protocol (Sarov et al., 2006). The resulting plasmid AxSox2:Cre-ERT2T2A-EGFP-nls was injected into one-cell-stage embryo with SceI meganuclease and allowed to develop normally. Larvae were
Immunohistochemical Analysis of Transgenic Animals

Tails and limbs of transgenic axolotl larvae were cut and xed, cryosectioned, and kept at 20 C until immunostained. The cryosections were stained with respective antibodies as previously described by Kragl et al. (2009).
Supplemental Information includes six gures and can be found with this article online at http://dx.doi.org/10.1016/j.stemcr. 2013.03.002.
Stem Cell Reports

Dunis, D.A., and Namenwirth, M. (1977). The role of grafted skin in the regeneration of x-irradiated axolotl limbs. Dev. Biol. 56, 97109. Echeverri, K., and Tanaka, E.M. (2003). Electroporation as a tool to study in vivo spinal cord regeneration. Dev. Dyn. 226, 418425. Echeverri, K., and Tanaka, E.M. (2005). Proximodistal patterning during limb regeneration. Dev. Biol. 279, 391401. Echeverri, K., Clarke, J.D., and Tanaka, E.M. (2001). In vivo imaging indicates muscle ber dedifferentiation is a major contributor to the regenerating tail blastema. Dev. Biol. 236, 151164. a-Ot n, A.L., and Guillou, F. (2006). Mammalian genome tarGarc geting using site-specic recombinases. Front. Biosci. 11, 1108 1136. Glaser, T., Perez-Bouza, A., Klein, K., and Brustle, O. (2005). Generation of puried oligodendrocyte progenitors from embryonic stem cells. FASEB J. 19, 112114. Habermann, B., Bebin, A.G., Herklotz, S., Volkmer, M., Eckelt, K., Pehlke, K., Epperlein, H.H., Schackert, H.K., Wiebe, G., and Tanaka, E.M. (2004). An Ambystoma mexicanum EST sequencing project: analysis of 17,352 expressed sequence tags from embryonic and regenerating blastema cDNA libraries. Genome Biol. 5, R67. Hayashi, T., Yokotani, N., Tane, S., Matsumoto, A., Myouga, A., Okamoto, M., and Takeuchi, T. (2013). Molecular genetic system for regenerative studies using newts. Dev. Growth Differ. 55, 229236. Israel, D.I. (1993). A PCR-based method for high stringency screening of DNA libraries. Nucleic Acids Res. 21, 26272631. Iten, L.E., and Bryant, S.V. (1975). The interaction between the blastema and stump in the establishment of the anteriorposterior and proximaldistal organization of the limb regenerate. Dev. Biol. 44, 119147. Kawakami, Y., Rodriguez Esteban, C., Raya, M., Kawakami, H., Marti, M., Dubova, I., and Izpisua Belmonte, J.C. (2006). Wnt/beta-catenin signaling regulates vertebrate limb regeneration. Genes Dev. 20, 32323237. Kerney, R., Hall, B.K., and Hanken, J. (2010). Regulatory elements of Xenopus col2a1 drive cartilaginous gene expression in transgenic frogs. Int. J. Dev. Biol. 54, 141150. Khattak, S., Richter, T., and Tanaka, E.M. (2009). Generation of transgenic axolotls (Ambystoma mexicanum). Cold Spring Harb. Protoc. 2009, pdb prot5264. Kragl, M., Knapp, D., Nacu, E., Khattak, S., Maden, M., Epperlein, H.H., and Tanaka, E.M. (2009). Cells keep a memory of their tissue origin during axolotl limb regeneration. Nature 460, 6065. Kumar, A., and Brockes, J.P. (2012). Nerve dependence in tissue, organ, and appendage regeneration. Trends Neurosci. 35, 691699. Kumar, A., Godwin, J.W., Gates, P.B., Garza-Garcia, A.A., and Brockes, J.P. (2007). Molecular basis for the nerve dependence of limb regeneration in an adult vertebrate. Science 318, 772777. Li, M., Pevny, L., Lovell-Badge, R., and Smith, A. (1998). Generation of puried neural precursors from embryonic stem cells by lineage selection. Curr. Biol. 8, 971974. Mallo, M. (2006). Controlled gene activation and inactivation in the mouse. Front. Biosci. 11, 313327.
ACKNOWLEDGMENTS
We gratefully acknowledge the dedicated animal care of Heino gel, Christa Junghans, and Andreas, Jitka Michling, Sabine Mo Beate Gruhl. We thank Jessica Whitehead for ert-cre-ert construct and Andrea Meinhardt for help in confocal microscopy. This work was supported by grants from the DFG (TA274/2 [Collaborative Research Center 655] and TA274/3 and TA274/4 [SPP1365]), HFSP, Volkswagen Foundation, Central funds from the Max Planck Institute of Molecular Cell Biology and Genetics, the DFG Research Center for Regenerative Therapies, and the Technical University Dresden to E.M.T. S.L.H. was supported by a Postdoctoral Research Fellowship from the Alexander von Humboldt Foundation. S.K. and E.M.T. designed and analyzed most of the experiments. M.S. and T.R. generated transgenic animals. S.K., T.R., K.H., and R.K. generated constructs. S.K., D.K., S.L.H., A.D., and T.S.-G. contributed regeneration experiments with transgenic animals. S.K. and E.M.T. wrote the manuscript. Received: January 29, 2013 Revised: February 16, 2013 Accepted: February 18, 2013 Published: June 4, 2013
REFERENCES
Anastassiadis, K., Rostovskaya, M., Lubitz, S., Weidlich, S., and Stewart, A.F. (2010). Precise conditional immortalization of mouse cells using tetracycline-regulated SV40 large T-antigen. Genesis 48, 220232. Attardo, A., Calegari, F., Haubensak, W., Wilsch-Brauninger, M., and Huttner, W.B. (2008). Live imaging at the onset of cortical neurogenesis reveals differential appearance of the neuronal phenotype in apical versus basal progenitor progeny. PLoS One 3, e2388. Bryant, S.V., and Iten, L.E. (1977). Intercalary and supernumerary regeneration in regenerating the mature limbs of Notophthalmus viridescens. J. Exp. Zool. 202, 116. Casanova, E., Lemberger, T., Fehsenfeld, S., Mantamadiotis, T., and Schutz, G. (2003). Alpha complementation in the Cre recombinase enzyme. Genesis 37, 2529. Casco-Robles, M.M., Yamada, S., Miura, T., and Chiba, C. (2010). Simple and efcient transgenesis with I-SceI meganuclease in the newt, Cynops pyrrhogaster. Dev. Dyn. 239, 32753284. Dent, J.N. (1962). Limb regeneration in larvae and metamorphosing individuals of the South African clawed toad. J. Morphol. 110, 6177.
Stem Cell Reports

McGuire, S.E., Le, P.T., Osborn, A.J., Matsumoto, K., and Davis, R.L. (2003). Spatiotemporal rescue of memory dysfunction in Drosophila. Science 302, 17651768. McHedlishvili, L., Epperlein, H.H., Telzerow, A., and Tanaka, E.M. (2007). A clonal analysis of neural progenitors during axolotl spinal cord regeneration reveals evidence for both spatially restricted and multipotent progenitors. Development 134, 20832093. McHedlishvili, L., Mazurov, V., Grassme, K.S., Goehler, K., Robl, B., Tazaki, A., Roensch, K., Duemmler, A., and Tanaka, E.M. (2012). Reconstitution of the central and peripheral nervous system during salamander tail regeneration. Proc. Natl. Acad. Sci. USA 109, E2258E2266. Mercader, N., Tanaka, E.M., and Torres, M. (2005). Proximodistal identity during vertebrate limb regeneration is regulated by Meis homeodomain proteins. Development 132, 41314142. Metzger, D., and Chambon, P. (2001). Site- and time-specic gene targeting in the mouse. Methods 24, 7180. Monaghan, J.R., Epp, L.G., Putta, S., Page, R.B., Walker, J.A., Beachy, C.K., Zhu, W., Pao, G.M., Verma, I.M., Hunter, T., et al. (2009). Microarray and cDNA sequence analysis of transcription during nerve-dependent limb regeneration. BMC Biol. 7, 1. Morrison, J.I., Borg, P., and Simon, A. (2010). Plasticity and recovery of skeletal muscle satellite cells during limb regeneration. FASEB J. 24, 750756. Mullen, L.M., Bryant, S.V., Torok, M.A., Blumberg, B., and Gardiner, D.M. (1996). Nerve dependency of regeneration: the role of Distal-less and FGF signaling in amphibian limb regeneration. Development 122, 34873497. Muneoka, K., Fox, W.F., and Bryant, S.V. (1986). Cellular contribution from dermis and cartilage to the regenerating limb blastema in axolotls. Dev. Biol. 116, 256260. Nacu, E., and Tanaka, E.M. (2011). Limb regeneration: a new development? Annu. Rev. Cell Dev. Biol. 27, 409440. Nacu, E., Glausch, M., Le, H.Q., Damanik, F.F., Schuez, M., Knapp, D., Khattak, S., Richter, T., and Tanaka, E.M. (2013). Connective tissue cells, but not muscle cells, are involved in establishing the proximo-distal outcome of limb regeneration in the axolotl. Development 140, 513518. Ogino, H., McConnell, W.B., and Grainger, R.M. (2006). Highthroughput transgenesis in Xenopus using I-SceI meganuclease. Nat. Protoc. 1, 17031710. Pajcini, K.V., Corbel, S.Y., Sage, J., Pomerantz, J.H., and Blau, H.M. (2010). Transient inactivation of Rb and ARF yields regenerative cells from postmitotic mammalian muscle. Cell Stem Cell 7, 198213. Pavlopoulos, A., and Akam, M. (2011). Hox gene Ultrabithorax regulates distinct sets of target genes at successive stages of Drosophila haltere morphogenesis. Proc. Natl. Acad. Sci. USA 108, 28552860. Pescitelli, M.J., Jr., and Stocum, D.L. (1980). The origin of skeletal structures during intercalary regeneration of larval Ambystoma limbs. Dev. Biol. 79, 255275. Putta, S., Smith, J.J., Walker, J.A., Rondet, M., Weisrock, D.W., Monaghan, J., Samuels, A.K., Kump, K., King, D.C., Maness, N.J., et al.
(2004). From biomedicine to natural history research: EST resources for ambystomatid salamanders. BMC Genomics 5, 54. Roy, S., Gardiner, D.M., and Bryant, S.V. (2000). Vaccinia as a tool for functional analysis in regenerating limbs: ectopic expression of Shh. Dev. Biol. 218, 199205. Sarov, M., Schneider, S., Pozniakovski, A., Roguev, A., Ernst, S., Zhang, Y., Hyman, A.A., and Stewart, A.F. (2006). A recombineering pipeline for functional genomics applied to Caenorhabditis elegans. Nat. Methods 3, 839844. Smith, J.J., Putta, S., Zhu, W., Pao, G.M., Verma, I.M., Hunter, T., Bryant, S.V., Gardiner, D.M., Harkins, T.T., and Voss, S.R. (2009). Genic regions of a large salamander genome contain long introns and novel genes. BMC Genomics 10, 19. Sobkow, L., Epperlein, H.H., Herklotz, S., Straube, W.L., and Tanaka, E.M. (2006). A germline GFP transgenic axolotl and its use to track cell fate: dual origin of the n mesenchyme during development and the fate of blood cells during regeneration. Dev. Biol. 290, 386397. Sordino, P., van der Hoeven, F., and Duboule, D. (1995). Hox gene expression in teleost ns and the origin of vertebrate digits. Nature 375, 678681. Steen, T.P. (1968). Stability of chondrocyte differentiation and contribution of muscle to cartilage during limb regeneration in the axolotl (Siredon mexicanum). J. Exp. Zool. 167, 4978. Stocum, D.L. (1975). Regulation after proximal or distal transposition of limb regeneration blastemas and determination of the proximal boundary of the regenerate. Dev. Biol. 45, 112136. Stocum, D.L., and Cameron, J.A. (2011). Looking proximally and distally: 100 years of limb regeneration and beyond. Dev. Dyn. 240, 943968. Suzuki, K.T., Kashiwagi, K., Ujihara, M., Marukane, T., Tazaki, A., Watanabe, K., Mizuno, N., Ueda, Y., Kondoh, H., Kashiwagi, A., et al. (2010). Characterization of a novel type I keratin gene and generation of transgenic lines with uorescent reporter genes driven by its promoter/enhancer in Xenopus laevis. Dev. Dyn. 239, 3172 3181. Urlinger, S., Baron, U., Thellmann, M., Hasan, M.T., Bujard, H., and Hillen, W. (2000). Exploring the sequence space for tetracyclinedependent transcriptional activators: novel mutations yield expanded range and sensitivity. Proc. Natl. Acad. Sci. USA 97, 79637968. Verrou, C., Zhang, Y., Zurn, C., Schamel, W.W., and Reth, M. (1999). Comparison of the tamoxifen regulated chimeric Cre recombinases MerCreMer and CreMer. Biol. Chem. 380, 1435 1438. Wallace, B.M., and Wallace, H. (1973). Participation of grafted nerves in amphibian limb regeneration. J. Embryol. Exp. Morphol. 29, 559570. Whited, J.L., Lehoczky, J.A., and Tabin, C.J. (2012). Inducible genetic system for the axolotl. Proc. Natl. Acad. Sci. USA 109, 1366213667. Whited, J.L., Tsai, S.L., Beier, K.T., White, J.N., Piekarski, N., Hanken, J., Cepko, C.L., and Tabin, C.J. (2013). Pseudotyped retroviruses for infecting axolotl in vivo and in vitro. Development 140, 11371146.
Stem Cell Reports

Yakushiji, N., Yokoyama, H., and Tamura, K. (2009). Repatterning in amphibian limb regeneration: a model for study of genetic and epigenetic control of organ regeneration. Semin. Cell Dev. Biol. 20, 565574. Zappone, M.V., Galli, R., Catena, R., Meani, N., De Biasi, S., Mattei, E., Tiveron, C., Vescovi, A.L., Lovell-Badge, R., Ottolenghi, S., et al. (2000). Sox2 regulatory sequences direct expression of a (beta)-geo
transgene to telencephalic neural stem cells and precursors of the mouse embryo, revealing regionalization of gene expression in CNS stem cells. Development 127, 23672382. Zhang, Y., Riesterer, C., Ayrall, A.M., Sablitzky, F., Littlewood, T.D., and Reth, M. (1996). Inducible site-directed recombination in mouse embryonic stem cells. Nucleic Acids Res. 24, 543548.

VL 1 NB 1

Transféré par

Informations du document

Description originale:

Titre original

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

VL 1 NB 1

Transféré par

Droits d'auteur :

Formats disponibles

Stem Cell Reports

Editorial Welcome to Stem Cell Repor ts

Stem Cell Reports j Vol. 1 j 12 j June 4, 2013 j 2013 The Authors 1

Stem Cell Reports

Christine Mummery, Ph.D.

Yvonne Fischer, Ph.D.

2 Stem Cell Reports j Vol. 1 j 12 j June 4, 2013 j 2013 The Authors

Stem Cell Reports

Stem Cell Reports j Vol. 1 j 34 j June 4, 2013 j 2013 The Authors 3

Stem Cell Reports

4 Stem Cell Reports j Vol. 1 j 34 j June 4, 2013 j 2013 The Authors

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

Image Capture and Analysis

Stem Cell Reports

Stem Cell Reports

Stem Cell Reports

RESULTS AND DISCUSSION

Stem Cell Reports

Normal mammary tissue

Single cell dissociation

CFC assay ~10 days

Fix, stain & score Luminal colony

6 R = 0.75 P < 0.0001 4 4 6 8 10 12

Telomere length - TRF (kb)

ladder HT1080 EEC TC EEC TC BC LP LC SC BC LP LC SC BC LP LC SC

Unstained LP Stained LP Thymocytes

100 e of maximum Percentage

2.4 2.0 0 1.5 100 0 100 0 100 % Maximum BC 1.0 LP

200 BC mean 6.3 kb LP mean 3.4 kb 150

Telomere length (kb)

Telomere length h (kb)

Telomere fluourescene units (x1000)

Stem Cell Reports

Stem Cell Reports

0.08 0.06 0.04 0.02 0.00

0.8 0.6 0.4 0.2 0.0

1.5 1.0 0.5 0.0

0.08 0.06 0.04 0.02 0.00 BC LP DNA-PK

8.0 6.0 4.0 2.0 0.0 BC LP P53

4.0 3.0 2.0 1.0 0.0 BC LP PML

2.0 1.5 1.0 0.5 0.0

2.5 2.0 1.5 1.0 0.5 0.0

1.0 0.8 0.6 0.4 0.2 0.0