Vous êtes sur la page 1sur 270

UAS - DGE P

Primer semestre
8
a
edicin
Biologa bsica. Primer ao
Diseo de portada:
Joao Enrique Pea de Lima
Diseo de interiores:
Irn Ubaldo Seplveda Len
Correccin de estlo y cuidado de edicin:
Juana Mara Alvarez Vega
1
a
edicin, 2003.
2
a
edicin, 2005.
3
a
edicin, 2006.
4
a
edicin, 2007.
5
a
edicin, 2009.
6
a
reimpresin, 2010.
7
a
reimpresin, 2011.
8
a
edicin, 2012.
Universidad Autnoma de Sinaloa
Direccin General de Escuelas Preparatorias
Academia Estatal de Biologa
Circuito interior oriente s/n
Ciudad Universitaria,
Culiacn Rosales, Sinaloa, Mxico. C.P. 80010
Tel: 667 -712-16-56, Fax 7 12-16-53; ext. 111.
Prohibida la reproduccin total o parcial de esta obra,
por cualquier medio sin autorizacin escrita de los autores.
Edicin con fnes acadmicos, no lucratvos.
7
Presentacin
L
a edicin de este libro Biologa bsica forma parte del programa de apoyo bibliogrfco
que la Direccin General de Escuelas Preparatorias de la Universidad Autnoma de Sinaloa
ha implementado en la idea de lograr avances signifcatvos en los programas de estudios
correspondientes. Es una herramienta fundamental para el estudio de la asignatura de biologa
de nuestros alumnos y, adems, una gua para el maestro.
En la unidad I, de manera resumida hemos expuesto un poco de la historia del pensamiento
biolgico, concretando los antecedentes del mecanicismo (o fsicismo) y su exponente ms
conocido: Ren Descartes, quien sostena que los organismos vivos no eran diferentes de la
materia inanimada. El bando contrario, el vitalismo, corriente del pensamiento de la poca del
siglo XIX, argumentaba que los conceptos biolgicos y teoras acerca de los seres vivos no se
podan reducir a las leyes de la fsica y de la qumica. Ya en el siglo XX se tuvieron que conjugar
estos principios en una nueva corriente del pensamiento biolgico, el organicismo, actual teora
explicatva de los fenmenos biolgicos.
Siguiendo las refexiones acerca de los organismos vivos, revisamos las caracterstcas que
distnguen a la vida, partendo de la consideracin de que los organismos vivos son sistemas
ordenados jerrquicamente con numerosas propiedades emergentes que no se observan en
el mundo inanimado, y que sus actvidades estn gobernadas por programas gentcos que
contenen informacin adquirida a lo largo del tempo.
La biologa es una ciencia equiparable a las ciencias fsicas, basadas en la observacin,
experimentacin y prueba de hiptesis, acorde a las propuestas del mtodo cientfco aceptado
universalmente. Este tema se aborda al fnal de la primera unidad.
En la unidad II revisamos de manera general que las propiedades y estructuras aparentemente
nicas de la materia viva se pueden explicar en trminos de las propiedades de las macromolculas
y su organizacin. Estos tpos de molculas responsables del desarrollo y funcionamiento de los
organismos vivos (cidos nucleicos, pptdos, enzimas, hormonas y componentes de membranas)
son macromolculas que no existen en la materia no viva.
Uno de los instrumentos que tuvo gran impacto en el desarrollo del conocimiento biolgico
es el microscopio, que cada vez ms perfeccionado ha permitdo el desarrollo de nuevas
disciplinas biolgicas, como es el caso del estudio de la clula, disciplina conocida bajo el
nombre de citologa. En el desarrollo de la citologa han partcipado por igual estudiosos tanto
de plantas como de animales o de cualquier otro reino de la naturaleza. As, por ejemplo,
el botnico Robert Brown descubri el ncleo de la clula; el zologo Schwann, junto con
el botnico Schleiden, propuso la teora celular, que pronto fue corregida y ampliada por el
mdico Virchow. Estos y otros hallazgos los veremos en la unidad III, dedicada al estudio de la
clula, la unidad de la vida.
8
Un paradigma
*
histrico, el descubrimiento de las leyes de la herencia por parte de un maestro
de la asignatura de ciencias en el bachillerato de la Universidad de Viena, Gregorio Mendel,
es uno de los ejemplos ms claros del rigor del mtodo cientfco. Mendel formul hiptesis
a partr de sus observaciones, examin su consistencia con resultados previos, comprobando
experimentalmente sus dos principios conocidos como Ley de la segregacin y Ley de la
distribucin independiente, tal como se presenta en la unidad IV.
El origen evolutvo de los organismos es hoy una conclusin cientfca establecida; es decir, es
un hecho aceptado por lo bilogos y por todas las personas bien informadas en este tema. Charles
Darwin, el fundador de la teora moderna de la evolucin, acumul evidencias para convencer a
los cientfcos del siglo XIX de que los seres vivos son descendientes modifcados de antepasados
comunes. Poco despus de que Darwin presentara su teora, y todava a principios del siglo XX, los
evolucionistas se dedicaban a buscar evidencias a favor y en contra de la evolucin. Actualmente,
los estudiosos de la evolucin tenen como objeto de estudio determinar las causas y la historia
de la evolucin. En la unidad V veremos el estado actual de los conocimientos acerca del hecho y
las causas de la evolucin.
El texto inicia con una evaluacin diagnstca donde se revisarn los conocimientos previos
que se considera deben de poseer los alumnos al inicio del curso.
Tambin cada unidad cuenta a su trmino con una autoevaluacin cuyo fn es refejar el avance
logrado por el estudiante. Es importante que los alumnos comparen y discutan sus respuestas.
Al fnal del texto se presenta una serie de diez sencillas actvidades de laboratorio cuya
realizacin es bsica ya que complementan el conocimiento de los temas biolgicos aqui tratados.
Esperamos que el libro sea una herramienta muy tl, tanto para los estudiantes como para
los profesores, durante el desarrollo del curso.
Los autores
*
Concepto que explica un conjunto de fenmenos.
9
CONTENIDO
Presentacin 7
Evaluacin diagnstca 17
UNIDAD 1. Introduccin a la biologa 25
Por qu estudiar biologa? 25
Caracterstcas y propiedades de los seres vivos 26
Organizacin compleja 28
Obtencin y transformacin de materia y energa (metabolismo) 28
Autorregulacin (homeostasis) 30
Crecimiento y desarrollo 30
Capacidad de responder a estmulos 31
Reproduccin (autorreplicacin) 32
Adaptacin y evolucin 33
Niveles de organizacin de los seres vivos 34
Organizacin a nivel del organismo 34
Organizacin ecolgica 35
Diversidad de los organismos 35
Reino Eubacteria 38
Reino Archaebacteria 38
Reino Protsta 38
Reino Fungi 38
Reino Plantae 39
Reino Animalia 39
Mtodo cientfco 39
El conocimiento como proceso 39
El conocimiento cientfco y sus caracterstcas 41
Autoevaluacin 43
UNIDAD 2. Molculas de inters biolgico 49
Introduccin 49
Elementos biolgicamente importantes 50
Molculas inorgnicas y orgnicas 50
Molculas inorgnicas 52
Minerales 52
Gases 52
Agua 52
9
10
C UAS
Ionizacin del agua: cidos y bases 54
Escala de pH 55
Molculas orgnicas 56
Carbohidratos 57
Monosacridos 57
Disacridos 58
Polisacridos 59
Lpidos 60
Grasas y aceites 61
Fosfolpidos 61
Ceras 62
Esteroides 62
Protenas 63
cidos Nucleicos 65
Autoevalucin 67
UNIDAD 3. La clula: unidad de la vida 73
Introduccin 73
Teora celular 74
Concepto de clula 76
El microscopio 76
El microscopio compuesto 77
El microscopio electrnico 78
Los tpos de clulas: procariotas y eucariotas 79
La clula procariota 80
La clula eucariota 81
Forma y tamao de las clulas 83
Forma de la clula 84
Tamao de las clulas 86
La estructura y funcin celular 87
La membrana plasmtca 87
Movimiento de las sustancias a travs de la membrana celular 89
Transporte pasivo 89
La difusin 89
Difusin simple 90
smosis 90
Difusin facilitada 92
Transporte actvo 93
Transporte mediado por vesculas: endocitosis y exocitosis 94
UAS
11
C DGEP
El ncleo 95
La envoltura nuclear 96
El nucleoplasma 96
El nuclolo 96
La cromatna (cromosomas) 96
Organelos celulares 98
El retculo endoplsmico (RE) 98
Los ribosomas 98
El aparato de Golgi 99
Los lisosomas 100
Las vacuolas 101
Las mitocondrias 102
Respiracin celular 103
Fermentacin 105
Trifostato de adenosina (ATP) 106
El citoesqueleto 107
Los centrolos y cuerpos basales 108
Los cilios y fagelos 108
Pared celular 109
La pared celular vegetal 109
Los plstdos o plastos 111
Cloroplastos 111
Cromoplastos 111
Leucoplastos 112
Fotosntesis 112
La luz 113
La clorofla y otros pigmentos 113
Las etapas de la fotosntesis 114
Reacciones dependientes de la luz 114
Reacciones independientes de la luz 114
Ciclo celular: divisin y muerte de las clulas 115
El ciclo celular 116
Haploida y diploida 117
Mitosis 118
Fases de la mitosis 118
Profase 118
Metafase 119
Anafase 119
Co:vioo
11
12
C UAS
Telofase 120
Citocinesis 120
Apoptosis 122
Meiosis 122
Fases de la meiosis 122
Meiosis I 123
Meiosis II 124
Diferencias entre mitosis y meiosis 125
La meiosis en la especie humana 126
Autoevalucin 128
UNIDAD 4. Gentca: la ciencia de la herencia 135
Introduccin 135
Gregorio Mendel. Padre de la gentca 135
Las investgaciones de Mendel 136
Objetvos de Mendel 136
Experimentos de Mendel 136
Observaciones de Mendel 138
Hiptesis de Mendel 139
Gentca moderna 140
Leyes de Mendel 140
Ley de la segregacin 141
Ley de la distribucin independiente 141
Genotpo y fenotpo 141
Probabilidad y gentca 142
Cuadro de Punnet 144
Cruce monohbrido 144
Cruce dihbrido 145
Mecanismos de herencia no mendelianos 146
Dominancia incompleta 146
Codominancia 147
Herencia polignica 147
Alelos mltples 147
Genes y cromosomas 148
Cromosomas y recombinacin 148
La teora cromosmica de la herencia 148
Genes ligados 149
Recombinacin gentca 149
13
C DGEP
Experimentos de Morgan 150
Cromosomas y determinacin del sexo 152
Determinacin del sexo 152
Caracterstcas limitadas por el sexo 153
Caracterstcas infuenciadas por el sexo 153
Mutaciones cromosmicas 154
cidos nucleicos: ADN y ARN 156
El material hereditario 156
El proceso de transformacin 156
ADN, el factor transformante 157
ADN y virus bacterianos 157
ADN: Estructura y replicacin 158
Estudios de rayos x. 158
Estructura del ADN 158
El modelo de la doble hlice 160
Rplica del ADN 161
ADN y protenas 162
ARN: Estructura y transcripcin 162
Transcripcin 163
Cdigo gentco 164
Sntesis de protenas 165
Mutaciones gnicas 167
Tipos de mutaciones gnicas 167
Supresin y adicin 167
Susttucin de un par de bases 167
El cncer y las sustancias que lo producen 168
Algunas aplicaciones de la gentca 168
Mejoramiento de razas y variedades 168
Ingeniera gentca 170
Transferencia de genes 170
Aplicaciones en la agricultura 171
Aplicacin en la industria 171
Aplicaciones en la medicina 172
Organismos transgnicos 172
Clonacin 173
Terapia gnica 174
Estudio de la herencia 176
rbol genealgico 176
Co:vioo
14
C UAS
Cariotpo 177
Tcnicas moleculares. El proyecto genoma humano 177
Autoevalucin 179
UNIDAD 5. Evolucin orgnica 185
Introduccin 185
Historia de la vida 186
Hiptesis de la generacin espontnea 186
Desacuerdos con la generacin espontnea 186
El experimento de Luis Pasteur 187
Origen de la vida 188
Formacin de la Tierra 188
Atmsfera primitva 189
Origen de las primeras clulas 189
Sntesis de molculas orgnicas 190
Experimentos que apoyan la teora de Oparin-Haldane 190
Polimerizacin 191
Membranas y protoclulas 192
Herencia y replicacin 192
Primeras formas de vida 192
Primeros hetertrofos 192
Respiracin aerbica 193
Eucariotes 195
Evolucin de la vida multcelular 195
Teora de la evolucin 196
Hiptesis de Lamarck 196
El viaje de Darwin 198
Teora de Darwin 200
Seleccin natural 201
Alfred Russel Wallace 202
Mecanismos de seleccin natural 202
Fuentes de variacin 203
Seleccin y nicho 203
Pruebas de la evolucin 204
El registro fsil 204
Determinacin de la edad de los fsiles 206
Evidencias en los organismos actuales 208
Anatoma comparada 209
15
C DGEP
Embriologa comparada 210
Bioqumica comparada 211
Especiacin 212
Aislamiento 212
Radiacin adaptatva 212
Evolucin convergente 213
Evolucin humana 214
Primates 214
Evolucin de los primates 215
Prosimios 215
Antropoides 216
Primeros homnidos 217
Australopithecus 217
Homo habilis 220
Homo erectus 220
Homo sapiens 221
Neanderthal 221
Cro-magnon 222
Autoevalucin 224
Gua didctca 228
La didctca en la actvidade experimental de biologa 231
La seguridad en el laboratorio 234
Orientaciones para el laboratorista sobre las actvidades 235
Actvidades de laboratorio 236
Actvidad 1. Conocimiento del microscopio ptco compuesto 236
Actvidad 2. Cuidado y uso del microscopio 239
Actvidad 3. Los seis reinos 241
Actvidad 4. Identfcacin de carbohidratos, lpidos y protenas 244
Actvidad 5. smosis en papas 246
Actvidad 6. Clula animal y clula vegetal 248
Actvidad 7. Mitosis e interfase 251
Actvidad 8. Herencia humana 253
Actvidad 9. Cariotpo humano 258
Actvidad 10. Genes y relaciones evolutvas 262
Bibliografa 267
Procedencia de las ilustraciones 269
15
Co:vioo DGEP
17
Acovri ov nioiooI DGEP
Completa correctamente los siguientes enunciados
1. Son los seis elementos qumicos formadores de los seres vivos, requeridos en mayor
cantdad ____________, ____________, ____________, ____________, ____________
y ____________.
2. Son los reinos de la naturaleza:_______________, _______________, ________________,
_______________, _______________ y _______________.

3. La ___________________________ es la unidad anatmica, fsiolgica y de origen de los
seres vivos.
4. En las clulas ______________________ el adn est disperso en el citoplasma ya que no
poseen membrana nuclear.
5. La ________________ es el proceso que realizan los cloroplastos para elaborar el alimento
de las plantas y liberar oxigeno.
6. Principales diferencias estructurales entre la clula vegetal y la animal.
_______________________________________________________________
7. El ____________________, ____________________y la ____________________ son
polisacridos formados por la unin de muchas molculas de glucosa.
8. Las protenas son biomolculas consttuidas por la unin de ____________________.
9. La rama de la biologa que estudia la herencia es ______________________.
10. Los cidos nucleicos son ____________________ y el ____________________.
11. Nmero total de cromosomas de la especie humana: ___________________.
12. En los cromosomas se encuentran los ___________________ que son los que determinan
las caracterstcas que tendr un organismo.
Evaluacin diagnstca
18
Eviuci oios:ic UAS
Correlaciona las columnas:
Subraya la respuesta correcta:
1. Cul de las siguientes son caracterstcas de los seres vivos?
a) Son complejos y organizados
b) Responden a estmulos
c) Se reproducen
d) Todas las anteriores
2. Regula los intercambios de sustancias entre la clula y el medio que la rodea:
a) Pared celular
b) Membrana plasmtca
c) Aparato de Golgi
d) Mitocondrias
3. Estructuras alargadas que contenen la informacin gentca.
a) Ribosomas b) Lisosomas
c) Cromosomas d) Vacuolas
4. Las clulas necesitan energa para realizar sus funciones. Para obtenerla las clulas respiran
y lo hacen mediante sus:
a) Cloroplastos b) Mitocondrias
c) Retculos endoplsmicos d) Ribosomas
Biomolculas que son el principal combustble de las clulas.
Son las molculas de la informacin.
Son molculas de usos mltples (estructural, enzimtco,
antcuerpos, etc.)
Son molculas de reserva energtca, son ejemplos los aceites
y las grasas.
En la molcula de adn, la citosina se une a la
Son partculas formadas por protenas y cidos nucleicos,
responsables de la infuenza, viruela, etc.
Son las protenas que regulan las reacciones qumicas en las
clulas.
Molcula que est presente en la mayora de las reacciones
qumicas de la clula y es el medio de eliminacin de los
productos de desecho del organismo.
Mineral que fortalece los huesos y los dientes.
1. Agua
2. Calcio
3. Carbohidratos
4. cidos nucleicos
5. Adenina
6. Enzimas
7. Virus
8. Guanina
9. Lpidos
10. Protenas
( )
( )
( )
( )
( )
( )
( )
( )
( )
19
Acovri ov nioiooI DGEP
5. El cuerpo de las plantas y animales est organizado por niveles, ordenados de menor a
mayor complejidad son:
a) rgano, tejido, clula y sistema b) Tejido, sistema, clula y rgano
c) Clula, tejido, rgano y sistema d) Tejido, clula, rgano y sistema
6. Proceso por el cual una clula se divide en dos clulas hijas con el mismo nmero de
cromosomas.
a) Mitosis b) Meiosis
c) Organognesis d) Partenognesis
7. Cul de los siguientes es una fsil?
a) Un tronco petrifcado b) Un mamut congelado
c) Un insecto atrapado en mbar d) Todas las anteriores
8. Cul es la era geolgica actual?
a) Mesozoica b) Paleozoica
c) Cenozoica d) Arqueozoica
9. Autor de la teora de la evolucin por seleccin natural.
a) Charles Lyell b) Charles Darwin
c) Thomas Malthus d) Lamarck
10. El siguiente esquema nos representa la divisin celular conocida como:
a) Mitosis b) Meiosis
c) Metafase d) Reproduccin asexual
20
Eviuci oios:ic UAS
A contnuacin se te muestran algunos esquemas y una lista de sus posibles nombres.
Identfcalos: molcula de agua, virus, estoma, ncleo, mitocondria, cromosoma, molcula de
adn, membrana celular, clula en metafase, cloroplasto y aparato de Golgi.
O
H
H
21
Acovri ov nioiooI DGEP
Rotula la fgura sealando los siguientes organelos: membrana plasmtca, aparato de Golgi,
retculo endoplsmico rugoso, retculo endoplsmico liso, ribosomas, mitocondria, membrana
nuclear, lisosoma, cromatna, citoplasma y centrolos.
Nota: Algunos ejercicios de la evaluacin diagnstca fueron tomados y otros fueron adaptados de los siguientes libros: Martnez,
M., Corts L. y Lujan, E. Maravillas de la Biologia 2, McGraw-Hill, Mxico, 2006. Miller, K. y Levine, J. Biologa 1. La naturaleza de
la vida. Pearson educacion, Mxico, 2007.
La jirafa es un mamfero africano que actualmente se le en-
cuentra en casi todos los zoolgicos del mundo. Su largo
cuello le sirve para ramonear el follaje a bastante altura.
UNIDAD
1
I
n
t
r
o
d
u
c
c
i

n

a

l
a

b
i
o
l
o
g

a
25
Introduccin a la biologa
Por qu estudiar biologa?
De manera muy general, podemos decir que existe una razn que domina sobre todas las dems:
Conocernos mejor a nosotros mismos y conocer ms al mundo en que vivimos.
La biologa, como ya sabemos consiste en el estudio integral de los seres vivos. A nivel social,
el grado de conocimiento de los seres vivos y sus manifestaciones es un indicador del avance
de la poblacin humana. Los saberes acerca de los seres vivos y su diversidad es fundamental
para el desarrollo de cualquier cultura. Siempre hemos querido saber acerca de los seres vi-
vos que pueden ser fuente de alimento o fuente de medicamentos o de qu organismos nos
tenemos que cuidar pues pueden causarnos algn dao o enfermedad. Es una preocupacin
actual el saber cmo estamos interaccionando nosotros como especie humana con el resto de
los seres vivos; cmo est infuyendo el ser humano en las poblaciones vegetales, animales y
microscpicas, y en general, con el medio ambiente.
Nuestra moderna civilizacin es posible debido a nuestro progresivo conocimiento de la
materia viva. Por ejemplo, los conocimientos sobre la gentca pueden ser usados para in-
crementar el aprovisionamiento mundial de alimentos de origen vegetal y animal al llevarse
a cabo el mejoramiento de variedades de plantas alimentcias y de ganadera. El estudio de
la clula (estructura y funcin) nos lleva a importantes avances en la medicina al desarrollar
nuevos frmacos que nos ayudan a enfrentar las enfermedades que han sido o son azote de la
humanidad. El conocimiento de la biologa es tambin fundamental para entender las preocu-
paciones y controversias de actualidad acerca del crecimiento poblacional, las epidemias mo-
dernas como el sida, as como las promesas y riesgos que conlleva proyectos como el del ge-
noma humano. Los aspectos sobre el medio ambiente, estudiados por la ecologa nos ayudan
a conocer las causas que actualmente daan nuestro mundo y asi poder tomar las medidas
necesarias para su conservacin.
Deberamos tambin anotar que ciertas carreras profesionales productvas y retributvas
pueden edifcarse sobre el conocimiento de la biologa. Los laboratorios de las universidades
siempre demandan ms hombres y mujeres para realizar nuevos descubrimientos. Tambin
se necesitan profesionales que apliquen sus conocimientos de biologa en actvidades como la
medicina, la investgacin agrcola y el desarrollo industrial. Se contnuarn necesitando profe-
sores de biologa que transmitan a las nuevas generaciones el conocimiento adquirido por las
precedentes.
Todo ciudadano podr partcipar ms efectvamente en una democracia siempre y cuando
pueda pronunciarse y votar inteligentemente sobre cuestones que impliquen tanto principios
biolgicos como el bienestar humano y esto slo lo lograr al tener una serie de conocimientos,
U 1
26
UAS
entre otros, de tpo biolgico. El uso de aditvos ali-
mentcios, drogas, insectcidas, radiacin, tcnicas de
ingeniera gentca y medidas de control de la pobla-
cin, son justamente algunos de los diversos medios
por los cuales nuestras vidas pueden ser modifcadas
por el nivel de conocimiento biolgico. El modo en
que se haga uso de este conocimiento, ya sea para
incrementar o disminuir el valor de nuestras vidas, lo
pueden decidir nicamente ciudadanos bien informa-
dos. Hay una riqueza cultural en el conocimiento de
la biologa.
Caracterstcas y propiedades de los seres vivos
Qu es la vida y cmo se pueden explicar los procesos vitales han sido temas de acaloradas con-
troversias desde hace ms de 500 aos. El intento de explicar la naturaleza de eso que llamamos
vida ha sido uno de los principales objetvos de la biologa. Sin embargo, cuando nos referimos
a la vida, ms bien nos estamos refriendo al proceso de vivir, que es lo que s se puede estudiar
cientfcamente. Se puede describir lo que es vivir, se puede defnir lo que es un organismo vivo,
y se puede intentar establecer una diferencia entre lo vivo y lo no vivo; pero para los estudiosos
de siglos anteriores esto no fue nada fcil porque haba ideas encontradas. De un lado exista
un bando que afrmaba que, en realidad, los organismos vivos no eran diferentes de la materia
inanimada; a estas personas se les llam mecanicistas. El flsofo francs Ren Descartes (1596-
1650) fue un destacado defensor de este punto de vista. Esta concepcin acerca de los seres vivos
pronto fue llamada fsicismo dado que sus defensores eran ms bien fsicos que mecnicos. Del
otro lado estaban los vitalistas, que aseguraban que los organismos tenan propiedades que no
existan en la materia inerte, y que , por lo tanto, las teoras y conceptos biolgicos no se podan
reducir a las leyes de la fsica y de la qumica. A fnales del siglo XIX, el principal vitalista era Luis
Pasteur. Quines tenan la razn?
De manera muy clara con respecto a este tema, el bilogo evolutvo de origen alemn Ernst
Mayr nos dice que ambos bandos tenan algo de razn y que, en parte, ambos se equivocaban.
Los mecanicistas o fsicistas estaban en lo correcto al decir que no existe una fuerza vital como
componente de la vida, y que, a nivel molecular, la vida se puede explicar segn los principios de
Hay consenso entre las comunidades cientfcas
de que toda persona que tenga una preparacin
educatva mnima deber estar familiarizada con
los conceptos biolgicos bsicos: evolucin, he-
rencia, biodiversidad y los peligros que enfrenta,
reproduccin y salud reproductva, competencia,
extncin, adaptacin y contaminacin.
Figura 1.1 Un eclogo realizando trabajo de
campo en este caso mide una for de Rafesia.
I:vooucci i nioiooI
27
DGEP
la fsica y de la qumica. Por su parte, los vitalistas tenan
razn al afrmar que, a pesar de todo, los organismos no
son como la materia inerte, sino que poseen numerosas
caracterstcas propias, especialmente sus programas ge-
ntcos, adquiridos a lo largo del tempo, los cuales no se
han encontrado en la materia inanimada. Los organismos
son sistemas ordenados a muchos niveles, muy diferen-
tes a todo lo que conocemos en el mundo inanimado.
En el ltmo siglo, ha quedado claro que deben reto-
marse los principios vlidos del fsicismo y del vitalismo,
conformando una nueva corriente de pensamiento flo-
sfco acerca de la vida y el vivir que se conoce como
organicismo.
Las funciones de los organismos vivos a nivel molecular obedecen a las leyes de la fsica y
la qumica. Sin embargo, los organismos son diferentes de la materia inerte. Son sistemas orde-
nados jerrquicamente, con nuevas propiedades que no se han observado nunca en la materia
inanimada.
Los organismos vivos presentan una serie de propiedades que les conferen ciertas cualida-
des, conocidas como caracterstcas, que defnitvamente no existen en los sistemas inanimados
y que, de acuerdo con Audesirk-Audesirk y Mayr, podemos describirlas. Estas son:
1. Los seres vivos tenen una estructura organizada compleja.
2. Los seres vivos tenen la capacidad de adquirir energa y materiales del exterior y los trans-
forman.
3. Los seres vivos tenen capacidad de autorregulacin.
4. Los seres vivos tenen capacidad de crecer y desarrollarse, siguiendo un programa gentco.
5. Los seres vivos tenen capacidad de responder a estmulos del medio ambiente.
6. Los seres vivos se reproducen utlizando una huella molecular llamada adn.
7. Los seres vivos, tomados como un todo, tenen capacidad de evolucionar.
Veamos estas caracterstcas con un poco de detalle:
El organicismo es el nuevo sistema explicatvo o pa-
radigma biolgico que domina desde 1930. Este nos
dice que los procesos a nivel molecular se pueden ex-
plicar perfectamente por mecanismos fsicoqumicos,
pero que dichos mecanismos tenen una infuencia
menor en los niveles superiores de integracin bio-
lgica. Las caracterstcas exclusivas de los seres vivos
no se deben a su composicin, sino a su organizacin.
De ah el origen de la palabra organicismo.
Figura 1.2 Luis Pasteur (1822-1895), qumi-
co y bilogo francs, famoso por sus inves-
tgaciones sobre la causa y prevencin de
enfermedades del gnero humano y de
los animales y por sus estudios sobre la
generacin espontnea y la fermentacin.
U 1
28
UAS
Organizacin compleja
Cada funcin o proceso que realizan los organismos vivos es vi-
tal para su existencia. Todas las funciones interactan unas con
otras para crear un singular y ordenado sistema viviente. Toda
funcin vital tene su explicacin en la estructura y funciona-
miento de la clula. Por eso, la unidad de organizacin de los
seres vivos es la clula, cuyas propiedades estn sustentadas en
funcin de sus componentes responsables del desarrollo y fun-
cionamiento de los seres vivos: cidos nucleicos, aminocidos,
enzimas, hormonas y los componentes membranosos que son
macromolculas que estn ausentes en la naturaleza no viva.
Cada tpo de organismo se identfca por su aspecto y
forma caracterstcos. Los adultos de cada especie tenen su
propio tamao, en tanto las cosas sin vida generalmente pre-
sentan formas y tamaos muy variables.
La clula es la parte ms simple de la materia viva ca-
paz de realizar todas las actvidades necesarias para la vida.
Algunos de los organismos ms simples, como las bacterias,
son unicelulares; es decir, constan de una sola clula. Por el
contrario, el cuerpo de un ser humano o el de un rbol como
el roble estn formados por miles de millones de clulas; en
estos organismos pluricelulares complejos, los procesos del
organismo entero dependen del funcionamiento coordinado
de las clulas que lo consttuyen.
Obtencin y transformacin de materia y energa (metabolismo)
Las sustancias que se incorporan a un organismo ingresan a una red de reacciones qumicas en las
que se degradan o se utlizan para la construccin de compuestos ms complejos. Los organismos
necesitan materiales y energa para mantener su alto grado de complejidad y organizacin, para
crecer y reproducirse. Los tomos y las molculas de los cuales todos los organismos estn for-
Los organismos vivos son sistemas complejos y ordenados jerrquicamente. Hoy sa-
bemos que las cualidades de cualquier sistema vivo no son la mera suma de sus com-
ponentes, sino que, en cada nivel de integracin superior, surgen o emergen nuevas
propiedades que no se haban podido predecir por muy bien que se conocieran los
componentes del nivel inferior. A estas nuevas propiedades se les conoce como emer-
gentes.
Figura 1.3 Los seres vivos estn
altamente organizados. Cada es-
tructura dentro de las clulas
desarrolla funciones especfcas.
La estructura esqueltca de esta
esponja marina muestra una com-
pleja organizacin.
Un rasgo fundamental que caracteriza a la vida es el hecho de que los seres vivos intercam-
bian sustancias y energa con el medio externo, es decir, funcionan como un sistema abierto.
I:vooucci i nioiooI
29
DGEP
clorofla
luz solar
mados, pueden obtenerse del aire, el agua, el suelo, o a partr
de los mismos seres vivos. Toman estos materiales y energa del
exterior y los transforman en molculas propias. Estas transfor-
maciones implican reacciones de tpo qumico que son necesarias
para sostener las actvidades vitales. A la suma de todas las reaccio-
nes qumicas se le conoce como metabolismo.
El intercambio y las transformaciones de materia y energa pueden
encontrarse tambin en el mundo inanimado. Sin embargo, hay una dife-
rencia fundamental: en los seres vivos, los cientos de miles de reacciones
qumicas que se producen son coordinadas en el tempo y en el espacio
en forma ordenada y siguiendo las instrucciones del material gentco.
En todos los seres vivos ocurren reacciones qumicas que
son esenciales para la nutricin, el crecimiento y la reparacin
de las clulas, as como para la conversin de la energa en for-
mas utlizables. Las reacciones metablicas ocurren de manera
contnua en todo ser vivo; en el momento en que se suspen-
den se considera que el organismo ha muerto.
El anabolismo incluye reacciones qumicas de construccin,
es decir, que de la unin de molculas sencillas se obtenen mo-
lculas complejas. En esta fase, al fusionarse las molculas, se
forman entre ellas enlaces qumicos, de manera que en dichas
reacciones se acumula energa.
El catabolismo incluye las reacciones de desdoblamiento
o degradacin de molculas complejas a molculas simples, que implica ruptura de enlaces y
liberacin de energa, que ser almacenada en las molculas de atp para ser utlizadas en las
funciones celulares.
A manera de ejemplo, veremos el metabolismo de los carbohidratos, primero su fase anablica
de construccin (fotosntesis) y despus su fase catablica o de degradacin (respiracin celular).
En la fotosntesis se construyen molculas de azcares y en ellas se acumula la energa lu-
minosa absorbida del Sol. La fotosntesis es un proceso complejo que implica una serie de reac-
ciones qumicas, que se resumen en una sola reaccin general, donde se tenen los reactvos
iniciales y los productos fnales.
6 CO
2
+ 6 H
2
0 C
6
H
12
O
6
+ 6 0
2
bixido + agua glucosa + oxgeno
de carbono
En la respiracin celular, los azcares son degradados hasta bixido de carbono y agua en
un proceso en el que se libera energa para sintetzar molculas de atp.
C
6
H
12
0
6
+ 6 0
2
6 C0
2
+ 6 H
2
0

+

energa
glucosa + oxgeno bixido + agua
de carbono
Figura 1.4 Todos los organismos
usan energa para el manteni-
miento de las estructuras celula-
res y para el crecimiento. El Sol
es la fuente de energa para casi
todos los organismos, ya que
proporciona la energa necesa-
ria para que las plantas realicen
la fotosntesis y puedan elaborar
los alimentos que los animales
requieren.
U 1
30
UAS
Autorregulacin (homeostasis)
Todos los organismos necesitan mantener su ambiente interno relatvamente estable, an cuan-
do las condiciones externas cambien en forma drstca. Esta condicin se llama homeostasis.
La regulacin de la temperatura corporal en el ser
humano es un ejemplo de mecanismo homeosttco.
Cuando la temperatura del cuerpo se eleva por arriba
de su nivel normal de 37
o
C, la temperatura de la san-
gre es detectada por clulas cerebrales especiales que
funcionan como un termostato. Dichas clulas envan
impulsos nerviosos hacia las glndulas sudorparas
para incrementar la secrecin de sudor; la evaporacin
del sudor que humedece la superfcie del cuerpo redu-
ce la temperatura corporal. Otros impulsos nerviosos
provocan la dilatacin de los capilares sanguneos de la
piel haciendo que sta se sonroje. El aumento del fujo
sanguneo en la piel lleva ms calor hasta la superfcie
corporal para que, desde ah, se disipe por radiacin.
Cuando la temperatura del cuerpo desciende por
debajo de su nivel normal, el cerebro inicia una serie de
impulsos que constrien los vasos sanguneos de la piel
reduciendo as la prdida de calor a travs de la super-
fcie. Si la temperatura corporal desciende an ms, el
cerebro empieza a enviar impulsos nerviosos hasta los
msculos, estmulando las rpidas contracciones mus-
culares conocidas como escalofros, un proceso que te-
ne como resultado la generacin de calor.
Crecimiento y desarrollo
Los organismos en general, atraviesan un ciclo vital en el cual crecen y se desarrollan. Tal ca-
racterstca se da en todo tpo de organismos, incluso en los microscpicos, pero donde es muy
clara es en los organismos superiores que inician su vida con un tamao muy pequeo y durante
su ciclo de vida su crecimiento es muy evidente. Es de notarse que el desarrollo se da junto con
el crecimiento, pues no es slo aumento de volumen, sino de cambios en las formas de la apa-
riencia corporal o estados mucho ms drstcos como la metamorfosis de una mariposa o una
rana. En cualquier caso, este proceso involucra la sntesis de macromolculas especfcas, que
est a cargo de la informacin gentca. El desarrollo abarca todos los cambios que se producen
durante la vida de un organismo.
Los seres vivos se caracterizan por poseer toda clase de mecanismos de control y regula-
cin, incluyendo mltples mecanismos de retroalimentacin que mantenen al organismo
en un estado estacionario. Esto, defnitvamente, no se encuentra en la materia inanimada.
Figura 1.5 La sudoracin es un ejemplo de
homeostasis. Cmo reduce el sudor la tem-
peratura corporal?
I:vooucci i nioiooI
31
DGEP
Quizs alguien
pudiera decir que en
la materia inanimada
tambin hay creci-
miento. Por ejemplo,
se forman cristales
en una solucin so-
bresaturada de una
sal; conforme ms
sal va saliendo de la
solucin, los cristales
crecen ms y ms.
No obstante, ese
proceso no es creci-
miento en el sentdo
biolgico. Los bilo-
gos restringen el tr-
mino crecimiento, a los procesos que incrementan la cantdad de sustancia viva en el organismo.
El crecimiento, por tanto, es un aumento en la masa celular como resultado de un incremento del
tamao de las clulas individuales, del nmero de clulas o de ambos. El crecimiento puede ser
uniforme en las diversas partes de un organismo, o mayor en unas partes que en otras, de modo
que las proporciones corporales cambian conforme ocurre el desarrollo.
Algunos organismos, por ejemplo, la mayora de los rboles, siguen creciendo indefnida-
mente. Muchos animales tenen un perodo defnido de crecimiento, el cual termina cuando se
alcanza el tamao caracterstco del adulto. Otro aspecto del proceso de crecimiento es que cada
parte del organismo sigue funcionando conforme ste crece.
Capacidad de responder a estmulos
Los animales han desarrollado durante su proceso evolutvo rganos sensoriales y sistemas mus-
culares que les permiten identfcar y responder a estmulos fsicos y qumicos externos e inter-
nos. Los estmulos que pueden producir una respuesta en casi todas las plantas y animales, son
cambios de color, intensidad o direccin de la luz, variacin de temperatura, presin o sonido y
cambios de la composicin qumica de la terra, el agua o el aire a su alrededor.
En el ser humano y otros animales superiores, algunas clulas del cuerpo estn muy especia-
lizadas y responden a ciertos tpos de estmulos: los bastones y conos de la retna (membrana del
ojo) responden a la luz, algunas clulas de la nariz y las clulas gustatvas de la lengua a estmulos
qumicos, y las clulas especiales de la piel, a cambios de temperatura o presin. En animales in-
feriores y plantas, pueden faltar estas clulas especializadas, pero el organismo entero responde
al calor o fro, a algunas sustancias qumicas o a la luz, acercndose o alejndose.
Figura 1.6 Los organismos crecen y se desarrollan. Observa la diferencia de tamao
y aspecto corporal entre el rinoceronte pequeo y el adulto. El rinoceronte pequeo
va a crecer aumentando su nmero de clulas y parte de su desarrollo incluye el
crecimiento de sus dos cuernos.
Los seres vivos tenen la capacidad de identfcar y responder a los estmulos
que reciben en su medio ambiente, ya sea interno y externo.
U 1
32
UAS
Los animales no son los nicos organismos que reciben y res-
ponden a estmulos. Los vegetales reaccionan a la luz, la gravedad,
el agua y otros estmulos, principalmente por crecimiento de las
diferentes partes de su cuerpo. El tallo de las plantas se curva hacia
la luz, las races crecen hacia abajo y las hojas se pliegan o langui-
decen durante la noche. Unas cuantas plantas como la atrapamoscas venus, son partcularmente
sensibles a los estmulos tctles y pueden capturar insectos. Otro caso es el de la planta Mimosa
pudica, que en nuestra regin se le conoce como cuca. Se identfca porque al ser tocada con la
mano, rapidamente cierra sus hojas (fgura 1.7).
Reproduccin (autorreplicacin)
Los procesos para generar descendientes son variados,
pero los resultados son los mismos. La diversidad de la
vida sucede, en parte, porque los descendientes, aun-
que provienen del material gentco proporcionado por
los padres, por lo general, son algo diferentes. Los me-
canismos por medio de los cuales los rasgos pasan de
una generacin a la siguiente, valindose de una huella
gentca, contenida en molculas de adn, produce estos
descendientes variables.
Una de las caracterstcas ms sorprendentes de los
seres vivos es su capacidad de autorreproducirse,
de transmitr informacin gentca a su descenden-
cia y as generar nuevos seres vivos con sus mismas
caracterstcas. Sin esta capacidad, los seres vivos
no podran persistr en el tempo, generacin tras
generacin.
Figura 1.8 Los seres vivos se reproducen y al
hacerlo aseguran la supervivencia de la es-
pecie. Qu tpo de reproduccin presentan
los pinginos?
Figura 1.7 Todos los organismos responden a los estmulos fsicos y qumicos del
ambiente. Las plantas pueden responder a la direccin de la luz solar, creciendo
hacia la direccin de los rayos luminosos. En todos los reinos tambin es notoria la
respuesta a los estmulos.
I:vooucci i nioiooI
33
DGEP
Se conocen dos tpos de reproduccin asexual y sexual. En la reproduccin asexual siempre
partcipa un solo progenitor, el cual se divide, germina o fragmenta para formar dos o ms descen-
dientes. La reproduccin sexual requiere de la partcipacin de clulas reproductoras llamadas ga-
metos. El gameto femenino es el vulo y el masculino el espermatozoide; el vulo y el espermato-
zoide se unen formando una clula llamada cigoto a partr de la cual se formar un nuevo individuo.
Adaptacin y evolucin
La composicin gentca de un
individuo es prctcamente la
misma durante su ciclo de vida,
pero la composicin gentca
de la poblacin de individuos
de la misma especie cambia a
lo largo de muchas generacio-
nes, es decir, evoluciona. La
fuerza ms importante en la
evolucin es la seleccin natural, proceso mediante el cual los organismos que poseen rasgos
que les ayudan a adaptarse a las condiciones de su medio, sobreviven y se reproducen ms sats-
factoriamente que otros que carecen de tales rasgos. Los rasgos adaptatvos que surgen de una
mutacin gentca que incrementa la supervivencia pasan a la siguiente generacin.
La capacidad de una especie de adaptarse a su ambiente es la caracterstca que le permite
sobrevivir en un mundo en constante cambio. Las adaptaciones son cambios que incrementan
la capacidad del organismo de sobrevivir en un ambiente determinado. Dichas adaptaciones
Los organismos son el pro-
ducto de 3 mil 800 millones
de aos de evolucin. Todas
sus caracterstcas refejan
esta historia. El desarrollo,
el comportamiento y todas
las dems actvidades de
los organismos vivos estn
controlados, en parte, por
programas gentcos que
son el resultado de la acu-
mulacin de informacin a
lo largo de la vida. Los orga-
nismos vivos son sistemas
adaptados como resultado
de la seleccin natural a la
que se vieron sometdos en
incontables generaciones
anteriores.
Figura 1.9 A los largo de generaciones, los grupos de organismos evolu-
cionan o cambian con el tempo. Por ejemplo, los caballos evolucionaron
de ser pequeos ramoneadores en reas boscosas hasta ser pastoreado-
res de las planicies. Los tres cambios principales fueron tamao, anato-
ma de la pata y de los dientes.

p
o
c
a
E
o
c
e
n
o
O
l
i
g
o
c
e
n
o
M
i
o
c
e
n
o
P
o
l
i
o
c
e
n
o
P
l
e
i
s
t
o
c
e
n
o

y

R
e
c
i
e
n
t
e
Ramoneo
Pastoreo
Diente
Pata
delantera
Hyracotherium(Eohippus)
Paleotheres
Mesohippus
R
a
m
o
n
e
o
Merychippus
Archaeochippus
Anchitherium
P
a
s
t
o
r
e
o
Pliohippus Hipparion
Nannipus
Equus Hippidion
Stylohipparion
U 1
34
UAS
pueden ser estructurales, fsiolgicas o conductuales, o una combinacin de ellas. El largo cue-
llo de las jirafas es una adaptacin para alcanzar las hojas de los rboles, y el grueso pelaje de
los osos polares es una adaptacin para sobrevivir en las temperaturas congelantes.
La adaptacin puede incluir cambios inmediatos que dependen de la irritabilidad de las c-
lulas, o ser el resultado de fenmenos de seleccin y mutacin a largo plazo. Salta a la vista que
ningn organismo puede adaptarse a todos los tpos concebibles de medio ambiente.
Las plantas recurren a adaptaciones muy ingeniosas para racionar su provisin de agua en
las zonas o pocas de sequa. Tratan de retener en el interior la mayor cantdad de agua posible y
para ello reducen cuanto pueden la superfcie de transpiracin: tenen hojas pequeas o incluso
carecen de ellas.
Sin embargo, las plantas que tenen que luchar ms intensamente contra la sequedad del cli-
ma son las plantas de zonas desrtcas. All donde la lluvia se reduce a unos escasos y breves agua-
ceros, los nopales desarrollan unos tallos carnosos en forma de palas; como si fueran esponjas,
absorben y guardan una provisin de agua, de la cual habrn de mantenerse durante varios meses.
Niveles de organizacin de los seres vivos
Las propiedades de una molcula compleja dependen de la organizacin de los tomos que la
consttuyen. De igual modo, las propiedades de una clula dependen de la organizacin de las
molculas que la consttuyen, y las propiedades de un organismo multcelular dependen de la or-
ganizacin de las clulas de su cuerpo. El ltmo nivel de organizacin biolgica, la bisfera, resul-
ta de las interacciones recprocas entre arqueobacterias, eubacterias, protstas, hongos, plantas y
animales y de sus interrelaciones con los factores fsicos del ambiente.
Al estudiar las interacciones que ocurren dentro de los grupos de organismos, y entre un gru-
po y otro, es posible detectar una jerarqua de complejidad cada vez mayor. Observa los diversos
niveles de organizacin de los seres vivos en la fgura 1.10.
Organizacin a nivel del organismo
De acuerdo con Helena Curts y colaboradores, el primer nivel de organizacin con el cual los
bilogos habitualmente se relacionan es el subatmico: las partculas (protones, neutrones y
electrones), se organizan para formar el siguiente nivel, que es el tomo. La organizacin de los
tomos en molculas representa un nuevo nivel que contene los anteriores.
Un ejemplo de esto fue mencionado por el cientfco Niels Bohr: a temperaturas normales,
el oxgeno y el hidrgeno son gases, y el agua que est compuesta por estos dos elementos, es
lquida con propiedades muy distntas de cada uno de estos gases.
Existen muchas molculas diversas que pueden asociarse entre s para formar estructuras
complejas y altamente especializadas a las que se denomina organelos. Son ejemplos de ellos
Aunque cada nivel est formado por componentes del nivel precedente, la nueva organi-
zacin de los componentes en un nivel dado da como resultado la aparicin de propieda-
des nuevas que son muy diferentes de las del nivel anterior.
I:vooucci i nioiooI
35
DGEP
la membrana plasmtca que rodea a la clula y el ncleo, que contene el material heredita-
rio. En un nuevo nivel de organizacin, surge la propiedad ms notable de todas: la vida, en la
forma de una clula. La clula en s es la unidad bsica estructural y funcional de la vida. Cada
clula est formada por un citoplasma gelatnoso, rodeado por una membrana celular.
Otras propiedades surgen cuando las clulas individuales y especializadas se organizan en un
nivel todava superior: en un organismo multcelular. Las clulas diferenciadas y especializadas
pueden organizarse consttuyendo tejidos. Segn el tpo de clulas que los formen y la manera
en que se organicen, los tejidos pueden consttuir rganos como el hgado, el estmago o el ce-
rebro. Este ltmo consttuido por tejido nervioso, tejido conectvo y sangre. Varios rganos que
en conjunto realizan una sola funcin forman un sistema de rganos; por ejemplo, el cerebro,
la mdula espinal, los rganos de los sentdos y los nervios forman juntos el sistema nervioso.
Todos los sistemas de rganos funcionan coordinadamente consttuyendo un ser vivo individual,
el organismo.
Organizacin ecolgica
Ms all de los organismos individuales, existen niveles ms amplios de organizacin. Un grupo
de organismos muy parecidos que potencialmente se entrecruzan, consttuyen una especie. A
los miembros de una misma especie que viven en un rea determinada se les considera una
poblacin. El ambiente ocupado por un organismo o poblacin se conoce como su hbitat. Las
poblaciones de diversas especies que viven en una regin determinada y que interactan entre s
forman una comunidad. Una comunidad puede estar formada por centenares de tpos diferentes
de formas de vida. Una comunidad ms el medio no viviente, que comprende el suelo, el agua y la
atmsfera, consttuyen un ecosistema. Toda la superfcie de la Tierra que est habitada por seres
vivos recibe el nombre de bisfera.
Diversidad de los organismos
Uno de los aspectos ms impresionantes del mundo vivo es su diversidad. En las poblaciones
con reproduccin sexual, no existen dos individuos idntcos; tampoco existen dos poblaciones
o dos especies idntcas. Cuando observamos a la naturaleza vemos muchos casos, pero cada
uno es nico.
Nuestro conocimiento de la diversidad de la vida, nos dice Ernst Mayr, ha ido creciendo du-
rante los ltmos trescientos aos. Comenz con los viajes de exploracin y el trabajo de explo-
radores a ttulo individual, cuyas observaciones y colecciones revelaron diferencias en las faunas
y foras de todo nuevo contnente e isla que se exploraba. Vino a contnuacin el estudio de los
organismos marinos y de agua dulce, incluyendo los de las profundidades ocenicas. La investga-
cin de los animales y plantas microscpicas, parsitos y restos fsiles, y por ltmo, el descubri-
miento de bacterias, revel las verdaderas dimensiones de la diversidad de formas biolgicas en
la Tierra. La evolucin ha hecho que surja esta variedad asombrosa.
Segn la investgadora, Lynn Margulis de la Universidad de Massachusets, se estma nuestra
diversidad biolgica en cuando menos 3 millones de especies distntas de seres vivos, aun cuando
se pueda decir que el nmero de estos pueda llegar hasta 30 millones de especies.
U 1
36
UAS
Figura 1.10 Organizacin biolgica. En todo sistema vivo, en los niveles de integracin superiores emergen nuevas
propiedades que no existen en los componentes inferiores. Los sistemas vivos tenen bases qumicas, pero la cua-
lidad de vida por s misma surge en el nivel celular. Las interaciones entre los componentes de cada nivel y de los
niveles debajo de l, permiten el desarrollo del siguiente nivel de organizacin.
Bisfera
La parte de la Tierra habitada por seres
vivos; incluye los componentes tanto
vivos como no vivos
Ecosistema
Una comunidad, junto con su ambiente
inanimado
Comunidad
Dos o ms poblaciones de diferentes
especies que viven e interactan en la
misma rea
Poblacin
Miembros de una especie que habitan
en la misma rea
Especie
Organismos muy similares que, en po-
tencia pueden cruzarse
Organismo
multicelular
Ser vivo individual formado de muchas
clulas
Sistema de
rganos
Dos o ms rganos que actan juntos
para realizar una funcin corporal es-
pecfca
rgano
Una estructura normalmente compues-
ta por varios tipos de tejidos que for-
man una unidad funcional
Tejido
Grupo de clulas similares que desem-
pean una funcin especfca
Clula La unidad ms pequea de vida
Organelo
Estructura dentro de una clula que
desempea una funcin especfca
Molcula Una combinacin de tomos
tomo
Partcula
subatmica
La partcula ms pequea de un
elemento que conserva las propiedades
de dicho elemento
Partculas que constituyen un tomo
O
Superfcie de la Tierra
riachuelo, vbora, antlope, halcn, arbustos, pasto, piedras
vbora, antlope, halcn, arbustos, pasto
rebao de antlopes amricanos
antlope amricano
el sistema nervioso
cerebro
tejido nervioso
clula nerviosa
H H
mitocondria
cloroplasto ncleo
agua
glucosa ADN
hidrgeno
carbono
nitrgeno oxgeno
protn neutrn electrn
I:vooucci i nioiooI
37
DGEP
Durante siglos, los naturalistas se han interesado en darle un orden al estudio de tantas
especies de seres vivos. Este trabajo se reconoce como abrumador y todos los intentos han
llegado a establecer rdenes jerrquicos; para aclarar un poco esto ltmo, revisemos lo si-
guiente:
En la vida cotdiana hay una gran cantdad de cosas muy diferentes con las que slo po-
demos tratar clasifcndolas. Las clasifcaciones sirven para ordenar instrumentos, medicinas,
obras de arte, pero tambin nos sirven para ordenar ideas, conceptos y hasta teoras. Para
ordenar, agrupamos los objetos en clases segn sus atributos comunes, de esta manera, se ha
llegado a formar verdaderos sistemas de agrupacin de la vasta diversidad de formas vivien-
tes.
La unidad bsica en que los bilogos se han puesto de acuerdo para clasifcar los organismos
es la especie. Resulta difcil dar una defnicin del trmino que sea igualmente aplicable a todo
el mundo vivo, pero defniremos la especie, en general, como un grupo de individuos semejan-
tes entre s, parecidos en sus caracteres estructurales y funcionales, que en la naturaleza puede
entrecruzarse libremente y producir descendientes frtles.
Las especies ntmamente emparentadas se agrupan para formar la siguiente unidad de cla-
sifcacin, el gnero. Cada organismo recibe un nombre cientfco formado por dos palabras, el
gnero y la especie, en latn. Por ejemplo, el nombre cientfco del encino blanco americano es
Quercus alba. Otro rbol, el sauce blanco, Salix alba, pertenece a un gnero diferente. El nombre
cientfco del ser humano es Homo sapiens.
En el siglo XVIII y con la publicacin del Sistema Natural de Carlos Linneo, slo se recono-
can dos grandes grupos de seres vivos: el de las plantas y el de los animales. Con el desarrollo
del microscopio se descubri una gran cantdad de microorganismos y su clasifcacin se haca
obligatoria. Ernst Haeckel propuso, a fnales del siglo XIX, la construccin de un tercer reino,
el de los Protstas, consttuido por los microorganismos. Haeckel reconoci, adems, que al-
gunos microorganismos carecan de ncleo celular y los denomin Monera. Posteriormente,
las bacterias fueron reconocidas, en 1956, por Herbert Copeland como un reino aparte de los
protstas, el Monera. En 1969, R. H. Whitaker propuso una clasifcacin de cinco reinos con-
siderando a los hongos (setas, mohos, y levaduras) como un quinto reino nuevo y aparte que
le llam Fungi. El criterio para sacarlos del reino vegetal es claro, pues los hongos no son fo-
tosinttcos y absorben sustancias orgnicas producidas por otros organismos. As se estable-
ci el sistema de los cinco reinos, a saber, Monera (bacterias), Protsta (protozoarios), Fungi
(hongos), Plantae y Animalia. Posteriormente, en 1978, Witaker y Margulis propusieron una
modifcacin conservando el nmero de reinos e incluyendo dentro del grupo protsta a todo
tpo de algas.
En 1977 Carl Woese y colaboradores, encontraron a partr del estudio comparatvo de las se-
cuencias de bases de genes, que existen dos grupos fundamentalmente distntos de bacterias:
arqueobacterias y eubacterias. En la actualidad muchos bilogos han aceptado dividir a los pro-
cariotas en los reinos Archaebacteria y Eubacteria, de lo que resulta un sistema de clasifcacin
de seis reinos.
Con base en diferencias moleculares entre eubacterias, arqueobacterias y eucariotas, mu-
chos investgadores taxonmicos emplean un nivel de clasifcacin superior al del reino, llamado
U 1
38
UAS
dominio. Ellos, de acuerdo a la propuesta de Carl Woese, clasifcan a los organismos en tres do-
minios, mismos que se le llama, al primero Archaea o arqueas (que corresponde exactamente
al reino de arqueobacterias), al segundo Eubacteria o eubacterias (tambin llamado Bacteria)
y al tercero Eukarya o eucarias (eucariotas). Este ltmo dominio est consttuido por los reinos
Protsta, Fungi, Plantae y Animalia.
En la actualidad la clasifcacin de organismos es un proceso en construccin y en permanen-
te cambio. Por cuestones didctcas, en el presente libro, seguiremos el esquema de los seis rei-
nos: Eubacteria, Archaebacteria, Protsta, Fungi, Plantae y Animalia. Observa la fgura 1.11 donde
se muestran algunos organismos que forman parte de estos seis reinos.
Reino Eubacteria (eubacterias)
Organismos procariotas unicelulares que forman el amplio grupo de bacterias, tradicional-
mente el ms conocido y que en aos anteriores se le llamaba Monera. Muestra una gran diver-
sidad tanto en sus medios de vida como de los tpos de metabolismo. Un primer grupo de ellas
son las hetertrofas y las encontramos casi por todas partes, pues slo necesitan molculas
orgnicas como fuente de energa y materiales. Algunas parasitan a otros seres vivos, otras se
alimentan de desechos orgnicos partcipando en la descomposicin de organismos muertos.
Un segundo grupo de eubacterias son auttrofas fotosinttcas y tenen colores como el ver-
deazul, otras son rojas y amarillas. Este tpo de bacterias cuando estn en cuerpos de agua le da
una coloracin caracterstca como es el caso de las Lagunas de Colores del Estado de Chiapas.
Un tercer grupo de eubacterias son las auttrofas quimiosinttcas. Estas bacterias obtenen
su energa de la descomposicin de sustancias inorgnicas, como los compuestos azufrados
y nitrogenados como las que convierten el nitrgeno atmosfrico en nitratos tles para las
plantas.
Reino Archaebacteria (arqueobacterias)
Organismos procariotas unicelulares donde se incluyen tres tpos de bacterias que se encuentran
principalmente en aquellos hbitats extremos en los que casi no existen otros seres vivos. Un gru-
po llamado metangenas vive en ambientes carentes de oxgeno y producen metano. Algunas de
estas arqueobacterias viven en las profundidades del ocano y en las plantas de tratamiento de
aguas negras. Un segundo grupo slo puede vivir en agua con alta concentracin de sales como
el Lago Salado en el estado americano de Utah y el Mar Muerto en el Medio Oriente, a estas bac-
terias se les llama halflas. Un tercer grupo denominado termflas viven en hbitats donde la
temperatura del agua est cerca de la ebullicin.
Reino Protsta
El reino Protsta est formado por organismos eucariotas. Algunos de sus representantes son
animaloides (protozoarios), otros son vegetaloides (algas) y otros son protstas fungoides (mu-
coides). Este reino incluye organismos unicelulares, formas coloniales y formas pluricelulares
simples.
I:vooucci i nioiooI
39
DGEP
Reino Fungi (hongos)
Todos los hongos son eucariotas hetertrofos y, con excepcin de las levaduras, son multcelula-
res. Obtenen su alimento por absorcin en vez de ingestn.
Los hongos contribuyen de manera signifcatva al equilibrio ecolgico de la bisfera, al de-
gradar los desechos y cuerpos muertos de otros organismos. Adems, entre sus aportaciones
directas al bienestar humano pueden mencionarse las de las levaduras con que se elabora el pan,
las del antbitco penicilina y, por supuesto, las de los hongos comestbles, entre los que cabe
mencionar los championes y trufas.
Reino Plantae
Las plantas son organismos eucariotas multcelulares adaptados para realizar la fotosntesis, es
decir, son auttrofos. Sus pigmentos fotosinttcos, como la clorofla, se localizan dentro de or-
ganelos llamados cloroplastos. Se incluyen en este reino a las brioftas o plantas no vasculares
(musgos, heptcas y antoceros) y las traqueoftas plantas vasculares.
Reino Animalia
Todos los animales son organismos eucariotas multcelulares y hetertrofos; obtenen sus nu-
trientes devorando otros organismos. Se reconocen diez grupos principales de animales.
Mtodo cientfco
El conocimiento como proceso
Desde que la especie humana comenz a crear cultura, es decir, a modifcar y remodelar el am-
biente que la rodeaba para sobrevivir y desarrollarse, fue necesario tambin que comprendiera
la naturaleza y los fenmenos que ocurren en ella. Actvidades que hoy resultan sencillas, como
construir la vivienda, domestcar animales, hacer producir la terra, incluso, saber qu tpo de ali-
mentos eran benfcos y cules venenosos, slo pudieron ser emprendidas despus de cuidadosas
observaciones de todo tpo: los ciclos estacionales, la duracin del da y la noche, las condiciones
de la reproduccin de los animales y vegetales, las variaciones de los climas, los tpos de suelos y su
productvidad y, en general todo tpo de conocimiento que tena que ver con las condiciones geo-
grfcas y el mismo espacio cercano y lejano del ser humano. Todo esto puede verse como parte de
un proceso de generacin y ampliacin del conocimiento que no es otra cosa que una aproximacin
a la verdad, y este paso del conocimiento a la verdad, no es uno solo, es un verdadero proceso que
muchas veces pasa por correccin de los errores derivados de interpretaciones falsas y un conoci-
miento superfcial o incompleto.
El conocimiento cientfco es uno de los modos posibles de conocimiento, quiz el ms tl
o adecuado, pero no el nico ni el nico capaz de proporcionarnos respuestas para nuestras in-
terrogantes.
U 1
40
UAS
Figura 1.11 Los seis reinos de vida en la Tierra: Archaebacteria, Eubacteria, Protsta, Fungi, Plantae y Animalia.
Orqudea
Reinos Eubacteria y Archaebacteria
alrededor de 4000
especies
Espirilos
Bacilos
Termfla
extrema
Diatomeas
Hongo de copa
Levaduras
Licopodios
Roble
Caracol
Foraminiferos
Cocos
Nostoc
Anabaena
Reino Protista
alrededor de 50 000
especies
Euglena
Volvox Amoeba
Ulva
Spirogyra
Alga roja
Radiolarios
Reino Fungi
alrededor de 100 000
especies
Bejines
Penicillium
Hongo de repisa Championes
Reino Plantae
alrededor de 265 000
especies
Trigo
Rosa
Cactus
Conferas
Diente de len
Equisetum
Ccadas
Ginkgo
Reino Animalia
alrededor de 1 000 000
de especies
Peces
Anmona
de mar
Mariposa
Tuncados
Salamandra
Cigea
Araa
Estrella
de mar
Chimpanc
Serpiente
Canguro
I:vooucci i nioiooI
41
DGEP
El conocimiento cientfco y sus caracterstcas
La ciencia es una de las actvidades que el ser humano realiza, un conjunto de acciones en-
caminadas y dirigidas hacia determinado fn, que es el de obtener un conocimiento verifcable
sobre los hechos que lo rodean.
Otras cualidades especfcas de la ciencia que permiten distnguirla del pensar cotdiano y de
otras formas de conocimiento son:
Objetvidad: se intenta obtener un conocimiento que concuerde con la realidad del obje-
to, que lo describa o explique tal cual es y no como desearamos que fuese. Lo contrario
es subjetvidad, las ideas que nacen del prejuicio, de la costumbre o la tradicin. Para
poder luchar contra la subjetvidad, es preciso que nuestros conocimientos puedan ser
verifcados por otros.
Racionalidad: la ciencia utliza la razn como arma esencial para llegar a sus resultados.
Los cientfcos trabajan en lo posible con conceptos, juicios y razonamientos, y no con las
sensaciones, imgenes o impresiones. La racionalidad aleja a la ciencia de la religin y de
todos los sistemas donde aparecen elementos no racionales o donde se apela a principios
explicatvos extra o sobrenaturales; y la separa tambin del arte, donde cumple un papel
secundario subordinado, a los sentmientos y sensaciones.
Sistematcidad: la ciencia es sistemtca, organizada en sus bsquedas y en sus resulta-
dos. Se preocupa por construir sistemas de ideas organizadas coherentemente y de incluir
todo conocimiento parcial en conjuntos ms amplios.
Generalidad: la preocupacin cientfca no es tanto ahondar y completar el conocimiento
de un solo objeto individual, sino lograr que cada conocimiento parcial sirva como puente
para alcanzar una comprensin de mayor alcance.
Falibilidad: la ciencia es uno de los pocos sistemas elaborados por el ser humano donde
se reconoce explcitamente la propia posibilidad de equivocacin, de cometer errores. En
esta conciencia de sus limitaciones es donde reside la verdadera capacidad para autoco-
rregirse y superarse.
El propsito del mtodo cientfco es establecer unos criterios confables que nos permitan
distnguir entre lo que es ciencia y el conocimiento comn.
El conocimiento cientfco se caracteriza por el mtodo adoptado y no tanto por el objeto de
estudio. As que cuando el mtodo de bsqueda del conocimiento es el hipottco-deductvo se
identfca la diferencia entre conocimiento cientfco y no cientfco.
En este mtodo se establecen una serie de condiciones y pasos que deben cubrirse en la
bsqueda de los conocimientos verdaderos. Es muy importante saber reconocer cmo hacer
para llegar a un conocimiento cercano a la realidad; "mtodo" es aquel conjunto de opera-
ciones tericas, lgico-epistemolgicas y procedimientos que permiten validar o justfcar las
teoras cientfcas.
La parte central del mtodo hipottco-deductvo reside en la posibilidad de antcipar los
conocimientos. sta es la funcin de las hiptesis formalmente deducidas de un cuerpo te-
U 1
42
UAS
rico, que posteriormente se tratarn de confrmar o refutar, precisamente con conocimientos
ms precisos.
Los conocimientos as adquiridos, que en conjunto conforman lo que llamamos ciencia, se
distnguen por ser un conjunto de conocimientos presentados mediante conceptos que luego, al
ser integrados en forma lgica, conforman las teoras o leyes. El uso de ese cuerpo de conceptos
lgicos nos llevar a encontrar nuevos conocimientos relacionados. La integracin lgica aplicada
a la totalidad de los conocimientos produce un sistema terico que supera a la suma de los cono-
cimientos aislados. Dicho sistema, a su vez, permite sacar nuevas conclusiones sobre la realidad.
ste sera el proceso y el producto del mtodo cientfco.
Podramos decir que una investgacin y, como consecuencia, un conocimiento, se considera
cientfca cuando es posible, siguiendo las reglas del mtodo, presentar los hechos en forma de
enunciados, conceptos, teoras explicatvas. Las explicaciones, enunciados, conjeturas o teoras
de carcter cientfco deben someterse a comprobacin o a demostrar su falsabilidad. Los cono-
cimientos en la ciencia o se consolidan o se reformulan.
Por lo general, los conocimientos derivados de la investgacin cientfca son aceptados por
todos, independientemente de la ideologa y de los tpos de sociedad, puesto que pueden ser
reproducidos y comprobados en cualquier lugar del mundo, es decir, tenen validez universal.
El planteamiento ms general del mtodo cientfco para cualquier estudio deber cumplir
mnimamente las siguientes fases:
1. Observar y defnir el problema a investgar.
2. Formular preguntas acerca del problema de estudio.
3. Establecer hiptesis o explicaciones fundadas y contrastables con la experiencia para dar
respuesta a las preguntas formuladas.
4. Investgacin y/o experimentacin.
5. Comprobacin de la validez de los resultados obtenidos por medio de la comparacin
o contrastacin. De esta manera se confrmar la hiptesis originalmente propuesta. En
caso de que los resultados muestren que nuestra hiptesis es incorrecta, esta deber ser
rechazada.
6. Interpretacin de los resultados, estmando que lo encontrado en un conocimiento
verdadero podr ser posteriormente confrmado o descartado a la luz de nuevos cono-
cimientos.
I:vooucci i nioiooI
43
DGEP
Autoevaluacin
Repaso de la unidad
Contesta las siguientes preguntas:
1. Cul sera para t una razn importante para estudiar biologa?
_______________________________________________________________________
_______________________________________________________________________
2. Describe el mtodo cientfco. De qu manera utlizas el mtodo cientfco en tu vida
diaria?
_______________________________________________________________________
_______________________________________________________________________
_______________________________________________________________________
3. Cuando los cientfcos comunican hallazgos nuevos, se espera que muestren sus mtodos
de investgacin y la informacin bsica, as como sus conclusiones. Por qu se considera
esencial esta comunicacin?
_______________________________________________________________________
_______________________________________________________________________
4. Por qu el trabajo de los cientfcos es tl e importante para todos nosotros?
_______________________________________________________________________
_______________________________________________________________________
Completa los espacios en blanco de los siguientes enunciados:
5. La __________________ es el mantenimiento de un ambiente interno relatvamente
constante necesario para el funcionamiento ptmo de las clulas.
6. El __________________ es el total de las reacciones qumicas que se efectan dentro de
un organismo.
7. Actualmente los seres vivos se clasifcan en seis reinos que son: __________, __________,
__________, __________, __________ y __________.
U 1
44
UAS
Indica cual de las siguientes afrmaciones son verdaderas (v) o falsas (f).
8. La clula es capaz de realizar todas las actvidades necesarias para la vida.
9. Algunos seres vivos se reproducen utlizando como huella molecular al adn.
10. Las clulas procariotas poseen ncleo celular.
11. La adaptacin es la capacidad que le permite a una especie sobrevivir en un
mundo en constante cambio.
12. Los reinos eubacteria y arqueobacteria estn consttuidos por clulas
procariotas.
13. Los organismos auttrofos no elaboran su propio alimento.
14. A las clulas procariotas, anteriormente se les clasifcaba en el reino monera.
15. Las arqueobacterias metangenas pueden vivir en agua con alta
concentracin de sales.
En la siguiente sopa de letras, localiza la respuesta de lo que se te pide:
16. Es la unidad bsica estructural y funcional de la vida.
17. Es ejemplo de hongos.
18. Fase del metabolismo que implica ruptura de enlaces en las molculas y liberacin de
energa.
19. Tipos de clulas por las que estn formados todos los animales, plantas, hongos y protstas.
20. Es la capacidad de los seres vivos de transmitr informacin gentca a su descendencia.
21. Las mitocondrias, los cloroplastos y el ncleo son ejemplos de:
22. Est formada por las poblaciones de diferentes especies que viven en una regin
determinada y que interactan entre s.
23. Reproduccin en la que partcipa un solo progenitor el cual se divide para formar dos o
ms descendientes.
24. Es un ejemplo de rgano.
C A T A B O L I S M O B
O N C E L U L A L A R U
R A O U B A E S T R G E
A B M C A B V E X U A B
Z O U A L C A X E R N A
O L N R I B D U L T E R
N I I I N D U A F E L O
A S D O V D R L U I O S
A M A T O B A C U H S I
Y O D A T A S A V E X I
D E N S I T O M E T R O
R E P R O D U C C I O N
( )
( )
( )
( )
( )
( )
( )
( )
I:vooucci i nioiooI
45
DGEP
Completa el siguiente diagrama de fujo sobre los niveles de organizacin de los seres vivos.
Aplicacin de conceptos
25. Qu les sucede a los organismos que son incapaces de adaptarse a su ambiente?
_______________________________________________________________________
26. Establece las diferencias esenciales entre vitalismo y fsicismo.
_______________________________________________________________________
_______________________________________________________________________
27. Por qu cundo hablamos de evolucin nos referimos a una poblacin y no a un individuo
en lo partcular?
_______________________________________________________________________
_______________________________________________________________________
tomos
Organelos celulares
Organismo
Los osos polares viven en el rtco, son animales solitarios cuyo principal alimen-
to son las focas. Actualmente el calentamiento global esta destruyendo su hbi-
tat natural, las gruesas capas de hielo por donde caminan se estan derritendo.
UNIDAD
2
M
o
l

c
u
l
a
s

d
e

i
n
t
e
r

s

b
i
o
l

g
i
c
o
49
Molculas de inters biolgico
Introduccin
La cualidad ms sobresaliente de los seres vivos es su complejidad y alto grado de organizacin,
ya que poseen estructuras internas que contenen muchas clases de molculas complejas. Ade-
ms, cada parte componente de la materia viva cumple una funcin determinada. Esto es vlido
para estructuras tales como la membrana, el ncleo y para compuestos qumicos conocidos como
lpidos, protenas y cidos nucleicos.
Es notable el hecho que los organismos vivos presentan la propiedad de utlizar la energa
contenida en materiales sencillos para construir y sostener sus estructuras y realizar trabajo
diverso. Sin embargo, el atributo ms extraordinario de los seres vivos es su capacidad de repro-
ducirse idntcamente.
Los organismos vivos estn consttuidos por los mismos elementos qumicos que tambien
consttuyen la materia inanimada; sin embargo, los organismos vivos poseen cualidades adicio-
nales y extraordinarias que no exhibe la materia inanimada. Cmo es que la materia viva se
diferencia de modo tan radical de la inerte? La biologa y la qumica son ciencias que se unen
cuando se estudia la estructura, funcionamiento y origen de los seres vivos, las molculas que
integran los organismos vivos no slo se rigen por principios fsicos y qumicos comunes que go-
biernan el comportamiento de la materia inanimada, sino que, adems, ejercen acciones mutuas
de acuerdo a reglas fundamentales que gobiernan la naturaleza, la funcin y las interacciones de
las molculas presentes en los organismos vivos que los dotan de la capacidad de organizarse y
replicarse a s mismos.
Revisemos algunos aspectos generales de la estructura y funcin de las molculas presentes
en la materia viva.
Primero, la mayor parte de los componentes qumicos de los organismos son molculas org-
nicas de carbono; muchas de ellas contenen tambin nitrgeno. Estos elementos no son abun-
dantes en la materia inerte y se encuentran en la atmsfera y corteza terrestre como bixido de
carbono, nitrgeno molecular, carbonatos y nitratos.
Tomando de ejemplo a una bacteria, veremos que contene un gran nmero de molculas or-
gnicas; se calcula que Escherichia coli contene alrededor de 3 mil clases diferentes de protenas
y 1000 tpos distntos de cidos nucleicos. En cambio, en el organismo humano puede haber 5
millones de protenas distntas. Ninguna de las protenas de la bacteria E. coli es idntca a alguna
protena humana, aunque algunas funcionen del mismo modo.
El estudio de la inmensa diversidad de molculas orgnicas de los organismos se puede sim-
plifcar. As, por ejemplo, las 3 mil protenas que existen en la clula de E. coli estn integradas tan
solo por 20 pequeas molculas diferentes llamadas aminocidos. Y de las 1000 o ms cidos nu-
cleicos de E. coli estn construidos a partr de slo 5 unidades estructurales diferentes llamadas
nucletdos. Estos s son idntcos en todas las especies de seres vivos. Parece probable que las
biomolculas fundamentales fueron seleccionadas en el curso de la evolucin biolgica.
Dndose por sentado que estas biomolculas sencillas son idntcas en todas las especies,
podemos deducir que todos los organismos vivos proceden de un antepasado comn.
50
U 2 UAS
Elementos biolgicamente importantes
En el mundo, toda la materia est formada a partr de 92 elementos qumicos que se encuen-
tran en forma natural. De todos estos elementos, solamente 18 son los ms comunes en los
seres vivos, dentro de los cuales, los ms abundantes en la materia viva son el carbono (C), el
hidrgeno (H), el nitrgeno (N), el oxgeno (O), el fsforo (P) y el azufre (S), ya que consttu-
yen aproximadamente 99% de todos los tejidos vivos (observa la tabla 2.1).
Otro elemento importante en la composicin de los seres vivos es el cloro (Cl). Adems,
existen varios minerales conocidos como oligoelementos, los cuales, a pesar de requerirse
en cantdades nfmas, es decir, muy pequeas, son indispensables para la vida ya que te-
nen un papel insusttuible en los procesos fsiolgicos. Muchos de ellos catalizan infnidad de
reacciones qumicas, intervienen en la sntesis de vitaminas y forman parte de la organizacin
estructural de las protenas y otros compuestos. Por ejemplo, la carencia de hierro disminuye
la formacin de la hemoglobina, la protena de los eritrocitos que se encarga de transportar el
oxgeno. Otros minerales son el yodo (I), el potasio (K), el calcio (Ca), el sodio (Na), el cromo
(Cr), el magnesio (Mg), el manganeso (Mn), el selenio (Se), el for (F), el cobre (Cu), el cinc (Zn)
y el molibdeno (Mo). En la tabla 2.2 se listan los principales elementos que consttuyen a los
seres humanos, mencionando la importancia de cada uno de ellos.
Tabla 2.1 Composicin atmica de tres organismos representatvos
Elemento Humano Alfalfa Bacteria
Carbono 19.37 % 11.34 % 12.14 %
Hidrgeno 9.31 % 8.72 % 9.94 %
Nitrgeno 5.14 % 0.83 % 3.04 %
Oxgeno 62.81 % 77.90 % 73.68 %
Fsforo 0.63 % 0.71 % 0.60 %
Azufre 0.64 % 0.10 % 0.32 %
CHNOPS
Total 97.90 % 99.60 % 99.72 %
Molculas inorgnicas y orgnicas
Desde tempos remotos los qumicos han clasifcado a las molculas en dos grandes grupos:
orgnicas e inorgnicas. Inicialmente esta clasifcacin se basaba en el origen de las molcu-
las, las inorgnicas provenan de los minerales y las orgnicas de los seres vivos, es decir, estas
ltmas eran fabricadas slo dentro de los organismos vivos. Con el paso del tempo estos
conceptos han cambiado sobre todo porque muchas molculas orgnicas son sintetzadas en
51
Moivcuis ov i:vvvs nioioico DGEP
el laboratorio. Por lo que la defnicin actual de molcula orgnica es cualquier molcula que
contenga tanto carbono como hidrgeno. La mayora de las molculas orgnicas son grandes
y con estructuras complejas como las protenas y los cidos nucleicos. Mientras que las mol-
culas inorgnicas comprenden el bixido de carbono y todas las molculas que no contenen
carbono, como el agua. Las molculas inorgnicas son menos complejas que la mayor parte de
las molculas orgnicas.
Tabla 2.2 Elementos que consttuyen el cuerpo humano
Necesario para la respiracin celular; presente en casi
todos los compuestos orgnicos. Forma parte del agua.
Consttuye el esqueleto de las molculas orgnicas; pue-
de formar cuatro enlaces con otros tantos tomos.
Presente en la mayora de los compuestos orgnicos, for-
ma parte del agua.
Componente de todas las protenas y cidos nucleicos.
Componente estructural de los huesos y dientes; impor-
tante en contraccin muscular, conduccin de impulsos
nerviosos y coagulacin de la sangre.
Componente de los cidos nucleicos; componente es-
tructural del hueso; importante en la transferencia de
energa.
Principal in positvo (catn) del interior de las clulas;
importante en el funcionamiento nervioso; afecta la con-
traccin muscular.
Componente de la mayora de las protenas.
Principal in positvo del lquido interstcial, importante
en el equilibrio hdrico del cuerpo; esencial para la con-
duccin de impulsos nerviosos.
Necesario para la sangre y los tejidos del cuerpo; forma
parte de muchas enzimas de importancia.
Principal in negatvo (anin) del lquido interstcial; im-
portante en el equilibrio hdrico.
Componente de la hemoglobina y mioglobina; forma
parte de ciertas enzimas.
Componente de las hormonas troideas.
Oxgeno O 65
Carbono C 18
Hidrgeno H 10
Nitrgeno N 3
Calcio Ca 1.5
Fsforo P 1
Potasio K 0.4
Azufre S 0.3
Sodio Na 0.2
Magnesio Mg 0.1
Cloro Cl 0.1
Hierro Fe Cantdades
traza
Yodo I Cantdades
traza
Nombre Smbolo Composicin Importancia
qumico aproximada del o funcin
cuerpo humano
Hay ciertos elementos, presentes en cantdades minsculas en el cuerpo (los oligoelementos) entre los que cabe
mencionar: manganeso (Mn), cobre (Cu), cinc (Zn), cobalto (Co), for (F), molibdeno (Mo), selenio (Se) y otros.
52
U 2 UAS
Molculas inorgnicas
En general, las molculas inorgni-
cas que forman parte de la materia
viva son los minerales slidos o en
disolucin, los gases disueltos y el
agua.
Minerales
Los minerales tenen un importante
papel en la estructura y funciona-
miento de los seres vivos. Los mi-
nerales slidos como el calcio, mag-
nesio y fsforo se encuentran en un
promedio de 1% a 5% ya sea for-
mando parte de rganos duros como huesos y dientes o como en las algas llamadas diatomeas,
cuyas paredes celulares estn formadas por slice y manganeso.
Los minerales en disolucin pueden ser metlicos o no metlicos, intervienen en muchas
funciones de las que slo mencionaremos algunas como:
Mantener el equilibrio osmtco de las clulas y establecer estados fsicos adecuados de
membranas y citoplasmas (potasio, sodio y cloro); como actvadores de enzimas de plan-
tas y animales (potasio, magnesio, calcio, etc.).
En la contraccin muscular (potasio); en la fotosntesis (principalmente: nitratos, sodio,
magnesio, manganeso, etc.); en la coagulacin de la sangre (calcio); en los fuidos del
cuerpo animal (sodio, calcio, cloro, etc.).
Para la absorcin del ferro y en la formacin de hemoglobina y citocromos (cobre ); es
necesario en la produccin de fores y semillas y en la biosntesis de hormonas vegetales
(cinc); contribuye a la prevencin de las caries (for), etc.
Gases
Los gases, componentes inorgnicos indispensables para la existencia de los seres vivos son: el
oxgeno (O
2
) y el bixido de carbono (CO
2
) que se utlizan en las funciones respiratoria y fotosn-
tesis, stos pueden estar disueltos o integrarse a los organismos.
Agua
El agua es la molcula inorgnica ms abundante en nuestro planeta ya que cubre las tres cuartas
partes de la superfcie de la Tierra. Tambin es la molcula inorgnica ms abundante en los orga-
nismos vivos ya que estn compuestos de un 60% a 95% de agua aproximadamente. Este ltmo
porcentaje lo presentan animales como las medusas y algunas plantas. Excepcionalmente puede
encontrarse en porcentajes ms bajos como en algunas semillas y esporas latentes que contenen
de 10% a 30% de agua.
Figura 2.1 El agua es la molcula ms abundante de los organis-
mos. Aqui la fotografa de una medusa, animal marino cuyo cuer-
po est consttuido por 95% de agua.
53
Moivcuis ov i:vvvs nioioico DGEP
En los seres humanos, aproximadamente 70% del peso del cuerpo est formado por agua.
En el caso de los tejidos humanos, la proporcin de agua vara entre 20% en el hueso y 85% en
las clulas cerebrales. Existe en todos los fuidos de los organismos y forma parte del citoplasma.
El agua fue y es la clave del origen y existencia de la vida en nuestro planeta, las aguas oceni-
cas contenen los componentes qumicos y condiciones adecuadas para la existencia y abundan-
cia de sta, en contraste con la escasez de seres vivos en regiones donde su existencia es mnima,
tanto que se convierten en zonas desrtcas.
El agua es esencial para que se lleve a cabo la fotosntesis, que consttuye el proceso bsico
de produccin de molculas orgnicas, ya sea para las plantas o para otros organismos que se
alimentan de ellas. Adems, el agua interviene como un reactvo o un producto en varias de las
reacciones qumicas que suceden en las clulas vivas. Por ejemplo, cuando nuestro cuerpo sinte-
tza protenas, grasas, azcares o cidos nucleicos, produce agua durante el proceso (sntesis por
deshidratacin), y cuando ingiere estas molculas orgnicas en los alimentos, el agua se utliza
en las reacciones llamadas de hidrlisis, durante las cuales estas molculas son separadas en sus
subunidades.
El agua, adems de disolver una gran cantdad de sustancias, es un importante vehculo de
transporte de stas. Por ejemplo, en el caso de los productos de desecho del metabolismo ayuda
a su eliminacin, primero de las clulas y, despus, del organismo.
Tambin el agua
acta como un lubri-
cante ya que se le halla
en los lquidos del cuer-
po dondequiera que un
rgano se frote contra
otro, as como en las
artculaciones de los
huesos.
Una molcula de
agua est consttuida
por dos tomos de hi-
drgeno y un tomo de
oxgeno que se mante-
nen unidos por enlaces
covalentes y cuya fr-
mula qumica es H
2
O.
La importancia del agua
deriva de sus propieda-
des fsicas y qumicas,
entre las que destaca la
polaridad de la molcu-
la al tener dos zonas
ligeramente positvas y
dos zonas ligeramente
negatvas (fg. 2.2).
Figura 2.2 La molcula de agua es polar, ya que presenta dos polos uno negatvo y
otro positvo. Estos polos se forman debido a la fuerte atraccin que ejerce el n-
cleo del oxgeno sobre los electrones que intervienen en los enlaces covalentes, los
cuales pasan ms tempo alrededor del ncleo de oxgeno que el que pasan alre-
dedor de los ncleos de hidrgeno. Por lo tanto, el extremo del tomo de oxgeno
tene carga ligeramente negatva y cada tomo de hidrgeno tene carga ligera-
mente positva. Adems, el tomo de oxgeno tene cuatro electrones adicionales
en su nivel energtco exterior, los cuales forman dos zonas ligeramente negatvas.
(Ligeramente negativo)
(Ligeramente positivo)
8p +8n
O
H H
Agua (H-O-H o H
2
O)
Molcula de agua
54
U 2 UAS
Debido a su naturaleza polar, las molculas de agua cercanas
se atraen, de tal manera que los oxgenos de algunas molculas
cargados negatvamente atraen a los hidrgenos de otras mol-
culas cargados positvamente. Esta atraccin elctrica recibe el
nombre de enlace o puente de hidrgeno. Cada molcula de
agua puede formar puentes de hidrgeno con otras cuatro mol-
culas de agua.
El agua es el mejor solvente, es decir, es capaz de disolver
una gran cantdad de molculas inorgnicas y orgnicas. La pola-
ridad de la molcula de agua favorece la disociacin de muchas
molculas formadoras de iones, los cuales partcipan en la regu-
lacin de propiedades biolgicas como la contraccin muscular,
la permeabilidad y la transmisin de impulsos nerviosos. Al di-
solver una amplia variedad de molculas, las sustancias acuosas
dentro de una clula proporcionan un medio adecuado para las
incontables reacciones qumicas fundamentales para la vida.
Entre las propiedades fsicas del agua estn su calor especfco y su calor de vaporizacin, las
cuales la convierten en un efciente estabilizador de la temperatura. Esto ltmo es muy impor-
tante ya que los organismos pueden sobrevivir slo dentro de un rango de temperatura limitado,
ya que las enzimas proteicas que guan las reacciones qumicas bsicas para la vida dejan de fun-
cionar tanto con las temperaturas elevadas como con las temperaturas bajas. El agua tene un
calor especfco elevado, es decir, puede absorber grandes cantdades de calor sufriendo cambios
relatvamente pequeos en su temperatura. Esta propiedad se debe a la presencia de enlaces de
hidrgeno entre las molculas de agua, ya que cuando el calor entra a un sistema acuoso como
una clula viva, mucha de la energa del calor rompe enlaces de hidrgeno en lugar de acelerar
las molculas individuales, lo que elevara la temperatura. El alto contenido de agua en los orga-
nismos les ayuda a mantener una temperatura relatvamente constante.
Tambin el agua posee un calor de vaporizacin elevado, es decir, tene la propiedad de
absorber mucho calor cuando se cambia del estado lquido al gaseoso. Esto sirve para que la su-
perfcie del cuerpo se deshaga de grandes cantdades de calor durante la transformacin del agua
lquida (sudor) en vapor. Por ejemplo, un jugador de basquetbol durante el partdo elimina agua a
travs de la piel en forma de sudor. La energa del calor producida durante el juego es transferida
desde su piel al agua, la cual se evapora. As, la evaporacin tene un efecto refrigerante ya que se
descarga el exceso de calor y se estabiliza la temperatura del organismo.
Ionizacin del agua: cidos y bases
El agua lquida tene una leve tendencia a disociarse en iones. Slo dos molculas de cada mil
millones de molculas de agua se ionizan, es decir, se separan en dos iones: el in hidrgeno (H
+
)
y el in hidrxido (OH
-
).
Esta reaccin puede resumirse con
una ecuacin qumica en la cual se usan
fechas dobles para mostrar que la reac-
cin puede ocurrir en cualquier direccin:
Figura 2.3 Ilustracin que mues-
tra los enlaces de hidrgeno que
se forman entre las molculas
de agua. Por qu las molculas
de agua se atraen entre s?
agua (H
2
O)
O
O
()
(+)
+
H H H
H
in hidrxido (OH

)
-
in hidrgeno (H
+
)
Enlace de
hidrgeno
()
(+)
H
H
O
55
Moivcuis ov i:vvvs nioioico DGEP
En el agua pura, el nme-
ro de iones hidrgeno es igual
al nmero de iones hidrxido.
Una solucin donde la con-
centracin de ambos iones
es igual, es una solucin neu-
tra. Sin embargo, cuando una
sustancia inica o una sustan-
cia con molculas polares se
disuelve en el agua, pueden
cambiar las concentraciones
de los iones H
+
y OH
-
. Si la
concentracin de iones H
+
su-
pera a la concentracin de io-
nes OH
-
, la solucin es cida;
si la concentracin de iones
OH
-
es mayor, la solucin es
bsica. Por ejemplo, cuando
el cido clorhdrico (HCl) se
disuelve en agua pura, se io-
niza casi completamente en
iones hidrgeno (H
+
) y cloru-
ros (Cl
-
). Esta solucin tene
ahora mucho ms iones H
+
que iones OH
-
. La solucin que resulta es cida. Ahora veamos cmo
se forma una solucin bsica. Cuando el hidrxido de sodio (NaOH) se disuelve en agua, las mol-
culas de NaOH se separan en iones sodio (Na
+
) y hidroxilos (OH
-
). Los iones OH
-
se combinan con
iones H
+
reduciendo su nmero. Por lo tanto, un cido es una sustancia que cede iones hidrgeno
y una base es una sustancia que se combina con iones H
+
y, por lo tanto, reduce su nmero.
Escala de pH
La escala del pH es un sistema de medicin ideado por qumicos para indicar las concentraciones
de iones hidrgeno en solucin. Por lo tanto el pH de una solucin es la medida de su concentra-
cin de iones hidrgeno. El smbolo pH deriva del francs pouvoir hydrogene (poder hidrge-
no). La escala de pH es numrica y va del 0 (el nivel ms cido) al 14 (el nivel ms bsico), donde el
nmero 7 representa una solucin neutra (igual cantdad de H
+
y de OH
-
). Un nmero arriba de 7
representa una solucin bsica y un nmero debajo de siete representa una solucin cida. El pH
de una solucin puede medirse electrnicamente o con papel tratado en forma especial. Observa
la escala de pH de la fgura 2.5, donde se seala el pH de diversas sustancias.
Por qu es importante el pH en los seres vivos? Es importante porque la mayor parte de
las reacciones qumicas que se llevan a cabo en los seres vivos son muy sensibles a los cambios
en el nivel del pH. Los pequeos aumentos o disminuciones mnimas en el pH pueden ocasionar
cambios drstcos tanto en la estructura como en la funcin de la enzimas, lo que ocasiona la
muerte de las clulas o de los organismos completos. Casi todas las reacciones de los seres vivos
Molculas
de agua
Figura 2.4 Cuando un cristal de cloruro de sodio o sal de mesa (NaCl)
cae en el agua, los hidrgenos cargados positvamente de las molculas
de agua atraern y rodearn los iones de cloro cargados negatvamente;
mientras que los oxgenos de las molculas de agua, cargados negatva-
mente, rodearn los iones de sodio con carga positva. Cuando sucede
esto, el agua evita que los iones de sodio y cloro vuelvan a unirse y, por lo
tanto, la sal se disuelve.
In Na
+
In Cl
-
56
U 2 UAS
tenen lugar a un pH entre 6 y 8. Una
excepcin es la del estmago de los
seres humanos y otros animales, cu-
yas reacciones tenen lugar a un pH
de 2. En nuestro organismo, tanto el
citoplasma celular como los lquidos
que baan las clulas son casi neu-
tros ya que su pH es de 7.3 aproxi-
madamente.
Molculas orgnicas
En todos los seres vivos se encuen-
tran cuatro tpos principales de mo-
lculas orgnicas: carbohidratos,
lpidos, protenas y cidos nuclei-
cos. Estas molculas contenen car-
bono, hidrgeno y oxgeno. Adems
las protenas, contenen nitrgeno
y azufre; los cidos nucleicos y al-
gunos lpidos contenen nitrgeno y
fsforo. Las molculas orgnicas, en
general, determinan la estructura y
funcin de las clulas que integran a
los seres vivos.
La mayora de las molculas or-
gnicas son grandes y se les conoce
como polmeros, ya que estn cons-
ttuidas de subunidades ms peque-
as, idntcas o similares llamadas
monmeros.
Estas molculas llevan a cabo dos tpos de reacciones qumicas: la sntesis por deshidrata-
cin, mediante la cual se unen las subunidades que las consttuyen, y la hidrlisis, que es la reac-
cin inversa, mediante la cual las subunidades se separan. En la primera se pierde agua, de ah su
nombre; en la segunda se requiere de agua.
Figura 2.5 La escala de pH expresa la concentracin de iones de
hidrgeno de una solucin en una escala de 0 a 14. Cada unidad
en la escala de pH representa un cambio 10 veces mayor en la
concentracin de iones H
+
. Por ejemplo, un refresco de cola que
tene un pH de 3, tene 10 000 veces la concentracin de H
+
que
el agua pura. Mientras que el caf tene 100 veces ms H
+
que
el agua pura. Cmo cambia el pH del caf si le aades leche?
Figura 2.6 En la polimerizacin las molculas pequeas, llamadas monmeros, se unen para formar polmeros o
macromolculas (molculas grandes).
UAS
Neutro
Limpiador de hornos
Blanqueador
Solucin de amoniaco
Jabn
Pasta dental
Agua de mar
Sangre humana
Agua pura
Leche
Lluvia normal
Caf negro
Lluvia cida
Jugo de tomate
Refrescos de cola
Jugo de limn
cido estomacal
cido de batera
14
13
12
11
10
9
8
7
6
5
4
3
2
1
0
C
a
d
a

v
e
z

m

c
i
d
o
C
a
d
a

v
e
z

m

s

b

s
i
c
o
M
onm
ero
Monmero
Monmero
Monmero Monmero
Monmero
Monmero
Monmero
Polmero
Polimerizacin
(unin de monmeros)
Monmero
57
Moivcuis ov i:vvvs nioioico DGEP
Carbohidratos
Los carbohidratos, tambin llamados glcidos, estn formados de tomos de carbono, hidrge-
no y oxgeno en proporcin aproximada de un tomo de carbono por dos de hidrgeno y uno de
oxgeno. La proporcin de tomos de hidrgeno y tomos de oxgeno es de 2:1 como en el agua.
Esto explica el origen del nombre carbohidrato, que signifca hidrato de carbono o carbono
con agua. Uno de los carbohidratos que no cumple con esta proporcin es la desoxirribosa ya
que le falta un oxgeno.
Los seres vivos usan los carbohidratos como su principal fuente de energa. Se originan
durante la fotosntesis, mediante la cual se captura la energa radiante que se convierte en
energa qumica y se almacena en ellos; para que posteriormente, por medio de otro proceso
conocido como respiracin, esa energa se pueda liberar para realizar las funciones biolgicas.
Algunos carbohidratos son importantes en la formacin de otros compuestos como en los
cidos nucleicos. Tambin, forman parte de diversas estructuras de las clulas vivas como las
paredes celulares en las que la celulosa es un componente muy importante.
Los carbohidratos se clasifcan en tres tpos principales que se llaman monosacridos, di-
sacridos y polisacridos. La palabra sacrido se deriva de una palabra griega que signifca
azcar.
Monosacridos
Monosacrido signif-
ca que tene un slo
monmero de azcar.
A los monosacridos
se les conoce tambin
como azcares simples
porque son los carbohi-
dratos ms sencillos, es
decir, no se pueden se-
parar por hidrlisis en
molculas ms peque-
as de azcar.
Las molculas de
los monosacridos
generalmente conte-
nen de 3 a 8 tomos
de carbono, pero los
de mayor importancia
biolgica son los de 5 y
6 tomos de carbono,
conocidos como pen-
tosas y hexosas res-
pectvamente.
H
Figura 2.7 Los azcares existen en la forma lineal y en anillo. La forma lineal de la
glucosa es rara. Cuando se disuelven en agua casi todas las molculas de glucosa
se pliegan espontneamente formando una estructura en anillo.
Forma lineal
Forma en anillo
58
U 2 UAS
Las pentosas como la ribosa y la desoxirribosa forman parte de las molculas gentcas
llamadas cido ribonucleico (arn) y cido desoxirribonucleico (adn), respectvamente. Entre
las hexosas ms importantes para los seres vivos estn la glucosa y la fructosa. La glucosa es el
monosacrido ms comn de los seres vivos y es la subunidad de la que estn hechos la mayor
parte de los carbohidratos (disacridos y polisacridos). La glucosa es elaborada por las clulas
de las plantas verdes durante la fotosntesis y es el principal combustble tanto en clulas vege-
tales como animales. La fructosa se encuentra en las frutas y en la miel de maz.
Disacridos
Son carbohidratos que se forman de la unin de dos monosacridos, los cuales estan unidos por
medio de un enlace glicosdico. Los disacridos se utlizan frecuentemente para el almacena-
miento de energa a corto plazo, principalmente en los vegetales. Entre los disacridos ms comu-
nes estn la sacarosa, la lactosa y la maltosa. La sacarosa o azcar de mesa es el disacrido ms
utlizado en la alimentacin humana. Est compuesto por los monosacridos glucosa y fructosa,
y en la naturaleza abunda en plantas como la caa de azcar y la remolacha. La lactosa o azcar
de la leche, consttuida por glucosa y galactosa, se encuentra slo en la leche de los mamferos,
ya que se forma exclusivamente en las glndulas mamarias de las hembras de estos animales. La
maltosa o azcar de malta est consttuida por dos molculas de glucosa; se le encuentra en la
malta, materia prima en la elaboracin de la cerveza. Tambin se obtene durante la digestn del
almidn.
Un disacrido se elabora mediante la sntesis por deshidratacin, reaccin en la que se eli-
mina una molcula de agua. Cuando los disacridos son utlizados como fuente de energa, los
monosacridos que los consttuyen se separan mediante una reaccin de hidrlisis, en la cual se
aade una molcula de agua. Observa estas dos reacciones en la siguiente fgura.
Figura 2.8 a) Sntesis de la sacarosa y b) hidrlisis de la sacarosa.
a)
H
H
H
H
H
H
OH
OH
OH
OH
OH
OH
OH
OH
OH
OH
OH
OH
HO
HO
+
+
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
CH
2
CH
2
CH
2
OH
CH
2
OH
CH
2
OH
CH
2
OH
CH
2
OH
CH
2
OH
OH
OH
HOCH
2
HOCH
2
Glucosa
Glucosa
Fructosa
Fructosa
Sacarosa
Sacarosa
Sntesis por deshidratacin
HOCH
2
HOCH
2
O
O
O
O
O
O
O
O
O
O
O
O
OH
OH
HO
HO
HO
HO
HO
HO
HO
HO
b)
59
Moivcuis ov i:vvvs nioioico DGEP
Polisacridos
En la naturaleza, la mayora de los carbohidratos estan en la forma de polisacridos. Los cuales se
forman por la unin en cadena de muchos monosacridos, principalmente glucosa. Estos carbo-
hidratos funcionan como fuente y almacenamiento de energa y como soporte estructural de los
organismos.
El polisacrido ms utlizado en la alimentacin, es el almidn, que puede presentarse enro-
llado o como cadenas sin ramifcaciones de hasta 1000 subunidades de glucosa o, ms frecuente-
mente como cadenas ramifcadas las cuales pueden estar consttuidas por hasta medio milln de
monmeros de glucosa. El almidn es la principal reserva alimentcia de la mayora de las plantas.
Alimentos como las papas, el arroz, el maz y el trigo son ricos en almidn, cuyas unidades de
glucosa son sintetzadas en la fotosntesis. Cuando estos alimentos son ingeridos por un animal,
el organismo lo degrada durante la digestn hasta disacridos o monosacridos.
El glucgeno es la principal forma de almacenamiento de glucosa en la mayora de los anima-
les; tene una estructura mucho ms ramifcada que el almidn. En los vertebrados, el glucgeno
se produce en el hgado y se almacena en l y en los msculos. Cuando el organismo requiere de
energa extra, el hgado hidroliza el glucgeno en glucosa.
Uno de los polisacridos estructurales ms importantes es la celulosa, que forma la mayor
parte de las paredes celulares de las plantas y aproximadamente la mitad de la masa del tronco
de un rbol.
Debido a la gran cantdad de fora (campos, bosques, selvas, etc.) presente en nuestro plane-
ta, la celulosa, es considerada la molcula orgnica ms abundante en la Tierra.
La celulosa est formada por muchas cadenas de glucosa colocadas una junto a otra y unidas
por puentes de hidrgeno. En conjunto, los enlaces estabilizan las cadenas y forman macizos
compactos que se organizan en fbras.
Figura 2.9 Compara y contrasta la estructura del almidn, el glucgeno y la celulosa.
Grnulos de almidn en
clulas de una papa
Grnulos de
glucgeno en
tejido muscular
Fibrillas de celulosa en la
pared de una clula vegetal
Molculas
de celulosa
Monmero
de glucosa
ALMI DN
GLUCGENO
CELULOSA
60
U 2 UAS
Slo pocos microorganismos (ciertas bacterias,
protozoarios y hongos) pueden hidrolizar la celulo-
sa. Las vacas y otros rumiantes, las termitas y las cu-
carachas pueden utlizar la celulosa como fuente de
energa debido a las bacterias simbitcas que viven
en sus sistemas digestvos, las cuales digieren la ce-
lulosa, es decir, rompen los enlaces entre las mol-
culas de glucosa.
En los animales, el polisacrido estructural ms
abundante es la quitna, principal componente de
los exoesqueletos de los artrpodos como los insec-
tos, cangrejos y araas. La quitna tambin se en-
cuentra formando parte de las paredes celulares de
muchos hongos. Este polisacrido resistente y duro tene una estructura parecida a la celulosa,
slo que en la quitna las glucosas tenen agregado un grupo amino.
Lpidos
Los lpidos son una gran variedad de molculas insolubles en agua, pero que se disuelven fcil-
mente en solventes orgnicos como el cloroformo o el ter. Al igual que los carbohidratos, estn
formados de carbono, hidrgeno y oxgeno, aunque pueden contener otros elementos como el
fsforo. Las unidades de construccin de los lpidos son los cidos grasos
y el glicerol, principalmente. Los lpidos realizan diversas funciones,
entre estas tenemos el almacenamiento de energa, algunos
actan como mensajeros qumicos (hormonas) y mu-
Figura 2.11 En la sntesis de una grasa o un aceite partcipan
una molcula de glicerol y tres cidos grasos.
Glicerol cidos grasos
Triglicrido
H
H
H
H +
3 molculas
de agua
H
H
H
H
H
H
H
H
H
H
H
H
OH
O
O
O
O
OH
O
OH
O
+
C
C
C
C
C
C
O
C HO CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
3
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
O
C CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
3
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
O
C HO CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
3
O
C CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
3
O
C HO CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
CH
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
Ch
3
OH
2
O
C CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
CH
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
Ch
3
OH
2
Figura 2.10 Fotografa de una cigarra que acaba
de mudar su cubierta externa o exoesqueleto de
quitna. Este se muda peridicamente para que
el insecto pueda crecer.
61
Moivcuis ov i:vvvs nioioico DGEP
chos otros forman parte de las membranas celulares. Las principales clases de lpidos son: grasas
y aceites, fosfolpidos, ceras y esteroides.
Grasas y aceites
Las grasas y los aceites estn consttuidos de tres molculas de cidos grasos unidas a una mol-
cula de glicerol. Debido a esta estructura, reciben el nombre qumico de triglicridos. Las grasas
a temperatura ambiente son slidas y los aceites a la misma temperatura son lquidos. Esto se
debe a los tpos de cidos grasos que los consttuyen; en las grasas, los cidos grasos son satura-
dos (con enlaces simples en sus cadenas de carbonos), y en los aceites son insaturados (con en-
laces dobles o triples en sus cadenas de carbonos). Los aceites son ms comunes en las plantas
que en los animales, son ejemplos el aceite de linaza, de olivo, de maz, de girasol, etc. Las grasas
las encontramos en la carne de los animales como la res y el cerdo (manteca, tocino).
Las grasas y los aceites almacenan energa en los organismos. Estas molculas producen ms
del doble de la energa, por gramo, que los carbohidratos. Adems, las grasas en los mamferos
acojinan y protegen los rganos internos como los riones y forman una capa que se encuentra
debajo de la piel, la cual sirve como aislante trmico, es decir, protege al organismo contra las
bajas temperaturas del ambiente. Esta capa de grasa est muy desarrollada en los mamferos
marinos como las focas y las ballenas.
Cuando se ingieren ms carbohidratos que los que requiere el organismo, ste los transforma
y almacena como grasas en el tejido adiposo. En los animales, durante la digestn, los lpidos
pueden ser hidrolizados hasta glicerol y cidos grasos.
Fosfolpidos
Los fosfolpidos son componentes estructurales muy importantes de la membrana plasmtca y
otros sistemas membranosos de la clula.
Los fosfolpidos son parecidos a las grasas y aceites, ya que estn formados por dos cidos
grasos unidos a un glicerol, slo que en estos, el tercer carbono de la molcula de glicerol est
ocupado por un grupo fosfato. Este extremo fosfato es hidroflico, mientras que los cidos grasos
son hidrofbicos. Esta caracterstca de los fosfolpidos es importante para la estructura y funcin
de la membrana plasmtca.
Figura 2.12 La molcula de un fosfolpido est formado por dos cidos grasos unidos a una molcula de glicerol y por
un grupo fosfato unido al tercer carbono del glicerol.
R O
O
Grupo
fosfato
Glicerol
cido graso
O
O
H
H
H
C
C
CC
C CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
3
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
CH
2
C
H
C
H
2
C
H
2
C
H
2
C
H
2
C
H
2
C
H
3
O
O
O
O
CH
2
3
2
1
P
62
U 2 UAS
Figura 2.14 Entre los esteroides de importancia biolgi-
ca encontramos el colesterol y las hormonas sexuales:
estrgeno (hembras) y testosterona (machos).
Estrgeno
Colesterol
Testosterona
Ceras
Las ceras estn consttuidas de cidos grasos unidos a un alcohol diferente al glicerol. Las ceras
son sintetzadas tanto por animales como por plantas; en algunos animales forman una capa pro-
tectora e impermeable sobre la piel, pelo, plumas y exoesqueletos, mientras que otros como las
abejas la utlizan para construir sus panales. En las plantas terrestres, las ceras forman una capa
resistente al agua sobre hojas, frutos y tallos.
Esteroides
Los esteroides poseen una estructura muy diferente a todos los otros lpidos, pero se les clasi-
fca dentro de ellos debido a que son insolubles en agua. Estn formados de cuatro anillos de
carbono fusionados, tres de los cuales poseen seis tomos y uno, cinco. Dentro de los esteroi-
des tenemos el colesterol que es un componente estructural indispensable de la membrana
plasmtca de la mayor parte de las clulas eucariotas. El colesterol tambin es utlizado por las
clulas para sintetzar otros esteroides como las hormonas sexuales, que regulan la funcin y el
desarrollo sexual.
Figura 2.13 Las ceras son un tpo de lpidos. a) Observa la capa de cera que protege las frutas de la fotografa.
b) Las abejas secretan la cera con la que construyen sus panales.
a b
CH
3
CH
3
CH
3
(CH
2
)
3
CH
3
HC
HC CH
3
CH
3
CH
3
CH
3
OH
OH
HO
O
HO
63
Moivcuis ov i:vvvs nioioico DGEP
Protenas
Las protenas son las molculas orgnicas ms abundantes en los seres vivos y estn forma-
das casi exclusivamente por carbono, hidrgeno, oxgeno y nitrgeno. Todas las protenas son
polmeros consttuidos por muchas subunidades (monmeros) llamados aminocidos. En la for-
macin de las protenas que se encuentran en los seres vivos, intervienen 20 aminocidos, los
cuales tenen la misma estructura fundamental, que consiste de un tomo de carbono central
unido a un grupo amino (NH
2
), uno carboxilo (COOH), un hidrgeno y a un grupo R que es va-
riable. Por lo que su estructura es:
Al igual que los lpidos y los polisacridos, las protenas se forman mediante sntesis por
deshidratacin, en la cual se desprende un OH del grupo carboxilo del primer aminocido y
un H del grupo amino del siguiente aminocido. El H y el OH forman una molcula de agua.
El enlace formado entre los tomos de C y N de los grupos carboxilo y amino se llama enlace
peptdico y el compuesto formado es un pptdo (fgura 2.17). En este caso es un dipptdo
ya que slo est consttuido por dos aminocidos. De esta manera se unen de uno en uno los
aminocidos hasta formar cadenas muy largas. La longitud de estas cadenas peptdicas varan
desde tres a miles de aminocidos. Cuando la cadena tene hasta 100 aminocidos, se le llama
polipptdo; si la cadena tene ms de 100 aminocidos unidos, se le considera una protena.
De tal manera que el tpo y caracterstcas de las diversas protenas que existen dependern
de la secuencia especfca de las uniones entre los distntos aminocidos y de la conformacin
dimensional de stos; siendo enorme la posibilidad de combinaciones entre los diferentes ami-
Figura 2.15 Tres ejemplos de aminocidos: alanina, valina y glicina. Cul es el grupo R en la glicina?
La nica diferencia entre los 20 aminocidos radica en su grupo R. Observa la siguiente fgura
que muestra la estructura de tres aminocidos.
Grupo R Grupo R Grupo R
CH
3
CH
3
CH
3
H
2
N
H
2
N
H
2
N
C C
C C
C C
H
H
H
H
OH
OH
OH
O
O
O
CH
Alanina (ala) Valina (val) Glicina (gly)
Grupo
variable
Grupo
amino
Hidrgeno
R
H
C C
H
H H
O
O
N
Grupo
carboxilo
64
U 2 UAS
nocidos, algo semejante a la posibilidad de
formar palabras con 20 letras diferentes.
Por ejemplo, slo los seres humanos elabo-
ramos aproximadamente unos 5 millones
de protenas diferentes, las cuales son sinte-
tzadas en los ribosomas de nuestras clulas.
En general, las diferencias estructurales de
las protenas son ms marcadas conforme ms
alejados se encuentren los organismos evolutvamente,
pero aun entre los individuos que integran una sola especie
existen diferencias importantes que pueden provocar el rechazo
de las protenas de un individuo a otro, como en los diferentes tpos
sanguneos, injertos y trasplantes de rganos.
Las protenas son compuestos bsicamente estructurales, se en-
cuentran prctcamente en todas las estructuras celulares y desempe-
an un papel fundamental en los procesos vitales.
A nivel celular, las protenas se encuentran formando parte de las
membranas del citoplasma y los diferentes organelos como mitocon-
drias, ribosomas, centrolos, etc. En organismos animales forman es-
tructuras como piel, uas, cabello, lana, cuernos, garras, plumas, etc. La
seda de las telaraas tambin es una protena.
Tambin es importantsima su accin como enzimas, ya que estas
actan como catalizadores que controlan las velocidades de casi todas
las reacciones qumicas que suceden dentro de la clula y, de esa for-
ma, regulan el fujo de molculas necesarias para la vida de la clula.
Otras protenas actan como defensas del organismo formando antcuerpos que ayudan a
combatr enfermedades e infecciones. Algunas ms son hormonas como la insulina (regula el
metabolismo del azcar y cuya defciencia es una causa de la diabetes) y la hormona del creci-
miento. Otras se utlizan para almacenamiento de energa (albmina de los huevos, la casena
de la leche), para transportar (la hemoglobina presente en los eritrocitos lleva el oxgeno en la
sangre), y muchas otras protenas son venenos, como el de la vbora de cascabel.
Los animales, en general, adquieren los aminocidos necesarios por medio de su alimenta-
cin casi siempre en forma de protenas, stas tambin pueden actuar en los organismos como
una fuente de energa.
Figura 2.16 Qu pro-
tena es el componente
principal del pico, plu-
mas y garras de este
tucn?
Figura 2.17 Sntesis proteica por deshidratacin. Cada vez que un aminocido se une a la cadena, se elimina una
molcula de agua.
Aminocido
Grupo
amino
Grupo
amino
Grupo
carboxilo
Enlace
peptdico
Aminocido Dipptido Agua
Grupo
carboxilo
65
Moivcuis ov i:vvvs nioioico DGEP
cidos nucleicos
Los cidos nucleicos son molculas muy complejas de las que hay dos tpos, el cido desoxi-
rribonucleico o adn y el cido ribonucleico o arn. Estos dos cidos nucleicos estn formados
por cadenas largas de cientos de miles de subunidades llamadas nucletdos. A su vez, cada
nucletdo est formado por un grupo fosfato, un azcar y una base nitrogenada. El azcar
puede ser ribosa o desoxirribosa. La primera se encuentra en los nucletdos del arn y la
segunda en los del adn. Las bases nitrogenadas son cinco: la adenina y la guanina, conocidas
como purinas; la tmina, la citosina y el uracilo, que se conocen como pirimidinas. Los nucle-
tdos de ambos cidos nucleicos estn consttuidos por slo cuatro bases. La adenina, guanina
y citosina se encuentran tanto en el adn como en el arn, mientras que la tmina se encuentra
slo en el adn y el uracilo slo en el arn. En los dos cidos, los nucletdos se enlazan entre
s por medio de los grupos fosfato que se unen en el carbono nmero 5 de un azcar y el car-
bono nmero 3 del azcar siguiente, conectndose las bases en el primer carbono del azcar
(fgura 2.19).
El adn es el principal componente de los cromosomas de las clulas y es el portador de la
informacin gentca. Est formado por dos largas cadenas de nucletdos colocadas en espi-
ral, estructuralmente independientes, que forman una doble hlice parecida a una escalera de
caracol. Las dos bandas de polinucletdos estn conectadas por la unin de las bases pricas
y pirimdicas, las cuales se combinan mediante puentes de hidrgeno de la siguiente forma: la
adenina con la tmina (A-T o bien T-A), y la guanina con la citosina (G-C o tambin C-G). La can-
tdad y secuencia de las combinaciones de estas cuatro bases varan en cada gen de acuerdo al
modelo de Watson y Crick (fgura 2.20).
Esta secuencia y cantdad de combinaciones de las bases pricas y pirimdicas del adn,
contene el mensaje en clave de las ca-
racterstcas hereditarias de cada indivi-
duo y es lo que se conoce como cdigo
gentco.
El arn, que tambin se encuentra en
las clulas de cualquier organismo tene
como funcin llevar la informacin gen-
tca del adn hacia el citoplasma y dirigir
la sntesis de protenas. Este cido nuclei-
co que se sintetza en el ncleo est for-
mado por una sola cadena de nuclet-
dos, los cuales estn consttuidos -como
ya se mencion- por un grupo fosfato, el
azcar ribosa y por una base que puede
ser adenina, guanina, citosina o uracilo.
Tanto el adn como el arn se estudian
con mucho ms detalle en la unidad 4, Ge-
ntca: la ciencia de la herencia.
Figura 2.18 Estructura de un nucletdo de arn, const-
tuido por un grupo fosfato, un azcar (ribosa) y una base
nitrogenada en este caso la adenina.
NH2
N
N
N
N
C
C
C
C
C
H
H
H
H H
OH
H
OH
CH2
O
O
O
O O P
Base
nitrogenada
Grupo
fosfato
Azcar
66
U 2 UAS
ARN ADN
C
G
A
T
C
G
T A
C
G
T A
C
G
T A
C
A
G
C
G
A
C
U
A
C
G
A
G
C
U
A
C
G
A
G
C
U
A
C
G
A
C
A
A
A
G
T
C
C
G
A
A
T
C
G
A
A
T
C
G
A
A
T
C
C
G
G
C
A T
C
T
C
T
C
T
C
T
C
T
Figura 2.19 Cadena de nucletdos. Figura 2.20 Modelo del arn y del adn.
Base
nitrogenada
Base
nitrogenada
Base
nitrogenada
Base
nitrogenada
Base
nitrogenada
Base
nitrogenada
Base
nitrogenada
Base
nitrogenada
Azcar
Azcar
Azcar
Azcar
Azcar
Azcar
Azcar
Azcar
Fosfato
Fosfato
Fosfato
Fosfato
Fosfato
Fosfato
Fosfato
Fosfato
67
Moivcuis ov i:vvvs nioioico DGEP
Autoevaluacin
Repaso de la unidad
Contesta las siguientes preguntas:
1. Cules son los elementos principales de la vida?
_______________________________________________________________________
2. Qu importancia tene el agua para los seres vivos?
_______________________________________________________________________
3. Qu es el pH?
_______________________________________________________________________
4. Cul es la importancia biolgica de la glucosa?
_______________________________________________________________________
5. Menciona algunas diferencias entre las grasas y los aceites.
_______________________________________________________________________
6. De qu estructura celular forman parte los fosfolpidos ?
_______________________________________________________________________
7. Por qu las protenas se consideran polmeros pero los lpidos no?
_______________________________________________________________________
8. Menciona algunas funciones de las protenas.
_______________________________________________________________________
9. Cul es la funcin del adn?
_______________________________________________________________________
Completa los espacios en blanco de los siguientes enunciados:
10. Las principales mleculas orgnicas que consttuyen a los seres vivos son:_____________,
______________, ______________ y ____________________.
11. La sacarosa o azcar de mesa esta consttuida por los monosacridos ____________ y
____________________.
68
U 2 UAS
12. Los 20 ________________ se combinan de diferentes maneras formando largas cadenas
de _________________.
13. El ________________ es un polisacrido presente en los animales.
14. Las ____________ son protenas que actan como catalizadores.
15. Los dos tpos de cidos nuclecos son: ___________________ y ____________________.
Estan formados por cadenas de ________________.
Indica cual de las siguientes afrmaciones son verdaderas (v) o falsas (f).
16. El cloro es un oligoelemento en los seres vivos.
17. El agua es un importante vehculo de transporte y adems acta como
lubricante.
18. Una solucin cida posee mayor concentracin de iones H
+
que de OH
-
.
19. La cera de abeja y el colesterol son lpidos.
20. Los cidos grasos de los aceites son insaturados.
21. Los monosacridos se pueden separar mediante hidrlisis en molculas
ms pequeas de azcar.
22. Todas las protenas son polmeros consttuidas de monmeros de
aminocidos.
23. Cada nucletdo est formado por un grupo fosfato un disacrido y una
base nitrogenada.
24. La base nitrogenada uracilo solo se encuentra en el adn.
25. La desoxirribosa es un monosacrido que forma parte del arn.
En la siguiente sopa de letras, localiza la respuesta de lo que se te pide:
26. As se les conoce a las molculas orgnicas grandes.
27. Es un ejemplo de pentosa.
28. Es el nombre del enlace que se forma entre dos monosacridos.
29. Polisacrido que forma la mayor parte de las paredes celulares de las plantas.
30. Es el polisacrido estructural ms abundante en los animales.
31. Las enzimas y los antcuerpos son ejemplos de:
32. Enlace formado entre dos aminocidos.
33. Base nitrogenada exclusiva del adn.
34. La adenina, guanina y ___________ se encuentran tanto en el adn como en el arn.
35. Es el principal componente de los cromosomas de la clula y es el portador de la
informacin gentca.
( )
( )
( )
( )
( )
( )
( )
( )
( )
69
Moivcuis ov i:vvvs nioioico DGEP
Aplicacin de conceptos
36. En base al pH, que desventajas tene para el organismo humano la ingestn de refrescos
de cola.
_______________________________________________________________________
37. Al realizar ejercicio, como ayuda el sudor a regular la temperatura corporal.
_______________________________________________________________________
38. Por qu los corredores de largas distancias deben comer ms cantdad de carbohidratos
que lo que acostumbran, das antes de la carrera?
_______________________________________________________________________
39. Muchas aves realizan largas migraciones, por lo cual almacenan grandes cantdades de
energa para poder volar. En qu tpo de molculas se almacena esta energa?
_______________________________________________________________________
Se clasifcan en
ejemplos
ejemplos
Disacridos
ejemplos
fructosa
celulosa
Completa el siguiente mapa conceptual.
C P R O T E I N A S E R
E L E F A N T I L T A R
L C I T O C I N A I N B
U R E R I B O S A M A S
L O S P E P T I D I C O
O R I Z A B A V E N Y A
S U E Q U I N T E A R U
A G L U C O S I D I C O
B E S I T I D O B L A D
C A S T I L A U R A D N
P O L I M E R O S I M O
A U B N U E N B A S T I
V E N A T A H J O S I E
70
U 2 UAS
Observacin con el microscopio ptco de
clulas de hojas de Elodea canadensis.
UNIDAD
3
L
a

c

l
u
l
a
:

u
n
i
d
a
d

d
e

l
a

v
i
d
a
73
La clula: unidad de la vida
Introduccin
La biologa comprende todas las disciplinas dedicadas al estudio de los organismos vivos. Dichas
disciplinas se denominan, tambin, ciencias de la vida. Una de esas ciencias de la vida que ms
han contribuido a la visin unifcadora del mundo de los seres vivos es la que estudia a la clula.
Tradicionalmente se le ha dado el nombre de citologa pero actualmente se le conoce como bio-
loga celular. Es en este campo de estudio donde se representan los diversos aspectos explicat-
vos de los fenmenos que ocurren en los seres vivos. Adems, la teora celular integra el cuerpo
cientfco de la biologa y es uno de los pilares tericos de esta ciencia. La biologa moderna, en
realidad despega a principios del siglo XIX y sus orgenes estn asociados a grandes investgadores
como Schwann, Schleiden y Virchow con el establecimiento de la teora celular.
El avance cientfco de la biologa celular se hizo posible gracias a la invencin del microscopio
y a los trabajos publicados por Robert Hooke en 1667, quien fue el primero en utlizar el trmi-
no de clula. Durante los ciento cincuenta aos siguientes, tres microscopistas sobresalientes
(Nehemiah Grew, Marcelo Malpigui y Anton van Leeuwenhoek) describieron numerosos objetos
microscpicos. El estudio de la clula se reactva posteriormente en la poca comprendida entre
1820 y 1880. Los adelantos en los saberes acerca de la estructura celular estuvo en funcin de
qu tanto se mejoraban los microscopios para una mejor interpretacin de lo diminuto: se mejo-
raron los mtodos para preparar tejidos y otros materiales vivos, luego se empezaron a usar todo
tpo de colorantes para crear contrastes entre la pared celular, el citoplasma y el ncleo.
El anuncio de parte de Robert Brown en 1831 del descubrimiento del ncleo, presente en
todas las clulas, cuya importancia fue reconocida por Mathias Schleiden en 1838, dio pauta
para la posibilidad de que las clulas existeran como unidades consttutvas de todo tpo de or-
ganismos. Un ao despus Theodor Schwann muestra que las clulas no slo existen en plantas
sino tambin en animales. Esto consolida fuertemente la formulacin de un concepto cientfco
unifcador en el estudio de los seres vivos conocido como la teora celular.
Las investgaciones de grandes cientfcos de fnes del siglo XIX fueron muy interesantes. Estas
estn relacionadas con Weismann que insista en que el material gentco estaba localizado en
los cromosomas, y Boveri que fue la persona que ms contribuy al conocimiento de los cromo-
somas. Estos estudios se consolidaron como las bases de la teora cromosmica de la herencia
propuesta por Suton y Boveri.
A partr de 1990, los avances en el conocimiento de la clula se dispararon. En un principio,
las contribuciones ms importantes se hicieron en los campos de la gentca y la fsiologa celular,
seguidas a contnuacin por la exploracin de la estructura ntma de la clula con la ayuda de
microscopios electrnicos y, por ltmo, el estudio de todos los componentes del citoplasma por
la biologa molecular.
La historia de la biologa celular es un indicador que ilustra de manera muy clara el progreso
gradual de las ciencias biolgicas.
74
U 3 UAS
Teora celular
La teora celular es la ms amplia y fundamental de todas las generalizaciones biolgicas. Esta teo-
ra nos dice, que todos los seres vivos desde los ms grandes, como las ballenas, hasta los ms pe-
queos, como los microbios, estn consttuidos por clulas. La clula es la unidad bsica de todos
los seres vivos. Existen seres vivos muy pequeos como las bacterias y los protozoarios que estn
consttuidos por una sola clula, por lo que se les llama organismos unicelulares. En cambio, los
seres vivos u organismos ms grandes como los hongos, algunas algas, las plantas y los animales,
estn consttuidos por muchas clulas, por lo que se les llama organismos multcelulares.
Todo este conocimiento, que parece sencillo, fue el resultado del estudio y la investgacin
de un gran nmero de hombres de diversas nacionalidades a travs de varios siglos. El conoci-
miento sobre la clula se inicia en el siglo XVII y su desarrollo est estrechamente relacionado con
la invencin y perfeccionamiento del microscopio. Un instrumento que permit a los primeros
investgadores aumentar el tamao de la materia viva, permitndoles as poder observar lo que
hasta ese momento era invisible para el ojo humano.
Enseguida mencionaremos las aportaciones hechas por algunos investgadores para el esta-
blecimiento de la teora celular.
Robert Hooke un fsico, matemtco y arqui-
tecto ingls dedic cierto tempo al mejoramien-
to y empleo del microscopio compuesto. En 1665
public su libro ttulado Micrographia, en el que
incluy una descripcin e ilustracin de la estruc-
tura del corcho. Hooke introdujo el trmino c-
lula para referirse a las pequeas cavidades que
observ con su microscopio en un pedazo de cor-
cho muy delgado. Estas diminutas cavidades le
recordaban a Hooke los pequeos cuartos o cel-
das de los monasterios, llamadas cellulae en latn,
de ah el nombre.
El corcho es la corteza seca del rbol llamado
alcornoque, por lo tanto, lo que Hooke realmen-
te vio fueron las paredes celulares de las clulas
vegetales que consttuyeron la corteza antes que
se secara. En las plantas vivas encontr que las
clulas estaban llenas de jugos, pero a pesar de
esta observacin, le dio una mayor importancia a
lo que en ese momento era ms visible, la gruesa
pared celular, ms que al contenido de la clula.
Su microscopio compuesto (de dos lentes) no le
permit observar ninguna estructura intracelular
ya que slo aumentaba treinta veces los objetos.
A Hooke se le reconoce haber sido el primero
que observ e identfc las clulas, adems de
legarnos el trmino clula.
Figura 3.1 Dibujos hechos por Robert Hooke sobre
las clulas del corcho, las cuales observ con un
microscopio similar al de esta fotografa.
75
L cviui: uioo ov i vio DGEP
Mientras Hooke realizaba sus in-
vestgaciones en Inglaterra, en un pe-
queo pueblo holands, un hombre de
ofcio comerciante llamado Anton van
Leeuwenhoek perfeccion el mto-
do de pulido de vidrio, mejorando las
lentes. Con ellas fabric un pequeo
microscopio simple (una lente), que
aumentaba los objetos cerca de tres-
cientas veces. Leeuwenhoek era un
gran observador y con los ms de cien
microscopios que construy descubri
un mundo desconocido para el ser humano (el mundo de los microor-
ganismos) que slo con sus microscopios pudieron ser vistos.
A partr de 1673, Leeuwenhoek da a conocer sus observaciones a una or-
ganizacin cientfca, la Real Sociedad de Londres, de la que Hooke formaba parte.
Durante 40 aos, Leeuwenhoek escribi 125 cartas a la Real Sociedad de Londres,
donde les narraba sus descubrimientos hechos en diversos materiales como el agua de
lluvia y de charcos, donde descubri unos seres que el llam animalculos, conocidos hoy como
protozoarios y bacterias. En sus cartas lleg a describir las tres formas que presentan las bacte-
rias: esferas, bastones y espirales. Adems de estos organismos unicelulares, tambin observ los
espermatozoides en el semen y los glbulos rojos en la sangre. Su curiosidad era tal, que lleg a
observar su propio excremento, donde vio la Giardia lamblia, un protozoario fagelado que habita
el intestno humano.
A Leeuwenhoek se le reconoce el haber realizado las primeras observaciones de bacterias y
protozoarios; con l se inicia la ciencia de la microbiologa.
Con los descubrimientos de Hooke y Leeuwenhoek se sientan las bases de la biologa celular.
Lamentablemente, este conocimiento permanece estacionario por ms de un siglo. Es hasta prin-
cipios del siglo XIX cuando se reconoce la importancia de las clulas para los seres vivos. Para estas
fechas, las tcnicas de preparacin de tejidos y los microscopios haban mejorado notablemente.
En 1824, el bilogo francs Henri Dutrochet lleg a la conclusin de que todos los tejidos ani-
males y vegetales estn consttuidos por diminutas clulas, y que el crecimiento de un organismo
era el resultado de un aumento en el nmero o en el tamao de las clulas, o en ambos.
En 1831, Robert Brown, botnico escocs, reconoce o generaliza la presencia de un corps-
culo central contenido en la sustancia mucosa de la mayora de las clulas. Este corpsculo
descrito por Brown es el ncleo.
Unos cuantos aos despus con los trabajos publicados por dos alemanes, el botnico
Mathias Schleiden y el zologo Theodor Schwann, se consolida todo el conocimiento que sobre
la clula se tena.
En 1838, como resultado de sus observaciones de tejidos vegetales, Schleiden concluye que
todas las plantas estn consttuidas por clulas. Al siguiente ao, en 1839, despus de estudiar por
aos el tejido animal, Schwann afrma que los animales tambin estn consttuidos por clulas.
Asimismo, argumentan que cada clula es capaz de mantener una existencia independiente, ya que
los procesos vitales de los seres vivos ocurren dentro de cada una de las clulas que lo consttuyen.
a)
b)
Figura 3.2 a) Dibujos he-
chos por Leeuwenhoek
de los espermatozoides
humanos, b) observados
con su pequeo micros-
copio simple.
76
U 3 UAS
Ambos investgadores presentan pruebas claras y convin-
centes de sus ideas logrando la aceptacin general de los bilo-
gos de la poca y el establecimiento de la teora celular, la cual
afrma:
Todos los seres vivos estn consttuidos por una o ms clulas.
La clula es la unidad bsica de estructura y funcin de los
seres vivos.
Posteriormente, en 1858, el patlogo alemn Rudolf Vir-
chow, con los resultados de sus observaciones ampla la teora
celular y agrega una tercera afrmacin:
Las clulas provienen slo de otras clulas.
La teora celular es muy importante porque enfatza la si-
militud de todos los seres vivos. En la actualidad se reconoce
como una de las principales teoras de la biologa.
Concepto de clula
Como ya se ha mencionado, los seres vivos son unicelulares o multcelulares. Un ser vivo unicelular
es todo l una sola clula, mientras que un ser vivo multcelular est consttuido por muchas clulas.
Hagamos la siguiente analoga entre una casa y un organismo multcelular; las unidades de
construccin de una casa son los ladrillos, en un organismo multcelular, las clulas. Por lo tanto,
las clulas son la unidad de estructura de todos los seres vivos.
Las clulas son consideradas tambin las unidades funcionales de los seres vivos, pues todas
las funciones metablicas del organismo como la respiracin, nutricin, excrecin, secrecin, re-
produccin, etc., se realizan en la clula. La clula tene todos los componentes qumicos y fsicos
necesarios para su propio mantenimiento y crecimiento. Debido a esto, las clulas han logrado
cultvarse (mantenerse vivas y reproducirse) in vitro, siempre y cuando dispongan de los nutrien-
tes esenciales y un ambiente adecuado. In vitro se refere a un experimento llevado a cabo fuera
del organismo, animal o vegetal, en un recipiente de vidrio.
El primer cultvo in vitro de clulas fue realizado en 1907 por el zologo norteamericano Ross
Harrison, quien cultv clulas de salamandra.
Por lo tanto, defnimos a la clula como la unidad estructural y funcional de todos los se-
res vivos.
El microscopio
El microscopio es un instrumento que aumenta la imagen de las cosas observadas, por ello se
emplea para ver objetos muy pequeos o diminutos. Este gran invento es indispensable para el
conocimiento de la clula, ya que casi todas son microscpicas; lo que no es visible a simple vista
es microscpico. Muchos organismos unicelulares como las bacterias, los protozoarios, las leva-
duras y muchas algas son microscpicos.
Figura 3.3 Mathias Schlei-
den (1804-1881), botni-
co alemn quien junto con
Theodor Schwann propuso
la teora celular.
Uioo z
77
L cviui: uioo ov i vio DGEP
La invencin del microscopio se remonta al ao de 1590, cuando los holandeses Zacharas
y Jans Janssen, fabricantes de anteojos, hacen el primer microscopio compuesto. La palabra mi-
croscopio proviene del griego micro (pequeo) y scope (ver o mirar).
El microscopio compuesto
El microscopio compuesto, ptco o de luz, es el ms utlizado en los laboratorios escolares. Este
microscopio utliza lentes, generalmente elaboradas a partr de cristales, para enfocar y amplifcar
los rayos luminosos que pasan a travs o rebotan en el espcimen (muestra) que se va observar.
El microscopio compuesto est formado por un tubo ptco, que en su extremo superior
tene una lente llamada ocular, y en el extremo inferior, cuatro lentes denominadas objetvos,
cada una con diferente grado de aumento. Los objetvos estn dispuestos en el revlver, un disco
giratorio que permite ubicar en la posicin correcta el objetvo que se quiere utlizar. Al llegar el
objetvo a la posicin correcta de trabajo, suena un leve clic.
La preparacin a observar se coloca sobre la platna, una plataforma metlica que tene un
orifcio central por donde pasa la luz y un par de pinzas que sujetan el portaobjetos de la prepa-
racin. Por debajo de la platna se encuentra el condensador, un juego de lentes que va a concen-
trar la luz sobre la preparacin. El condensador tene un diafragma que regula la cantdad de luz.
Otras partes del microscopio son: los tornillos macromtrico y micromtrico, con los cuales se
enfoca la muestra; la columna, pieza donde se localizan estos tornillos; el brazo, por donde se toma
el microscopio, y la base, el soporte del mismo. Localiza todas las partes mencionadas en la fg. 3.5.
Para determinar el poder de aumento del microscopio (amplifcacin), se multplica el au-
mento del ocular por el del objetvo que se est empleando. El aumento de estas lentes est
Figura 3.4 Unidades de medicin que se emplean en microscopa. La microfotografa del adn se obtuvo con un mi-
croscopio de barrido de efecto tnel que da amplifcaciones hasta de 100 millones de veces.
Chlamydomonas
(alga verde)
5-6 m
Escherichia coli (bacteria)
25 mde largo
Trypanosoma
(protozoario)
25 mde largo
Virus de
la polio
30 nm
VIH
(Virus del
SIDA) 100 nm
Bacterifago T4
de 225 nmde largo
Eritrocito humano
(glbulo rojo),
dimetro
7-8 m
Clula vegetal tpica
10-100 m
Huevo
de rana
3 mm
Mitocondria
1-5 m
Cloroplasto
2-10 m
100 m 10 m 1 m 100 nm 10 nm 1 nm
0.5 nm
1 mm
Virus de mosaico del
tabaco de 300 nm
de largo
Molcula
de ADN,
2 nmde
dimetro
78
U 3 UAS
Ocular
Sostiene los lentes que
aumentan la imagen
Tornillo macromtrico
Mueve el tubo o la platina
hacia arriba o hacia abajo
Brazo
Sostiene el tubo
Tornillo micromtrico
Enfoca la imagen
Objetivos
Sostiene las lentes
de aumento
Platina
Sostiene las laminillas
Diafragma
Regula la cantidad de luz
que pasa a travs del
espcimen
Base
Sostiene el microscopio
Figura 3.5 Microscopio compuesto de luz
y la funcin de cada una de sus partes.
grabado en ellas, con
un nmero seguido de
una X. Por ejemplo, si el
aumento del ocular es
de 10X y el del objetvo
es de 40X, el poder de
aumento del microsco-
pio es de 400, es decir,
el espcimen observa-
do lo veremos 400 ve-
ces mayor.
En los estudios con
microscopio, las uni-
dades de medida ms
comunes son el micr-
metro (m), que es la
milsima parte de un
milmetro, y su sub-
divisin, el nanmetro
(nm), que es la milsima
parte de un micrme-
tro. El micrmetro se
conoca anteriormente
como micra o micrn.
Adems del poder de aumento del microscopio es muy importante tambin su poder de
resolucin, que es la capacidad del microscopio para distnguir como separados a dos objetos
muy cercanos entre s. El poder de resolucin de los mejores microscopios compuestos es de
0.2 micrmetros. Los objetos que estn ms cerca de 0.2 micrmetros se vern como uno
solo. La resolucin del microscopio nos permite observar con claridad los detalles fnos del
espcimen.
El microscopio electrnico
El primer microscopio electrnico fue construido por los alemanes Max Knoll y Ernst Ruska en
1937. Este microscopio utliza un haz o fujo de electrones en lugar de luz para aumentar la ima-
gen. Los electrones se enfocan mediante campos magntcos en lugar de lentes.
Hay dos clases principales de microscopio electrnico: el de transmisin y el de barrido.
El microscopio electrnico de transmisin o met se llama as porque el haz de electrones pasa
a travs de una muestra delgada produciendo la imagen. Esta imagen amplifcada por el haz
de electrones se ve en una pantalla fuorescente. Tambin se puede tomar una fotografa de la
imagen y ampliarla. Un met puede aumentar el tamao de un objeto 300 mil veces. Su poder de
resolucin es de 0.2 nanmetros, es decir, pueden verse claramente dos puntos cuya separacin
es de 0.2 nanmetros. El uso de electrones permite que la resolucin sea mil veces mayor que la
del microscopio compuesto.
Uioo UAS
79
L cviui: uioo ov i vio DGEP
En el met, el espcimen a observar debe ser delgado, por lo que se corta en capas muy fnas.
Esto es una desventaja ya que a consecuencia de este proceso slo observamos clulas muertas.
Con el met podemos observar detalles de la estructura celular, as como los virus que son part-
culas ms pequeas que las bacterias.
El microscopio electrnico de barrido o meb pertenece a la generacin de microscopios
electrnicos modernos. El meb rebota electrones sobre el espcimen a observar, el cual previa-
mente ha sido cubierto con metales, proporcionando as imgenes tridimensionales de ste y
dejando ver con detalle su superfcie. Con el meb pueden observarse desde insectos completos
hasta organelos celulares. Recientemente se han podido fotografar especmenes vivos usando
el meb.
Los tpos de clulas: procariotas y eucariotas
Existen dos tpos de clulas bsicas: procariotas y eucariotas. Esta clasifcacin se basa en el he-
cho de que las primeras no poseen organelos rodeados por membranas y las segundas s. Debido
a esto, la diferencia ms notoria entre ellas es que la clula eucariota tene su material gentco
dentro de un organelo limitado por una membrana, el ncleo, mientras que el material gentco
de las clulas procariotas no est englobado por una membrana, sino libre en el citoplasma. En
todas las clulas vivas, el material gentco es el adn (cido desoxirribonucleico). La tabla 3.1 re-
sume las similitudes y diferencias entre las clulas procariotas y eucariotas.
Figura 3.6 (Derecha) Micros-
copio electrnico de barrido
(meb), arriba al centro; ima-
gen tridimensional de una
hormiga aumentada 42 ve-
ces con el meb. (Izquierda)
Espermatozoides de conejo
vistos en: a) Un microscopio
ptco. b) Un microscopio
electrnico de transmisin.
c) Un microscopio electr-
nico de barrido. El met per-
mite observar detalles de la
estructura celular y el meb
nos proporciona una ima-
gen tridimensional de los
espermatozoides.
L cviui: uioo ov i vio DGEP
a
b
c
1 m
0.5 m
10 m
80
U 3 UAS
Tabla 3.1 Comparacin de clulas procariotas y eucariotas
ESTRUCTURA CLULAS CLULAS EUCARIOTAS
PROCARIOTAS CLULA ANIMAL CLULA VEGETAL
Membrana plasmtca S S S
Pared celular S No S
Ncleo No S S
Cromosomas Hebra circular de adn Muchos Muchos
Ribosomas S (pequeos) S (grandes) S (grandes)
Retculo endoplsmico No S S
Aparato de Golgi No S S
Lisosomas No S S
Vacuolas No Pequeas o nada S
Mitocondrias No S S
Cloroplastos No No S
Citoesqueleto No S S
La clula procariota
Las clulas procariotas son las formas de vida ms antguas que se conocen; se han encontrado
fsiles de ellas en estratos rocosos con una edad de 3 mil 500 millones de aos. Estas clulas slo
las vamos encontrar en los organismos de los reinos Archaebacteria (arqueobacterias) y Eubac-
teria (eubacterias).
Las clulas procariotas son usualmente ms pequeas que las eucariotas y adems, son ms
sencillas en su estructura. Su tamao promedio es de 1 a 10 micrmetros. Todas contenen un
citoplasma con una gran cantdad de ribosomas, una sola cadena de adn (material gentco) y
una membrana plasmtca circundante. El material gentco, por lo regular, est enrrollado y
adherido en un punto a la membrana plasmtca, y concentrado en una regin de la clula lla-
mada nucleoide. Como se mencion anteriormente, no est fsicamente separado del resto del
citoplasma por una membrana.
Adems del cromosoma muchas bacterias contenen en su citoplasma pequeos trozos circu-
lares de adn llamados plsmidos, los cuales por lo regular contenen de 2 a 30 genes.
Tambin todas las clulas procariotas presentan, con excepcin de los micoplasmas (las bac-
terias mas pequeas) una pared celular. Las sustancias que forman la pared son secretadas por
la misma clula. Hay otras estructuras como la cpsula, esporas, fagelos y pili (singular, pilus) o
fmbrias, que se presentan slo en algunas de estas clulas.
81
L cviui: uioo ov i vio DGEP
La clula eucariota
En una clula eucariota, el
material dentro de la mem-
brana plasmtca se divide
en el ncleo, organelo que
contene el material gent-
co, y el citoplasma. El cito-
plasma, a su vez, est const-
tuido por el citosol y el resto
de los organelos. El citosol es
una solucin acuosa de sa-
les, azcares, aminocidos,
protenas, cidos grasos, nu-
cletdos y otros materiales.
Muchas reacciones biolgi-
cas ocurren en l gracias a
las enzimas (protenas) que
catalizan dichas reacciones.
Suspendidos en el citosol se
encuentran los organelos, es-
tructuras que trabajan como
rganos en miniatura, llevan-
do a cabo funciones especfcas en la clula. En el citoplasma tambin existe una red de fbras o
flamentos proteicos que forman un sistema de sostn intracelular llamado citoesqueleto. Con al-
gunas excepciones, todas las clulas eucariotas contenen los siguientes organelos: ncleo, retculo
endoplsmico, ribosomas, aparato de Golgi, mitocondrias y vesculas. Las clulas eucariotas son
ms grandes que las procariotas. La mayora de las clulas eucariotas varian entre 5 y 100 m de
dimetro. Las clulas de los protstas, hongos, plantas y animales son clulas eucariotas.
Figura 3.7 Una clula procariota tpica tene pared y membrana plasmtca,
pero no tene ncleo. Dnde est localizado el material gentco?
Nucleoide (ADN)
Pilus o
fmbria
Ribosomas
Grnulo de
alimento
Flagelo
procaritico
Plsmido (ADN)
Citoplasma
Membrana
plasmtica Pared celular
Cpsula
o capa
mucilaginosa
Figura 3.8 A la derecha micrografa electrnica de las clulas de una
hoja de maz y a la izquierda dibujo elaborado en base a esta.
Pared celular
Membrana plasmtica
Envoltura nuclear
Ncleo
Nuclolo
Mitocondria
Grano de almidn
Cloroplasto
Vacuola
82
U 3 UAS
Adems de todos los organelos mencionados, debemos sealar que las clulas de las plan-
tas poseen dos estructuras especiales que las diferencian de las clulas animales. La primera
es una pared celular de celulosa que rodea la membrana plasmtca y cuya funcin es proteger
y sostener a la clula. La segunda, son los plastos, como el cloroplasto, organelo membranoso
que contene el pigmento verde llamado clorofla y cuya funcin es atrapar la energa solar y
utlizarla para sintetzar carbohidratos u otras molculas orgnicas. Otras diferencias entre las
clulas animales y vegetales son la presencia de grandes vacuolas en las clulas vegetales, mien-
tras que en las clulas animales son pequeas o no existen. Las clulas animales poseen un par
de centrolos situados muy cerca del ncleo, mientras que las clulas vegetales carecen de ellos.
Las fguras 3.9 y 3.10 son un modelo de clula animal y vegetal respectvamente, que mues-
tran todas las estructuras caracterstcas de estas clulas.
Filamentos
intermedios
Membrana
plasmtica
Flagelo
Citoplasma
Retculo endoplsmico
rugoso
Ribosoma
Lisosoma
Microtbulos
Retculo
endoplsmico
liso
Ribosoma libre
Mitocondria
Vescula
Vescula
Aparato
de Golgi
Envoltura
nuclear
Poro nuclear
Ncleo
Centrolos
Cromatina (ADN)
Nuclolo
Figura 3.9 Modelo de clula animal que muestra cada una
de sus estructuras. Qu organelo de esta clula no se en-
cuentra en la clulas vegetales?
83
L cviui: uioo ov i vio DGEP
Forma y tamao de las clulas
Tanto las clulas procariotas como eucariotas presentan una gran diversidad o variedad en sus
formas y tamaos, que representan su adaptacin evolutva a distntos ambientes o a diferentes
funciones especializadas dentro de un organismo multcelular.
Figura 3.10 Modelo de clula vegetal que muestra cada una de sus estructuras. Qu organelos caracterstcos de
estas clulas, no estan presentes en las clulas animales?
Mitocondria
Vacuola
central
Plasmodesmo
Pared
celular
Membrana
plasmtica
Filamentos
intermedios
Ribosoma libre
Ribosomas
Nuclolo
Ncleo
Envoltura
nuclear
Poro nuclear
Cromalina
Plstido
Microtbulos
(parte del citoesqueleto)
Cloroplasto
Aparato de Golgi
Retculo
endoplsmico
liso
Vescula
Retculo
endoplsmico
rugoso
84
U 3 UAS
Forma de la clula
Aunque tenden a ser esfricas o globulares cuando se encuentran aisladas, las clulas presentan
numerosas formas caracterstcas; estas se deben a algunos factores como:
La existencia de las paredes celulares, que presentan las clulas de las plantas, hongos y
muchos organismos unicelulares.
La presin que ejercen unas clulas sobre otras.
La disposicin del citoesqueleto, especie de armazn que presentan en el citoplasma las
clulas eucariotas.
Las funciones que cumplen las clulas y para las cuales estn adaptadas.
En los tejidos y rganos que consttuyen el cuerpo humano se han identfcado por lo me-
nos 200 tpos diferentes de clulas. Algunas de ellas son: los eritrocitos o glbulos rojos de la
sangre que tenen la forma de un pequeo disco bicncavo debido a que han perdido el ncleo,
lo que les permite disponer de una mayor superfcie para el transporte del oxgeno. Las clulas
sexuales masculinas o espermatozoides tenen la forma de un renacuajo con una larga cola, que
es un fagelo que utlizan para desplazarse y as poder llegar al vulo. Las neuronas de forma
estrellada poseen largas extensiones que les permiten la transmisin de impulsos nerviosos. Las
clulas epiteliales, que cubren y protegen al cuerpo, tenen la forma de pequeos tabiques o la-
drillos. Las clulas musculares lisas que consttuyen rganos como el estmago, tenen la forma
Figura 3.11 Observa las variadas formas de algunas clulas humanas.
Osteocito
Neurona
Glbulos rojos
vulo y espermatozoides
humanos
Glbulos blancos
85
L cviui: uioo ov i vio DGEP
de huso. Los leucocitos o glbulos blancos son esfricos dentro de la sangre, pero, para salir de
los vasos sanguneos y cumplir con su funcin defensiva, emiten pseudpodos (prolongaciones
citoplsmicas), variando su forma a medida que se desplazan.
Las clulas vegetales son esfricas, ovoides, polidricas, cilndricas, reniformes, etc. Tambin
los organismos unicelulares procariotas (eubacterias y arqueobacterias) y los eucariotas (proto-
zoarios, levaduras y muchas algas) presentan un sinfn de formas.
Figura 3.12 Algunas formas de clulas entre los organismos unicelulares.
Bacilos
Algas / Diversas diatomeas Dinofagelado
Protozoarios
Bacterias
Paramecium Stentor Trypanosoma
Cocos Espirilos
86
U 3 UAS
Tamao de las clulas
Las clulas son generalmente microscpi-
cas; su tamao se mide por medio de mi-
crmetros. La mayora de las clulas tenen
dimensiones comprendidas entre 1 y 20
micrmetros de dimetro. Sin embargo,
las hay mucho ms pequeas que 1 micr-
metro y algunas son tan grandes que pue-
den ser observadas a simple vista. Entre
las ms pequeas, tenemos a las bacterias
de los grupos micoplasma y ricketsia, que
miden 0.2 0.3 micrmetros de dimetro
y entre las ms grandes, destacan las algas
marinas del gnero Acetabularia, las ye-
mas de los huevos de las aves y los huevos
de los peces (como el caviar que son los huevos de un pez llamado esturin). Todas estas clulas
tenen dimensiones de centmetros y pueden ser observadas a simple vista. Por lo general, las
Ncleo
Figura 3.14 La alga marina Acetabularia es una clula eu-
cariota gigante de 5 cm de altura.
Figura 3.13 Las clulas varan mucho en tamao. 1 micrmetro (m) es la milsima parte de 1 milmetro y 1 nan-
metro (nm) es la milsima parte de 1 micrmetro.
El nmero de clulas
Como ya se ha comentado, el tamao de un individuo es independiente de las dimensiones de
los elementos celulares que lo forman, pero no de su nmero. En los animales y en las plantas
verdes, los de mayor tamao tenen tambin un nmero superior de clulas. El ser humano
proviene de una sola clula fecundada, el cigoto. A lo largo del proceso de gestacin y debido a
los contnuos procesos de divisin celular (mitosis), el infante suele pesar al nacer aproximada-
mente 3 kg y est formado por unos 2 billones de clulas, mientras que el cuerpo de un adulto
est formado de 70 a 100 billones de clulas.
Molcula de
hemoglobina
tomo de
hidrgeno
0.1 nm 1 nm 10 nm 100 nm 1 m 10 m 100 m
Ribosoma
Virus
Bacteria
Mitocondria
Clula
animal
Clula
vegetal
87
L cviui: uioo ov i vio DGEP
clulas de los organismos multcelulares son casi del mismo tamao; as, el tamao de las clulas
de una lombriz de terra, un ratn, un ser humano o una ballena azul, es aproximadamente igual.
La ballena azul es el organismo de mayor tamao simplemente porque sus genes estn progra-
mados para la formacin de un mayor nmero de clulas.
La mayora de las clulas son pequeas por dos razones: en primer lugar, casi todos los nu-
trimentos y desechos se mueven dentro, y salen de las clulas por difusin, la cual funciona
para mover molculas a distancias muy cortas, de algunos micrmetros, pero es muy lenta para
llevar a cabo el transporte en distancias ms largas. Por ejemplo, se ha calculado que si existera
una clula de 20 centmetros de dimetro las molculas de oxgeno tardaran ms de 200 das
en llegar al centro de ella. Esto obviamente no permitra la vida en la clula. En segundo lugar,
a medida que una clula crece, su volumen aumenta ms rpidamente que su superfcie, de tal
manera que en una clula muy grande, la superfcie de la membrana sera demasiado pequea
para permitr que entraran los sufcientes nutrimentos y oxgeno o salieran los desechos, lo cual
causara la muerte de la clula.
La estructura y funcin celular
Como las clulas son las unidades o bloques de construccin de todos los seres vivos, es muy
importante saber ms de ellas. El saber cmo est consttuida y cmo funciona cada una de sus
estructuras, ha permitdo a la humanidad comprender y poder resolver algunos problemas muy
importantes para ella, por ejemplo, los relacionados con la alimentacin, la salud, la enferme-
dad, el envejecimiento y la herencia biolgica. A contnuacin describiremos cada una de las
estructuras de una clula eucariota, en el siguiente orden:
Membrana plasmtca
Ncleo
Citoplasma (organelos citoplsmicos)
La membrana plasmtca
La membrana plasmtca conocida anteriormente como membrana celular es una cubierta que
envuelve y delimita a la clula separndola del medio externo. Funciona como una barrera entre
el interior de la clula y su entorno ya que permite la entrada y salida de molculas a travs de
ella. Este paso de molculas es un fenmeno llamado permeabilidad. Pero la membrana no deja
pasar facilmente a todas las molculas, por lo que es selectvamente permeable.
La membrana plasmtca es muy delgada, mide de 7 a 10 nanmetros (nm) de grosor, por
lo que el microscopio ptco no la detecta, slo puede ser observada con el microscopio elec-
trnico.
A medida que se ha ido obteniendo informacin sobre la membrana plasmtca, se han pro-
puesto varios modelos que explican como est estructurada y como funciona. El que se acepta
actualmente es el modelo del mosaico fuido, propuesto por los bilogos celulares S. J. Singer y
G. L. Nicolson en 1972.
88
U 3 UAS
Este modelo propone que la membrana est formada por dos capas (bicapa) de fosfolpidos
en la que estn incluidas numerosas protenas; las que se localizan en la superfcie exterior o en
la interior de la bicapa lipdica se llaman protenas perifricas, y las que penetran la bicapa son
protenas integrales. A veces las protenas y los lpidos tenen carbohidratos unidos a ellas, for-
mando glucoprotenas y glucolpidos, respectvamente.
La bicapa de fosfolpidos tambin contenen colesterol. Algunas membranas como las de las
mitocondrias tenen unas cuantas molculas, pero algunas otras membranas tenen la misma
cantdad de colesterol y fosfolpidos. El colesterol hace que la bicapa sea ms fuerte y fexible,
pero menos fuida y permeable a sustancias solubles en agua.
Debido a que las molculas de fosfolpidos no estn unidas entre s, esta doble capa es bas-
tante fuida, permitendo un movimiento lateral tanto de los fosfolpidos como de las protenas.
Se dice que la gran variedad de protenas que consttuyen la membrana forman un mosaico
proteico. Por ejemplo, la membrana celular del glbulo rojo contene ms de 50 protenas dife-
rentes. A algunas de estas protenas se les llama protenas de transporte ya que partcipan en el
movimiento de sustancias a travs de la membrana. Hay dos tpos de protenas de transporte, las
llamadas canales proteicos, que forman poros o canales, y las protenas portadoras, que como
su nombre lo indica, transportan sustancias a travs de la membrana.
Todas las membranas de la clula, incluso la de los organelos como el ncleo, retculo endo-
plsmico, aparato de Golgi, mitocondrias, lisosomas y cloroplastos, poseen esta misma estructura
bsica, aunque los tpos y cantdades de lpidos, protenas y carbohidratos varan dependiendo
del organelo.
Glucoprotena
Carbohidrato
Glucolpido
Cabeza del
fosfolpido
Bicapa
lipdica
Interior de
la clula
(citoplasma)
Protenas perifricas
Colas de cidos
grasos
Colesterol
Protenas
integrales
Figura 3.15 Modelo de la membrana plasmtca, determinado a partr de micrografas electrnicas y datos bioqu-
micos. Qu nombre recibe este modelo de membrana?
Uioo UAS
89
L cviui: uioo ov i vio DGEP
Movimiento de las sustancias a travs de la membrana plasmtca
Para poder vivir y crecer las clulas necesitan recibir constantemente nutrientes y eliminar las
sustancias de desecho antes de que se acumulen en ella y le causen algn dao. Tambin la clu-
las secretan sustancias producidas por ellas mismas. Todos los nutrientes, desechos y secreciones
deben pasar a travs de la membrana.
Hay tres formas generales por medio de las cuales las sustancias atraviesan la membrana
plasmtca:
Transporte pasivo
Transporte actvo
Transporte mediado por vesculas
Transporte pasivo
Es el movimiento de sustancias a travs de la membrana plasmtca en el que no se requiere
energa para realizar el trabajo de transportar sustancias por parte de la clula. El transporte
pasivo depende de la energa cintca de las partculas de la materia (tomos, iones, molculas)
que las mantene en constante movimiento. En los slidos, las partculas vibran en un solo sito;
en cambio, en los lquidos y en los gases se mueven de un sito a otro al azar, es decir, se mueven
en lnea recta hasta que chocan con otras partculas; rebotan entre ellas y cambian de direccin.
Durante el transporte pasivo, las sustancias se mueven de un medio de mayor concentracin a
uno de menor concentracin, es decir, a favor de un gradiente de concentracin. Un gradiente de
concentracin es una medida de la diferencia en la concentracin de una sustancia en dos regio-
nes. Son mecanismos de transporte pasivo la difusin simple, la smosis y la difusin facilitada.
La difusin
La difusin es el movimiento de las partculas de una regin de mayor concentracin a otra de
menor concentracin, producida por el gradiente de concentracin. Puede ocurrir dentro de un
lquido o de un gas, o a travs de una barrera, como una membrana.
Molculas
de tinta
Figura 3.16 Las molculas
de tnta difunden a travs
del agua en el vaso de preci-
pitado hasta que estn uni-
formemente distribuidas.
89
90
U 3 UAS
La fgura 3.16 muestra un ejemplo de difusin en agua. Se agrega una gota de tnta roja en un
vaso de agua, lentamente esta se va tornando de color rojo. Qu sucedi?
La gota de tnta est consttuida por muchas molculas individuales de pigmento, las cuales se
desplazan por su energa cintca de la regin de mayor concentracin de la tnta (la gota), hacia
la de menor concentracin (agua). Lo mismo sucede con las molculas de agua; estas se mue-
ven hacia la gota de tnta donde est en menor concentracin. La difusin de ambas molculas
se detene cuando estn uniformemente dispersas. En este momento no existe un gradiente de
concentracin ni de la tnta ni del agua.

Difusin simple
Muchas molculas atraviesan la membrana plasmtca por difusin debido a las diferencias de
concentraciones entre el citoplasma de la clula y su medio externo. Entre las molculas que
pasan por difusin estn las de agua, oxgeno, bixido de carbono y las solubles en lpidos.
Al proceso de difusin de molculas a travs de la membrana plasmtca se le llama difusin
simple.
El agua, el oxgeno y el bixido de carbono pasan a travs de los espacios que hay entre las
molculas que forman la membrana. Las sustancias solubles en lpidos como el alcohol etlico
y la vitamina A, pasan a travs de la membrana disolvindose en ella.
smosis
La smosis es la difusin del agua a travs de una membrana selectvamente permeable, des-
de una regin donde est ms concentrada a una regin donde lo est menos. Como habrs
observado, smosis es el nombre especial que recibe la difusin simple del agua, debido a las
consecuencias tan drstcas que puede tener para las clulas. Las clulas no tenen control sobre
la smosis. La direccin en la cual se difunde el agua depende slo de la concentracin de las
molculas de agua fuera y dentro de la clula. En su mayor parte, las membranas celulares son
muy permeables al agua.
Todas las clulas contenen sustancias disueltas en su citoplasma como sales, azcares, pro-
tenas, etc., por lo que el fujo de agua por la membrana va a depender de la concentracin de
agua en el lquido que baa o rodea a la clulas. Veamos cmo afecta este proceso a la clula de
una planta. Si la solucin que rodea a la clula tene una concentracin ms alta de molculas
de agua que el contenido de la clula, las molculas de agua entrarn a la clula y causarn una
presin dentro de ella llamada turgencia. Esto provoca que la clula se ponga rgida, permiten-
do que tejidos suaves de la planta como los ptalos, hojas y tallos ternos se mantengan frmes.
Pero en cambio, si la solucin que rodea a la clula tene una concentracin de agua menor que
dentro de la clula, el agua difundir hacia fuera de la clula, perdindose la turgencia. Esto cau-
sa que el contenido celular se encoga y los tejidos suaves de la planta se marchiten. Observa la
fgura 3.17 donde se muestra lo que sucede en una clula vegetal y en una animal, dependiendo
de las concentraciones de agua fuera las clulas.
Uioo UAS
91
L cviui: uioo ov i vio DGEP
Figura 3.17 Como un resultado de la smosis, las clulas responden de diferente manera cuando la concentracin de
agua dentro de la clula es igual a, mayor que, o menor que la concentracin de agua a su alrededor.
H
2
O
EFECTOS DE LA CONCENTRACIN DE AGUA EN CLULAS
CONCENTRACIN
DE AGUA
GLBULO ROJO
(animal)
CLULA DE ELODEA
(vegetal)
a) Igual concentracin de agua La clula no se altera
La clula no se altera
b) Mayor concentracin
de agua fuera de la clula
La clula estalla
(Citlisis)
La clula se hincha
c) Mayor concentracin de
agua dentro de la clula
La clula se encoge
(Plasmlisis)
El contenido celular
se encoge
Molculas de agua
H
2
O
H
2
O
H
2
O
H
2
O
H
2
O
Sustancias disueltas
92
U 3 UAS
Difusin facilitada
Muchas sustancias necesarias para
la clula como los iones (K
+
, Na
+
,
Ca
2+
), los monosacridos y los ami-
nocidos, a pesar de estar en mayor
concentracin fuera de la membra-
na plasmtca, no pueden atrave-
sarla ya que son sustancias insolu-
bles en lpidos o demasiado grandes
para abrirse paso a travs de ella.
Entonces, cmo pasan a travs de
la membrana plasmtca? Estas mo-
lculas pueden atravesar y difundir-
se slo con la ayuda de las prote-
nas de transporte: las protenas de
canal y las protenas portadoras. La
difusin de molculas a travs de la
membrana plasmtca con molcu-
las de transporte se conoce como
difusin facilitada.
Las protenas de canal forman
poros permanentes o canales, en
la bicapa lipdica, por medio de los
cuales ciertos iones pueden cru-
zar la membrana (fgura 3.18). Las
protenas portadoras tenen sitos
de unin para molculas especf-
cas. Como resultado de la unin,
las protenas portadoras cambian
su forma, haciendo que la molcula
pase a travs de la parte central de
la protena hacia el otro lado de la
membrana (fgura 3.19). Las prote-
nas portadoras son muy especfcas,
cada una de ellas tene un punto de
unin caracterstco por el que se
une a una clase partcular de mol-
cula, pero no a otra que podra ser
casi idntca. La unin entre la pro-
tena portadora y la molcula trans-
portada es transitoria. Despus de
Figura 3.19 Las protenas portadoras cambian su forma para
permitr que ciertas molculas pasen la membrana. Qu mol-
culas utlizan este mecanismo de transporte?
Protena
portadora
Protena
canal
Figura 3.18 Las protenas de canal proporcionan un pasaje a
travs de los cuales partculas como los iones pueden atrave-
sar la membrana.
93
L cviui: uioo ov i vio DGEP
que la molcula ha pasado al otro lado de la membrana, la protena portadora queda libre
y puede empezar un nuevo ciclo para ayudar a otras molculas de esta sustancia a cruzar la
membrana. Las molculas que utlizan este mecanismo de transporte son los aminocidos, los
monosacridos como la glucosa y algunas protenas pequeas. Recuerda que en la difusin
facilitada las molculas se mueven a favor de un gradiente de concentracin, es decir, de una
regin de mayor concentracin a otra de menor concentracin.
Transporte actvo
Todas las clulas necesitan introducir o eliminar algunas sustancias en contra de su gradiente de
concentracin (de una regin de menor concentracin a una de mayor). Como el movimiento es
opuesto a la direccin normal de la difusin, la clula usa energa proporcionada por la molcula
de atp (adenosin trifosfato). Este proceso por medio del cual las molculas pasan a travs de
la membrana en contra de un gradiente de concentracin y con uso de energa por parte de la
clula se llama transporte actvo. Este transporte ocurre con la ayuda de otro tpo de protenas
de transporte, las cuales poseen dos sitos actvos, uno al que se va unir la molcula que se va a
transportar y otro para que se una el atp. Este ltmo cede energa a la protena, haciendo que
esta cambie de forma y mueva la molcula al otro lado de la membrana. Una vez liberada la mo-
lcula, la protena de transporte recupera su forma original y puede seguir repitendo el proceso.
Un ejemplo de transporte actvo es el paso del yodo de la sangre hacia la glndula troides. Tam-
bin hay evidencias de que la glucosa, los aminocidos y algunos iones pasan a las clulas por
este tpo de transporte.
Alta concentracin
de iones
Iones
Baja concentracin
de iones
Energa
Protena
transportadora
Figura 3.20 En el transporte actvo, la energa es usada para modifcar la forma de una protena transportadora. Este
cambio permite el movimiento de un in o molcula a travs de la membrana desde una regin de concentracin
ms baja a una de mayor concentracin.
94
U 3 UAS
(Lquido extracelular)
Pinocitosis
(Citoplasma)
Vescula que
contiene fuido
extracelular
Clula
Fagocitosis
Partcula
de alimento
Pseudpodo
Partcula incluida en
una vacuola alimenticia
1 2
3
Figura 3.21 Endocitosis.
a) Pinocitosis: una parte
de la membrana plasmt-
ca se hunde, conteniendo
lquido extracelular, y lo
introduce en el citoplasma
como una vescula. b) Fa-
gocitosis: los pseudpodos
rodean una partcula, los
extremos se fusionan, for-
mando una gran vescula
(vacuola alimentcia) que
contene a la partcula.
1
2
3
Transporte mediado por vesculas: endocitosis y exocitosis
En los procesos de transporte anteriores se ha visto como las molculas pequeas pasan a travs
de la membrana plasmtca, pero las clulas tambin pueden introducir materiales grandes que
no pueden pasar a travs de la membrana, por un proceso llamado endocitosis (del griego den-
tro de la clula). Hay dos tpos de endocitosis: la pinocitosis y la fagocitosis. En ambos procesos
los materiales son introducidos en la clula en un saco membranoso llamado vescula. En la pino-
citosis la clula introduce lquidos dentro de vesculas pequeas, mientras que en la fagocitosis
la clula introduce materiales grandes y slidos como los microorganismos dentro de vesculas
grandes.
En la pinocitosis una parte muy pequea de la membrana plasmtca se hunde, contenien-
do lquido extracelular. Esta depresin formada se separa como una vescula llena de lquido
(Fig. 3.21).
Casi todas las clulas eucariotas, tanto las de organismos unicelulares como las de animales
multcelulares, introducen constantemente lquidos mediante la pinocitosis. En cambio, la fago-
citosis slo se ha observado en algunos organismos unicelulares como la amiba y en clulas ani-
males como los leucocitos, que son clulas de la sangre que se encargan de defender al organis-
mo, fagocitando las bacterias patgenas o dainas que han penetrado a l. Por ejemplo, un leu-
cocito llamado macrfago emite extensiones de su membrana llamadas pseudpodos (del latn
falso pie). Los pseudpodos rodean
a la bacteria, los extremos se fusionan
formando una vescula grande (vacuo-
la alimentcia) que engloba a la bac-
teria. La vacuola alimentcia
se fusiona con lisosomas
cuyas enzimas digieren
a la bacteria. Este mis-
mo proceso es llevado
a cabo por los organis-
mos unicelulares para
obtener nutrientes.
95
L cviui: uioo ov i vio DGEP
Figura 3.22 Exocitosis. Ilustracin y micrografa electrnica (derecha) sobre la exocitosis. El
material que va a ser sacado de la clula se encuentra dentro de una vescula que se mueve
hacia la superfcie de la clula. Qu sucede cuando la vescula llega a la superfcie celular?
(Exterior de la clula)
Membrana plasmtica
Material
secretado
Membrana
plasmtica
Vescula
(Citoplasma)
1
2
3
0.2 micrmetros
Figura 3.23 El ncleo contene cromatna y nuclolos.
Qu estructuras lo comunican con el resto de la clula?
Nuclolo
Cromatina
Poros
nucleares
Membrana
nuclear
interna
Membrana nuclear externa
La exocitosis es el proceso contrario a la endocitosis, consiste en la salida de sustancias de la
clula hacia el fuido extracelular a travs de una vescula que se origina en el aparato de Golgi
y que al fusionarse con la membrana plasmtca, se abre liberando su contenido. Por exocitosis
la clula expulsa productos de desecho obtenidos de su actvidad o sustancias que normalmente
secreta como son las hormonas y las enzimas que van a ser tles en algn otro sito del orga-
nismo.
El ncleo
El ncleo es el centro de control de la clula
eucariota ya que dentro de l est el material
gentco o adn. Esta molcula posee la infor-
macin necesaria para construir a la clula y di-
rigir las incontables reacciones qumicas nece-
sarias para la vida y la reproduccin. La mayora
de las clulas tenen un ncleo (uninucleadas),
pero algunas tenen dos ncleos (binucleadas)
o ms de dos (multnucleadas) como es el caso
de las clulas musculares estriadas que cons-
ttuyen nuestros msculos. La clula no puede
sobrevivir si el ncleo se ha perdido o se ha da-
ado extensamente, aunque existen algunas
96
U 3 UAS
excepciones como la de los glbulos rojos de los mamferos, los cuales sobreviven durante algu-
nos meses despus de que pierden el ncleo durante el proceso de maduracin, por eso se les
llama clulas anucleadas.
En las clulas uninucleadas el ncleo por lo general se localiza cerca del centro, pero se puede
encontrar en cualquier parte de la clula; su forma puede ser esfrica u ovalada. El ncleo est
consttuido de cuatro partes: la envoltura nuclear, el nucleoplasma, el nuclolo y la cromatna.
La envoltura nuclear
El ncleo est separado del citoplasma circundante por la envoltura nuclear, la cual esta formada
por dos membranas que poseen entre ellas un pequeo espacio (10 a 50 nanmetros), pero que
a intervalos frecuentes se unen formando aberturas circulares o poros nucleares por los cuales
pasan materiales hacia dentro y hacia fuera del ncleo. La envoltura nuclear posee miles de estos
poros.
El nucleoplasma
Es la sustancia fundamental semilquida y rica en protenas localizada dentro de la membrana
nuclear, en la cual se hallan suspendidos los nuclolos y la cromatna.
El nuclolo
El nuclolo es una estructura esfrica que se encuentra en la mayor parte de los ncleos euca-
ritcos. Carece de una membrana propia, por lo que se encuentra rodeado del nucleoplasma.
Puede haber uno o ms nuclolos en el ncleo, cada nuclolo es producido por una regin or-
ganizadora del nuclolo (nor), localizada en un sito partcular de un cromosoma. Los nuclolos
estn formados de arn ribosomal (arnr), protenas, ribosomas en diversos estados de sntesis
y adn.
En el nuclolo se lleva a cabo la sntesis del arnr y el ensamblaje de las dos subunidades que
consttuyen a los ribosomas, organelos encargados de la sntesis de las protenas. Durante la divi-
sin celular, en tanto que la cro-
matna se condensa en cromoso-
mas, el material del nuclolo se
dispersa volviendo a condensar-
se en las nuevas clulas hijas.
La cromatna y cromosomas
Tanto la cromatna como los
cromosomas se localizan dentro
del ncleo, y gracias al micros-
copio electrnico y a los avan-
ces en biologa molecular, se
Centrmero
Cromtidas hermanas
Cromosoma
doble
Cromosoma
sencillo
a)
b)
Figura 3.24 a) Cromosoma sencillo o no duplicado, consta de una
sola cromtda. b) Cromosoma doble o duplicado, consta de dos
cromtdas.






97
L cviui: uioo ov i vio DGEP
Doble
hlice
de ADN
Nucleosoma
Cromosoma doble
Espirales
Superespirales
Protenas histonas
Figura 3.25 Condensacin de cromosomas. Los cromosomas eucariotas contenen adn enrrollado alrededor de unas
protenas llamadas histonas, consttuyendo un nucleosoma. Estos a su vez se enrrollan formando gruesas hebras, las
cuales se siguen enrrollando para formar una estructura compacta, es decir, un cromosoma.
sabe actualmente que ambos tenen la misma composicin qumica, adn y protenas, pero en
diferentes etapas de condensacin. Cuando la clula no est dividindose, el adn es una maraa
de hilos delgados o hebras extendidas a travs del nucleoplasma, cuando se encuentran en esta
forma se le llama cromatna. Cuando la clula va a dividirse, las hebras se enrollan hacindose
ms gruesas y cortas, consttuyendo as a los cromosomas, los cuales pueden observarse con
el microscopio compuesto de luz. Es-
tos cromosomas condensados miden
de 5 a 20 micrmetros de longitud
aproximadamente, en cambio, estos
mismos cromosomas en su fase de
cromatna miden de 10 mil a 40 mil
micrmetros de longitud. Los cromo-
somas son los portadores del mate-
rial hereditario, los genes.
La estructura de los cromosomas
es sencilla, consta de un flamento de
adn y protenas llamado cromtda;
en una regin de la cromtda se ob-
serva una pequea zona circular lla-
mada centrmero.
Antes de que la clula inicie su
divisin, cada cromosoma se duplica
apareciendo entonces cromosomas
dobles, los cuales tenen dos crom-
tdas unidas por un solo centrmero.
Cromtidas hermanas
Centrmero
Figura 3.26 Micrografa electrnica de barrido que muestra
algunos cromosomas humanos durante la divisin celular.
Son cromosomas sencillos o dobles?
98
U 3 UAS
Mientras estn unidas, reciben el nombre de cromtdas hermanas. Cada cromtda es una mo-
lcula nica de adn idntca al adn del cromosoma original antes de la duplicacin. Durante la
divisin celular, las dos cromtdas hermanas se separan, y cada cromtda forma un cromosoma
hijo independiente que seran distribuidos equitatvamente en cada clula hija.
Organelos celulares
Como ya se mencion anteriormente, el material dentro de la membrana plasmtca se divide
en el ncleo y el citoplasma. El citoplasma a su vez est consttuido por el citosol y los organelos
restantes, estos organelos que se encuentran inmersos en el citosol sern descritos a contnua-
cin.
El retculo endoplsmico (re)
El retculo endoplsmico (re) descubierto en 1945 por Keith Porter, es un conjunto de sacos apla-
nados, tubos y canales membranosos interconectados en el citoplasma. El re forma una red que
se extende desde la membrana nuclear hasta la membrana celular. Existen dos tpos de retculo
endoplsmico, rugoso y liso, los cuales son contnuos uno con el otro. El re rugoso (rer) tene
numerosos ribosomas adheridos a su superfcie externa, los cuales le dan un aspecto rugoso, de
ah su nombre. En cambio, el re liso (rel) carece de ribosomas. El rer partcipa principalmente
en la sntesis de protenas debido a su asociacin con los ribosomas; las protenas sintetzadas
pasan al interior del re y pueden permanecer all para ser utlizadas en el interior de la clula
o fnalmente pueden ser secretadas hacia el exterior. El rel est ms bien relacionado con la
sntesis y transporte de lpidos (grasas, fosfolpidos y esteroides) o en la destoxifcacin de una
variedad de venenos. Los materiales (protenas, lpidos) destnados a ser secretados se transpor-
tan a travs del citoplasma en vesculas que se han desprendido del retculo endoplsmico. Estas
vesculas migran hacia el aparato de Golgi al cual se fusionan. Una vescula es una pequea esfera
o bolsita rodeada por una membrana que contene diversas sustancias.
Adems de tener diferente funcin, el rer y el rel tambin se distnguen por la disposicin y abun-
dancia de sus membranas. Las membranas del rer estn dispuestas como pilas de sacos aplanados,
mientras que las membranas del rel estn formando una red de tubos; observa la fgura 3.27.
Los ribosomas
Los ribosomas son organelos no membranosos que estn consttuidos por dos subunidades, una
grande y otra pequea, cada una de las cuales est compuesta de arn ribosomal (arnr) y una
gran cantdad de protenas. Cuando se juntan las dos subunidades, forman una compleja mqui-
na molecular. En las micrografas electrnicas, los ribosomas se observan como grnulos obscuros
que se pueden encontrar libres en el citoplasma, ya sea aislados o en grupos (polirribosomas), o
adheridos a la membrana del retculo endoplsmico y a la membrana externa del ncleo. Tienen
un dimetro aproximado de 15 a 30 nanmetros. A pesar de que los ribosomas son muy peque-
os, su funcin es muy importante ya que en ellos se lleva a cabo la sntesis de protenas, por lo
99
L cviui: uioo ov i vio DGEP
que se les conoce como las fbricas de protenas de la clula. Los ribosomas son los organelos
celulares ms numerosos; una clula puede contener hasta medio milln de ribosomas, especial-
mente si est actva sintetzando protenas.
La distribucin de los ribosomas en las clulas eucariotas est relacionada con la utlizacin
de las protenas ya sea dentro o fuera de la clula. Por ejemplo, en los glbulos rojos inmaduros
que fabrican hemoglobina, los ribosomas se distribuyen en todo el citoplasma; mientras que en
clulas productoras de enzimas digestvas, hormonas o mucus que son liberados o exportados
fuera de la clula, los ribosomas se encuentran en gran cantdad unidos al retculo endoplsmico.
Tanto las clulas procariotas como las eucariotas poseen ribosomas, aunque en las primeras
son ms pequeos.
El aparato de Golgi
Este organelo fue descubierto en 1898 por el citlogo italiano Camilo Golgi, quien le llam apa-
rato retcular interno. Por esta aportacin, Golgi recibi el premio Nobel en 1906. El nombre de
aparato de Golgi le fu asignado en 1914 por el investgador espaol Santago Ramn y Cajal en
honor a su descubridor. El aparato de Golgi es un conjunto de sacos aplanados membranosos
que se originan a partr del retculo endoplsmico. Alrededor del aparato de Golgi hay pequeas
vesculas de 50 nanmetros o ms de dimetro. Las protenas y lpidos sintetzados por el retculo
endoplsmico llegan al aparato de Golgi, donde algunas molculas pueden ser modifcadas, por
ejemplo, agregndoles azcares para hacer glucoprotenas y glucolpidos. Finalmente empaca
estas sustancias en vesculas que son transportadas a otras partes de la clula o a la membrana
celular para su exportacin. Cuando las sustancias empacadas son enzimas digestvas, la vescula
recibe el nombre de lisosoma; resumiendo sus funciones son almacenar, modifcar y empacar
las sustancias de secrecin. Es especialmente notable en las clulas que partcipan actvamente
Figura 3.27 a) Micrografa electrnica y b) dibujo del retculo endoplsmico rugoso. Qu organelos se encuentran
adheridos al retculo endoplsmico?
Ribosomas
a)
b)
100
U 3 UAS
a) b)
Vesculas
Figura 3.28 a) Micrografa electrnica y b) dibujo de un aparato de Golgi. Ntense las vesculas que se segregan de
los bordes del aparato de Golgi.
Uioo UAS
Figura 3.29 Micrografa electrnica y dibujo que muestra
dos lisosomas digiriendo dos mitocondrias desgastadas.
Lisosomas que contienen
mitocondrias defectuosas
Aparato de Golgi
con lisosomas en
liberacin
Mitocondrias casi completamente digeridas
0.5micrmetros
en el proceso de secrecin. Las clulas de los animales suelen contener de 10 a 20 aparatos de
Golgi y las de las plantas pueden tener varios centenares. La celulosa secretada por las clulas
vegetales para formar la pared celular se sintetza dentro del aparato de Golgi.
Los lisosomas
Los lisosomas descubiertos en 1949 por Christan de Duve, son vesculas que contenen enzimas
digestvas que pueden fragmentar por hidrlisis a las protenas, grasas y carbohidratos en las
subunidades que los consttuyen.
Las enzimas digestvas son sintetzadas por los ribosomas del retculo endoplsmico. Hasta
la fecha, los investgadores han encontrado unas 50 enzi-
mas digestvas en los lisosomas. Con algunas excepciones,
los lisosomas se encuentran en todas las clulas animales,
as como en muchos protstas y hongos y en una variedad
de clulas vegetales.
El tamao de los liso-
somas vara desde 0.5
micrmetros de di-
metro hasta varios mi-
crmetros, en el caso
de vesculas grandes.
101
L cviui: uioo ov i vio DGEP
Una de las funciones de
los lisosomas es digerir los
alimentos y otros materia-
les que entran a la clula por
endocitosis. Por ejemplo,
cuando un organismo unicelular como la amiba ingiere una partcula alimentcia por fagocitosis,
esta queda dentro de un saco membranoso llamado vacuola alimentcia. Los lisosomas reconocen
esta vacuola alimentcia y se fusionan o unen con ella. El contenido de las vesculas se mezcla y las
enzimas lisosmicas intervienen en el catabolismo de las molculas que consttuyen a los alimen-
tos convirtndolas en monmeros (aminocidos, cidos grasos y monosacridos). Estas molculas
se difunden fuera de la vacuola hacia el citoplasma para nutrir la clula. De esta manera, tambin
los glbulos blancos de la sangre nos defenden de muchas enfermedades al fagocitar y digerir las
bacterias patgenas o dainas que penetran a nuestro organismo. Otra funcin de los lisosomas es
digerir organelos defectuosos, daados o viejos, como mitocondrias o cloroplastos. Los organelos
defectuosos son incluidos en vesculas que se fusionan con los lisosomas. Este proceso permite que
la clula vuelva a utlizar o recicle las sustancias que consttuyen a estos organelos. Tambin partci-
pan en la destruccin o autolisis de la clula. Cuando una clula muere, los lisosomas se revientan
y sus enzimas degradan sus componentes, los cuales pueden ser utlizados como materia prima por
otras clulas.
Un ejemplo muy interesante de un lisosoma es el que se encuentra en la parte superior de un
espermatozoide humano, al que se le da el nombre de acrosoma. La funcin de este lisosoma gigan-
te es la de digerir mediante
sus enzimas la cubierta del
vulo, permitendo as que
penetre el espermatozoide
y se lleve a cabo la fecunda-
cin.
Las vacuolas
Casi todas las clulas con-
tenen vacuolas, estas son
cuerpos parecidos a las
burbujas, rodeados por
una membrana cuyo con-
tenido depender de la c-
lula donde se encuentre.
Las clulas vegetales ma-
duras tenen una vacuola
central, que puede llegar
a ocupar hasta tres cuartas
partes o ms del volumen
de la clula. La funcin de
esta vacuola es almacenar
Acrosoma
Ncleo
Mitocondrias
en espiral
Figura 3.30 Espermatozoide humano, donde
se observa un lisosoma gigante llamado acro-
soma. Cul es la funcin de este lisosoma?
Figura 3.31 a) El agua entra a la vacuola central por smosis, elevndose la pre-
sin dentro de la vacuola. Esta presin empuja al citoplasma en contra de la pa-
red celular, lo que permite que la clula est hinchada o turgente, manteniendo
su forma. b) Cuando la vacuola central pierde agua y se encoge, la planta se
marchita. A qu se debe esto?
Citoplasma
Vacuola
central
Membrana plasmtica
Pared celular
(ganancia
de agua)
(prdida
de agua)
a) Clula turgente
b) El citoplasma se encoge y se
aleja de la pared celular
102
U 3 UAS
diversas sustancias de reserva tales como almidn, protenas, grasas y pigmentos. La vacuola, al
hincharse, ejerce presin contra la pared celular proporcionando as a la clula un alto grado de
frmeza o turgencia, lo cual permite que las hojas, fores y tallos ternos de las plantas se manten-
gan frmes y no marchitos.
Otros organismos que presentan vacuolas grandes son las algas y los hongos verdaderos. En
cambio, en las clulas animales si acaso se presentan, son pequeas. Casi todos los protozoarios
tenen vacuolas digestvas con alimentos en proceso de digestn, adems de vacuolas contrc-
tles que expulsan fuera de la clula el exceso de agua. Por ejemplo, en un protozoario de agua
dulce como el Paramecium, el agua entra constantemente a la clula por smosis (fgura 3.32).
Si el exceso de agua no fuera eliminado por las vacuolas contrctles, este organismo estallara.
Recuerda que el Paramecium es un protsta unicelular.
Las mitocondrias
A las mitocondrias se les conoce como las centrales de energa de las clulas debido a que en
ellas se lleva a cabo un proceso muy importante llamado respiracin, en l se obtene la energa
que la clula requiere para realizar sus actvidades como por ejemplo: la sntesis de sustancias, el
transporte actvo, la divisin celular, movimiento de cilios y fagelos, la contraccin muscular, etc.
Si una clula no obtene energa, no slo no funciona sino, adems, al poco tempo se desintegra.
Estos organelos presentan formas muy variadas, las puede haber cilndricas, ovaladas, esfricas
o hasta con la apariencia de una papa. Las micrografas electrnicas muestran que las mitocondrias
presentan dos membranas: una externa lisa que encierra al organelo, y una interna que se dobla
Figura 3.32 El Paramecium contene vacuolas contrctles. a) La smosis ocasiona que el agua entre constantemente
a la clula, la cual es captada por los conductos colectores y drena hacia el depsito central de la vacuola. b) Cuando
est lleno, el depsito se contrae sacando el agua a travs de un poro en la membrana plasmtca.
El agua entra hacia los conductos colectores
y llena el depsito central
Conductos
colectores
Depsito
central
Poro
Vacuola
contrctil
Paramecium
Depsito lleno
a)
b)
Depsito vacio
El depsito se contrae, expulsando
el agua a travs del poro
103
L cviui: uioo ov i vio DGEP
en numerosos sitos for-
mando pliegues, llama-
dos crestas. En el interior
de la membrana interna
se encuentra la matriz,
un lquido muy viscoso.
Las mitocondrias tenen
aproximadamente el ta-
mao de una bacteria,
aunque las puede haber
mucho ms grandes. La
fgura 3.33 muestra una
micrografa electrnica
de una mitocondria, as
como un esquema de su
estructura.
Cuanto mayor sea la cantdad de energa que requiere una clula, ms numerosos son estos
organelos. Por ejemplo, un hepatocito (clula del hgado), que tene un requerimiento de energa
moderado, posee unas 2 mil 500 mitocondrias, mientras que las clulas del msculo cardaco
tenen varias veces ms mitocondrias.
Cuando se observan clulas vivas, las mitocondrias se
mueven de un sito a otro en el citoplasma, cambian de for-
ma y tamao. Tambin al igual que los cloroplastos tenen
su propio adn y sus propios ribosomas, adems de que se
multplican originando nuevas mitocondrias, observa la f-
gura 3.34.
Respiracin celular
Por lo general, cuando se habla de respiracin, inmediata-
mente lo relacionamos con la inspiracin y la espiracin,
que son la entrada y salida respectvamente de aire de
los pulmones. Este proceso es slo un intercambio de ga-
ses entre el organismo y el aire que lo rodea, que permite
aportar oxgeno a las clulas de los tejidos del organismo
y eliminar el bixido de carbono, desecho que resulta de
la actvidad celular. Pero el trmino respiracin tambin
es utlizado por bioqumicos y bilogos celulares para re-
ferirse a un proceso mucho ms complicado mediante el
cual la clula obtene la energa necesaria para realizar
todas sus actvidades. Dicho proceso se realiza dentro de
la clula, por eso se le llama respiracin celular. Durante
este proceso, la principal molcula orgnica utlizada por
las clulas como fuente de energa o combustble es la
Membrana externa
Membrana
interna
Crestas
a)
b)
Figura 3.33 a) Esquema de una mitocondria mostrando su estructura interna y b)
micrografa de una mitocondria. Las mitocondrias estn rodeadas por dos mem-
branas. Qu nombre reciben los pliegues de la membrana interna?
Figura 3.34 Serie de micrografas elec-
trnicas que muestran la divisin de
una mitocondria. Observa que se for-
ma un surco membranoso, el cual di-
vide a la mitocondria en dos mitocon-
drias hijas.
L cviui: uioo ov i vio DGEP
1.
2.
3.
104
U 3 UAS
glucosa. Esta molcula, como ya sabes, es un carbohidrato que posee seis tomos de carbono.
Cuando por alguna razn los carbohidratos disminuyen en el organismo, este puede utlizar los
lpidos y, en casos extremos, las protenas como fuente de energa. Tanto los lpidos como las
protenas son transformadas a glucosa para poder ser utlizadas como combustble.
Con todo lo mencionado anteriormente, podemos defnir la respiracin celular como el pro-
ceso en donde la molcula de glucosa se descompone hasta bixido de carbono (CO
2
) y agua
(H
2
O), liberndose la energa qumica que contene. La energa liberada de la glucosa no queda
libre,

sino que pasa a formar enlaces de fosfato en una molcula que cede fcilmente la energa,
llamada trifosfato de adenosina o atp.
Como recordars, esta energa que se libera proviene del Sol y fue atrapada durante la foto-
sntesis en forma de energa qumica contenida en los enlaces de molculas orgnicas (carbohi-
dratos, lpidos y protenas) y que almacenada en los alimentos, puede ser utlizada por las clulas
por medio del proceso de la nutricin.
La respiracin celular comprende muchas reacciones, sin embargo, la reaccin general se
representa con la siguiente ecuacin:
C
6
H
12
0
6
+ 6 0
2
6 CO
2
+ 6 H
2
0 + atp
glucosa oxgeno bixido agua energa
de carbono
Este proceso ocurre en dos etapas: la primera, llamada gluclisis, es anaerbica porque no
necesita oxgeno. La gluclisis es una serie de reacciones que se llevan a cabo en el citosol de la
clula mediante las cuales una molcula de glucosa se desdobla en dos molculas de cido pirvi-
co. Este desdoblamiento libera solamente el 7 % de la energa qumica almacenada en la glucosa,
la cual queda en las dos molculas de atp que se producen. El resto de la energa permanece en
las uniones de las dos molculas de cido pirvico.
Fase anaerobia (se realiza en el citosol)
C
6
H
12
0
6
C
3
H
4
0
3
+ H
2
+ 2 atp
glucosa cido pirvico energa

La segunda etapa se lleva a cabo en las mitocondrias y es aerbica porque requiere de oxge-
no. Esta etapa est consttuida por tres fases: la formacin de acetl Co A, el ciclo de Krebs y el
transporte de electrones. En estas fases se lleva a cabo un conjunto de reacciones en las cuales
el cido pirvico se degrada a bixido de carbono y agua, producindose grandes cantdades de
atp. Esta etapa produce de 34 a 36 molculas de atp dependiendo de la clula.
Fase aerobia (se realiza en las mitocondrias)
C
3
H
4
0
3
+ 0
2
CO
2
+ H
2
0 + 34 a 36 atp
cido pirvico bixido agua energa
de carbono
Como podrs observar, la mayor cantdad de atp se forma durante la etapa aerbica. Es decir,
entre mayor es el nivel de degradacin de la glucosa, mayor energa se obtene y ms efciente es
el proceso respiratorio. Si sumamos los atp producidos en las dos etapas, tendremos que en el
proceso de respiracin celular, la degradacin de una molcula de glucosa produce de 36 a 38 atp.
105
L cviui: uioo ov i vio DGEP
Fermentacin
La mayora de los seres vivos obtenen su energa mediante la respiracin celular, slo algunos mi-
croorganismos la obtenen mediante un proceso que no requiere de oxgeno, el cual es llamado
respiracin anaerobia o fermentacin. La primera parte de la fermentacin es la gluclisis, en la
cual, se forman dos molculas de cido pirvico y dos molculas de atp. En la segunda parte, el
cido pirvico puede convertrse ya sea en alcohol etlico y CO
2
, o en cido lctco; esto depen-
der del tpo de organismo.
Las levaduras y otros microorganismos llevan a cabo la fermentacin, que convierte el cido
pirvico formado en la gluclisis, en alcohol etlico y CO
2
, lo cual se conoce como fermentacin
alcohlica. Mediante este tpo de fermentacin se elaboran productos como el vino, la cerveza y
el pan. En el caso del pan, la levadura que se le agrega convierte el azcar del trigo en alcohol y
CO
2 .
El CO
2
que es un gas, hace que el pan se esponje, mientras que el alcohol se evapora cuando
el pan se est horneando.

Las reacciones de la fermentacin alcohlica se pueden representar de la siguiente manera:
C
6
H
12
O
6
2 C
2
H
5
OH + 2 CO
2
+ 2 atp
glucosa alcohol etlico bixido energa
de carbono
Algunos otros microorganismos convierten el cido pirvico en cido lctco, este tpo de
fermentacin se llama fermentacin lctca.
La elaboracin de alimentos lcteos como el yogurt, la crema cida, el jocoque y la mayora
de los quesos, se basa en el proceso de fermentacin lctca realizada por diversas bacterias. El
cido lctco les proporciona a estos alimentos su sabor caracterstco.
La reaccin de esta fermentacin puede representarse como:
C
6
H
12
O
6
2 C
3
H
6
O
3
+ 2 atp
glucosa cido lctco energa
La fermentacin lctca tambin es llevada a cabo por las
clulas de nuestros msculos, por poco tempo y bajo ciertas
condiciones. Cuando se hace ejercicio, los msculos necesitan
grandes cantdades de atp como fuente de energa y esta es
proporcionada por el proceso de respiracin celular que se est
llevando a cabo en cada una de las clulas musculares. Pero
cuando el ejercicio es exagerado, el aporte de oxgeno de los
pulmones es insufciente para mantener la fase aerbica de la
respiracin celular. Es en este momento cuando las clulas mus-
culares recurren a la fermentacin lctca para obtener energa.
Cuando el cido lctco se acumula en los msculos, causa
un malestar intenso, fatga y una sensacin de ardor, lo cual
provoca que la persona disminuya o detenga el ejercicio. Este
descanso, a su vez, provoca que el aporte de oxgeno pulmo-
nar sea sufciente y se vuelva a llevar a cabo la respiracin ce-
lular.
Figura 3.35 Algunos productos de la
fermentacin: vinos, quesos y pan.
106
U 3 UAS
El cido lctco acumulado en los msculos es transportado por la sangre al hgado, donde es
convertdo de nuevo a cido pirvico. Esta conversin no se realiza en las clulas musculares ya
que estas no poseen las enzimas que se requieren.
Los dos tpos de fermentacin producen 2 atp por cada molcula de glucosa que se degrada.
Trifosfato de adenosina (atp)
La molcula portadora de energa
ms comn en las clulas es el tri-
fosfato de adenosina, que se abrevia
como atp, el cual est consttuido por
la adenosina y tres grupos fosfato. La
adenosina est consttuida a su vez
por una base nitrogenada, la adenina
y un azcar, la ribosa. En la fgura 3.36
observa su frmula estructural. La
molcula de atp puede representarse
como a-p~p~p, donde la A representa
la adenosina y las p son los grupos fosfato. Las lneas onduladas (~) entre los dos ltmos grupos
fosfato, representan enlaces de alta energa. El atp es una fuente inmediata de energa para todas
las actvidades del organismo.
La energa liberada median-
te la respiracin celular es utli-
zada para sintetzar atp a partr
del difosfato de adenosina (adp)
y fosfato inorgnico, los cuales se
encuentran en la clula. El adp
capta la energa liberada de la
glucosa en un tercer enlace fos-
fato y se convierte en atp. Este
proceso puede representarse de
la siguiente manera:
La molcula de atp conser-
va su energa hasta el momento
en que la clula requiere de ella
para realizar alguna actvidad
celular, entonces se rompe el
enlace del tercer fosfato rico en
energa, formndose adp y fos-
fato inorgnico. La reaccin pue-
de escribirse as:
El adp y el fosfato inorgni-
co, por lo comn se reciclan for-
mando de nuevo atp.
Fosfato
inorgnico
A T p
A D P
energa
Fosfato
inorgnico
A D P
A T p
energa
Figura 3.36 Frmula estructural del atp. El atp es la fuente de
energa bsica de todos los tpos de clulas.
Adenina Ribosa 3 grupos fosfato
107
L cviui: uioo ov i vio DGEP
El citoesqueleto
El citoesqueleto como su nombre lo indica es una especie de esqueleto o armazn de la clula
que se encuentra distribuido por todo el citoplasma, semejando una red. Se descubre en la dca-
da de 1970 mediante la microscopa electrnica de alto voltaje.
El citoesqueleto est consttuido por tres tpos de estructuras protecas: los microflamentos,
los microtbulos y los flamentos intermedios. Los microflamentos tenen el aspecto de hebras
y estn compuestos principalmente por las protenas actna y miosina. Los microtbulos son unos
pequeos tubos consttuidos por la protena tubulina y adems de formar parte del citoesque-
leto, son los componentes bsicos con los que estn construidos los centrolos, cuerpos basales,
cilios, fagelos y el huso mittco. Este ltmo se forma durante la divisin celular. Los flamentos
intermedios, estn compuestos por protenas que varan segn el tpo de clula. Observa estas
estructuras en la fgura 3.37.
Son varias las funciones del citoesqueleto:
Da forma y soporte a la clula
Sostene y mueve los organelos
Partcipa en el movimiento de la clula. Por ejemplo: en el movimiento amiboideo de
amibas y glbulos blancos, la formacin de pseudpodos se debe al ensamblado, desen-
samblado y deslizamiento de los microflamentos y los microtbulos del citoesqueleto.
Microflamentos
Filamentos
intermedios
Microtbulo
Membrana
plasmtica
Ribosomas
Figura 3.37 Dibujo del citoesque-
leto basado en las observaciones
de clulas, vistas con el micros-
copio electrnico de alto voltaje.
108
U 3 UAS
Los centrolos y cuerpos basales
Las clulas animales, algunas algas y hongos contenen cerca del ncleo dos cuerpos cilndricos
huecos, perpendiculares entre s, llamados centrolos. El microscopio electrnico permite obser-
var que las paredes de los centrolos estn consttuidas por nueve conjuntos de microtbulos, con
tres microtbulos en cada conjunto.
Los centrolos partcipan en la formacin del huso mittco, durante la divisin celular. Cabe
aclarar que los centrolos no son esenciales para la formacin del huso mittco o para la divisin
de la clula, ya que se forman normalmente en los organismos que no los poseen, como es el
caso de las plantas.
Tambin dan origen a los cilios y fagelos, slo que en este caso reciben el nombre de cuerpos
basales, por localizarse en la base de estas estructuras motoras. Por ejemplo, a medida que un
espermatozoide adquiere su forma, un centrolo se aproxima a la membrana celular y el fagelo
(cola) del espermatozoide surge de l mediante el ensamblaje de microtbulos.
Los cilios y fagelos
Los cilios y los fagelos de clulas eucariotas son extensiones delgadas de la membrana plasm-
tca que se encuentran en muchas clulas. Cada cilio y fagelo est consttuido por microtbulos
en forma de haces tubulares que se originan a partr de un cuerpo basal (ver fgura 3.39). Cada
microtbulo esta formada por una protena llamada tubulina. Algunos autores a estas estructuras
les llaman undulipodios.
En las clulas con cilios y fagelos, los centrolos se multplican y los centrolos hijos se mue-
ven hacia la superfcie de la clula, colocndose por debajo de la membrana plasmtca, originan-
do los microtbulos que forman un cilio o un fagelo.
Los cilios (de cilium: pestaa) son cortos y numerosos; mientras que los fagelos (de fage-
llum: ltgo) son largos y poco numerosos. Ambos se mueven casi contnuamente por lo que
necesitan de una gran cantdad de atp, la cual es proporcionada por las abundantes mitocondrias
que generalmente se encuentran cerca de los cuerpos basales.
Figura 3.38 En las clulas animales se encuentra
un par de centrolos cerca del ncleo. El dibujo nos
muestra a los centrolos en un corte longitudinal.
Observa los nueve tripletes de microtbulos que los
consttuyen.
Membrana plasmtica
Par de centrolos
Ncleo
109
L cviui: uioo ov i vio DGEP
Las clulas procariotas tambin tenen fage-
los, pero son ms pequeos y su estructura es di-
ferente de tal manera que estn formados por una
sola fbrilla consttuda por la protena fagelina.
En muchos organismos unicelulares, los cilios
y los fagelos sirven para la locomocin. Por ejem-
plo, un Paramecium puede tener unos 17 mil cilios,
que al moverse coordinadamente le permiten des-
plazarse por el agua. Otro organismo unicelular la
Chlamydomona, una alga verde, posee dos fagelos
que le permiten tambin desplazarse por el agua.
Una clula del cuerpo humano, el espermatozoi-
de, producido en los testculos del varn, se mueve
mediante su fagelo. Otras clulas humanas pre-
sentan cilios y se localizan revistendo la trquea
(conducto del sistema respiratorio) y las trompas
de Falopio del sistema reproductor femenino. En
este caso, los cilios no mueven a las clulas, sino
que sirven para arrastrar sustancias a lo largo de
la superfcie celular. Los cilios de las clulas que
tapizan la trquea pulsan hacia arriba para crear
una corriente de moco que arrastra las sustancias
extraas como el polvo, el polen y el alquitrn del
tabaco, hacia la garganta, donde se puede eliminar
mediante la deglucin (tragar). Este proceso evita
que estas sustancias se depositen directamente
sobre la membrana celular, mientras que las clu-
las ciliadas de las trompas de Falopio, mueven el vulo hacia el tero o matriz.
La pared celular
En muchos organismos, la membrana plasmtca no es el borde ms externo. Las plantas, las al-
gas, los hongos y las bacterias tenen una pared celular, situada despus de la membrana plasm-
tca. Las paredes celulares de plantas y algas estn consttuidas principalmente del polisacrido
celulosa. Las paredes celulares de hongos y bacterias estn consttuidos por otros materiales. Las
clulas de estos organismos secretan la pared celular.
La pared celular vegetal
La pared celular es una de las caracterstcas ms sobresalientes de la clula vegetal. Est const-
tuida de tres partes: lmina media, pared celular primaria y pared celular secundaria. La lmina
media se forma entre clulas adyacentes durante la divisin celular. Est consttuida por una
sustancia gelatnosa llamada pectna, que acta como un cemento que une a las clulas. Durante
el proceso de maduracin, las frutas se vuelven suaves debido a la disolucin de la pectna y la
Paramecium
Cilio
Membrana
plasmtica
Cuerpo
basal
0.1micrmetro
Figura 3.39 Estructura de un cilio que muestra su
cuerpo basal, el cual tene nueve tripletes fusio-
nados, a partr de estos surgen los microtbulos
que lo consttuyen.
110
U 3 UAS
separacin de las clulas. La pared celular primaria se localiza entre la membrana plasmtca y
la lmina media, y se forma durante el desarrollo de la clula, es decir, mientras la clula est
creciendo. Esta pared celular primaria es ms delgada en los ptalos, hojas y frutas suaves que
en los tallos. Es la responsable de que los vegetales crujan cuando se muerden. Al terminar el
crecimiento, muchas clulas maduras secretan ms celulosa formando una pared celular secun-
daria gruesa entre la pared primaria y la membrana plasmtca. Esta pared secundaria hace a la
clula ms fuerte y proporciona el grado de soporte que requiere una planta grande, como un
rbol. Estas paredes permanecen mucho tempo despus de que las clulas mueren. Lo que ob-
serv Robert Hooke en 1665, fueron las paredes secundarias de las clulas muertas del corcho.
Las paredes celulares secundarias de las plantas nos proporcionan madera, papel, algodn,
lino y camo; los derivados de la celulosa se emplean para fabricar rayn, celofn y plstcos.
Las paredes celulares son una especie de armazn que les proporcionan proteccin y soporte
a las clulas de las plantas, esto ltmo les permite a las plantas permanecer erectas sobre la terra.
La pared celular, a diferencia de la membrana plasmtca, es permeable a la mayora de las
molculas y no controla el paso de materiales hacia dentro y hacia afuera de la clula. Adems,
la pared celular presenta orifcios diminutos llamados plasmodesmos, a travs de los cuales se
establece contacto entre una clula y otra, realizndose intercambio de sustancias entre ellas.
Observa la pared celular de la clula vegetal de la fgura 3.10.
Los plstdos o plastos
Los plstdos son organelos que se encuentran solamente en las clulas de las plantas y de las al-
gas. Al igual que el ncleo y las mitocondrias, estos organelos estn limitados o rodeados por dos
membranas. Los plstdos maduros son de tres tpos: cloroplastos, cromoplastos y leucoplastos.
Cloroplastos (de chloro: verde)
Los cloroplastos son los plstdos ms
comunes y los de mayor importancia
biolgica, pues la vida en nuestro pla-
neta depende de su funcin, que es el
proceso de fotosntesis. Estos organe-
los se caracterizan por la presencia de
clorofla, pigmento verde que atrapa la
energa lumnica (solar) para la fotosn-
tesis. Ademas la clorofla es responsable
del color verde de las plantas, principal-
mente el de sus hojas.
Los cloroplastos tenen en gene-
ral forma ovoide o esfrica; su tamao
suele estar comprendido entre 3 y 10
micrmetros de largo en la mayora de
las clulas. En las algas tenen mayores
dimensiones y presentan formas muy
Spirogyra Chlamydomona
Figura 3.40 Los cloroplastos de plantas terrestres y muchas
algas son tpicamente de forma ovoide, pero con frecuencia
tenen formas no usuales en las algas. El cloroplasto tene
forma de copa en Chlamydomona y de espiral en Spirogyra.
Cloroplasto
Ncleo
111
L cviui: uioo ov i vio DGEP
variadas (fgura 3.40). El nmero de cloroplastos por clula tambin vara mucho. Por ejemplo,
el alga unicelular Chlamydomona tene un solo cloroplasto, mientras que las clulas de cualquier
hoja poseen de 40 a 100 de estos organelos.
El microscopio electrnico permit observar con detalle la estructura del cloroplasto, el cual
est rodeado por dos membranas y en su interior se encuentran unos sacos membranosos apla-
nados llamados tlacoides, que se disponen en pilas denominadas grana. Las granas estn rodea-
das de una sustancia gelatnosa llamada estroma. La clorofla se encuentra en las granas. La fgura
3.41 ilustra la estructura del cloroplasto.
Adems de la clorofla, algunos cloroplastos contenen pigmentos llamados carotenoides,
pigmentos de color amarillo, rojo y anaranjado. En las hojas verdes, estos colores estn enmasca-
rados por la clorofla que es ms abundante.
Cromoplastos (de chromo: color)
Los cromoplastos son los plstdos responsables de los colores rojo, amarillo o anaranjado que
presentan las frutas, las verduras, las fores y las hojas en el otoo. Estos colores se deben a los
pigmentos llamados carotenoides, los cuales se dividen en dos grupos: carotenos de colores ana-
ranjado y rojo, y las xantoflas de color amarillo.
Los cromoplastos pueden derivar de los cloroplastos cuando estos pierden la clorofla. El
cambio de color de las frutas verdes al madurar, en muchas plantas se debe a la conversin de
cloroplastos en cromoplastos. Por ejemplo, cuando un tomate madura se destruye la clorofla,
descubrindose el color rojo, enmascarado por la clorofla. Otros pigmentos que dan color a las
fores y a otras partes de las plantas se encuentran disueltas en las vacuolas. Estos pigmentos son
las antocianinas, cuya gama de color va del azul o violeta al rojo.
Figura 3.41 Las plantas estan consttudas por clulas vegetales,
las cuales poseen cloroplastos, los organelos donde se realiza
la fotosntesis. En qu parte del cloroplasto se realiza la foto-
sntesis?
Grana
Membrana
del tilacoide
Tilacoide
Espacio del tilacoide
Clula vegetal
Cloroplasto
Membrana
externa
Membrana
interna
Estroma
112
U 3 UAS
Leucoplastos (de leuco: blanco)
Los leucoplastos son plstdos
incoloros, su funcin es alma-
cenar almidn y otras sustan-
cias como protenas y aceites.
Son muy numerosos en races
como el nabo o en tubrcu-
los como la papa. Las papas
son masas de clulas llenas de
leucoplastos que contenen al-
midn. Tambin se les puede
encontrar en otras partes de
las plantas como semillas, em-
briones y en la epidermis de las
hojas, tallos y fores.
Fotosntesis
La fotosntesis es el proceso
mediante el cual las plantas
verdes captan (atrapan) la
energa solar y la utlizan para
sintetzar compuestos de car-
bono de alta energa como la
glucosa, a partr de molculas
de baja energa como el bixi-
do de carbono y agua. As, la
fotosntesis convierte la ener-
ga solar en energa qumica
que se almacena en la molcu-
la de glucosa. Hay dos tpos de
transformaciones durante el
proceso fotosinttco:
La energa solar se
transforma en energa
qumica
Las molculas inorg-
nicas se transforman
en molculas orgnicas
La fotosntesis en las plantas se lleva a cabo dentro de los cloroplastos, los cuales se encuen-
tran principalmente en las clulas de las hojas.
Figura 3.42 Leucoplastos de una clula de papa mostrando los glbulos
de almidn.
Figura 3.43 Organismos fotosinttcos. Los organismos fotosinttcos in-
cluyen a) cianobacterias tales como Oscillatoria, las cuales son un tpo de
bacteria; b) algas tales como el Kelp que tpicamente viven en agua y su
tamao puede variar desde el microscpico hasta el macroscpico y c)
plantas tales como el rbol de Sequoia las cuales son terrestres.
Plstido
Glbulos de
almidn
a b c
113
L cviui: uioo ov i vio DGEP
Recuerda que adems de las plantas, las algas y algunas bacterias son capaces de usar la
energa lumnica del Sol para llevar a cabo la fotosntesis.
La fotosntesis es un proceso complejo que implica una serie de reacciones qumicas que se
resumen en una sola reaccin general donde se tenen los factores iniciales y los productos fnales:
La fotosntesis es una reaccin anablica, o sea, es una reaccin de sntesis o de elaboracin
de molculas complejas a partr de molculas sencillas.
El bixido de carbono y el agua son las materias primas a partr de las cuales se elabora la
glucosa; el bixido de carbono proporciona el carbono y el oxgeno para la sntesis de glucosa. Se
encuentra en el aire y entra por los estomas de las hojas. El agua entra por la raz de las plantas y
proporciona el hidrgeno para la elaboracin de la glucosa. El oxgeno del agua es el que se ob-
tene como un producto fnal secundario en la reaccin general; es el oxgeno que la planta libera
al medio ambiente a travs de los estomas. Las enzimas controlan la sntesis de glucosa.
Por ser la luz y la clorofla factores bsicos en este proceso de la fotosntesis revisaremos bre-
vemente algunos aspectos importantes como los siguientes:
La luz
La luz es energa radiante que viaja o se propaga en ondas. La distancia entre las crestas de
las ondas es la longitud de onda. La energa radiante solar es la mezcla de muchas diferentes
longitudes de onda. Cuando un rayo de luz pasa a travs de un prisma, se separan las diferentes
longitudes de onda, dando como resultado una banda de colores llamada espectro visible. Los
colores del espectro visible son: rojo, naranja, amarillo, verde, azul y violeta. Cada color tene su
propia longitud de onda. Las gotas de lluvia hacen lo mismo que el prisma, de ah que en los das
lluviosos y con sol se forme el arco iris.
Cuando la luz choca con un objeto, parte de la energa de la luz se absorbe y se convierte en
otras formas de energa, mientras que otra parte de la energa se refeja o se emite dando color al
objeto. Cuando la luz choca con una hoja, parte de ella es absorbida por la clorofla y se convierte
en energa qumica que se almacena en las molculas de glucosa. Mientras que la luz que es re-
fejada por la clorofla -luz verde- es la responsable del color verde de las plantas.
La clorofla y otros pigmentos
El color verde brillante de las hojas, brotes y tallos jvenes es producido por la clorofla. Exis-
ten varias clases de clorofla, las cuales se designan como a, b, c y d. Los pigmentos verdes en
las plantas vasculares son las cloroflas a y b. No se exagera cuando se dice que la clorofla es
6 6
Bixido de
carbono
Oxgeno
gaseoso
Agua Glucosa
FOTOS NTESI S
6 + + CO
2
O
2
H
2
O C
6
H
12
O
6
Energa
luminosa
Clorofla
114
U 3 UAS
el compuesto orgnico
ms importante que
existe sobre la terra.
Este pigmento es el que
capacita a las plantas
verdes para utlizar la
energa del sol y formar
carbohidratos con agua
y bixido de carbono.
Todos los organismos
vivos, con excepcin de
unas pocas formas de
bacterias, dependen di-
recta o indirectamente
de la clorofla para su
existencia. Los otros pigmentos presentes en los cloroplastos son los carotenoides y se les conoce
como pigmentos accesorios. Los carotenoides tambin absorben la luz y la transferen a la clorof-
la. Estos pigmentos estn presentes en la mayor parte de las plantas y absorben la luz azul y verde
por lo que se ven de color amarillo, naranja o rojo. Durante la poca de otoo podemos observar
en muchos rboles los colores amarillo y naranja de dichos pigmentos, esto se debe a que las ho-
jas al envejecer descomponen su clorofla, lo cual permite que se hagan visibles los carotenides.
Las etapas de la fotosntesis
Son las reacciones dependientes de la luz y las reacciones independientes de la luz.
Reacciones dependientes de la luz
Estas reacciones se efectan slo en presencia de la luz y se llevan a cabo en las granas de los
cloroplastos. Los principales eventos de esta primera etapa son:
La clorofla y otras molculas de pigmentos presentes en los cloroplastos absorben la
energa de la luz.
Se produce atp, el cual se utliza en la siguiente etapa de la fotosntesis.
Las molculas de agua se rompen en iones de oxgeno y de hidrgeno.
Reacciones independientes de la luz
Las reacciones independientes de la luz se llevan a cabo en el estroma de los cloroplastos. El atp
sintetzado durante la primera etapa proporciona la energa necesaria para la sntesis de gluco-
sa a partr de bixido de carbono. Las reacciones que fjan carbono son una serie de reacciones
conocidas como ciclo de Calvin, en honor a su descubridor el Dr. Melvin Calvin. Cada paso del
ciclo es catalizado por una enzima especfca. Adems de la glucosa se pueden sintetzar otros
carbohidratos, grasas y otros lpidos y, con la adicin de nitrgeno, aminocidos y bases nitro-
genadas.
Figura 3.44 El color verde de las plantas se debe a que la clorofla refeja la luz
verde.
UAS
115
L cviui: uioo ov i vio DGEP
10 m
Figura 3.45 Micrografa electrnica de barrido que nos
muestra a un protozoario ciliado concluyendo su proce-
so de divisin celular. Observa que la separacin de las
dos clulas hijas casi se ha completado.
La fotosntesis es un proceso biolgico fundamental para la vida en nuestro planeta. Las
plantas verdes mediante la fotosntesis elaboran compuestos orgnicos (carbohidratos, lpidos
y protenas) y liberan oxgeno a la atmsfera. Los compuestos orgnicos son la base de la ali-
mentacin de todos los animales incluyendo al ser humano. Mientras que el oxgeno liberado es
el elemento indispensable que utlizan todos los seres vivos (con excepcin de algunas bacterias
anaerobias) en la respiracin celular, proceso indispensable para obtener la energa necesaria
para realizar todas sus funciones.
Ciclo celular: divisin y muerte de las clulas
En el curso de su vida, la mayora de las clulas eucariotas pasan por una secuencia regular y
repettva de crecimiento y divisin conocida como el ciclo celular. Las clulas se reproducen
mediante un proceso conocido como divisin celular, en el cual su material gentco (adn) se
reparte entre dos nuevas clulas hijas.
En los organismos unicelulares, por este mecanismo aumenta la cantdad de individuos en la
poblacin (fgura 3.45). En los organismos multcelulares, la divisin celular es el procedimiento
por el cual el organismo crece, partendo de una sola clula, y los tejidos daados son reempla-
zados y reparados, adems se resttuyen las clulas que mueren. Por ejemplo, normalmente en
el cuerpo humano mueren unos 50 millones de clulas por segundo y se produce una misma
cantdad para susttuir a las que murieron. Una clula individual crece asimilando sustancias de
su ambiente y transformndolas en nuevas molculas estructurales y funcionales. Cuando una
clula alcanza cierto tamao crtco y cierto estado metablico, se divide; las dos clulas hijas
comienzan entonces a crecer.
Las nuevas clulas hijas son casi idntcas entre s, como lo son a su progenitora. Son simi-
lares, en parte, porque cada nueva clula recibe aproximadamente la mitad del contenido del
citoplasma, incluidos los organelos,
de la clula materna. Pero la razn
ms importante de esta similitud, a
nivel de estructura y funcin, es que
cada nueva clula hereda un dupli-
cado exacto de la informacin gen-
tca de la clula materna.
En el desarrollo y mantenimien-
to de la estructura de los organismos
pluricelulares, no slo se necesita
de la divisin celular, que aumenta
el nmero de clulas somtcas (del
cuerpo), sino tambin de un proceso
de muerte celular programada co-
nocido como apoptosis. La divisin
y la muerte celular ocurren de un
modo coordinado y, de esta manera,
se mantene la forma del organismo.
116
U 3 UAS
El ciclo celular
El ciclo celular es una serie de sucesos que experimentan las clulas mientras crecen y se dividen.
Durante el ciclo celular, la clula crece, se prepara para la divisin, se divide para formar dos c-
lulas hijas y, luego, cada una de ellas vuelve a iniciar el ciclo celular.
El ciclo celular consta de cuatro fases G
1
, S, G
2
y M. Las primeras tres fases del ciclo se cono-
cen colectvamente como interfase. Durante la fase M ocurren la mitosis y citocinesis.
Veamos que sucesos ocurren en cada una de las fases.
Fase G
1
. La clula crece casi a su maximo y sintetza las protenas y organelos nuevos.
Fase S. A la fase G
1
le sigue la fase S o de sntesis. En esta fase el adn de la clula se replica
para dar origen a los cromosomas dobles. La clula al fnal de esta fase contene el doble
de adn de lo que tenia al principio.
Fase G
2
. Durante esta fase se producen muchos de los organelos y las molculas necesa-
rias para la divisin celular.
Fase M o de divisin celular. Esta fase produce dos clulas hijas y ocurre en dos etapas:
mitosis y citocinesis. Se le nombra fase M por el proceso de mitosis. Durante la mitosis los
cromosomas duplicados son distribuidos en partes iguales entre los dos ncleos hijos. A
esta primera etapa le sigue la citocinesis o divisin del citoplasma separando a la clula
madre en dos clulas hijas.
Figura 3.46 El ci-
clo celular consta
de cuatro fases:
G
1
, S, G
2
y M. En
qu fase existen
dos copias de la
informacin ge-
ntca de la c-
lula?
Fase G
1
(crecimiento
celular)
Fase G
2
(Preparacin
para la mitosis)
Fase S
(replicacin
del ADN)
Interfase
C
i
t
o
c
i
n
e
s
i
s
M
it
o
s
is
D
i
v
i
s
i

n

c
e
l
u
l
a
r
F
a
s
e

M
117
L cviui: uioo ov i vio DGEP
Haploida y diploida
Para comprender me-
jor los procesos de mi-
tosis y de meiosis, re-
visemos algunos con-
ceptos bsicos relacio-
nados con el nmero
de cromosomas.
Cada organismo
est formado por c-
lulas que contenen
un nmero de cromo-
somas caracterstco
de la especie a la cual
pertenece. Por ejem-
plo, el ser humano tene 46 cromosomas por clula, el gato 38, el sapo 22, el tomate 24, la cebo-
lla 16 y el mosquito 6. En cambio, las clulas sexuales o gametos tenen exactamente la mitad de
la cantdad de cromosomas caracterstcos de las clulas del cuerpo (somtcas) del organismo.
La cantdad de cromosomas de los gametos se conoce como nmero haploide (simple) y la
cantdad de cromosomas de las clulas somtcas como nmero diploide (doble). El nmero
haploide se representa por n y el diploide por 2n. En los seres humanos, por ejemplo, n =23 y 2n
= 46. En los animales, los gametos son, en la hembra, el vulo; y en el macho, el espermatozoide.
Cuando un espermatozoide fecunda a un vulo, los dos ncleos haploides se fusionan, n + n = 2n,
y el nmero diploide se restablece. La clula diploide producida mediante fusin de dos gametos
se conoce como cigoto.
En las clulas diploides, cada cromosoma tene un compaero, estos pares de cromosomas se
conocen como cromosomas homlogos y cada uno de ellos proviene de un progenitor. Las clu-
las humanas tenen 46 cromosomas 23 pares. Un cromosoma de cada par es de origen paterno
y el otro de origen materno. Cada par de cromosomas homlogos se parecen en tamao, forma
y en el tpo de informacin hereditaria que contenen.
Tabla 3.2 Nmero de cromosomas caracterstco de algunas especies de vegetales y de animales
Vegetales Cromosomas Animales Cromosomas
Pepino 14 Mosca casera 12
Papaya 18 Rana 26
Maz 20 Cerdo 40
Caf 44 Gorila 48
Tabaco 48 Oveja 54
Caa de azcar 80 Caballo 66
Cromosoma paterno
Cromosoma Cromosoma
Centrmero
Duplicacin Duplicacin
Cinetcoro
Par de cromosomas homlogos
Cromtidas
no hermanas
Cromtidas hermanas
Cromosoma materno
Figura 3.47 Cromosomas homlogos. Las cromtdas hermanas contenen los mis-
mos genes.
118
U 3 UAS
Mitosis
La funcin de la mitosis es distribuir los cromosomas duplicados
de modo tal que cada nueva clula obtenga un complemento o
dotacin completa, o sea, un cromosoma de cada tpo. Recuerda
que los cromosomas se duplican durante la fase S de la interfase.
Por lo tanto, cuando se inicia la mitosis, cada cromosoma est
consttuido por dos cromtdas hermanas unidas por el centr-
mero.
Fases de la mitosis
La mitosis es un proceso contnuo, pero para facilitar su estudio
se divide en cuatro fases: profase, metafase, anafase y telofa-
se. Cada fase da lugar a la siguiente; de las cuatro fases, la de
mayor duracin es la profase. Por ejemplo, si una divisin mit-
tca dura 10 minutos, la profase requiere 6 minutos.
Al estudiarse cada una de las fases, se harn notar las di-
ferencias entre las clulas animales y vegetales. Es muy conve-
niente que al estudiar cada una de las fases observes la fgura
que se presentan de cada una de ellas.
Profase (del griego pro: antes de)
Durante la profase, la cromatna se condensa y los cromosomas duplicados se hacen visi-
bles. Fuera del ncleo se empieza a formar un huso.
El primer signo evidente que seala el comienzo de la profase es la condensacin de los
hilos largos de cromatna. La cromatna se condensa mediante un proceso de enrollamiento
o plegamiento del adn que la consttuye. A medida
que avanza este proceso, los hilos largos de cromatna
se hacen ms cortos y gruesos consttuyendo los cro-
mosomas. Cada cromosoma est consttuido por dos
cromtdas hermanas, unidas por una regin constre-
ida llamada centrmero. Dentro del centrmero se
encuentran dos estructuras proteicas llamadas cineto-
coros; cada cromtda posee un cinetocoro; estos l-
tmos desempean un importante papel en la fjacin
de los cromosomas a las fbras del huso; los cromoso-
mas dobles resultan de la duplicacin del adn durante
la interfase. Los cromosomas hacen posible la separa-
cin exacta del adn durante la divisin celular.
Otro cambio que ocurre dentro del ncleo es que
los nuclolos se desintegran y desaparecen al disper-
vulo
23 cromosomas
Espermatozoide
Cigoto
(46 cromo-
somas)
Figura 3.48 Durante la fecunda-
cin, el vulo y el espermatozoi-
de, clulas con 23 cromosomas
cada una se fusionan originando
un cigoto con 46 cromosomas.
Figura 3.49 Profase.
Centrolos
Huso en
formacin
Membrana nuclear
Cromosomas
Centrmero
119
L cviui: uioo ov i vio DGEP
sarse sus componentes en el nucleoplasma. Al fnal de la profase, cuando desaparece la membra-
na nuclear, el material del nuclolo es liberado en el citoplasma. Mientras estos procesos suce-
den en el ncleo, en el citoplasma aparece una estructura llamada huso mittco, consttuido por
microtbulos. El huso mittco tene la forma de un baln de ftbol americano, cuyos extremos
se llaman polos y el centro ecuador o placa ecuatorial. En las clulas animales, los centrolos
controlan la formacin del huso. Los dos pares de centrolos se localizan a un lado del ncleo.
Cada par de centrolos se halla rodeado por el ster, un conjunto de microtbulos en forma de
estrella. Ambos pares de centrolos, junto con los steres, se separan formndose entre ellos,
a medida que se alejan, las fbras del huso, consistentes en microtbulos. Cuando el huso est
formado la membrana nuclear se desintegra, quedando los fragmentos dispersos en el citoplas-
ma. El rompimiento de la membrana nuclear permite que el huso entero se desplace y ocupe el
espacio del ncleo.
Por ltmo, cada cromtda hermana se une mediante su cinetocoro a alguna de las fbras del
huso. La funcin de estas fbras es controlar el movimiento de los cromosomas y asi ayudar a se-
pararlos.
En las clulas vegetales, a pesar de que no tenen centrolos de todos modos se forma el huso
mittco, aunque este carece de steres.
Metafase (del griego meta: entre)
Durante la metafase, los cromosomas se alinean
en el ecuador del huso.
En esta fase, cada cromosoma se alinea en el
ecuador (medio) del huso, orientados de tal manera
que los cinetocoros de cada par de cromtdas her-
manas se colocan opuestos a los polos de la clula.
En este momento, todo est listo para la separacin
de las cromtdas hermanas y su migracin a los polos
opuestos.
Anafase (del griego ana: atrs)
Durante la anafase, las cromtdas hermanas se sepa-
ran y son llevadas a polos opuestos de la clula.
Al inicio de la anafase, el centrmero de cada cro-
mosoma se divide y las cromtdas hermanas se separan
desplazndose hacia los polos opuestos del huso; a es-
tos cromosomas sencillos, de una sola cromtda, se les
llama cromosomas hijos. Su movimiento hacia los polos
se debe a que son jalados por las fbras del huso adheri-
das a su cinetocoro. Cada cromosoma adquiere la forma
de V. Esta fase es la ms rpida.
Figura 3.50 Metafase.
Figura 3.51 Anafase.
Huso
Cromosomas
individuales
120
U 3 UAS
Telofase (del griego telo: fn)
Durante la telofase, se forma una membrana nu-
clear alrededor de cada grupo de cromosomas hi-
jos.
La telofase es la fase fnal de la mitosis y se
inicia cuando los cromosomas han llegado a sus
respectvos polos. Durante esta fase, los cromo-
somas comienzan a desenrollarse, hasta que son
otra vez hebras delgadas de cromatna; el huso
mittco se desintegra. Los fragmentos de mem-
brana nuclear de la clula madre que se desin-
tegr durante la profase, se unen alrededor de
cada conjunto de cromatna formndose dos
ncleos nuevos; en cada ncleo reaparecen los
nuclolos.
Citocinesis
En casi todas las clulas, durante la telofase ocurre la citocinesis o divisin del citoplasma. Duran-
te la citocinesis, el citoplasma se parte en dos clulas hijas recibiendo cada clula uno de los n-
cleos recientemente formados y cantdades casi iguales de citoplasma. En las clulas animales, el
citoplasma se constrie en la regin ecuatorial (centro) de la clula. Esta constriccin se acenta
y profundiza hasta que la clula se divide. Esto es causado por un anillo de microflamentos que
se forma alrededor del ecuador de la clula; el anillo de microflamentos se contrae hasta que la
clula se divide.
En las clulas vegetales, la citocinesis es muy diferente ya que se forma en la regin ecua-
torial de la clula una estructura llamada placa celular, que se origina al fusionarse una serie
de vesculas llenas de carbohidratos, provenientes del aparato de Golgi.
Pared celular
Aparato
de Golgi
Vesculas llenas de
carbohidrato formando
la placa celular
Vesculas fusionndose para formar
la nueva pared celular y membranas
plasmticas entre las clulas hijas
Separacin completa
de las clulas hijas
Figura 3.53 Citocinesis en clulas de plantas.
Figura 3.52 Telofase.
Se vuelven
a formar
membranas
nucleares
121
L cviui: uioo ov i vio DGEP
Figura 3.54 Ciclo celular normal
(interfase, mitosis y citocinesis)
de una clula animal con 4 cro-
mosomas.
Al terminar la mitosis se han formado dos clulas hijas, las cuales son idntcas tanto en su
contenido gentco como en su contenido de citoplasma. Son gentcamente idntcas ya que
cada una recibi una copia exacta de los cromosomas de la clula madre. Las dos clulas hijas
resultantes entran en interfase para despus volver a dividirse.
Citocinesis: el citoplasma
se estrangula a la mitad.
Cada clula hija tiene
un conjunto idntico
de cromosomas
duplicado.
Interfase: la clula
crece y replica su
ADN y centrolos.
Profase: la cromati-
na se condensa en
los cromosomas.
Los centrolos
se separan y se
empieza a formar
el huso. La mem-
brana nuclear
se rompe.
Metafase: los cromosomas se alinean
en el centro de la clula. Cada cromo-
soma est conectado a las fbras
del huso en su centrmero.
Anafase: las cromatidas
hermanas se separan en
cromosomas individuales.
Telofase: los cromosomas
se aglutinan en los extremos
opuestos de la clula
y pierden sus formas
distintivas. Se forman
dos membranas
nucleares nuevas.
121
122
U 3 UAS
Apoptosis
En la formacin de un organismo pluricelular, la muerte celular o apoptosis es tan importante
como la divisin celular. En los vertebrados, por medio de la apoptosis se regula el nmero de
neuronas durante el desarrollo del sistema nervioso, se eliminan linfocitos que no funcionan co-
rrectamente y se moldean las formas de un rgano en desarrollo eliminando clulas especfcas.
Por ejemplo, las clulas de la cola de los renacuajos se elimina por este proceso durante la me-
tamorfosis. En los embriones humanos, las clulas que forman las membranas interdigitales se
eliminan por apoptosis en cierto momento del desarrollo.
La mayora de las clulas fabrican las protenas que forman parte de una maquinaria para su
propia destruccin. Las clulas que entran en apoptosis se encogen y se separan de sus vecinas;
se dividen en numerosas vesculas, las cuales sern engullidas por clulas vecinas.
Meiosis
La inmensa mayora de los organismos eucariotas -como las moscas, los chapulines, las estrellas
de mar, los peces, los girasoles y los seres humanos- se reproducen sexualmente. La reproduccin
sexual requiere, en general, de dos progenitores y siempre implica dos hechos: la meiosis y la
fecundacin.
La meiosis es un tpo especial de divisin nuclear y celular, en la cual una clula diploide
se divide dos veces para producir cuatro clulas haploides. El trmino meiosis proviene de una
palabra griega que signifca disminuir, y eso es exactamente lo que hace la meiosis: disminuye
el nmero de cromosomas a la mitad. Cada clula hija contene solamente la mitad del nmero
de cromosomas de la clula madre.
En los organismos multcelulares, la meiosis slo se realiza en las clulas germinales de los
rganos reproductores. En los animales, las clulas haploides que resultan de la meiosis son los
gametos vulos y espermatozoides y en las plantas con fores son los vulos y granos de polen.
En algunas plantas como los helechos y en muchos hongos, las clulas haploides son esporas.
La fecundacin (o fertlizacin) es la unin de clulas haploides para formar el cigoto, resta-
blecindose en este ltmo el nmero diploide (2n).
La meiosis es muy importante ya que mantene constante el nmero normal de cromoso-
mas de cada especie. Los citlogos predijeron la existencia de la meiosis antes de que fuese
observada, ya que sin ella la fecundacin duplicara el nmero de cromosomas en cada gene-
racin sucesiva.
Fases de la meiosis
La meiosis consiste en dos divisiones nucleares sucesivas, llamadas meiosis I y meiosis II. Cada
una de ellas comprende las cuatro fases de la mitosis: profase, metafase, anafase y telofase.
A contnuacin, se describir la meiosis en una clula animal cuyo nmero diploide es 4.
Las cuatro clulas hijas que se producen son clulas haploides ya que cada una de ellas conte-
ne slo 2 cromosomas. De los 4 cromosomas, 2 fueron heredados de un progenitor y los otros
2 del otro. Por cada cromosoma de un progenitor hay un cromosoma homlogo proveniente
del otro progenitor.
123
L cviui: uioo ov i vio DGEP
Durante la interfase, los cromosomas se replican, de modo que para el comienzo de la meio-
sis I cada cromosoma consiste en dos cromtdas hermanas idntcas unidas entre s a nivel del
centrmero. Este proceso se describe en la fgura 3.56.
Meiosis I
Profase I
Durante la profase I, los cromosomas homlogos se aparean e intercambian adn.
Las hebras de cromatna se acortan y engrosan hacindose visibles como cromosomas. Cada
cromosoma consta de dos cromtdas idntcas unidas a nivel del centrmero. Cada cromosoma
se une a su homlogo formando pares; cada par de cromosomas homlogos tene cuatro crom-
tdas, por lo que al conjunto se le denomina ttrada.
Las cromtdas de una ttrada frecuentemente se entrelazan formando cruces o puntos de
unin llamados quiasmas. Es en los quiasmas donde las cromtdas intercambian entre ellas
segmentos de adn, proceso que se conoce como entrecruzamiento. En los puntos donde hay
entrecruzamiento, un fragmento de cromtda de un homlogo se rompe y se intercambia por
un fragmento de cromtda del otro homlogo. Por lo que las cromtdas hermanas de cada
cromosoma homlogo dejan de ser gentcamente idntcas. El entrecuzamiento es un me-
canismo crucial para el proceso evolutvo. Observa la fgura 3.55. Tambin durante la profase
desaparece la membrana nuclear y el nuclolo y se forma el huso mittco.
Metafase I
Las ttradas se alinean a lo largo del ecuador de la clula.
Anafase I
Esta fase comienza cuando los cromosomas homlogos de la ttrada se separan y se dirigen hacia
polos opuestos.
Figura 3.55 a) Par de cromosomas homlogos. b) Ttrada, en la cual se observan los quiasmas, que son los sitos de
intercambio de adn, c) luego, los cromosomas se separan. Las cromtdas hermanas de cada homlogo ya no son
completamente indntcas.
Homlogo
Homlogo
Cinetocoro
Quiasma
Fibras
cinetocricas
Centrmero
T

t
r
a
d
a
Par de
cromosomas
homlogos
Cromtidas
hermanas
a b c
124
U 3 UAS
Telofase I
Esta fase se inicia cuando los cromosomas homlogos llegan a sus respectvos polos. Los eventos
que suceden son los siguientes: desaparece el huso, se forman las membranas nucleares alrede-
dor de cada conjunto de cromosomas y se lleva a cabo la citocinesis o divisin del citoplasma. El
resultado es que se forman dos clulas hijas, donde cada una tene un miembro de cada par de
cromosomas homlogos.
Por lo general, a la meiosis I le sigue de manera inmediata la meiosis II, con poca o ninguna
interfase.
Meiosis II
Las fases de la meiosis II son muy parecidas a la de la mitosis y ocurren en las dos clulas forma-
das en la meiosis I.
Profase II
El huso se vuelve a formar y la membrana nuclear y el nuclolo se desintegran. Cada cromosoma
est consttuido por dos cromtdas unidas por un centrmero.
Metafase II
Los cromosomas se alinean en el ecuador de la clula.
Figura 3.56 Meiosis en una clula animal con nmero diploide de 4, es decir con 4 cromosomas.
Interfase I
Las clulas
experimentan
una replicacin
del ADN, formando
cromosomas
duplicados.
MEIOSIS I
Profase I
Cada cromosoma
hace pareja con el
cromosoma homlogo
correspondiente para
formar una ttrada.
Metafase I
Las fbras del huso
se adhieren a los
cromosomas.
Anafase I
Las fbras tiran
de los cromosomas
homlogos hacia los
extremos opuestos
de la clula.
Telofase I
y citocinesis
Se forman las
membranas
nucleares.
La clula se
separa formando
dos clulas.
125
L cviui: uioo ov i vio DGEP
Anafase II
Las cromtdas de cada cromosoma se separan y se mueven hacia los polos opuestos de la
clula.
Telofase II
Los husos desaparecen y se forma una membrana nuclear alrededor de cada juego de cromoso-
mas. La citocinesis se lleva a cabo formndose un total de cuatro clulas haploides.
Cada una de las clulas haploides producidas por meiosis contene un complemento nico de
cromosomas, debido al entrecruzamiento y a la segregacin al azar de los cromosomas. De esta
manera, la meiosis es una fuente de variabilidad en la descendencia.
Diferencias entre mitosis y meiosis
Los acontecimientos que tenen lugar durante la meiosis se asemejan a los de la mitosis, pero
una comparacin de los dos procesos muestra un buen nmero de diferencias importantes (ta-
bla 3.3).
Durante la profase I de la meiosis, se produce el apareamiento de los cromosomas homlo-
gos seguido del alineamiento de los pares de homlogos en el plano ecuatorial en la metafase I,
y de la separacin de los homlogos, en la anafase I. Estos sucesos, que no se producen durante
la mitosis, son la clave de la reduccin del nmero cromosmico.
MEIOSIS II
Profase II
La meiosis I produce dos
clulas hijas haploides (n),
cada una con la mitad de
los cromosmas de la
clula original.
Metafase II
Los cromosomas
se alinean de manera
semejante a la fase
de metafase de la
mitosis.
Anafase II
Las cromtidas
hermanas se separan
y desplazan hacia los
extremos opuestos
de la clula.
Telofase II
y citocinesis
La meiosis II produce
cuatro clulas hijas
haploides (n).
126
U 3 UAS
Durante la meiosis, cada ncleo diploide se divide dos veces, produciendo un total de cuatro
ncleos. Sin embargo, los cromosomas se duplican slo una vez, antes de la primera divisin nu-
clear. Por lo tanto, cada uno de los cuatro ncleos producidos contene la mitad del nmero de
cromosomas presentes en el ncleo original. Mientras que en la mitosis, luego de la duplicacin
de los cromosomas, cada ncleo se divide slo una vez. En consecuencia, el nmero de cromoso-
mas se mantene invariable. Debido al fenmeno del entrecruzamiento y al de segregacin al azar
de los cromosomas, durante la meiosis se recombina el material gentco de los progenitores, lo
que no ocurre en la mitosis.
La mitosis puede ocurrir en clulas haploides o diploides, mientras que la meiosis ocurre
solamente en clulas con un nmero diploide (o poliploide) de cromosomas.
La meiosis en la especie humana
En todos los vertebrados, incluyendo la especie humana, la meiosis tene lugar en los rganos
reproductores, los testculos del macho y los ovarios de la hembra. En el macho, las clulas di-
ploides que experimentan la meiosis son los espermatocitos primarios, cada uno de los cuales
produce cuatro espermtdas haploides, que se transforman en aproximadamente 74 das en
espermatozoides.
En las hembras, las clulas diploides que sufren la divisin meitca se llaman ovocitos primarios.
Estas clulas tambin producen cuatro clulas haploides, pero el citoplasma se distribuye de ma-
nera desigual durante la citocinesis, tanto en la meiosis I como en la meiosis II. De cada ovocito
slo se forma un vulo (o clula huevo) que se queda con la mayor parte del citoplasma y tres
cuerpos polares los cuales se desintegran.
Tabla 3.3 Comparacin de mitosis y meiosis
Mitosis Meiosis
Ocurre en Todas la clulas Algunos tpos de clulas
del cuerpo de rganos reproductvos
No. de clulas producidas Dos Cuatro (tres pueden morir)
por clula progenitora
No. de cromosomas de Diploide (2n) o Diploide (2n)
clula progenitora Haploide (n)
No. de cromosomas de El mismo que en la clula Haploide (n)
clulas hijas progenitora
Tipo de clula producida Varias clulas, tales como Gametos animales o algunos tpos
las de la piel y msculos de esporas
Funcin Contnuidad gentca de Contnuidad gentca entre
clula a clula generaciones; promueve la variacin.
127
L cviui: uioo ov i vio DGEP
Figura 3.57 Divisin celular mitt-
ca y meitca en los seres humanos.
Observa la importancia que tenen
estos dos procesos de divisin celu-
lar en la reproduccin, crecimiento
y mantenimiento del ser humano.
Adulto
L cviui: uioo ov i vio DGEP




Mitosis para el mantenimiento
del organismo
Mitosis para el mantenimiento
del organismo
Mitosis para
formar
estructuras
corporales
y crecer
Mitosis
para
crecer
Meiosis en el ovario
para producir vulos
vulo
vulo
fecundado
Embrin
Beb
Espermatozoide
Meiosis en el testculo para
producir espermatozoides
128
U 3 UAS
Autoevaluacin
Repaso de la unidad
Contesta las siguientes preguntas:
1. Cules son los puntos principales de la teora celular?
________________________________________________________________________
2. Cmo ayud la invencin del microscopio a los cientfcos a conocer el mundo natural?
________________________________________________________________________
3. Cul es la diferencia entre magnifcacin y resolucin?
________________________________________________________________________
4. Cules son algunas de las ventajas y desventajas de los microscopios ptco y electrni-
co?
________________________________________________________________________
5. Qu organelos son comunes en clulas vegetales y animales, y cules son nicos en cada
una de ellas?
________________________________________________________________________
________________________________________________________________________
6. Las membranas separan a la clula de su ambiente, pero no son barreras infranqueables,
por qu es importante esto?
________________________________________________________________________
7. En qu se parecen la difusin facilitada y el transporte actvo? En qu son diferentes?
________________________________________________________________________
8. Cules son las semejanzas y diferencias entre cromatna y cromosomas?
________________________________________________________________________
9. Cul es la funcin de las mitocondrias?
________________________________________________________________________
10. Describe la importancia del atp para los seres vivos.
________________________________________________________________________
11. Defne en tus propias palabras que es la fotosntesis.
________________________________________________________________________
129
L cviui: uioo ov i vio DGEP
Indica cual de las siguientes afrmaciones son verdaderas (v) o falsas (f).
12. Robert Brown descubri el ncleo celular
13. Los organelos celulares son las unidades estructurales y funcionales de los
seres vivos
14. Mathias Schleiden introdujo el trmino clula en 1667
15. Los lisosomas se desprenden del aparato de Golgi
16. El tubo ptco es una pieza del microscopio compuesto, en su extremo
superior tene un lente llamado ocular
17. En las mitocondrias se obtene la energa que la clula requiere para realizar
sus actvidades
18. El microscopio electrnico de barrido proporciona imgenes tridimensionales
19. La cromatna es ms larga que los cromosomas
20. Las clulas de las plantas, de algas, de hongos y bacterias poseen pared
celular, adems de la membrana plasmtca
21. Los plasmodesmos son orifcios diminutos que poseen las paredes celulares
animales
En la siguiente sopa de letras, localiza la respuesta de lo que se te pide:
22. Es la difusin de molculas de agua a travs de una membrana selectvamente permeable.
23. Retculo endoplsmico en el que se sintetzan y transportan lpidos.
24. Organelo celular en el que se efecta la sntesis de protenas.
25. Es la muerte celular programada.
26. En esta fase de la mitosis, los cromosomas se alinean en el ecuador del huso mittco.
27. Son los sacos membranosos aplanados de los cloroplastos.
28. Son plstdos que almacenan almidn, protenas y aceites.
29. Organelos que partcipan en la formacin del huso mittco durante la divisin celular.
30. Divisin celular en la que se forman ttradas.
31. Tipo de clulas que se producen mediante la meiosis.
I L C E N T R I O L O S
N E U O S M O S I S G U
L U Y M U J B U K L U A
I C T I L A C O I D E S
S O E B E N U M L I M A
O P M E T A F A S E P M
A L E N E B I R U N S E
H A P L O I D E S U M I
V S A R X C V M K R L O
C T A R I B O S O M A S
A O V M R Q P C D B O I
B S B A P O P T O S I S
( )
( )
( )
( )
( )
( )
( )
( )
( )
( )
130
U 3 UAS
Elabora un modelo que represente las fases de la mitosis, utlizando diversos materiales tales
como el unicel, plastlina, papel, etc.
Completa los espacios en blanco de los siguientes enunciados:
32. La funcin de los ribosomas es sintetzar ___________________.
33. El ________________ es el centro de control de la clula. Consta de ________________,
_________________ y _________________.
34. Los ______________ son organelos digestvos que contenen enzimas.
Aplicacin de conceptos
35. Comenta qu le pasara a una clula si la membrana fuera permeable a todas las molculas.
________________________________________________________________________
36. Por qu las molculas solubles en lpidos, como las del alcohol, pasan rpidamente a
travs de las membranas?
________________________________________________________________________
37. Puede haber smosis entre los tejidos y las clulas muertas, pero el transporte actvo
puede ocurrir solamente en las clulas vivas. Explica por qu esto es as.
________________________________________________________________________
38. Si se tomara una muestra de tejido de las piernas de un corredor de maratn as como de
una papa, cul se esperara que tuviera una mayor densidad de mitocondrias? por qu?
________________________________________________________________________
39. De qu fuente obtenen las clulas la mayor parte de su energa?
________________________________________________________________________
40. En qu forma pueden la fotosntesis y la respiracin considerarse como procesos com-
plementarios?
________________________________________________________________________
41. Predice qu le pasara a la atmsfera terrestre si desaparecieran las plantas verdes. Qu
efecto tendra esto sobre la vida animal?
________________________________________________________________________
________________________________________________________________________
131
L cviui: uioo ov i vio DGEP
Fotosntesis
Reaccionan
CO
2
Forman las molculas
Alimento Gas
Completa el siguiente mapa conceptual:
Rotula la siguiente fgura:
Imagen de un vulo y espermatozoides hu-
manos durante la fecundacin tomada con
microscopio electrnico de barrido.
UNIDAD
4
G
e
n

t
i
c
a
:

l
a

c
i
e
n
c
i
a
d
e

l
a

h
e
r
e
n
c
i
a
135
Gentca: la ciencia de la herencia
Introduccin
Desde tempos remotos, el ser humano observ que ciertas caracterstcas en plantas y animales
eran hereditarias, es decir, se transmiten de los progenitores a los descendientes. Este conocimien-
to emprico fue aprovechado por las primeras civilizaciones que seleccionaban aquellas plantas y
animales que tenan las mejores caracterstcas. Por ejemplo, los natvos de Mxico y Centro Am-
rica desarrollaron ms de 300 variedades de maz a partr de una planta silvestre llamada teosinte.
Tambin, desde siempre, la humanidad ha observado que los nios se parecen a sus padres
en caracterstcas como los rasgos de la cara, color del cabello, color de ojos, complexin del cuer-
po, etc. Esto explica que a travs de los siglos los hombres de ciencia trataran de saber cmo se
lleva a cabo esta transmisin de caracterstcas de padres a hijos.
Una hiptesis que fue aceptada durante muchos aos fue la de la mezcla de caracterstcas que
deca que las caracterstcas de los padres se mezclaban en los hijos. Esta hiptesis era la idea que
prevaleca hasta los tempos de Mendel, pero todava contnuaba la duda de cmo era que estas
caracterstcas se transmitan de padres a hijos.
Fue hasta 1900, cuando se redescubri el traba-
jo de Gregorio Mendel, que se empez a aclarar el
panorama en cuanto a la transmisin de las caracte-
rstcas hereditarias. La transmisin de las caracte-
rstcas de padres a hijos se conoce como herencia.
La rama de la biologa que estudia la herencia es la
gentca. Muchos de los grandes descubrimientos
cientfcos del siglo XX se realizaron en el campo de
la gentca, que en la actualidad es una de las reas
ms actvas de la investgacin cientfca.
Gregorio Mendel, padre de la gentca
La gentca inici en 1865 con la publicacin de
las investgaciones cientfcas de un monje austra-
co llamado Gregorio Mendel. Las bases de la ge-
ntca moderna fueron construdas por Mendel,
quien us plantas de chcharo para estudiar cmo
las caracterstcas se pasaban de una generacin
a otra. Es de aclarar que antes de Mendel ya se
haba estudiado la herencia en las plantas, pero
nadie fue capaz de explicar cmo eran heredadas
las caracterstcas de las plantas progenitoras a
sus descendientes.
Figura 4.1 Gregorio Mendel descubri las leyes
bsicas de la herencia al realizar sus experimen-
tos con las plantas de chcharos.
136
U 4 UAS
Mendel tena la paciencia y los conocimientos que lo capacitaban para identfcar los patro-
nes de la herencia; tena conocimientos de biologa, matemtcas, probabilidad y fsica. En su
estudio, Mendel se ocup en dar por primera vez un enfoque matemtco a sus experimentos.
En aquel tempo, los investgadores no se apegaban a un mtodo cientfco de investgacin. Men-
del aplic las matemtcas a sus observaciones de la herencia a sus experimentos con plantas de
chcharo. Los resultados numricos no apoyaban la hiptesis de la mezcla de caracterstcas; la
evidencia lo conduca a sugerir nuevas hiptesis para explicar la herencia. Sin embargo, a causa
de que la mayora de los bilogos de ese tempo no tenan la sufciente preparacin en matem-
tcas, la trascendencia e importancia del trabajo de Mendel no fue reconocida sino hasta 35 aos
despus.
Investgaciones de Mendel
Mendel pacientemente experiment con cruces de plantas de chcharos durante 8 aos; cruzaba
plantas con caracterstcas diferentes, por ejemplo, de fores moradas con blancas; altas con ena-
nas. A los descendientes les llam hibridos, y a sus experimentos hibridaciones. Un hbrido es
hijo de dos padres que diferen en una o ms caracterstcas. En 1865 Mendel, public los resul-
tados de sus experimentos en la Revista Cientfca de la Sociedad de Historia Natural de Brn, con
el ttulo Experimentos de Hibridacin en Plantas, que consista en un trabajo de 46 cuartllas
donde se explicaba por primera vez los mecanismos bsicos de la transmisicn de las caracters-
tcas hereditarias de la mayoria de los seres vivos. Mendel tuvo xito en sus experimentos de
hibridacin porque se bas en tres aspectos fundamentales en la investgacin: 1) seleccionar el
organismo adecuado para trabajar, 2) disear y realizar el experimento correctamente y 3) anali-
zar la informacin de manera rigurosa.
Objetvos de Mendel
En realidad, Mendel no elabor previamente una hip-
tesis acerca de la herencia, sencillamente se trataba de
encontrar la forma en que las caracterstcas eran trans-
mitdas de padres a hijos, reuniendo datos de cruces de
plantas durante varias generaciones. Al fnal de sus ex-
perimentos, Mendel desarrollaba hiptesis para explicar
sus resultados.
Experimentos de Mendel
Mendel us el chcharo de jardn en sus experimentos
aprovechando ciertas caracterstcas fsicas de la planta
que favorecan la posibilidad de estudiarlas. Por ejem-
plo, la estructura cerrada de la for permite que la planta
de chcharo se autopolinice en forma natural. La transfe-
rencia de polen dentro de la misma for, o entre fores de
la misma planta se llama autopolinizacin. El polen de
Estructuras reproductoras
de la for de chcharo
Estambres
(estructuras
masculinas)
Gineceo
(estructura
femenina)
transferencia de polen
Flor morada Flor blanca
Figura 4.2 Mendel llev a cabo la poli-
nizacin cruzada entre dos variedades
de plantas puras para una caracterstca,
transfriendo manualmente polen de una
planta al gineceo de la otra planta.
137
Gvv:ic: i civci ov i nvvvci DGEP
los estambres fertliza los vulos en el pistlo de la misma for. Mendel entrecruz manualmente
las plantas poniendo el polen de una for en otra planta diferente. En este caso, nos referimos a
una polinizacin cruzada. Observa en la fgura 4.2 la estructura de la for del chcharo.
Uno de los aciertos en la investgacin de Mendel fue la cuidadosa seleccin de caracterst-
cas en las plantas del chcharo que el mismo haba desarrollado como lneas puras. Lnea pura es
un grupo de organismos que produce progenie con una caracterstca idntca, generacin tras
generacin. Por ejemplo, una variedad de chcharos que era pura para el color verde de la semilla,
producira nicamente chcharos con la semilla verde.
Las siete caracterstcas que Mendel estudi en esas plantas eran contrastantes entre ellas.
Observando la fgura 4.3 se nota, por ejemplo, que la vaina del chcharo es amarilla o verde; no
hay colores intermedios. Bajo las mismas circunstancias, se estudiaron las dems caracterst-
cas, como plantas altas y enanas, forma lisa o rugosa de la semilla, forma infada y contrada de
la vaina, color morado o blanco de la for y posicin axial o terminal de la for. Las semillas de la
planta de chcharo son fciles de obtener y se producen nuevas semillas en slo 90 das. El corto
ciclo reproductvo dio a Mendel rpidos resultados.
Tomemos como ejemplo el color de las fores para ilustrar cmo Mendel investg acerca
de la forma en que se transmitan los factores hereditarios. En sus experimentos, Mendel cruz
una variedad pura de for de color morada con una planta de variedad pura de for blanca. El le
llam a las plantas de lnea pura generacin paterna (P). Las plantas paternas produjeron una
generacin de plantas hbridas. Estas plantas descendientes fueron hbridos porque recibieron
informacin gentca de plantas con for morado de un progenitor y para planta de for blanca
del otro progenitor. Mendel llam a esta descendencia primera generacin flial (F
1
). Observa la
fg. 4.4 y podrs reconocer las mismas caracterstcas que encontr Mendel en la generacin F
1
.
Figura 4.3 Mendel estudio siete caracterstcas en las plantas de chcharo, cada una de las cuales podra ser expresa-
da slo de dos maneras diferentes y contrastantes.
Forma de la
semila
Rasgo
dominante
Rugosa Verde Blanca Terminal Amarilla Contrada Enano
Rasgo
recesivo
Forma de la
vaina
Largo del
tallo
Color de la
semila
Color de la
for
Color de la
vaina
Posicin de
la vaina
Lisa Amarilla Morada Axial Verde Infada Alto
138
U 4 UAS
Despus, Mendel dej que las plantas hbridas se autofertlizaran. A esta segunda generacin de
plantas se le llama segunda generacin flial (F
2
). Si observas la fgura 4.5, qu crees que observ
Mendel acerca del color de las fores en la generacin F
2
?
Observaciones de Mendel
La hiptesis de la mezcla de la herencia predeca que las plantas hbridas F
1
deberan ser de fores
rosas, sin embargo, Mendel encontr que todos los hbridos F
1
son de fores moradas. No haba
color intermedio ni blanco, aun cuando todas las plantas tenan un progenitor con fores blancas.
Cuando Mendel dej que las plantas hbridas F
1
se autofertlizaran, encontr que la caracters-
tca de for blanca reapareca. La generacin F
2
consist aproximadamente de 3/4 de plantas de
for morada y 1/4 de plantas de for blanca. En otras palabras, de cada 3 plantas de for morada
haba una planta de for blanca, es decir, una proporcin de 3 a 1. Mendel repit su serie de ex-
perimentos con las otras seis caracterstcas. En cada nuevo experimento, se encontr el mismo
patrn de herencia en la descendencia. Para cada caracterstca, la generacin entera F
1
se pare-
Figura 4.4 Mendel cruz variedades puras de for morada y for blanca obteniendo como resultado una generacin
de hbridos todos con fores moradas. Dnde qued el color blanco?
Figura 4.5 El cruce de individuos de la generacin F
1
result en una proporcin de una planta de for blanca por cada
tres plantas de for morada.
Plantas progenitoras Generacin F
1
Generacin F
1
Generacin F
2
WW
X
X
ww Ww
Ww Ww WW Ww Ww ww
Ww Ww Ww
139
Gvv:ic: i civci ov i nvvvci DGEP
ca slo a una de las plantas paternas. El rasgo del otro padre no se mostraba. Mendel llam a la
caracterstca que era mostrada en los hbridos F
1
carcter dominante. El rasgo que no se mostra-
ba en los hbridos F
1
le llam carcter recesivo. En el experimento del color de las fores, el color
morado es dominante y el color blanco es recesivo. Para identfcar los caracteres dominantes y
recesivos en cada cruce estudiado por Mendel, revisa la fgura. 4.6.
En la generacin F
2
, Mendel encontr que haba los dos tpos de plantas. Alrededor de las
3/4 partes de las plantas F
2
mostraban el carcter dominante, y alrededor de 1/4 de las plantas F
2

mostraban el carcter recesivo. Evidentemente, el pensamiento antguo acerca de la mezcla de
caracterstcas no se refejaba en los resultados que obtuvo Mendel.
Hiptesis de Mendel
Mendel aplic sus conocimientos matemtcos para establecer patrones en sus resultados, l
saba de la importancia de obtener un gran nmero de descendientes de cada cruce con el fn de
minimizar los efectos de errores cuando se considera slo un pequeo nmero de casos. Mendel
desarroll varias hiptesis para explicar sus resultados.
Primera hiptesis de Mendel
Mendel encontr que cada caracterstca es controlada por un factor dentro del organismo.
En la actualidad, se usa la palabra gen o gene en lugar de factor. Hoy sabemos que los genes
son segmentos de adn que se encuentran a lo largo de los cromosomas y que consttuyen las
unidades de herencia.
Mendel encontr que muchos factores tenen dos formas para una caracterstca. Por ejem-
plo, para el color de la for de chcharo, hay un factor para el morado y otro factor para el color
blanco. Por lo tanto, Mendel concluye su primera hiptesis estableciendo que las caracterst-
cas heredadas estn controladas por factores que se presentan en pares.
Figura 4.6 Los resultados obtenidos por Mendel al llevar cabo los cruces de cada una de las siete caracterstcas con-
trastantes fueron que todas las plantas hijas (generacin F
1
) presentaron la caracterstca dominante.
Forma de la
semila
Rugosa Arrugada Verde Verde Blanca
Terminal
Enano
X
X X
X
X X
P
F
1
Largo del
tallo
Forma de
la vaina
Color de la
semila
Color de la
for
Color de la
vaina
Posicin de
la for
Lisa Lisa Amarilla Amarilla Axial Alto
Morada X
Verde Lisa Lisa Amarilla Morada Axial Alto
140
U 4 UAS
Gentca moderna
Los principios bsicos de la herencia son actualmente llamadas leyes de Mendel, pero convie-
ne aclarar que Mendel no les llam leyes a sus hiptesis. Las hiptesis fueron afrmaciones que
Mendel propuso para explicar los resultados de sus experimentos. Los avances de las ciencias
naturales que se dieron posteriores a la presentacin de los trabajos de Mendel, proporcionaron
muchas evidencias que apoyaban esas afrmaciones, y que desde las primeras dcadas del siglo
XX son universalmente llamadas Leyes de Mendel.
Leyes de Mendel
El trabajo de Mendel debe ser situado en el ambiente cientfco de su poca. Nada se saba en-
tonces de los cromosomas ni de los genes ni de la divisin celular, tampoco de la unin de los
gametos; por lo tanto, los principios mendelianos estuvieron basados exclusivamente en la expe-
rimentacin sobre cruzamientos. Sin embargo, las ideas de Mendel acerca de cmo los factores
eran pasados de padres a descendientes son marcadamente similares a los procesos que hoy se
conocen acerca de la conducta de los genes y cromosomas en la meiosis y fecundacin.
El conocimiento de las etapas de la meiosis es tl para entender las leyes de Mendel. Recor-
demos que los organismos diploides tenen los cromosomas en pares. Un cromosoma de cada par
viene del vulo y el otro del espermatozoide. La ubicacin de los genes para la misma caracterstca
estn en la misma posicin en cada cromosoma del mismo par. A causa de que los organismos di-
ploides tenen dos cromosomas, hay dos copias de un gen para una caracterstca dada. Estas dos
Segunda hiptesis de Mendel
Otra conclusin fue que los rasgos que aparecan en las plantas F
1
deban ser ms fuertes que
sus rasgos contrastantes. A los factores para tales rasgos los llam dominantes; a los factores
que quedan escondidos les llam recesivos. Por ejemplo, el color morado es dominante sobre
el color blanco de las fores de chcharo. Esta es la segunda hiptesis que establece que en un
par de factores, uno de ellos oculta al otro, impidindole manifestar su efecto.
Tercera hiptesis de Mendel
Mendel reconoci que los dos padres contribuyen a la herencia de un organismo; por esta
razn, cada organismo debe tener dos factores para cada caracterstca. Mendel tambin
hipotetz que los dos factores se separan cuando se forman los gametos. Como resultado,
los gametos de un individuo contenen slo un factor de cada caracterstca. Durante la
fecundacin, los factores individuales son unidos para formar un par en los descendientes.
La tercera hiptesis de Mendel establece que se segregan o se separan un par de factores
durante la formacin de los gametos.
141
Gvv:ic: i civci ov i nvvvci DGEP
copias de genes son llamados alelos y los podemos defnir como las versiones diferentes de un
gen para la misma caracterstca.
Ley de la segregacin
Mendel prob que los factores se separan cuando se forman los gametos, esta generalizacin
resumida es ahora conocida como primera ley de Mendel o ley de la segregacin. La ley de la
segregacin establece que cada par de alelos se segrega o separa durante la meiosis. A causa de
la segregacin, la mitad de los gametos de un organismo tene un alelo de cada par y la otra mitad
de gametos contene al otro alelo. La segregacin de los pares de genes puede ser explicada por
la conducta de los pares de cromosomas durante la meiosis.
Ley de la distribucin
independiente
Mendel hizo varios experimen-
tos en los cuales estudi la he-
rencia de dos caracterstcas
contrastantes al mismo tem-
po. Por ejemplo, l cruz plan-
tas que tenan semillas lisas y
amarillas (caracterstcas domi-
nantes) con plantas que tenan
semillas rugosas y verdes (ca-
racterstcas recesivas). En la
generacin F
1
todas las semillas son lisas y amarillas. Cuando las plantas F
1
se autofertlizaron,
aparecieron en la generacin F
2
todas las combinaciones posibles del color de la semilla y de la
forma de la semilla. Observa la fg. 4.7. Esto signifca que, por ejemplo, el color de las semillas no
tene relacin alguna con la forma de la semilla de la planta de chcharo. Mendel concluy que las
caracterstcas o factores se heredan independientemente de los otros pares de factores. A esta
ley tambin se le conoce como segunda ley de Mendel.
La distribucin, independientemente de pares de genes, resulta de la conducta de los cro-
mosomas durante la meiosis. La separacin de los pares de cromosomas ocurre al azar y produce
muchas combinaciones diferentes de cromosomas en los gametos. Como los genes estn en los
cromosomas, la separacin al azar de los pares de cromosomas tambin separa azarosamente los
pares de genes.
Genotpo y fenotpo
En gentca se utlizan letras para representar los pares de genes que controlan las caracterst-
cas hereditarias. Como los genes estn en pares (como crea Mendel) entonces cada organismo
debe tener dos genes para determinar una caracterstca. Los genetstas usan las formas mi-
nsculas y maysculas de una misma letra porque los alelos para ciertas caracterstcas estn
en las versiones diferentes del mismo gen. Como regla, la letra mayscula representa el alelo
Figura 4.7 Cmo las combinaciones del color y forma de las se-
millas en la generacin F
2
evidencian que los pares de alelos se
segregan en gametos al azar e independientemente?
Semillas rugosas
verdes
Semillas lisas
amarillas
Todas las semillas
lisas y amarillas
(son fertilizadas)
Lisas
amarillas
Lisas
verdes
Rugosas
amarillas
Rugosas
verdes
P
F
1
F
2
142
U 4 UAS
dominante en un par de genes,
mientras que la letra minscula
representa al alelo recesivo. Los
organismos diploides tenen dos
alelos para cada caracterstca.
Los alelos de una planta que es
raza pura de for morada puede
ser escrito como WW. Una plan-
ta de chcharo con for blanca es
representada por ww, y el hbrido
tene los alelos Ww. La consttu-
cin gentca de un organismo es
llamado genotpo. Por ejemplo,
el genotpo de una planta de ch-
charo raza pura de fores mora-
das es WW. El genotpo muestra
ambos alelos en un par de genes
aun cuando no se exprese uno de
ellos, es el caso de los hbridos, que a pesar de tener for morada, su genotpo es Ww. El fenot-
po de un organismo es la apariencia externa, por ejemplo: el fenotpo del hbrido F
1
de Mendel
es for morada. El genotpo ww produce el fenotpo de planta con for blanca. A causa que W
es dominante, ambos genotpos WW y Ww producen el mismo fenotpo, es decir, planta
con for morada. Observa la fgura 4.8.
Cuando en un organismo los dos genes de un par son idntcos, se dice que es homocigtco
para esa caracterstca. WW y ww son ambos genotpos homocigtcos. La generacin paterna
(P) de Mendel consist de plantas que eran homocigotos para la caracterstca que se estudiaba.
Si los genes apareados no son idntcos, se dice que el organismo es heterocigtco. El ejemplo
de un genotpo heterocigtco es la generacin F
1
de Mendel. Los organismos heterocigtcos
se llaman tambin hbridos. Las plantas que tenen el genotpo mixto Ww son heterocigtcas o
hbridos de for morada.
Probabilidad y gentca
Mendel fue la primera persona que, a la vez que produjo hbridos, los clasifc y aplic el anlisis
matemtco a sus datos, especfcamente la rama de la probabilidad. La probabilidad es el estu-
dio de la forma en que operan las leyes del azar. El azar se refere a la posibilidad de que ocurra
cierto evento. Por ejemplo, obtener cara al trar una moneda al aire.
Expresiones tales como mitad y mitad o posibilidad de uno en diez describe la probabilidad
de que un evento puede suceder. El uso de fracciones y proporciones es una forma comn para
predecir la posibilidad de ocurrencia de un evento. Esa probabilidad se simboliza por la letra P. La
probabilidad es muy tl en biologa. Los genetstas usan la probabilidad para predecir los fenotpos
y genotpos de la descendencia cuando se experimenta con cruzamientos. La probabilidad puede
predecir los nmeros de cada clase de descendientes antes de que cada cruza se lleve a cabo. Ense-
guida veremos esto con ms detalle.
Figura 4.8 El genotpo es la consttucin gentca de un organismo
y su apariencia fsica es su fenotpo. Una planta de chcharo con
el genotpo WW es un organismo homocigtco para el color de
la for. Cul ser la representacin del genotpo para la planta con
fores blancas?
Ww
ww
WW
Genotipo Fenotipo
Alelo W
Alelo W
Alelo w
Alelo W
Alelo w
Alelo w
Cromosomas homlogos
143
Gvv:ic: i civci ov i nvvvci DGEP
Figura 4.9 La probabili-
dad de que dos mone-
das lanzadas al mismo
tempo caigan de un
mismo lado es de 1/4.
Tomemos el ejemplo de la mone-
da cuando es lanzada al aire. Si se
lanza una moneda al aire, hay dos
posibles resultados, guila o sello.
Puede ser guila o sello, pero no
ambos. Si se lanza una moneda al
aire 100 veces, se espera que 50
veces caiga guila y 50 veces caiga
sello. La probabilidad de que cai-
ga guila o sello es P=1/2 .
Suponiendo ahora que se lan-
cen dos monedas al mismo tem-
po, los dos lanzamientos son inde-
pendientes porque el lado del que
caiga una moneda no infuir en el
lado que caiga la otra moneda. Cul
es la posibilidad de que ambas mone-
das puedan caer del mismo lado? La pro-
babilidad que dos eventos sucedan juntos
es calculado multplicando sus probabilidades
por separado. La posibilidad de que la primera
moneda caiga en guila es P=1/2, y la posibilidad de que la segunda tambin sea guila es
P=1/2; entonces la probabilidad de que ambas monedas caigan en guila es 1/2x1/2=1/4. La
fgura 4.9 muestra con claridad
estas proporciones.
Volviendo a la gentca de
Mendel, y como se observa en
la fgura 4.10, los resultados pre-
dichos para un cruce autopoli-
nizado en plantas de chcharo
donde se sigue el color y forma
de la semilla ser de la siguiente
manera: consideramos que los
padres son heterocigotos para
esos genes; los padres producen
gametos con las cuatro combi-
naciones posibles de alelos: RY,
Ry, rY, ry. Cada combinacin te-
ne una probabilidad P=1/4 .
Figura 4.10 Una planta heterocigota para
dos caracterstcas como forma y color de
las semillas producir cuatro tpos de ga-
metos cuya combinacin tene una P=1/4
R (lisa), r (rugosa), Y (amarillo), y (verde).
P =1/2
P =1/2
P =1/2
Padres
RrYy
RY
P =1/4
RY
P =1/4
Ry
P =1/4
rY
P =1/4
ry
P =1/4
Ry
P =1/4
rY
P =1/4
ry
P =1/4
vulos
RRYY
RRYy
RrYY
RrYy
RRYy
RRyy
RrYy
Rryy
RrYY
RrYy
rrYY
rrYy
RrYy
Rryy
rrYy
rryy
P =1/4
P =1/4
P =1/4
P =1/4
P =1/2
Esperma
144
U 4 UAS
Durante la fertlizacin, los gametos se combinan; la probabilidad de que cada genotpo ocu-
rra en la descendencia es 1/16. Este resultado se debe a que la probabilidad de que los dos even-
tos sucedan juntos es el producto de las probabilidades de los dos eventos por separado. Cada
gameto tene una P=1/4, as la probabilidad de esta combinacin es P=1/4X1/4=1/16.
La proporcin predicha de cada fenotpo en la descendencia es de 9 amarillos lisos, 3 amari-
llos rugosos, 3 verdes lisos y 1 verde rugoso. La forma ms comn para expresar esta proporcin
de fenotpos es 9:3:3:1.
Cuadro de Punnet
Un mtodo para calcular probabilidades es hacer lo que se llama un cuadro de Punnet, llamado
as en honor de Reginald C. Punnet quien fue su inventor. En realidad, es una cuadrcula muy tl
para predecir los resultados de los cruces gentcos; es importante aclarar que slo muestra las
probabilidades, no los resultados. La forma de usar el cuadro de Punnet es la siguiente:
1. Escriba el genotpo de cada progenitor.
2. Determine los alelos en los gametos de los progenitores.
3. Ubique los alelos de los gametos de un
progenitor en la parte superior de la
cuadrcula y en la parte izquierda los del
otro progenitor.
4. Combine los alelos correspondientes de
cada lado en el interior de cada cuadro.
5. Determine los genotpos y fenotpos de
los descendientes en cada cuadro.
Ahora utlizaremos el cuadro de Punnet
para predecir las caracterstcas de la descen-
dencia en un cruce monohbrido y un cruce di-
hbrido.
Cruce monohbrido
Cuando slo se considera un par de caracterst-
cas contrastantes en un cruce, se le llama cruce
monohbrido. En el siguiente ejemplo retoma-
remos la herencia del color de la for de la plan-
ta de chcharo y no se tomarn en cuenta otras
caracterstcas.
a) La generacin P consiste de una planta
con for morada (WW) que se cruza con
una planta con for blanca (ww). La cru-
za se escribe WW x ww. La planta de for
Figura 4.11 Los resultados de mendel del cru-
ce F
1
son mostrados en este cuadro de Punnet.
Aqu hay tres posibles combinaciones de genes:
WW, Ww y ww.
F
1
Ww
W
W
WW
Ww
Ww
ww
w
w
Ww
145
Gvv:ic: i civci ov i nvvvci DGEP
morada produce gametos que portan el alelo W. La planta de for blanca produce gametos
que portan el alelo w. Su descendencia, la generacin F
1
, deber siempre tener el genot-
po Ww.
b) Como se muestra en la fgura 4.11, el cruce entre dos plantas F
1
(o una sola planta F
1
que
se autofertlice) es escrita Ww x Ww. Siendo hbridos los F
1
, pueden contribuir con dos
tpos de gametos, la mitad de ellos porta el alelo W y la otra mitad porta el alelo w. Una
forma fcil de predecir las caracterstcas de la descendencia de este cruce es usando el
cuadro de Punnet. Como se indica en la misma fgura, los alelos que son aportados por
los progenitores se anotan en la parte superior y al lado izquierdo del cuadro. Entonces,
en el interior, se combina cada uno de los alelos que coincidan en cada cuadro interior.
c) Las combinaciones de los alelos en los cuadros interiores son los genotpos de la gene-
racin F
2
; al contar el nmero de los diferentes genotpos en el cuadro de Punnet, se
encontrar un WW, dos Ww y un ww. Se escribir estos resultados del cruce como una
proporcin genotpica 1:2:1. Despus de esto se pueden determinar los fenotpos de la
descendencia a partr de sus genotpos. Si W es dominante sobre w, entonces el color
morado es dominante sobre el blanco, tres de las plantas tendrn for de color morado
y una tendr color blanco. Esta proporcin de plantas puede ser escrita como propor-
cin fenotpica de 3:1.
Cruce dihbrido
Es ms comn investgar sobre la
herencia siguiendo dos de las carac-
terstcas al mismo tempo. Un cruce
que comprende dos grupos diferen-
tes de caracterstcas se llama cruce
dihbrido.
a) Usaremos como ejemplo a
las plantas con semillas que
a la vez que son amarillas
son lisas, y a las plantas con
semillas verde y rugosa. Una
planta progenitora que es
homocigota, para semillas
amarillas y lisas se simboliza
como (RRYY), y la otra plan-
ta progenitora homocigota
para semilla verde y rugo-
sa se simboliza (rryy). Los
gametos producidos por las
plantas progenitoras (P) se-
rn RY y ry, es decir, un alelo
para el color de la semilla y
Figura 4.12 La generacin F
2
de un cruce de dos caracterstcas
claramente muestra que los alelos se segregan independiente-
mente uno de otro.
F
1
RY
RRYY
RY
Ry
rY
ry
RRYy
RrYY
RrYy
RrYY
RrYy
rrYY
rrYy
RRYy
RRyy
RrYy
Rryy
RrYy
Rryy
rrYy
rryy
Ry rY ry
RrYy RrYy
X
146
U 4 UAS
otro para la forma de dicha semilla. Por esto, toda la generacin hbrida F
1
debe tener el
genotpo RrYy. Observa la fgura 4.12 donde aparece este cruce dihbrido.
b) Al cruzar de nuevo a las plantas F
1
, entre ellas mismas resultar un cruce que se escribe
RrYy x RrYy. La ley de la distribucin independiente establece que los alelos se distribuirn
en todas las combinaciones posibles, entonces hay cuatro combinaciones de alelos en los
gametos de las plantas F
1
: RY, Ry, rY, ry.
c) Al anotar los gametos en la parte superior y lado izquierdo de una cuadrcula de 4x4,
podemos combinar los alelos en los cuadros interiores para determinar los genotpos
y fenotpos de los descendientes F
2
. El resultado es que hay 9 semillas lisas amarillas, 3
semillas rugosas amarillas, 3 semillas verdes lisas y 1 semilla verde rugosa. Es claro que la
proporcin fenotpica es de 9:3:3:1.
Mecanismos de herencia no mendelianos
Adems de las leyes de Mendel que
describen claramente los mecanismos
bsicos de la herencia, se han recono-
cidos otros patrones de herencia y de
expresin diferentes a las de Mendel.
Dominancia incompleta
La dominancia incompleta es una con-
dicin hereditaria que ya se haba ob-
servado desde mediados del siglo XIX,
y consiste en que un organismo hete-
rocigoto tene un fenotpo intermedio
entre los dos fenotpos homocigotos
de los progenitores; ningn alelo se ex-
presa totalmente.
Un ejemplo de dominacin incom-
pleta es el color de la for en la siciliana,
tal como se muestra en la fg. 4.13. En un
cruce entre una siciliana con for roja y
otra de for blanca, la descendencia te-
ne fores rosas. No debe pensarse que
los alelos se mezclan; en la dominancia
incompleta solamente es el fenotpo el
intermedio, ya que los alelos rojo y blan-
co permanecen separados. La mitad de
los gametos de la planta con for rosa
portan el alelo para rojo y la otra mitad
portan el alelo para blanco.
Figura 4.13 En la dominancia incompleta ningn alelo es
dominante sobre otro. Al cruzar dos plantas de for rosa es
posible tener fenotpos: for roja, for blanca y for rosa.
Generacin F
1
(todas las fores
son rosas)
Generacin F
2
Progenitores
(Flor blanca)
(Flor roja)
RR (Flor roja)
Rr (Flor rosa)
Rr (Flor rosa)
rr (Flor blanca)
RR
rr
Rr
Rr Rr
R
R
r
r
X
X
147
Gvv:ic: i civci ov i nvvvci DGEP
Codominancia
Existen casos en los que ambos alelos en un heterocigoto se expresan totalmente. Esto es otra
forma de herencia intermedia. Es un buen ejemplo dos de los alelos responsables de los grupos
sanguneos humanos A y B. Son codominantes uno del otro, por lo siguiente: si una persona reci-
be el alelo tpo A (I
A
) de un padre, y recibe el alelo tpo B (I
B
) del otro padre, tal persona tendr
el genotpo ( I
A
I
B
). Este genotpo produce el fenotpo del tpo sanguneo AB. La sangre de esta
persona tene las caracterstcas para ambos tpos sanguneos A y B. Los alelos para los otros tpos
sanguneos se muestran dominantes o recesivos entre ellos.
Herencia polignica
Es comn reconocer que a veces varios pares de genes partcipan en la determinacin de ciertas
caracterstcas en el mismo individuo. Las caracterstcas controladas por ms de dos pares de
genes son consecuencia de la herencia polignica. Caracterstcas como la estatura, el peso, el
color de la piel y el color de los ojos en el ser humano son rasgos polignicos. Por ejemplo, se cree
que el color de la piel est controlado por cuatro a siete pares de genes. Los varios alelos de estos
pares de genes producen diferentes cantdades del pigmento llamado melanina. La combinacin
de la totalidad de los alelos de todos los pares de genes determinan cunta melanina debe pro-
ducirse en el cuerpo de una persona, por lo que, el color de una persona es la suma de los efectos
de todos los genes presentes para el color de su piel; es por eso que hay tantos tonos de piel.
Alelos mltples
Los alelos mltples existen cuando hay ms de dos alelos para una caracterstca en una pobla-
cin. Nuevamente, los tpos sanguneos del ser humano nos ejemplifcan sobre esta condicin.
Los genes de los tpos sanguneos humanos
existen como alelos mltples. Los tpos san-
guneos son fenotpos que pueden ser pro-
ducidos por tres alelos diferentes, los cuales
se presentan como I
A
, I
B
, e i. Cada persona
tene slo dos de estos genes, uno de cada
padre, pero, en la poblacin humana ente-
ra, existen tres alelos. Como sabemos, los
genes I
A
, I
B
son codominantes, pero ambos
son dominantes sobre i. Una persona ho-
mocigtca (ii) tene el tpo sanguneo O. En
la tabla 4.1 podemos ver que hay seis geno-
tpos y cuatro fenotpos para los tpos san-
guneos humanos. Los cuatro fenotpos sanguneos son A, B, AB y O.
Es necesario no confundir alelos mltples con rasgos polignicos. En el caso de los poligni-
cos, cada individuo tene muchos pares de genes, los cuales se expresan todos simultneamente.
En los alelos mltples hay muchos alelos diferentes de un gen en la poblacin, sin embargo, un
individuo hereda slo dos de estos alelos uno de la madre y otro del padre.
Tabla 4.1 Tipos de sangre humana
Fenotpos (tpos sanguneos)
A
B
AB
O
Genotpos
|
A
|
A
|
A
i
|
B
|
B
|
B

i
|
A
|

B
ii
148
U 4 UAS
Genes y cromosomas
Cromosomas y recombinacin
Mientras que las publicaciones de Mendel permanecan en el olvido, se hicieron algunos descu-
brimientos que daban idea acerca de algunos aspectos de la herencia. As, en 1879, el bilogo
alemn Walter Flemming descubri los cromosomas al teir clulas y describi el proceso de la
mitosis. Al avanzar los conocimientos acerca de los cromosomas, se supona que eran estos los
portadores de las caracterstcas hereditarias.
En 1900, los bilogos, Carl Correns, Hugo de Vries y Erick Tschermak, trabajando indepen-
dientemente llegaron a las mismas conclusiones que Mendel. Con gran sorpresa y antes de pu-
blicar sus trabajos, encontraron en archivos de revistas cientfcas el artculo que Mendel haba
publicado 30 aos antes. Cada uno de los cientfcos le dio el crdito completo a Mendel.
La teora cromosmica de la herencia
Poco despus de que el trabajo de Mendel fue redescubierto, varios cientfcos notaron la si-
militud entre los factores de Mendel y la conducta de los cromosomas durante la meiosis.
Tres aos despus del redescubrimiento de los trabajos de Mendel, Walter S. Suton y Theodor
Boveri propusieron de manera independiente que los factores de Mendel para determinar las
caracterstcas hereditarias estaban localizados en los cromosomas. Posteriormente se recono-
cieron a los factores de Mendel como genes y a la propuesta de Suton y Boveri se le llam teora
cromosmica de la herencia.
Genes ligados
Si existen ms genes que cromosomas, es posible que algunos genes no se van a distribuir inde-
pendientemente porque deben estar juntos o ligados.
Uno de los primeros pares de genes ligados fue descubierto por William Bateson y R. C.
Punnet en 1906, cuando experimentaban con una planta de chcharo dulce (es una variedad
diferente a la que us Mendel). Bateson y Punnet hicieron un cruce dihbrido, o sea, involu-
crando dos caracterstcas de las plantas. El color de la for prpura (P) es dominante sobre el
color rojo (p),y la forma larga del polen (L) es dominante sobre el polen de forma redonda (l).
Cuando un chcharo homocigoto de fores prpuras y polen largo (PPLL) fueron cruzados con
un chcharo homocigoto de for roja y polen redondo (ppll), como se esperaba, la generacin F
1

fue heterocigota con fores prpura y polen largo (PpLl). Tambin se esperaba que los fenotpos
de la generacin F
2
mostraran una proporcin de 9:3:3:1, resultado predicho por la ley de la
distribucin independiente de Mendel. Sin embargo, los resultados de Bateson y Punnet fueron
diferentes a esa proporcin. La mayora de las plantas fueron prpura larga y roja redonda, es
decir, los fenotpos de los progenitores. Slo pocas plantas tenan las combinaciones fenotpicas
de prpura redonda y roja alargada. Observa estos resultados en la fgura 4.14. Bateson y Pun-
La teora cromosmica de la herencia dice que los cromosomas son los portadores de los genes.
149
Gvv:ic: i civci ov i nvvvci DGEP
net supusieron que los genes estaban de alguna manera conectados o acoplados, y entonces
tendan a distribuirse juntos cuando los gametos eran formados.
Pocos aos despus de los experimentos de Bateson y Punnet, Thomas Hunt Morgan hizo
un experimento similar. Morgan us la mosca de la fruta Drosophila en sus experimentos y en-
contr que las caracterstcas del color del cuerpo y de la forma de las alas no se distribuan inde-
pendientemente. Morgan propuso que tales resultados podan ser explicados si los genes eran
portados en el mismo cromosoma. Los genes que estn en el mismo cromosoma son llamados
genes ligados. Cuando los genes para caracterstcas diferentes estn muy cerca en el mismo cro-
mosoma, ellos tenden a distribuirse juntos durante la meiosis y a heredarse juntos. Por lo tanto,
los genes ligados no se distribuyen independientemente.
Recombinacin gentca
Pocas plantas de la generacin F
2
del experimento de Bateson y Punnet tenan fores prpuras
con polen redondo y fores rojas con polen largo. Cmo sucedi esto si los genes estn ligados?
Las plantas con las caracterstcas prpura-redondo y rojas-largo fueron el resultado del entrecru-
zamiento. Recordemos que el entrecruzamiento es el intercambio de genes entre cromosomas
homlogos y este se lleva a cabo durante la profase I de la meiosis. El reacomodo de genes en
nuevas combinaciones por entrecruzamiento es llamado recombinacin gentca. Un organismo
o un cromosoma con un conjunto de genes recombinados es descrito como recombinante; una
planta con el fenotpo recombinante de prpura-redondo podra tener el genotpo Ppll. Este ge-
notpo puede slo ser producido si un gameto tuvo la combinacin de genes Pl, tal combinacin
es producida slo por entrecruzamiento. La frecuencia del entrecruzamiento entre genes liga-
dos puede utlizarse para localizar los genes en un cromosoma y determinar si dos genes estn
en el mismo cromosoma, y si es as, qu tan cerca o lejos estn. Con esa informacin se puede
construir una especie de mapa cromosmico que muestran las posiciones de los genes en los
cromosomas.
Figura 4.14 Resultados de la generacin F
2
del experimento de Bateson y Punnet. La
proporcin de fenotpo es diferente a la esperada 9:3:3:1. Observa que slo los fenot-
pos de los progenitores son los que ms se presentan.
Fenotipos de la for y polen
Nmero observado
de plantas
Prpura
Prpura
Roja
Roja
Largo
Redondo
Largo
Redondo
296 (9)
27 (1)
19 (1)
85 (3)
240 (9)
80 (3)
80 (3)
27 (1)
Nmero esperado
de plantas
150
U 4 UAS
Experimentos de Morgan
Thomas Hunt Morgan emple en sus in-
vestgaciones en gentca a la mosca de
la fruta Drosophila melanogaster. Es un
organismo ideal para estudiar la gent-
ca porque es fcil de alimentar y man-
tener. Ms aun estas moscas producen
una nueva generacin aproximadamen-
te en dos semanas, produciendo en cada
cruza ms de cien descendientes. Droso-
phila tene slo cuatro pares de cromo-
somas, los cuales pueden ser estudiados
fcilmente con un microscopio. Un par
de esos cromosomas determina el sexo
de los insectos. Estos cromosomas son
llamados cromosomas sexuales.
Los cromosomas sexuales fueron
descubiertos en 1905 por la investgado-
ra Nete Stevens, que los identfc en
un tpo de abeja. En la fgura 4.15 se puede ver que los cromosomas sexuales de la mosca de la
fruta diferen en el macho y la hembra. En los machos, uno de los cromosomas sexuales es llama-
do X y el otro Y. En las hembras, los dos cromosomas sexuales son X.
El color normal de ojos en la mosca de la fruta es rojo. Morgan encontr que entre sus mos-
cas haba una mosca macho con ojos blancos en vez de los ojos rojos. Variaciones tales como el
gen para ojos blancos suceden algunas veces, cuando un gen de un cromosoma cambia espont-
neamente se le conoce como mutacin.
Morgan cruz una hembra de ojos rojos con el macho de ojos blancos. Toda la descenden-
cia F
1
tena los ojos rojos; no hubo ninguna difcultad para reconocer al alelo mutante para ojos
blancos como recesivo con respecto al alelo rojo. Despus, Morgan cruz machos y hembras de
la generacin F
1
para producir una generacin F
2
. Casi tres cuartos de las moscas F
2
tena los ojos
rojos, mientras que el otro cuarto tena los ojos blancos. Estos resultados coincidieron con la ley
de la segregacin de Mendel, excepto por una cosa: todas las moscas de ojos blancos eran ma-
chos. Nada en la hiptesis de Mendel poda explicar caracterstcas relacionadas con el sexo del
organismo.
El color de ojos es heredado en forma diferente por machos y hembras. Este hecho fue con-
siderado por Morgan como una asociacin de estos genes con los cromosomas sexuales. Morgan
explic que el gen para el color de ojos estaba sobre el cromosoma X y que el cromosoma Y no porta
ningn gen para el color de ojos. Los genes encontrados en el cromosoma X o Y son llamados genes
ligados al sexo. Observa los genotpos y fenotpos de las generaciones p, F
1
y F
2
en la fgura 4.16.
Los genes ligados al sexo deben representarse con un superndice en la parte superior de X o
Y. Por ejemplo, el ojo rojo es dominante y se representa con la letra R. El genotpo de la hembra
de ojos rojos se escribe X
R
X
R
, mientras que una hembra heterocigota es X
R
X
r
. El genotpo para una
mosca macho con ojos rojos es X
R
Y. Ntese que no hay superndice sobre Y, dado que ese cromo-
Figura 4.15 La mosca de la fruta tene cuatro pares de cro-
mosomas, tres pares de autosomas y un par de cromosomas
sexuales. Observa la diferencia entre los cromosomas sexua-
les de la hembra y del macho.
Cromosomas
sexuales
Autosomas
Autosomas
Mosca
hembra
Mosca
macho
Cromosomas
sexuales
X
X
Y
X
151
Gvv:ic: i civci ov i nvvvci DGEP
Figura 4.16 Los dos cuadros de Punnet nos muestran los resultados obte-
nidos por Morgan en la generacin F
1
y F
2
.
soma no porta alelo para
esta caracterstca. La le-
tra Y es incluida en el ge-
notpo para mostrar que
la mosca es un macho;
el genotpo de un macho
de ojos blancos es X
r
Y.
Esta simbologa se apre-
cia en la fgura 4.16.
En la generacin F
2
,
alrededor de la mitad
de los machos reciben
el alelo dominante para
ojos rojos y la otra mi-
tad reciben el alelo do-
minante para ojos blan-
cos. Al no haber alelo
correspondiente en el
cromosoma Y, un gen en
lo individual determina
la caracterstca. As, la
caracterstca recesiva
es expresada en los ma-
chos que heredan ese
alelo. Qu genotpos se
encontrarn en las hem-
bras de la generacin F
2
?
Morgan hizo otro
experimento para pro-
bar su hiptesis de que
el gen para el color de
ojos est en el cromo-
soma X. El cruz un ma-
cho ojos blancos (X
r
Y)
con hembras de ojos rojos de la generacin F
1
(X
R
X
r
). Qu resultado puedes predecir? En la
fgura 4.17 se muestra que alrededor de la mitad de las hembras tendran ojos blancos, resul-
tado que Morgan obtuvo. Debido a que las hembras no heredan un cromosoma Y, el gen para
ojos blancos no estar en aquel cromosoma. El gen estar en los cromosomas X.
Morgan fue el responsable del descubrimiento de los genes ligados al sexo, pero sus series de
experimentos tambin confrmaron la teora cromosmica de la herencia. Los experimentos con el
color de ojos blancos en Drosophila, proporcionaron la primera evidencia que ubica un gen part-
cular en un cromosoma partcular.
Gracias a las investgaciones de Morgan con la mosca Drosophila, la teora cromosmica de la
herencia queda bien establecida.
Macho
ojo blanco
X
r
Y
X
r
X
r
X
r
X
r
X
r
X
r
X
r
X
R
X
R
X
R
X
R
X
R
y
X
R
Y
X
R
X
R
X
R
X
R
X
R
X
R
X
R
Y
Y
Y
X
R
y
X
R
X
R
Y
Hembra
ojo rojo
Macho
ojo rojo
Hembra
ojo rojo
Generacin F
1
(todos tienen
ojos rojos)
Generacin F
2
(3/4 ojo rojo
1/4 ojo blanco)
152
U 4 UAS
Cromosomas y determinacin
del sexo
En los mamferos, en muchos in-
sectos, en algunos peces y en las
plantas dioicas, los machos tenen
el mismo nmero de cromosomas
que las hembras, pero un par, el
de cromosomas sexuales, es muy
diferente en apariencia y composi-
cin gentca. Las hembras tenen
dos cromosomas sexuales idnt-
cos llamados cromosomas X, y los
machos tenen slo un cromosoma
X y un cromosoma Y. El sexo es de-
terminado por la combinacin de
los cromosomas X y Y.
Los cromosomas X y Y son mar-
cadamente no homlogos; en otras
palabras, la mayora de los genes en un cromosoma no tenen alelos correspondientes en el otro.
Los genes en el cromosoma X se dicen ser ligados a X, y los genes en el cromosoma Y son ligados
a Y. Muchos genes ligados al sexo no tenen que ver con caracterstcas sexuales, por ejemplo,
el gen de ojos blancos en Drosophila no tene nada que ver con la masculinidad o feminidad
de la mosca. Todos los pares de cromosomas, excepto los cromosomas sexuales, son llamados
autosomas; la mayora de los cromosomas en el organismo son autosomas. Los nmeros de cro-
mosomas varan, pero siempre hay slo un par de cromosomas sexuales; por ejemplo, la mosca
Drosophila tene 4 pares de cromosomas (3 pares de autosomas), los seres humanos tenemos 23
pares (22 pares de autosomas) y los perros 39 pares (38 pares de autosomas).
Determinacin del sexo
Durante la meiosis, los cro-
mosomas sexuales se se-
gregan en pares, de la mis-
ma manera que los autoso-
mas. Como resultado de la
segregacin, la mitad de los
espermatozoides portarn
un cromosoma X, y la otra
mitad portarn un cromo-
soma Y. La hembra, con dos
cromosomas X, producir
vulos siempre con cromo-
somas X.
Figura 4.18 Cuando un espermatozoide con un cromosoma X fecunda un
vulo, el organismo resultante ser una hembra. En cambio, si el espermato-
zoide tene un cromosoma Y, el organismo que resulta de esta fecundacin
es un macho. En los seres humanos quien determina el sexo?
Figura 4.17 Resultados del
cruce de Morgan entre un
macho de ojos blancos (X
r
Y)
y una hembra de ojo rojo
(X
R
X
r
), el cual evidenci que
el gen para el color de ojos
en Drosophila se encuentra
en el cromosoma X.
Espermatozoide
Espermatozoide
Cigoto hembra
Cigoto macho
vulo
vulo
+
+
X
Y
X
X
XX
XY
Macho
ojo blanco
Hembra
ojo rojo
X
r
Y
X
r
X
r
X
r
X
r
X
r
X
r
X
r
X
R
X
R
X
R
X
R
Y
Y
Y
153
Gvv:ic: i civci ov i nvvvci DGEP
Como puedes ver, en la fgura 4.18, el sexo de la descendencia es determinado en la fecun-
dacin. Cuando un espermatozoide con cromosoma X fecunda a un vulo, el cigoto resultante
contene dos cromosomas X, por lo que el organismo resultante es hembra. En el caso de que
un espermatozoide con un cromosoma Y fertlice un vulo, el cigoto contene los cromosomas
X y Y, resultando un macho. Ntese que en estos organismos es el macho el que determina el
sexo.
En muchos organismos no hay cromosomas sexuales, por ejemplo, en la mayora de las
abejas y hormigas el sexo es determinado por el nmero cromosmico total. Los machos son
producidos de vulos sin fertlizar y son haploides. Las hembras se desarrollan a partr de vulo
fertlizado y son diploides; algunos peces y reptles no tenen cromosomas sexuales. En estos
animales, el sexo de un individuo es determinado por factores ambientales; por ejemplo, el
sexo del embrin de caimn es determinado por la temperatura a la cual se desarrolla el hue-
vo. Adems, en las aves, las polillas, las mariposas, los reptles y algunos peces y anfbios es el
macho el que tene dos copias correspondientes del cromosoma sexual, mientras que la hem-
bra tene los cromosomas sexuales desiguales. En estas condiciones, por ejemplo, en las aves
es la hembra la que determina el sexo.
Caracterstcas limitadas por el sexo
Previamente encontramos que existen caracterstcas que estn determinadas por los cromosomas
sexuales y son llamadas caracterstcas ligadas al sexo. En este caso, se menciona al daltonismo y
a la hemoflia; sin embargo, tambin los autosomas contenen algunos genes que son expresados
slo en uno o en otro sexo. Caracterstcas autosmicas que son expresadas slo en un sexo son
llamadas caracterstcas limitadas por el sexo. Los genes limitados por el sexo son portados por
ambos machos y hembras; sin embargo, esos genes son actvados por las hormonas de un sexo,
pero no por las hormonas del otro sexo. El crecimiento de la barba en los machos y la produccin de
leche en hembras son ejemplos de caracterstcas limitadas por el sexo.
Caracterstcas infuenciadas por el sexo
Otros genes localizados en cromosomas autosmicos estn infuenciados por el sexo; sin embar-
go, tampoco estn ligados al sexo. Las caracterstcas infuenciadas por el sexo se encuentran en
ambos sexos, pero se expresan en forma diferente. El padre o la madre pueden pasar estos genes
tanto a las hijas como a los hijos.
La calvicie es una caracterstca infuenciada por el sexo; tanto hombres como mujeres pue-
den ser calvos, pero la calvicie es mucho ms frecuente en los hombres. Esto se debe a que las
hormonas sexuales infuyen en la expresin del gen de la calvicie. En la presencia de hormonas
sexuales masculinas, este gen es dominante, pero en la presencia de las hormonas sexuales fe-
meninas este gen acta como recesivo.
Adems de la calvicie, se conoce como caracterstcas infuenciadas por el sexo al labio lepo-
rino y la gota, que se presentan ms frecuentemente en hombres que en mujeres. El desorden
gentco de la espina bfda, que consiste en una fsura de una vrtebra, es ms comn en las
mujeres.
154
U 4 UAS
Mutaciones
cromosmicas
Los cromosomas pue-
den sufrir cambios es-
pontneos, tales cam-
bios que involucran a
cromosomas enteros
o partes de ellos son
llamadas mutaciones
cromosmicas. Estas
usualmente ocurren
durante la mitosis o
meiosis. Hay dos t-
pos de mutaciones
cromosmicas, uno
de ellos son los cam-
bios en la estructura
del cromosoma y, el
otro, son los cambios
en el nmero normal
de cromosomas. En el
caso de las mutacio-
nes en la estructura del cromosoma se reconocen cuatro alteraciones:
Delecin: prdida de una parte del cromosoma.
Duplicacin: repetcin de una parte del cromosoma.
Inversin: un fragmento del cromosoma se separa y se reinserta invertdo.
Translocacin: una parte de un cromosoma se une a otro diferente.
Las mutaciones cromosmicas son an ms drstcas que las gnicas en sus efectos sobre un
organismo ya que involucran a muchos genes. Por lo general, estos cambios drstcos provocan
la muerte o deformaciones en la descendencia; rara vez pasan a las generaciones siguientes.
El otro tpo de mutacin cromosmica sucede cuando los cromosomas homlogos no se
separan durante la meiosis, de esto resulta un nmero desigual de cromosomas en los gametos
producidos. Este error se le conoce como no-disyuncin, a consecuencia de que algunas veces
las cromtdas o pares de homlogos de cromosomas fallan en la separacin correcta durante la
mitosis o meiosis. Cuando la no-disyuncin ocurre en la mitosis, la clula puede morir, pero el
organismo usualmente no es daado. Pero cuando la no disyuncin ocurre en la meiosis, el resul-
tado es un gameto anormal que puede producir una descendencia anormal. Ese gameto tendr
un cromosoma extra o le faltar un cromosoma. Observa la representacin esquemtca de la
no-disyuncin en la fgura 4.20.
Si un gameto anormal se fusiona con un gameto normal, el cigoto tendr tambin un nmero
anormal de cromosomas. Si el cigoto recibe slo un cromosoma partcular en lugar de dos, a esta
Figura 4.19 La delecin, duplicacin, inversin y translocacin son las cuatro mu-
taciones que alteran la estructura de los cromosomas. Cul es la diferencia entre
duplicacin e inversin?
A
A
A
A W
W
A
B
B
B
B X
X
D
C
C
C
C A
Y Y Z Z
Translocacin
Inversin
Delecin
Duplicacin
C
D
D
D
D B
B
E
E
E
E C
E
F
F
F
F D
F
G
G
G
G E
G
H
H
H
H F G H
H
A
A
B
B
C
C
E
B
F
C
G
D
H
E F G H
155
Gvv:ic: i civci ov i nvvvci DGEP
condicin se le llama monosoma. En la trisoma, el cigoto recibe tres cromosomas de un tpo
partcular en lugar de los dos cromosomas que normalmente se reciben. La no disyuncin puede
involucrar cromosomas autosmicos o sexuales.
En humanos, la monosoma o trisoma en cualquier par de cromosomas produce alteracio-
nes tan fuertes que puede matar al embrin durante su desarrollo; sin embargo, si la descenden-
cia sobrevive, tendr difcultades en su desarrollo. Por ejemplo, la trisoma en el cromosoma 21
en humanos causa el sndrome de Down; las personas con sndrome de Down estn incapacita-
das severa o medianamente. Tpicamente, las personas con este desorden gentco tenen varias
caracterstcas en comn; estatura baja, ojos oblicuos, lengua grande y msculos dbiles. Estas
personas presentan retraso mental; su desarrollo y coordinacin muscular es frecuentemente
pobre y, adems, son propensos a los defectos del corazn. Sin embargo, muchas personas con
este sndrome llevan una vida actva y productva.
Otras anormalidades son causadas por la no disyuncin de los cromosomas sexuales, por
ejemplo, el sndrome de Klinefelter es la condicin trismica causada por un cromosoma X
extra en el hombre, produ-
cindose individuos XXY.
Tales personas generalmen-
te tenen testculos subde-
sarrollados, son estriles y
pueden presentar retraso
mental. El sndrome de Tur-
ner es un desorden en el
que una persona tene sola-
mente un cromosoma X en
lugar de un par; por tanto es
una monosoma. Las perso-
nas con este sndrome son
mujeres XO, quienes duran-
te la niez se ven normales
y con inteligencia normal,
pero en la adolescencia no
alcanzan la estatura debida,
no maduran sexualmente
y son estriles. Es notable
que estas mujeres tenen
un cuello muy ancho y un
coefciente intelectual bajo.
En la poliploida, la no
disyuncin ocurre en todos
los pares de cromosomas
a la vez; un organismo po-
liploide tene tres o ms
juegos enteros de cromoso-
mas. La poliploida es rara
Figura 4.20 No disyuncin de los cromosomas sexuales durante la ovog-
nesis y progenie que resulta cuando estos vulos anormales son fecunda-
dos por un espermatozoide normal. Cuntos cromosomas X posee una
mujer con el sndrome de Turner?
vulo que carece
de cromosomas X
No
disyuncin
vulos anormales
vulos con dos
cromosomas X
Espermatozoides
normales
Mujer XO
(Sndrome
de Turner)
Y
No viable
Mujer
XXX
(Triple X)
Hombre XXY
(Sndrome
de Klinefelter)
156
U 4 UAS
en los animales, pero en muchas plantas se presenta en forma natural. En los animales, la poli-
ploida casi siempre resulta en muerte; sin embargo, en las plantas la poliploida puede producir
plantas ms resistentes. A causa de que estas frecuentemente combinan las caracterstcas de
dureza de las especies progenitoras, las plantas poliploides son frecuentemente ms saludables,
tenen fores o frutas ms grandes o tenen otras caracterstcas benfcas.
En la naturaleza, la poliploida en plantas puede ocurrir como un resultado de dos meca-
nismos gentcos. Cuando la poliploida ocurre como resultado de la no disyuncin, la planta
resultante puede fertlizarse a s misma o aparearse con otras plantas similares. Adems, la poli-
ploida tambin puede ocurrir cuando el gameto poliploide de una especie se une con el gameto
haploide de otra especie. Los mejoradores de plantas producen plantas poliploides artfcial-
mente con reactvos qumicos que previenen la separacin de cromosomas, induciendo la no
disyuncin.
Los poliploides han sido importantes en la evolucin de las plantas. La poliploida es una fuente
importante de variacin gentca en las plantas. Entre 25 y 50% de todas las especies de plantas
son poliploides, incluyendo algunas comestbles.
cidos nucleicos: adn y arn
El material hereditario
Para identfcar la base molecular de la herencia, en 1868, el bioqumico Friedrich Miescher
investg la composicin qumica del ncleo celular. Un ao ms tarde, Miescher encontr que
la mitad de los materiales en el ncleo eran protenas. El resto de los materiales nucleares no
los pudo identfcar, reconociendo solamente que eran sustancias cidas y que nicamente se
localizaban en el ncleo, motvo por el cual les llam nuclena. Posteriormente, los cientfcos
reconocieron esos materiales llamndoseles cidos nucleicos. Se identfcaron dos de estas
sustancias, a una de ellas se le conoce como cido desoxirribonucleico (adn) y a la otra, cido
ribonucleico (arn). En 1902, Walter Suton sugiri que la base fsica de la herencia son los
cromosomas. Despus, el trabajo de Morgan dio fuertes evidencias para apoyar esta teora
cromosmica de la herencia; sin embargo, ya se haba encontrado que los cromosomas conte-
nen cantdades iguales de adn y protenas. A partr de estas investgaciones surge la necesidad
de precisar de si eran los cidos nucleicos o las protenas los responsables de la informacin
contenida en los genes.
El proceso de transformacin
En 1928, el bacterilogo Frederick Grifth dio los primeros pasos hacia la respuesta de la con-
troversia: adn o protenas? Grifth experiment con la bacteria Streptococcus pneumoniae,
de la que descubri dos variedades o cepas, en una de ellas cada bacteria tene una cpsula o
cubierta que la protege. Esta variedad fue llamada cepa S y causa neumona en los ratones.
En la otra variedad, las bacterias no tenen cpsula y fue llamada cepa R; esta cepa no pro-
duce la enfermedad. Grifth, para ver si era la cubierta mucosa la que causaba la enfermedad,
calent las bacterias de la cepa S; resultado: el calor mat las bacterias, pero no destruy la
157
Gvv:ic: i civci ov i nvvvci DGEP
Figura 4.21 Experimento de Grifth.
capa mucosa. Grifth inyect las clulas S muertas en los ratones y encontr que los ratones no
desarrollaban la enfermedad de la neumona, por lo que concluy que la cubierta por s sola no
causa la enfermedad.
Grifth, al contnuar con sus experimentos, mezcl las bacterias muertas de la cepa S con
bacterias vivas de la cepa R y la inyect a los ratones. Como las clulas de la cepa S estaban muer-
tas y las clulas de la cepa R no producen neumona, l esper que dicha mezcla no enfermara
a los ratones. La fgura 4.21 nos muestra que los ratones que fueron inyectados con la mezcla
murieron de neumona. Al ser examinada la sangre de los ratones muertos, Grifth encontr bac-
terias vivas de la cepa S con cubierta mucosa. De dnde vinieron las bacterias vivas de la cepa S?
Grifth supuso que algn material se pas de la bacteria muerta S a la bacteria viva R, cambiando
a la bacteria R en una bacteria S. Los investgadores se refrieron a ese material transferido como
factor transformante. Grifth reprodujo las bacterias S que recuper de la sangre de los ratones
muertos, encontrando que las bacterias hijas tambin tenan cpsula mucosa. Todo indicaba que
el factor transformante deba ser el material gentco, pues las nuevas caracterstcas heredadas,
incluyendo la habilidad para formar la cpsula mucosa, fueron identfcadas en las clulas hijas.
El proceso mediante el cual la bacteria es cambiada al absorber material gentco del exterior es
llamado transformacin. Pero, en realidad, Grifth no aport respuesta clara a la controversia.
ADN, el factor transformante
La evidencia ms fuerte de que el adn era el factor transformante, fue publicada en 1944 por
el bacterilogo estadounidense Oswald Avery y sus colegas Colin McLeod y Maclyn McCarty.
Estos investgadores aislaron adn de bacterias de la cepa S, lo mezclaron con bacterias de la
cepa R y produjeron bacterias de la cepa S vivas, pero qu sucedi? La bacteria R incorpor
el adn a su cromosoma. La conclusin de estos resultados fue que el adn es el responsable de
la transformacin. A pesar de estos resultados, muchos cientfcos seguan dudando de que el
adn fuera el material gentco.
ADN y virus bacterianos
Los estadounidenses Martha Chase y Alfred Hershey publicaron en 1952 los resultados de una
serie de experimentos donde concluan que el adn es el material gentco. Sus experimentos
involucraron al material gentco de ciertos virus llamados bacterifagos, o fagos. Estos bacteri-
fagos infectan y destruyen a las bacterias.
158
U 4 UAS
Hershey y Chase saban que un bacterifago est consttuido slo de adn y protenas. Cuando
un bacterifago infecta a una bacteria, este se adhiere a la superfcie bacteriana e inyecta cierto
material dentro de la clula; el resto del fago permanece fuera de la bacteria. La sustancia inyec-
tada, entonces, se apodera de la clula bacteriana que inicia la produccin de nuevos fagos. Los
nuevos virus revientan a la bacteria, liberndose para infectar nuevas bacterias.
Hershey y Chase supusieron que la sustancia inyectada podra ser el material gentco ya
que este controla el metabolismo de la bacteria. Para determinar si la sustancia inyectada por el
bacterifago es adn o protenas, Hershey y Chase prepararon bacterifagos cuyos adn conte-
nan fsforo radiactvo y otros que contenan protenas con azufre radiactvo. Despus pusieron
en contacto estos bacterifagos radiactvos con bacterias. El resultado de este experimento fue
que el fsforo radiactvo siempre apareca en el interior de las bacterias y el azufre por fuera. As,
Hershey y Chase concluyeron que el adn y no la protena era el material gentco de los bacte-
rifagos.
ADN: estructura y replicacin
Una vez que el adn fue conocido como material gentco, se estableci una competencia en-
tre los cientfcos para trabajar sobre su estructura. Uno de estos cientfcos fue el bioqumico
Erwin Chargaf, quien con sus experimentos descubri un dato muy importante. El analiz la
cantdad de bases nitrogenadas del adn de diversas especies y encontr que la cantdad de
adenina es siempre igual a la de tmina, y la cantdad de citosina es siempre igual a la cantdad
de guanina. Estas observaciones son conocidas como reglas de Chargaf. El mismo Chargaf no
pudo explicar sus descubrimientos, pero fueron indicios importantes para otras investgacio-
nes posteriores.
Estudios de rayos X
A principios de 1950, en Londres, Rosalin Franklin y Maurice Wilkins hicieron una importante
contribucin para revelar la estructura del adn. Estos cientfcos bombardearon con rayos X cris-
tales de adn purifcados y fotografaron los patrones de difraccin resultante. Estas fotografas
sugirieron a Franklin y Wilkins que la molcula de adn es una hlice, o sea, una espiral; adems,
les revel algunos datos sobre algunas de sus dimensiones.
Estructura del adn
Muchos eran los cientfcos que queran encontrar la estructura del adn, pero la suerte favore-
ci al fsico Francis Crick y al bilogo James Watson, quienes propusieron en 1953 un modelo de
estructura del adn que se conoce como la doble hlice. Este modelo es el aceptado en la ac-
tualidad como la estructura correcta del adn. Watson y Crick, para llegar a la estructura del adn,
trabajaron con modelos de alambre y con la informacin que sobre el adn se tena y que era el
resultado de investgaciones realizadas por muchos otros cientfcos. A fnes de 1940, los cientf-
cos haban establecido que el adn consiste de largos flamentos de nucletdos. Cada nucletdo
contene un azcar de cinco carbonos llamado desoxirribosa, un grupo fosfato y una base nitro-
genada que puede ser adenina (A), tmina (T), guanina (G) y citosina (C). Tambin se encontr
159
Gvv:ic: i civci ov i nvvvci DGEP
Figura 4.23 Un nucletdo est consttuido por un grupo fosfato, una molcula de azcar y una base nitrogenada. Los
nucletdos se nombran por la base que contenen. Por ejemplo, el nucletdo de adenina contene la base adenina.
Cuntos nucletdos observas en la fgura?
PURINAS
PIRIMIDINAS
Adenina Guanina
Citosina
Timina
Grupo fosfato Azcar
Figura 4.22 Francis Crick ( a la izquierda) y James Watson en 1953,
con un modelo de su estructura del adn.
que dos de estas bases tenen ani-
llos dobles en una estructura simi-
lar al grupo de las purinas; las pu-
rinas son adenina y guanina. Las
otras dos bases tenen solamente
un anillo en su estructura, carac-
terstco de las pirimidinas, y son
la tmina y la citosina. En la fgura
4.23 se muestra la estructura de
los nucletdos.
Muchas interrogantes perma-
necan sin respuesta. Qu forma
tenen las molculas del adn? es
una sola cadena? las bases se en-
cuentran dentro o fuera de la mo-
lcula? Un modelo que represente
a estas sustancias nos debe ayudar
para explicar las observaciones
de Chargaf acerca de las mismas
cantdades de bases y deber, a su
vez, explicar cmo se duplica por
s misma, esta molcula.
160
U 4 UAS
El modelo de la doble hlice
Watson y Crick ensamblaron varios modelos tridimensionales; despus de probarlos y mejo-
rarlos, hicieron un modelo en el cual la molcula de adn est consttuida por dos cadenas largas
enrrolladas en una forma llamada doble hlice, de la misma manera en que se enrosca una
escalera de caracol. Las molculas de fosfato-azcar se encuentran por el lado de afuera de la
molcula; imagnate que forman los pasamanos de la escalera.
Las bases se encuentran en el centro de la molcula, en pares,
unidas por puentes de hidrgeno formando los travesaos o es-
calones de la escalera. Segn este modelo, cada par de bases que
forma un escaln est consttuido por una de las purinas y una
de las pirimidinas, reconocindose que la adenina slo se une
con la tmina, y la guanina slo con la citosina. Cada purina hace
par con una pirimidina que puede hacer el mismo nmero de
enlaces hidrgenos. Las dos cadenas adn se dice que son com-
plementarias una con otra porque si se conoce la estructura de
una cadena, tambin se conocer la estructura de la otra cadena.
Observa la fgura de la estructura del adn e identfca cada uno
de sus componentes.
Figura 4.24 La estructura
de doble hlice del adn
resulta del apareamiento
de las cuatro bases y de
los ngulos de sus enla-
ces qumicos. Con quin
se aparea la adenina?
=Fosfato P
D
A
T
G
C
=Desoxirribosa
=Adenina
= Timinia
=Guanina
=Citosina
161
Gvv:ic: i civci ov i nvvvci DGEP
Figura 4.25 Durante la replicacin, las bases del adn original se separan quedando expuestas. Cada base se une con
un nucletdo libre que contene su base complementaria. Este proceso se repite hasta que se forman dos copias
idntcas de la molcula de adn original.
Rplica del adn
El modelo propuesto por Watson y Crick despejaba las dudas anteriores, entre ellas, perfecta-
mente explicaba las reglas de Chargaf y cmo se autoduplica el adn. El cual en los cromosomas
hace copias de s mismo durante la interfase, previo a la divisin celular.
El proceso por el cual el adn hace copias de s mismo es llamado replicacin
Al principio de la rplica, las dos cadenas del adn se desenrollan; las enzimas rompen los
enlaces de hidrgeno que unen los pares de bases del adn. Las dos cadenas de nucletdos se
separan de manera parecida a la accin de un cierre que se abre. Cada cadena original sirve
como patrn o molde para la formacin de una cadena hija complementaria. La nueva cadena se
forma con los nucletdos libres que han sido sintetzados previamente en el ncleo. Una enzima
llamada adn polimerasa se mueve a lo largo de la cadena original del adn, uniendo las bases de
la cadena con las bases complementarias de los nucletdos libres. La adenina se enlaza con la
tmina y la citosina con la guanina. Este proceso realizado por la adn polimerasa se lleva a cabo en
las dos cadenas originales. Los enlaces tambin se forman entre los azcares y fosfatos de los nu-
cletdos adyacentes El resultado de la rplica es la formacin de dos molculas de adn idntcas
a la original. Este proceso de replicacin del adn se le conoce como rplica semiconservadora,
ya que cada molcula de adn posee o conserva una cadena del adn original y una recin sintet-
zada. Observa este proceso en la fgura 4.25.
=Fosfato
ADN original
Cadena original
Cadena nueva
Cadena original
Nucletido a
punto de aparearse
Nucletidos libres
Nueva
copia
de ADN
Nueva
copia
de ADN
P
D
T
A
G
C
=Desoxirribosa
=Adenina
= Timinia
=Guanina
=Citosina
162
U 4 UAS
ADN y protenas
La cuestn de cmo
los genes controlan
la clula fue inves-
tgado desde antes
que los cientfcos
supieran que los ge-
nes estaban const-
tuidos de adn. Ya en
1941, mediante una
serie de experimen-
tos, algunos cientf-
cos haban llegado a
la conclusin de que
cada gen, de alguna
manera, controla la
produccin de un
tpo de enzima. Esto dio origen a la hiptesis un gen, una enzima. Recuerda que las enzimas
regulan todas las reacciones qumicas que ocurren en la clula.
Actualmente, los cientfcos saben cmo el adn controla la elaboracin o sntesis de todas
las protenas celulares, no slo de las enzimas. La hiptesis anterior ahora es un gen, una pro-
tena. En otras palabras, un gen es un segmento de adn que contene la informacin necesaria
para sintetzar una protena.
ARN: estructura y transcripcin
Como recordars, el adn de las clulas eucariotas est en el ncleo y la sntesis de protenas se
lleva a cabo en los ribosomas, localizados en el citoplasma de la clula. Por lo tanto, el adn no
puede dirigir directamente la sntesis de protenas. Existe una molcula intermediaria que es un
segundo tpo de cido nucleico, el arn o cido ribonucleico.
El arn se parece al adn ya que tambin est estructurado por un azcar, un grupo fosfato y
bases nitrogenadas. La diferencia est en que el arn es una sola cadena de nucletdos; el azcar
es la ribosa y, en lugar de la base tmina, tene la base uracilo (U). Estas diferencias se muestran en
la fgura 4.26. Tres tpos de arn estn involucrados en llevar a cabo las intrucciones de la sntesis
de protenas. La elaboracin de protenas es llamada sntesis proteica.
El primero, el arn mensajero (arnm), lleva las intrucciones codifcadas para elaborar una
protena desde el adn en el ncleo hasta los ribosomas en el citoplasma. El segundo, el arn
de transferencia (arnt), acarrea los aminocidos a los ribosomas, ordenadamente, segn la se-
cuencia en que deben aparecer en la nueva protena. El tercer tpo es el arn ribosomal (arnr),
que consttuye, junto con otras protenas, a los ribosomas. Ahora veamos cmo a partr del adn,
la clula va a sintetzar las miles de protenas diferentes que se requieren para el funcionamiento
celular. Para esto, debemos revisar dos procesos fundamentales que son la transcripcin y la tra-
duccin.
1. Azcar: desoxirribosa
2. Cadena doble
3. Adenina-Timina
4.- Guanina-Citosina
1. Azcar: ribosa
2. Cadena sencilla
Figura 4.26 El arn difere del adn en tres aspectos: primero su azcar es la ribo-
sa; segundo, contene uracilo en lugar de tmina, y tercero esta consttuido por
una sola cadena.
ADN
Nucletido de ADN
Fosfato
Fosfato
Desoxirribosa
Ribosa
BASE
BASE
Nucletido de ARN
ARN
Azcar
Azcar
P
P
Adenina
Timina
Guanina
Citosina
Adenina
Uracilo
Guanina
Citosina
Base
Base
163
Gvv:ic: i civci ov i nvvvci DGEP
Transcripcin
La produccin de una protena inicia con la sntesis del arnm. La sntesis del arnm a partr del
adn, es llamada transcripcin. Sigue cuidadosamante el proceso de transcripcin en la fgura
4.27. Como puedes ver, la transcripcin inicia cuando una regin de las dos cadenas del adn se
desenrrollan y se separan, quedando expuestas las bases. La separacin slo ocurre en la regin
del adn o gen que posee la informacin de la protena que se requiere sintetzar; slo una de las
dos cadenas posee esta informacin, por lo que se le conoce como cadena patrn.
Figura 4.27 En la transcripcin,
una seccin del adn se separa
quedando las bases expues-
tas. Los nucletdos del arn
que se encuentran libres en
el ncleo se unen a sus bases
complementarias en el adn
abierto, sintetzando una mo-
lcula de arnm que contene
en su secuencia de base la cla-
ve de la protena que requiere
el organismo elaborar.
ADN
doble hlice
Cadena
de ADN
Cadena
deADN
Cadena
de ARN
Cadena
de ARN
163
=Fosfato
P
D
A
T
G
C
U
=Desoxirribosa
=Adenina
= Timina
=Ribosa R
=Guanina
=Citosina
=Uraclio
=Cadena de ADN
=Cadena de ARN
164
U 4 UAS
Los nucletdos del arn estn libres en el ncleo en espera de ser ensamblados como arnm.
La enzima arn polimerasa une las bases del arn con sus bases complementarias sobre la cadena
patrn del adn.
Por ejemplo, suponiendo que las tres primeras bases en la cadena patrn del adn sean G,
T y A, entonces, la arn polimerasa alinear a los nucletdos con las bases complementarias C,
A, y U. Observa que el uracilo reemplaza a la tmina en el arn. Las enzimas unen a los nuclet-
dos del arn formando una molcula de arn mensajero. La molcula de arn mensajero recin
sintetzada se separa de la cadena patrn y emigra al citoplasma. El arnm contene la informa-
cin necesaria completa para el polipptdo o protena que se debe sintetzar.
Cdigo gentco
Como ya hemos visto, la molcula de arn mensajero, transcrito del adn, lleva el cdigo para la
protena que se quiere sintetzar. El cdigo gentco o clave gentca del arnm est en la secuen-
cia de sus bases, es decir, esa secuencia estricta de bases va a determinar, a su vez, la secuencia
de aminocidos que sern ensamblados en la protena que se sintetzar.
Pero, cmo se puede descifrar el cdigo gentco? Un problema que enfrentaron los pri-
meros cientfcos que se dieron a la tarea de descifrar el cdigo gentco fue saber cmo las
bases codifcan o indican cada uno de los aminocidos que se deben enlazar. Recuerda que
hay 20 aminocidos que se encuentran en todas las protenas y slo hay cuatro bases en el
arn. As, cada base en lo individual no puede codifcar para un aminocido simplemente por-
que son pocas las bases. Si una secuencia de dos bases codifcara un aminoacido, entonces
solamente tendramos posibilidad de 16 combinaciones (4)
2
de bases diferentes. Esto tambin
es insufciente para completar los 20 aminocidos. Por fn, en 1961, los cientfcos encontraron
que para codifcar a cada aminocido debe existr una secuencia de tres bases, es decir, un
conjunto diferente de tres bases del arnm indica cul aminocido est cifrado y que formar
parte de alguna protena.
El cdigo de tres bases en el adn o en el arnm es llamado codn. Por ejemplo, el
codn del arn: UUU traduce para el aminocido fenilalanina, y cag traduce para la
glutamina.
Figura 4.28 Una serie de tres bases
forma un codn o triplete.
ADN codn
(ACT)
ADN codn
(GCT)
164
165
Gvv:ic: i civci ov i nvvvci DGEP
A partr de que los codones
son de tres bases, puede ha-
ber 64 codones (4)
3
, lo cual,
es ms que sufciente para
codifcar los 20 aminoci-
dos. Todos los codones
tenen una funcin es-
pecfca. Cierto codn
seala el inicio de la
cadena, especfca-
mente es aug, que
tambin codifca para
el aminocido meto-
nina. Esto signifca que
el primer aminocido
de una protena es la
metonina; otros sea-
lan el trmino de la sn-
tesis de la protena como
lo son uaa, uag y uga, que
son la seal de alto. En otros
casos, hay simplemente dos o ms
diferentes codones para el mismo
aminocido. Observa la fgura 4.29
para tener una idea ms clara sobre
este cdigo.
Los cdigos para aminocidos son
universales; en humanos, en bacterias o virus, el mismo co-
dn se traduce para el mismo aminocido, por ejemplo, cau
es en todos los organismos el que codifca a la histdina. El he-
cho de que todos los organismos compartan el mismo cdigo
gentco muestra la unidad bsica de la vida en la Tierra.
Sntesis de protenas
El proceso mediante el cual se sintetzan protenas con la par-
tcipacin del arnm se llama traduccin. Las protenas son
sintetzadas en el citoplasma, especfcamente en los riboso-
mas. Antes de que una protena sea sintetzada, el arn men-
sajero que porta el cdigo para una protena debe, previa-
mente, ser transcrito a partr del adn del ncleo. El arnm,
entonces, debe dejar el ncleo y entrar al citoplasma. Ya en
el citoplasma, las dos subunidades de los ribosomas se unen
al arnm.
Figura 4.29 El cdigo gentco muestra los aminocidos que co-
rresponden a cada uno de los 64 codones posibles. Para deco-
difcar un codn se empieza por el centro del crculo y contna
hacia afuera. Por ejemplo UUU y UUC codifcan para fenilalanina.
Figura 4.30 El ARNt es una cadena
simple pero adquiere la forma de
una hoja de trbol. Un extremo de
la molcula tene un sito de unin
para el aminocido que transpor-
ta. El otro extremo es una regin
llamada antcodn, consttuida por
tres bases expuestas.
RNAt
para el
aminocido
metionina
Sitio de
unin de un
aminocido
Bases de
ARN
Anticodn
166
U 4 UAS
Todas las protenas estn formadas por largas cadenas de aminocidos. Los aminocidos in-
dividuales son llevados hacia los ribosomas por el arn de transferencia (arnt). Cada clase de
aminocido tene su propio arnt especfco. Todos los arnt tenen una regin llamada antcodn
(fgura 4.30), cuyas bases complementan un codn del arnm.
Resumiendo el proceso de traduccin, tenemos que, una vez que el ribosoma se une al arnm,
un arnt cargado con su aminocido iniciar la formacin de una protena. El primer codn com-
plementario del arnm que se encuentra es el gcu que codifca para el aminocido alanina; el
primer arnt debe tener el antcodn cga y portar la alanina. Codn y antcodn se unen. El ri-
bosoma slo tene dos lugares para unir aminocidos, de tal manera que, los arnt que posterior-
mente llegan, segn el codn siguiente, se identfcan con su antcodn, entregan su aminocido
y las enzimas ribosomales los van uniendo en cadenas caracterstcas de cada protena; cuando
esto sucede, cada arnt vaco se va retrando del ribosoma para dar lugar a que los siguientes
arnts que portan otros aminocidos puedan entrar al ribosoma que se va moviendo al siguiente
codn sobre el arnm. Esto se repite hasta que el ribosoma alcanza el codn de terminacin del
arnm. Al proceso mediante el cual los ribosomas construyen protenas uniendo aminocidos
ordenadamente de uno por uno, se le llama ciclo de elongacin. Cuando se llega al codn de
terminacin, el ribosoma suelta al arnm; la protena terminada es liberada y est lista para ser
utlizada por la clula. Observa este proceso en la fgura 4.31. Tomando en cuenta que el ribo-
soma va avanzando sobre la cadena de arnm, otros ribosomas pueden incorporarse en la parte
inicial, de tal forma que puede haber hasta 100 ribosomas trabajando simultneamente sobre
una misma cadena de arnm.
Figura 4.31 Proceso de traduccin o sntesis de
protenas. En que estructura celular se lleva a cabo?
ARNm
ARNm
A
R
N
t
A
R
N
t
ARNt
Enlace
peptdico
cido
glutmico
cido
glutmico

c
id
o

g
lu
t
m
ic
o
R
ib
o
s
o
m
a
Alanina
Alanina
Prolina
Alanina
Ribosoma
1
U A C G
4
3
2
167
Gvv:ic: i civci ov i nvvvci DGEP
Mutaciones gnicas
En la mayora de los casos, la replicacin ocurre sin errores; sin embargo, algunas veces la secuencia
de nucletdos cambia durante la replicacin del adn. Un cambio en la secuencia de nucletdos en
un gen es llamado una mutacin gnica o puntual. Algunas desrdenes causados por mutaciones
gnicas son, entre otras, el albinismo, la anemia drepanoctca, la fenilcetonuria y la hemoflia.
Tipos de mutaciones gnicas o puntuales
Una mutacin gnica ocurre durante la replicacin del adn; la mutacin puede involucrar uno o
ms errores en el proceso de copiado, causando desrdenes en el metabolismo o en la estructura
de un organismo. En casos extremos, la mutacin gnica puede conducir a la muerte; las muta-
ciones gnicas pueden deberse a la adicin o supresin de bases nitrogenadas o la susttucin de
una base por otra.
Supresin y adicin
Una mutacin por supresin es la prdida de una o ms bases del adn de un gen; una mutacin
por adicin ocurre cuando una o ms bases son aadidas al adn de un gen. Debido a que los
ribosomas traducen bases en grupos de tres
en tres durante la sntesis de protenas, si una
base es perdida o ganada, la sntesis de pro-
tenas es alterada.
Susttucin de un par de bases
Una susttucin puede no ser nociva porque
simplemente puede cambiar un codn por
otro codn para el mismo aminocido. Por
ejemplo, revisando la tabla del cdigo gen-
tco, nos podemos dar cuenta que la tercera
base de los codones para arginina pueden
cambiarse y seguir codifcando para arginina.
Por ello cualquier susttucin en la tercera
base de un codn para la arginina no afectara
a la protena; la protena resultante no cam-
biara. Alrededor del 30% de todas las muta-
ciones por susttucin no resultan en cambios
de la protena.
Por otro lado, un codn susttuto puede
causar que sea insertado un nuevo amino-
cido en lugar del aminocido usual; la pro-
tena resultante puede no funcionar o puede
ser defectuosa. Por ejemplo, una susttucin
Figura 4.32 Micrografa electrnica de glbulos ro-
jos normales y de glbulos rojos falciformes. Qu
forma adquieren los glbulos rojos en la anemia fal-
ciforme?
168
U 4 UAS
de un par de bases en el gen normal para hemoglobina puede producir el gen para hemoglobina
anormal, la cual causa la enfermedad conocida como anemia drepanoctca o falciforme. Esta
mutacin altera los glbulos rojos, los cuales adquieren la forma de una hoz, o sea, de media
luna. Esta enfermedad es muy grave y puede llegar a ser mortal. Observa la fotografa de la f-
gura 4.32.
El cncer y las sustancias que lo producen
Hay mutaciones que producen una variacin que mejora la funcin del organismo, en este caso
son mutaciones favorables y resultan en adaptaciones de las especies a su ambiente. Esto, evi-
dentemente, es un tema que lo revisaremos en la teora evolutva. Otras mutaciones, sin embar-
go, pueden ser letales, pues tenen como resultado la produccin de protenas defcientes en su
funcin, tal es el caso de la hemoglobina mutada que causa la anemia falciforme. Esto s puede
ser frecuente.
Los factores ambientales contribuyen a mutaciones gnicas desfavorables, los mutgenos
son factores del ambiente que causan mutaciones. Por ejemplo, varias formas de radiacin, como
los rayos X y los ultravioleta, son mutgenos bien conocidos. Adems, muchas sustancias qumi-
cas, tales como las del humo del tabaco, el asbesto, el benceno, y el formaldehdo alteran al adn
causando mutaciones. Los mutgenos causan cambios en el mensaje del adn que pueden ser
pasados a las clulas hijas durante la divisin celular.
Algunas aplicaciones de la gentca
Las aplicaciones tecnolgicas en gentca hacen posible alterar la herencia de los organismos
para adaptarlos a condiciones partculares del ambiente y mejorar los rasgos que pueden hacer-
los tles para nosotros. Hay dos campos donde se aplica la gentca, uno de ellos es la gentca
clsica aplicada y el otro es la ingeniera gentca.
Mejoramiento de razas y variedades
La gentca clsica aplicada consiste fundamentalmente en el mejoramiento de razas animales y
variedades vegetales.
La recoleccin y siembra de plantas para seleccionar aquellos organismos con mejores cuali-
dades o productvidad es un mtodo que data desde la prehistoria. Ademas, el cruce de aquellos
organismos seleccionados dio como resultado organismos con caracterstcas superiores; as se
inicia el proceso de los cruces selectvos.Cuando el cruce se realiza entre individuos de parentesco
muy cercano, se le llama cruzamiento consanguneo o endogamia y se realiza con la fnalidad de
preservar una caracterstca partcular en una planta o en un animal. El cruzamiento consaguneo
tambin puede tener algunas desventajas, entre estas se encuentra el aumento de la probabilidad
de que se exprese algn rasgo recesivo. Si este rasgo es indeseable, la endogamia puede causar
diversos problemas. Por ejemplo, un caso muy comn es el de los cruces consanguneos entre los
perros, como los french poodle miniatura. Has notado las manchas caf oscuras que aparecen en
las esquinas de los ojos de esos perritos? Esas manchas son el resultado de la obstruccin de los
169
Gvv:ic: i civci ov i nvvvci DGEP
ductos lagrimales. La lgrima usualmente fuye en
forma natural desde el ojo a la nariz por el ducto
lagrimal, de tal manera que la obstruccin obliga
a la lgrima a ser expulsada hacia la cara causan-
do esas manchas (fgura 4. 33). Ciertamente esto
no es daino para el poodle, pero s hay otros pro-
blemas producidos por la consanguinidad tales
como, hombros dislocados, epilepsia, diabetes y
colapso de la trquea. La salud de esos perros es
mejor a medida que disminuye la endogamia.
Otra fnalidad de realizar los cruces selectvos
es la de obtener nuevas variedades de organismos
por hibridacin, estos se realizan cruzando dos
especies diferentes o cruzando dos individuos
de la misma especie pero de diferente raza. Por
ejemplo, el perro de la raza bul-mastn es produc-
to hbrido logrado por el ser humano mediante el
cruce de dos razas: el mastn y el buldog. El bul-
mastn presenta las cualidades deseables de los dos progenitores, por lo cual, result un perro
muy tl para la proteccin del ganado y de las terras. La hibridacin es un proceso de primer
importancia en la produccin de alimento de origen vegetal y ha salvado a la humanidad. Los ca-
sos del maz, el trigo, el sorgo, el arroz que ya han sido hibridizados, han permitdo una sensible
elevacin de los rendimientos en la productvidad de estos productos alimentcios.
Otra de las aplicaciones importantes de la gentca es la induccin de la poliploida, con-
dicin en la cual, las clulas tenen ms de dos conjuntos de cromosomas. La poliploida es muy
rara en los animales y cuando llega a darse, es mortal. Sin embargo, en el caso de los vegetales, la
poliploida es un proceso que resulta -muchas veces- en caracterstcas favorables, y adems, son
frtles. Las plantas poliploides pueden ser ms grandes, tener fores y frutos ms grandes que
el tamao de las originales. La poliploida puede ocurrir en forma natural en las plantas y puede
ser el origen de nuevas especies. Los ftomejo-
radores que se dedican a la produccin de plan-
tas poliploides han desarrollado la tcnica de la
colchicina. Si se aplica colchicina en la raz de la
planta se induce la poliploida. La colchicina se
aplica en la raz porque es un tejido en divisin
celular constante y esta sustancia impide que la
clula se divida despus de que se ha duplicado
el nmero de cromosomas durante la mitosis.
Esto da como consecuencia la duplicacin del
nmero cromosmico. En realidad, muchos
productos alimentcios vegetales son poliploi-
des. El tomate gordo es poliploide, as como
muchas variedades de uvas, fresas, trigo, repo-
llo, etctera.
Figura 4.34 La poliploida en las plantas frecuen-
temente produce individuos ms vigorosos y de
mayor tamao. La fresa de la izquierda es poli-
ploide, comprala con la fresa normal.
Figura 4.33 Observa las manchas que aparecen
cerca de los ojos de esta perrita french poodle
debido a problemas de consanguinidad.
170
U 4 UAS
Ingeniera gentca
Cuando se aplican los conocimientos bsicos de una ciencia para producir materiales tles al ser
humano para cubrir las necesidades propias, se desarrollan las tecnologas y la ingeniera. As con
la aplicacin de los conocimientos de la bioqumica, la microbiologa, la gentca y la ingeniera
qumica, se ha desarrollado todo un campo tecnolgico nunca antes visto, la ingeniera gentca.
La Ingeniera gentca es el uso de tcnicas bioqumicas especiales para identfcar, estudiar o modi-
fcar genes. Algunas tcnicas de la ingeniera gnetca involucran la combinacin del adn de genes
de diferentes organismos.
Por ejemplo, se han transferido genes humanos a las bacterias, haciendo posible que la bac-
teria produzca protenas tles para los humanos El nuevo adn que resulta de incorporar com-
ponentes de diferentes organismos es llamado adn recombinante. La insulina y la hormona del
crecimiento, son dos protenas que han sido sintetzadas a partr de adn recombinante.
El adn de los organismos eucariotas, es ms complejo que el de las bacterias, las cuales
como recordars son procariotas. Antes de que un gen de una clula eucaritca sea transferido
a una bacteria, el adn eucaritco debe ser simplifcado, puesto que no puede traducir un adn
complejo. Los cientfcos han transferido genes al interior de microorganismos eucariotas como
las levaduras en lugar de las bacterias. Por ser las levaduras hongos unicelulares eucaritcos,
pueden traducir el adn de otros eucariotes. De esta forma, los investgadores produjeron la pri-
mera vacuna humana, usando clulas de levadura. Esta es la vacuna de la hepatts B. La hepatts
B es una infeccin viral potencialmente fatal en el hgado. Los cientfcos, tambin, han insertado
genes en clulas de plantas y animales pluricelulares. Por ejemplo, a ciertas plantas se les ha in-
sertado genes que les permite resistr la accin de los herbicidas.
Para transferir adn al interior de una clula, los cientfcos usan un transportador especial
llamado vector. En ingeniera gentca, un vector es un transportador de material gentco. Las
bacterias no poseen ncleo celular, por lo que el material gentco se encuentra libre en el cito-
plasma en cromosomas y en pequeas porciones circulares de adn llamadas plsmidos. Los
plsmidos son vectores, ya que ellos pueden llevar adn al interior de las clulas. Los cientfcos,
tambin, han usado virus como vectores para transferir adn a otras clulas.
Transferencia de genes
Las bacterias pueden ser usadas para producir materiales biolgicos como la insulina, que es
una hormona que normalmente es producida en el pncreas y que ayuda a controlar la cantdad
de azcar en nuestra sangre. Para producir insulina, los plsmidos son aislados de las bacterias.
Los ingenieros gentcos usan una enzima para cortar el plsmido y el adn humano en fragmen-
tos. Los fragmentos son, ligados por otra enzima, causando que el gen para insulina humana sea
insertado en el plsmido bacteriano. La bacteria que contenga el plsmido producir la insulina
humana.
El siguiente procedimiento es un buen ejemplo de como trabajan los ingenieros gentcos
para producir insulina humana: El fragmento de adn humano tene el gen para la insulina.
El plsmido fue cortado en la parte media del gen responsable de la resistencia al antbitco te-
traciclina. Una enzima es usada para ligar la terminal del adn del plsmido con el gen de la insulina
humana. Si el gen de la insulina es insertado en el gen de la resistencia a la tetraciclina, el gen de la
171
Gvv:ic: i civci ov i nvvvci DGEP
Figura 4.35 Usando la tcnica del adn recombinante, la bac-
teria E. coli es utlizada para producir la insulina humana.
ADN extrao
(gen para insulina)
Plsmido
recombinado
Clula transgnica
Insulina
humana
Reproduccin
Numerosas clulas hijas
con ADN recombinante
Plsmido
Plsmidos
Cromosoma
E. coli
Sitio de ruptura
tetraciclina no tendr ya dicha funcin. Esta prdida de resistencia frente al antbitco indica a los
cientfcos cual plsmido capt el gen de la insulina. Los plsmidos son insertados en las bacterias.
Las bacterias crecen en placas especiales para identfcar a aquellas portadoras de la insulina. Estas
bacterias se reproducen libremente en tubos de ensayo y producen insulina humana (fgura 4.35)
La insulina es aislada y purifcada para usarse en el tratamiento mdico de pacientes diabtcos. En
el pasado, la insulina se extraa del pncreas del cerdo o de la vaca, siendo escasa y cara.
La primera transferencia exitosa de un gen ocurri en 1973, actualmente se est trabajando
en casi todas las ramas de la biologa con la ingeniera gentca.
Aplicaciones en la agricultura
Diversos campos productvos han sido objeto de desarrollo usando las tcnicas de la ingeniera ge-
ntca; as, el mejoramiento de la calidad y la cantdad de los alimentos de origen vegetal ha hecho
posible un nuevo desarrollo de la agricultura. Por ejemplo, se han producido varios tpos de nuevas
bacterias que ayudan a incrementar la produccin de cosechas; una bacteria alterada gentca-
mente ayuda a algunas plantas a resistr daos por congelacin. Tambin, algunas bacterias como
Agrobacterium pueden ser portadoras de genes selectos y ser usadas para modifcar plantas.
Aplicacion en la industria
La utlizacin de microorganismos para elaborar ciertos productos como quesos, vinos, pan, yo-
gurt y otros, es conocida desde la antgedad. La ingeniera gentca puede, ahora, ayudar a me-
jorar la produccin y calidad de estos productos usando las tcnicas del adn recombinante para
alterar las caracterstcas de los microorganismos utlizados.
Otro de los campos en donde se est trabajando es el de los servicios pblicos. Por ejemplo,
cientfcos de varios laboratorios estn trabajando en el mejoramiento de bacterias que puedan
ayudar en el proceso de depuracin de aguas negras. Incluso, considerando la escases de energ-
tcos, se han producido bacterias modifcadas que transforman la celulosa en combustble.
172
U 4 UAS
Aplicaciones en la medicina
El rea en la cual la ingeniera gentca ms ha infuido en la vida humana es la medicina. Uno
de los primeros productos mdicos producidos con las nuevas tcnicas es la insulina, que es una
hormona que regula el metabolismo de azcares en el cuerpo. Si un organismo falla en la produc-
cin de sufciente insulina por parte de las clulas pancretcas, o si las clulas de ese organismo
no pueden incorporar sufciente insulina, se desarrolla una condicin llamada diabetes mellitus.
Anteriormente, los mdicos trataban a los diabtcos con insulina obtenida de extractos pan-
cretcos del cerdo y la vaca, pero esa insulina puede producir reacciones alrgicas en algunos
pacientes. Actualmente, la ingeniera gentca ha aportado diferentes formas de producirla al
insertar el gen humano responsable de la produccin de la insulina en los plsmidos bacterianos.
La bacteria sujeta a esta insercin empieza a producir insulina idntca a la humana, que no causa
reacciones alrgicas.
El interfern es una protena producida por las clulas cuando estas son atacadas por virus,
por lo que es utlizado como un medicamento antviral. Hasta hace algunos aos era difcil ob-
tener el interfern humano; hoy es producido tambin por el uso de plsmidos bacterianos y
clulas de levaduras.
Se han desarrollado muchos otros productos como algunas vacunas y la hormona del creci-
miento. Bacterias alteradas gentcamente pueden producir factores de crecimiento celular que
ayuda a los pacientes anmicos a producir clulas sanguneas. Otros nuevos productos pueden
disolver cogulos sanguneos en los pacientes con ataques al corazn.
Organismos transgnicos
Los cientfcos han logrado conocer las bases ms importantes de los procesos hereditarios,
y falta mucho por conocer; pero tambin esos conocimientos los han usado para desarrollar
proyectos de investgacin verdaderamente ambiciosos, como el de modifcar a los seres vivos.
El ser humano, como nos dice el Dr. Jess Kumate, por la tecnologa que procede de la ciencia,
tene ms poderes que Prometeo. Ha concentrado tanto poder tecnolgico, cientfco y econ-
mico que hasta puede destruir la vida en la Tierra (entrevista en El Sol de Sinaloa, 10 de Junio
del 2007). Expresiones como estas son comunes entre aquellos que estn preocupados por el
uso precipitado de los adelantos en la ciencia. El caso de los organismos transgnicos es un
ejemplo de ello.
Los organismos transgnicos tambin llamados organismos gentcamente modifcados, son
organismos a los cuales, por tcnicas de laboratorio conocidas como ingeniera gentca, se les in-
troduce un gen de otro organismo. El gen extrao puede provenir de otro organismo de una especie
vecina, pero tambin de otro organismo que pertenezca a un reino diferente (animal, vegetal, hon-
gos, protstas, o bacterias). Esto es un cruce muy sofstcado entre especies de diferentes reinos
en la que se utliza tecnologa avanzada para modifcar las caracterstcas originales del organismo.
El nombre de organismos transgnicos se debe a que los genes introducidos se conocen como
transgenes. Ya se han hecho estos cruces gnicos, por ejemplo, un maz con genes de bacteria, un
cerdo con genes de humano o una fresa con genes de un pez.
Los humanos utlizando los conocimientos que nos legaron cientfcos como Mendel estamos
modifcando el curso de la vida y creando seres vivos que nunca han existdo de manera natural.
173
Gvv:ic: i civci ov i nvvvci DGEP
Algunos adelantos en ingeniera gentca son benfcos, como es el caso de las bacterias
transgnicas que producen sustancias como la insulina, la hormona del crecimiento y el factor de
coagulacin que sirven para tratar enfermedades.
Existen los animales transgnicos. Se han producido ratones con genes humanos para es-
tudiar el efecto de enfermedades en el sistema inmunolgico humano. Hay ganado transgnico
que lleva copias adicionales de genes de la hormona del crecimiento. Estos animales crecen ms
rpido y producen ms carne que los animales comunes. La generacin de animales transgnicos
como las vacas, abre la posibilidad en un futuro de producir en la leche grandes cantdades de
protenas de importancia farmacutca.
Las plantas transgnicas como soya y maz se les han insertado un gene que produce una
protena que es txica para los insectos que puedan signifcar plagas para los cultvos agrcolas.
Tambin se han obtenido plantas resistentes a virus como el del mosaico del tabaco, donde la
planta produce protenas que inhiben la infeccin por el virus. Adems se han desarrollado plan-
tas transgnicas que mejoran las cualidades nutricionales de la planta o los colores de sus fores
en el caso de las ornamentales.
Los problemas que se han presentado por el uso de los transgnicos son muchos. En primer lu-
gar, es un clamor de muchsimos investgadores que los transgnicos se han lanzado como produc-
tos comerciales seguros cuando an no se saben muchas cosas de ellos, es decir, que consecuen-
cias puede haber en la salud del hombre, o que daos puedan producir a los animales y vegetales
silvestres. Por ejemplo, esa protena que produce el maz transgnico puede desarrollar alergias
en las personas que lo consuman. En el medio ambiente tambin puede haber contaminacin. Es
muy ilustratvo el caso de que una gran empresa multnacional de transgnicos ha demandado a
ejidatarios que tenen sus cultvos adyacentes a los de transgnicos que por causa del viento el po-
len transgnico ha fertlizado variedades locales. Cuan-
do esas grandes empresas han analizado los produc-
tos de los ejidatarios adyacentes les han encontrado
fragmentos de sus transgnicos, lo que ha motvado
demandas en contra de los ejidatarios, que por dems
son gente pobre que no puede enfrentar la presin de
los grandes capitales mundiales. Es el ejidatario el que
debera de demandar a las grandes empresas trasna-
cionales por contaminar sus variedades naturales.
Clonacin
La clonacin es la elaboracin de una copia exacta
de un organismo. As, los genes y todas las partes del
clon son idntcas a aquellas del organismo original.
Los cientfcos han estado trabajando en reproducir
copias gentcas exactas de animales desde la dcada
de 1950.
Es en 1996 cuando se logra duplicar un mamfero a
partr de un adulto, obtenindose la primera oveja clo-
nada, la cual fue nombrada Dolly. Este fue el resultado
Figura 4.36 La oveja Dolly, el primer mam-
fero clonado, se aprecia con su primer cra
Bonnie. Dolly es sacrifcada a los 6 aos de
edad, ya que la aquejaba una enfermedad
pulmonar comn en ovejas viejas.
174
U 4 UAS
del trabajo de los cientfcos del Insttuto Roslin de Escocia y del ppl Therapeutc Inc. Se llevaron a
cabo 300 experimentos antes de lograr la clonacin de Dolly.
La tcnica de clonacin con la que se obtuvo a Dolly es la siguiente: consiste en tomar un
vulo sin fertlizar, quitarle el ncleo (contene la mayor parte de la informacin gentca) y reem-
plazarlo por el ncleo de una clula adulta. La caracterstca primordial para escoger dicha clula
es que se encuentre en interfase. Lo difcil es engaar a ese vulo para que se comporte como
si hubiese sido fertlizado por un espermatozoide y empiece a dividirse para generar un embrin,
en lugar de crear ms clulas de piel o hgado o de cualquier otro rgano de donde se obtuvo ese
ncleo.
Terapia gnica
La ingeniera gentca ha tenido en los ltmos aos grandes avances que han permitdo median-
te la tecnologa del adn recombinante implementar la terapia gnica.
La terapia gnica es la utlizacin mdica del adn para corregir enfermedades gentcas,
enfrentar infecciones virales como el sida y detener enfermedades neurodegeneratvas. Existen
ms de 4 mil enfermedades gentcas causadas por defectos en un solo gen, como la fbrosis
qustca, la hemoflia, la anemia falciforme y la distrofa muscular. Otras enfermedades como el
cncer, la artrits y el asma, tenen que ver con el funcionamiento defciente de varios genes.
Figura 4.37 Esquema del proceso de clo-
nacin de la oveja Dolly. Por qu Dolly no
se parece a la oveja donadora del vulo?
Se toma una clula
donadora de la
ubre de una oveja
Las dos clulas se
fusionan usando
una descarga
Clula
fusionada
Se retira el ncleo
del vulo
Embrin
Se deposita el
embrin en el tero
de la madre sustituta
El embrin se
desarrolla hasta
convertirse en un
cordero: Dolly
Madre
sustituta
Cordero
clonado
Se toma un
vulo de una
oveja adulta
La clula
fusionada
comienza
a dividirse
normalmente
Ncleo
donador
vulo
175
Gvv:ic: i civci ov i nvvvci DGEP
A pesar de que la terapia gnica tene sus inicios en 1990, todava en la actualidad se encuen-
tra en la etapa de investgacin, en ensayo, para tratar estas y muchas otras enfermedades. Hoy
en da varios pases estn realizando numerosos ensayos clnicos de terapia gnica en seres hu-
manos cuyos resultados presentan distnto grado de xito. Existen algunos reportes de pacientes
que han fallecido durante el tratamiento.
La mayora de los ensayos o tratamientos de terapia gnica consisten en introducir genes nor-
males y funcionales en clulas del paciente con el fn de reemplazar el gen ausente o defectuoso,
para que as el organismo pueda producir la protena o enzima que necesita y cuya carencia causa
la enfermedad.
La terapia gnica es un rea de investgacin que promete mucho, pero que todava presenta
una serie de difcultades que no permiten que se logre una terapia gnica satsfactoria como se
ha mencionado anteriormente. Una de estas difcultades es la incorporacin del gen en buenas
condiciones de funcionamiento en un gran nmero de clulas del paciente. Los genes se insertan
en las clulas utlizando transportadores o vectores como los virus. Los cuales son atacados por
el sistema inmunitario del paciente lo que ha limitado el xito de este proceso. Otro problema a
resolver por los investgadores es que el gen debe de expresarse efcientemente, es decir, debe
de producir una cantdad sufciente de protena que ayude a vencer a la enfermedad. Pero sucede
con mucha frecuencia que las clulas del paciente modifcan el gen de tal manera que la protena
no se elabora.
Actualmente una de las enfermedades tratadas con terapia gnica es la inmunodefciencia
combinada grave (scid). En la mayora de los nios tratados se han obtenido excelentes resultados.
Los nios nacidos con scid no tenen un sistema inmunitario normal y son incapaces de combatr
cualquier tpo de infeccin ya sea bacteriana o viral. Por eso estos nios deben de vivir en un entor-
no estril. Durante mucho tempo estos nios fueron conocidos como los nios burbuja ya que
vivian en un cuarto estril conocido como burbuja. Esta enfermedad es causada por mutaciones en
un gen del cromosoma X. El gen codifca una protena necesaria para el desarrollo de clulas del
sistema inmunitario. En la mayora de los nios tratados se han obtenido excelentes resultados.
Figura 4.38 Para que la terapia gnica funcione se tenen que introducir copias de un gen normal en las clulas del
paciente y las copias tenen que expresarse, es decir, se debe sintetzar la protena de la cual se carece y causa la
enfermedad.
Paciente
con SCID
1. Se aslan clulas madre de
la mdula sea del paciente
y se cultivan in vitro
2. Retrovirus recombinantes
llevan el alelo normal a las
clulas husped
3. Las clulas que expresan
alelos normales se aslan y
se implantan en el paciente
176
U 4 UAS
Estudio de la herencia
El estudio de los patrones de herencia en el humano es difcil debido a que se tene poca descen-
dencia y, adems, madura lentamente. Para seguir las lneas de herencia se requiere varios aos
dado el largo perodo de vida; muchos aos pasan entre una generacin y la siguiente. Es posible
experimentar e investgar acerca de los patrones de herencia de plantas y animales, mientras que
est fuertemente restringido experimentar con humanos. En muchos pases existen leyes que
prohben experimentar directamente con el hombre por consideraciones tcas y porque pue-
de haber resultados impredecibles e irreversibles. Recientemente se han desarrollado tcnicas
que permiten a los investgadores estudiar a los genes directamente. Como resultado de estas
investgaciones se ha conformado una nueva rama que se conoce como gentca humana, que
comprende conocimientos acerca de los patrones hereditarios a nivel de poblaciones humanas
y de familias.
rbol genealgico
Una forma en que se puede dar un seguimiento acerca de ciertas caracterstcas hereditarias
que se quieren investgar, a nivel familiar es elaborando los rboles familiares o rboles genea-
lgicos para determinar los patrones de herencia en el ser humano. Un rbol genealgico es un
mapa que muestra cmo una caracterstca, y los genes que la controlan, son heredados en una
familia. Para desarrollar un rbol genealgico, se recoge toda la informacin posible acerca de la
historia hereditaria de la familia, describiendo como se ha transmitdo cierta caracterstca entre
los padres, hijos y otras generaciones.
Figura 4.39 Ejemplo de rbol genealgico donde se muestra lo que representa cada uno de los smbolos. Cules son
los genotpos de los dos progenitores de la primera fla? Cmo lo sabes?
Un crculo representa
a una mujer
Una lnea horizontal que
conecta a un hombre y
una mujer representa
un matrimonio
Un crculo o cuadra-
do sombreado indi-
ca que la persona
expresa el rasgo
Un crculo o un cua-
drado sin sombreado
indican que la persona
no expresa el rasgo
Una lnea vertical y
un corchete conectan
a los padres con
sus hijos
Un cuadrado representa
a un hombre
No hay rasgo de
mechn blanco
Presencia del rasgo
de mechn blanco
en la frente
=
=
177
Gvv:ic: i civci ov i nvvvci DGEP
Cariotpo
Otra forma de investgar la herencia
humana es estudiando los cromo-
somas directamente. Un cariotpo
muestra todos los cromosomas ho-
mlogos agrupados en pares y or-
denados por tamao decreciente.
Para hacer un cariotpo, primero se
obtenen clulas sanguneas de una
persona; usualmente son usados los
leucocitos y tratados con reactvos
qumicos que estmulan la mitosis.
Despus de que las clulas han cre-
cido durante varios das en un medio
especial, son expuestos a otra so-
lucin para detener la mitosis en la
etapa de metafase. En esta etapa, los
cromosomas individuales son fciles de aislar, teir y fotografar a travs de un microscopio espe-
cial; se corta entonces la fotografa, segn sean los cromosomas, y se arreglan los homlogos en
pares y se ordenan en tamao decreciente. Se inicia con los cromosomas ms grandes. Un cario-
tpo puede ser usado para detectar anormalidades visibles, por ejemplo, el cariotpo puede mos-
trar si una persona tene cromosomas de ms o de menos, tal es el caso del sndrome de Down,
que tene un cromosoma de ms en el par 21. Tambin sucede con los hombres con el sndrome
de Klinefelter, que tenen un cromosoma sexual X de ms; el sndrome de Turner se presenta en
mujeres que les falta un cromosoma sexual X. Observa el cariotpo mostrado en la fgura 4.40.
Tcnicas moleculares. El Proyecto Genoma Humano
A travs de la historia, el ser humano ha tratado de estudiarse y entenderse a s mismo, cada
vez mejor y con mayor detalle, as como a su medio ambiente.
1
Antguamente para lograr ste
objetvo, los anatomistas disecaban cadveres humanos para describir, estudiar y entender el
funcionamiento de nuestro organismo; por ello sabemos, como son y como funcionan nuestros
rganos y sistemas anatmicos. A partr de que se descubrieron las molculas y se empezaron a
usar las leyes de la fsica y de la bioqumica, los cientfcos empezaron a buscar la forma de tener
un conocimiento ms profundo de nosotros mismos que jams hayamos tenido: la informacin
gentca genoma humano.
2
Qu es el genoma humano? Es una enciclopedia de toda la informacin hereditaria que
poseemos como especie. Para tener una idea clara usemos una similitud con la construccin y el
funcionamiento de una casa que seramos nosotros mismos. Para poder construirla necesitamos
1
Riesgo Juan R. Qu es el genoma humano. Revista Ciencia. Enero-Marzo 2002, p. 6-11.
2
Reynaud E. La punta del iceberg. Revista Cmo vs? Nm. 37.
Figura 4.40 Cariotpo humano. Qu tpo de sndrome padece
la persona a la que pertenece este cariotpo? Cul es su sexo?
1
7
13
19
2
8
14
20
3
9
15
21
4
10
16
5
11
17
22
6
12
18
23
178
U 4 UAS
informacin sobre los materiales necesarios y donde podemos encontrarlos, y en algunos casos
sobre la manera de elaborarlos a partr de otros materiales sencillos -como la mezcla para pegar
ladrillos, pinturas- y el modo de aplicarlos; adems hay que tener conocimientos de resistencia
de los materiales, hidrulica y diseo. Todos esos son conocimientos que aplicaremos segn las
condiciones del terreno y del medio ambiente.
El genoma, en esta similitud, ocupa el lugar de los libros y es donde se indica como se cons-
truye y se pone a funcionar al genro humano. Los libros del genoma estn escritos en un idioma:
el idioma de la gentca y tene su sustento en una sustancia qumica: el adn.
En la clula, toda la informacin gentca para hacer otra clula u organismo igual est con-
tenida en el genoma.
En aos recientes, la gentca a avanzado espectacularmente, de tal forma, que en 1990 se
inici una gran investgacin: el Proyecto Internacional del Genoma Humano, encaminado a
averiguar el pequeo sito donde estn situados nuestros genes en un cromosoma, es decir, de-
sarrollar un mapa de localizacin de nuestros genes; y conocer la secuencia de los poco ms de
3 mil millones de pares de bases que forma el genoma humano haploide
3
. Otras metas de este
proyecto fueron secuenciar los genomas de organismos modelo pra interpretar el adn humano,
desarrollar tecnologas que apoyarn la investgacin, explorar las funciones de los genes y capa-
citar a futuros cientfcos.
Finalmente, los primeros resultados de la investgacin del Proyecto del Genoma Humano se
publicaron el 15 de febrero del 2001

en la revistas Nature y Science. La secuencia completa del
genoma humano queda terminada en abril del 2003, marcando as el fnal de este proyecto. Se
concluye que el genoma humano haploide se compone aproximadamente de 3 mil 200 millones de
pares de bases y se calcula que tenemos entre 30 y 40 mil genes.

En realidad estos resultados nos
conducen a enfrentar una serie de retos, en primer lugar se tendr que averiguar para que sirven
todos estos genes, pues no se tene
idea de la funcin del 40% de los ge-
nes que se han identfcado en la se-
cuencia del genoma humano.
Es importante que apreciemos que
el conocimiento adquirido reciente-
mente sobre el genoma humano es un
hecho trascendental para toda la cultura
humana.
4
Actualmente se trabaja en el Proyec-
to Genomas 1000, que inici en 2008, el
cul estudiar el genoma de mil personas
para producir un catlago detallado de la
variacin humana. Se espera que la infor-
macin que se obtenga revele datos para
elaborar nuevos medicamentos y terapias
contra mucchas enfermedades humanas.
3
Lisker Ruben. Qu es el Proyecto Internacional del Genoma Humano. revista Ciencia, enero-marzo, 2002.
4
Calva E. El genoma humano. Revista Cmo ves?, Nm. 37
Figura 4.41 Portada de las revistas cientfcas Science
y Nature donde se publicaron los primeros detalles
del genoma humano.
179
Gvv:ic: i civci ov i nvvvci DGEP
Autoevaluacin
Repaso de la unidad
Contesta las siguientes preguntas:
1. Qu pasos fundamentales realiz Mendel para tener xito en sus experimentos?
________________________________________________________________________
2. Por qu concluy Mendel que los rasgos estn controlados por pares de factores?
________________________________________________________________________
3. Qu es lo que establece la ley de la segregacin y la ley de la distribucin independiente?
________________________________________________________________________
________________________________________________________________________
4. Qu signifcaban para Mendel los trminos dominante y recesivo?
________________________________________________________________________
5. Por qu los organismos pueden tener diferentes genotpos pero el mismo fenotpo?
________________________________________________________________________
6. Cul es la diferencia entre un organismo homocigtco y uno heterocigtco para cierta
caracterstca?
________________________________________________________________________
7. En qu difere la herencia de los tpos de sangre de la herencia del color de la piel?
________________________________________________________________________
8. Qu es un gen?
________________________________________________________________________
9. Qu partes son idntcas en todos los nucletdos?
________________________________________________________________________
10. Qu es un cariotpo?
________________________________________________________________________
11. De qu manera la tecnologa del adn recombinante ha benefciado a la humanidad?
________________________________________________________________________
12. Qu es la clonacin?
________________________________________________________________________
180
U 4 UAS
Completa los espacios en blanco de los siguientes enunciados:
13. Las caracterstcas que se pueden observar en un individuo consttuyen su__________.
14. Un _______ es un segmento de adn situado en un lugar especfco de un cromosoma y
consttuye la unidad de herencia.
15. En el cariotpo de un nio con sndrome de Down se ven tres copias del _____________.
Indica cual de las siguientes afrmaciones son verdaderas (v) o falsas (f).
16. La ley de la segregacin de Mendel establece que cada par de alelos se separa
durante la meiosis
17. A la consttucin gentca de un organismo se le llama fenotpo
18. Cuando en un organismo los dos genes de un par son idntcos se dice que es
homocigtco para esa caracterstca
19. A la trisoma en el cromosoma 21 en humanos se le conoce como sndrome
de Klinefelter
20. La teora cromosmica de la herencia dice que las histonas son los portadores
de los genes
21. Las caracterstcas controladas por ms de dos pares de genes, son
consecuencia de la herencia polignica
22. Los autosomas son los cromosomas que determinan el sexo
23. El reacomodo de genes en nuevas combinaciones por entrecruzamiento, es
llamada recombinacin gentca
En la siguiente sopa de letras, localiza la respuesta de lo que se te pide:
24. Proceso mediante el cual el adn hace copias de s mismo.
25. Clula que tene ms de dos conjuntos de cromosomas.
26. Es la prdida de una parte de cromosoma.
27. Son organismos gentcamente modifcados.
28. Es el cdigo de tres bases nitrogenadas en el adn o en el arnm.
29. Observ que en el adn, la cantdad de adeninas es siempre igual al de tminas y la cantdad
de citocinas es igual al de guaninas.
30. Es una caracterstca infuenciada por el sexo.
31. Es una base nitrogenada prica.
32. cido nucleico de cadena sencilla.
33. Sndrome causado por un cromosoma extra en el varn.
( )
( )
( )
( )
( )
( )
( )
( )
181
Gvv:ic: i civci ov i nvvvci DGEP
T R A N S G E N I C O S
A E D E Y I N O N O B U
C P E R N B E B I D A B
H L N V A R N E W O T E
A I I F A B U L O N A S
R C N A C I O N A L E S
G A A T D E L E C I O N
A C R C A L V I C I E J
F I P O L I P L O I D E
E O R T U N A T O A L M
U N I F O R M E P R O F
K L I N E F E L T E R E
Aplicacin de conceptos
34. Qu cruza haras para determinar si un conejo negro es homocigtco negro o heterocigtco
negro?__________________________________________________________________
35. Por qu un criador de caballos pagara una gran cantdad de dinero para cruzar a una
hembra con un semental ganador de pura sangre ?
________________________________________________________________________
36. La relacin fenotpica de una cruza que involucra coballos negros y coballos blancos es
de 1 negro: 1 blanco Cules son los posibles genotpos de los padres? Usa el cuadro de
Punnet para apoyar tu respuesta.
________________________________________________________________________
________________________________________________________________________
37. Es posible que una mujer con sangre tpo AB y un hombre con sangre tpo B tengan hijos
con sangre tpo A. Usa un cuadro de Punnet para explicar tu respuesta.
________________________________________________________________________
________________________________________________________________________
38. La capacidad de doblar la lengua en forma de U se controla mediante un gen dominante (R).
a) Qu genotpos se produciran si se apareara un individuo homocigoto dominante con un
individuo recesivo?________________________________________________________
b) Qu porcentaje de los hijos F
1
podra doblar la lengua ?_________________________
39. En la reserva de Manantln, en el estado de Jalisco, se descubri una especie silvestre
de maz que produce mazorcas todo el ao. Por qu puede ser ste un descubrimiento
importante para nuestro pas? _______________________________________________
________________________________________________________________________
Huevos fsiles llamados Macroelongatoolithus xixiaensis: son los huevos
ms grandes de dinosaurio encontrados. El nombre refeja su alargada
fgura y descubrimiento en Xixia, China. Miden 46 cm de largo.
UNIDAD
5
E
v
o
l
u
c
i

n

o
r
g

n
i
c
a
185
Figura 5.1 Maravilloso
modelo de un embrin
de dinosaurio, basado
en sus restos fsiles.
Evolucin orgnica
Introduccin
En la edad media y hasta mediados del si-
glo XIX, se crea que el mundo era constan-
te y que exista desde haca mucho tempo.
Pero la credibilidad de esta visin religiosa
se haba debilitado ya en algunos campos
debido a una serie de avances cientfcos.
El primero fue la revolucin copernicana,
que desplaz a la Tierra y sus habitantes
humanos del centro a la periferia del uni-
verso; el segundo, las investgaciones de
los gelogos que revelaron la gran edad de
la Tierra; el tercero, el descubrimiento de
fsiles de animales extnguidos que descar-
taba la teora de que la vida sobre la Tierra
no haba cambiado desde la creacin.
Una de las objeciones que pusieron los
primeros adversarios de Darwin a la teo-
ra de la evolucin, fue que, aunque haba
explicado que unos organismos derivan de
otros, no haba explicado el origen de la
vida misma a partr de la materia inanima-
da.
El tema del origen de la vida es muy
complicado, pero ya no es el misterio que
prevaleci en el perodo inmediatamente
posterior a Darwin. De hecho, ya no existe
ninguna difcultad fundamental para expli-
car, basndose en leyes fsicas y qumicas,
el origen de la vida a partr de la materia
inanimada.
1
1
Mayr Ernst (1998) As es la Biologa. Ed. Unigraf, Madrid.
186
U 5 UAS
Historia de la vida
Hiptesis de la generacin espontnea
Desde la antgedad hasta hace poco menos de un siglo, el ser humano no tena difcultad para
hablar acerca del origen de la vida, simplemente se crea que la vida inici de la materia inani-
mada y que esto segua sucediendo como un proceso contnuo. Por ejemplo, pensaba que las
larvas de los cuerpos en animales muertos se formaban de los cuerpos en descomposicin; que
los insectos salan de la madera, de hojas secas, incluso, hasta del pelo de los caballos. Se lleg a
decir que las ranas y los peces se desarrollaban en las nubes y caan a la terra con la lluvia. Aun
ms, los cientfcos de aquellos tempos crean que muchos tpos de materia inerte contenan una
propiedad que daba vida llamada principio actvo. Se pensaba que por esta propiedad la mate-
ria inanimada produca seres vivos en cualquier momento.
La hiptesis de que la vida podra venir de la materia inerte es llamada generacin espontnea.
Desacuerdos con la generacin espontnea
En 1668, el mdico italiano Francisco Redi realiz un sencillo y bien diseado experimento para
poner a prueba la idea de la generacin espontnea. En virtud de que se deca que las moscas pro-
venan de la carne podrida, Redi observ cuidadosamente algunos restos de carne, observando
que las moscas llegaban a los trozos de carne descompuesta y depositaban huevecillos que, poste-
riormente, se desarrollaban en larvas y luego en nuevas moscas. Redi prepar varios frascos don-
de deposit carne cruda; cubri algunos frascos con tela, otros fueron sellados hermtcamente
y otros ms fueron dejados abiertos. Redi observ que las moscas entraban a los frascos abiertos,
no as en los frascos cubiertos o en los sellados. Das despus, observ larvas en la carne de los
frascos abiertos, pero no aparecieron en la carne de los frascos que estaban cubiertos con tela,
concluyendo que las
larvas vienen de los
huevecillos deposi-
tados por las mos-
cas que entraron a
los frascos abiertos
(observa este sen-
cillo pero importan-
te experimento en
la fgura 5.2). Redi
reconoce sus resul-
tados como eviden-
cia de que los seres
vivos proceden de
otros seres vivos; en
este caso, las larvas
se desarrollaron de
Figura 5.2 a) El experimento de Redi demostr que las moscas provienen de las mos-
cas y que por lo tanto no se generan espontneamente de la carne descompuesta
como se crey durante siglos, b) Ciclo biolgico de la mosca.
Huevos y gusanos
no aparecen
b) a)
Huevos y gusanos
aparecen en la carne
El aire circula a
travs de la tela
Tiempo Tiempo
Adulto
Huevo
Larva Pupa
187
Evoiuci ovoXic DGEP
los huevecillos de las moscas, estableciendo el principio de que la vida procede de la vida, mis-
mo que se conoce como biognesis. A pesar de esto, al ser descubiertos los microorganismos, la
controversia de la generacin espontnea se concret a los seres microscpicos.
Entre los seguidores de la generacin espontnea se contaba al cientfco ingls John Needham,
quin en 1745 realiz un experimento para apoyar esta hiptesis en el terreno de la microbiologa.
Needham prepar un cocimiento de carne y verduras que lo hirvi durante unos pocos minutos; al
terminar el cocimiento tom muestras de caldos que observ en el microscopio, pero no encontr
ningn microorganismo presente. Procedi entonces a cerrar los frascos con tapones de corcho.
Pocos das despus, el caldo de los frascos se encontraba totalmente poblado de bacterias por lo
que estaba turbio y an cuando Needham concluy que esas bacterias encontradas en los frascos
se formaron en el caldo por generacin espontnea, no se dio cuenta que los microorganismos
penetraron a los frascos porque el corcho que us no era sufciente para impedir la penetracin
de microorganismos. El falso resultado de este experimento apoyaba la hiptesis de la generacin
espontnea.
Veintcinco aos despus, el biolgo italiano Lazzaro Spallanzani, desaf las conclusiones
de Needham; pens que Needham no haba hervido el caldo el tempo sufciente para destruir
totalmente a todas las bacterias. Spallanzani tuvo especial cuidado para hervir las muestras y
sellar los frascos; us corcho para tapar la mitad de los frascos y la otra mitad los sell herm-
tcamente. Precisamente, slo en los frascos que estaban tapados con corcho se desarroll la
turbidez que evidenciaba la presencia de microorganismos: Needham estaba convencido de que
la idea de la generacin espontnea se descartaba. Por otro lado, los defensores de la genera-
cin espontnea decan que al excluir el aire de los frascos sellados, se eliminaba el elemento
esencial de la generacin espontnea.
El experimento de Luis Pasteur
Casi 100 aos despus del experimento de Spallanzani en 1864, el qumico francs Luis Pasteur
realiz un experimento que puso fn a la controversia. Pasteur puso caldo nutritvo en matraces,
luego con calor estr el cuello de cada uno de los matraces y les dio la forma de un cuello de
cisne; algunos matraces fueron dejados con el cuello recto normal. Pasteur hirvi por largo tem-
po los caldos de los matraces para luego dejarlos en reposo. No sell los cuellos, de tal manera
que el aire poda estar en contacto libremente con el caldo. Despus de varios das, los matraces
de cuello de cisne permanecieron sin bacterias, mientras que el caldo de los matraces con cuello
recto se enturbi con bacterias.
Qu fue lo que sucedi? Por qu si los dos tpos de matraces estaban en contacto con el
aire, solamente en los de cuello recto haba desarrollo de microorganismos?
Pasteur plante que las partculas de polvo eran los medios de transporte de las bacterias al
interior de los matraces con cuello recto. Sin embargo, en los matraces de cuello curvo las bacte-
rias quedaban atrapadas en su parte baja, sin alcanzar a entrar hasta el caldo, por lo que no hubo
desarrollo de bacterias. Ms aun, cuando Pasteur quebr el cuello curvo de uno de sus matraces,
ese caldo empez a enturbiarse en unas cuantas horas mostrando el desarrollo bacteriano. Con
este sencillo pero inteligente experimento, Pasteur demostr que las bacterias no se generaban
espontneamente en el caldo, sino que procedan del exterior del matraz y penetraban a l con
el polvo que se encuentra en el aire. Observa parte de este experimento en la fgura 5.3.
188
U 5 UAS
De esta mane-
ra, Luis Pasteur f-
nalmente estableci
que la vida no se
desarrolla de la ma-
teria inanimada, des-
cartando defnitva-
mente la generacin
espontnea y confr-
mando, a su vez, la
hiptesis de la bio-
gnesis, la cual est
frmemente estable-
cida en la actualidad.
Algunos de los
matraces que Pas-
teur us en sus expe-
rimentos an existen, permanecen sin desarrollo microbiano y estn en exhibicin en el Insttuto
Pasteur de Pars.
Origen de la vida
Si la vida no puede originarse de la materia inanimada, entonces, cul es el origen de la vida? Es
una pregunta que siempre ha sido difcil contestar. Los cientfcos tenen evidencias que la Tierra
en la actualidad es diferente a las condiciones que existan antes de que se originara la vida. La
mayora de los cientfcos piensan que las condiciones que existan en la Tierra primitva, permi-
teron el origen de la vida.
Formacin de la Tierra
A. G. H. Cameron, en su obra El Origen y la Evolucin del Sistema Solar nos dice que hace unos
4mil 600 millones de aos una gran nube de gas y polvo se contraa en el espacio interestelar en
la extremidad de uno de los brazos de nuestra galaxia. La nube se concentr y gir aun ms de
prisa, formando un disco. En un momento dado, el cuerpo concentrado en el centro del disco fue
tan masivo, denso y caliente, que provoc la ignicin de su combustble nuclear y se convirt en
una estrella: el Sol. Ms tarde, las partculas de polvo restante se unieron para formar los ocho
planetas, ligados a rbitas alrededor del Sol y satlites, a su vez ligados a rbitas alrededor de al-
gunos planetas. A medida que la temperatura descenda lentamente, la Tierra fue adquiriendo su
forma a travs de millones de aos. Los materiales ms pesados, tales como el nquel y el hierro,
se unieron para formar el ncleo terrestre. Los materiales ms livianos emergen a la superfcie y
se enfran formando la corteza y la atmsfera primitva. Las erupciones volcnicas derramaban
lava de las regiones calientes del interior, aumentando el material de la corteza. El gas hidrgeno,
el ms liviano de todos los materiales, probablemente form la capa ms externa; esta capa de
hidrgeno fue el antecedente de la atmsfera.
Figura 5.3 Este experimento mostr que los microorganismos que se desarro-
llaron en el caldo nutritvo provenan de las esporas y microorganismos pre-
sentes en el aire.
Caldo
nutritivo
Esterilizacin
del caldo por calor
La solucin es en-
friada lentamente y
permanece estril
Cuello del frasco
curvado por la fama
en forma de S
El polvo
y las bacte-
rias quedan
atrapadas
en el cuello
189
Evoiuci ovoXic DGEP
Atmsfera primitva
La atmsfera de la Tierra primitva era muy diferente a la actual. Alexander I. Oparin, un notable
bioqumico ruso, propuso que la atmsfera primitva estaba formada por gases como el meta-
no (CH
4
), amoniaco (NH
3
), hidrgeno
(H
2
), y vapor de agua (H
2
O). Otros
cientfcos sugieren que tambin
exista bixido de carbono (CO
2
) y ni-
trgeno (N
2
). El oxgeno gaseoso (O
2
)
en la atmsfera actual es producido
por los organismos fotosinttcos,
por lo que no haba o haba muy poco
oxgeno en la atmsfera antes de que
apareciera la vida. Compara en la ta-
bla 5.1 los contenidos de gases de
la atmsfera primitva y la atmsfera
actual.
El vapor de agua se condens
precipitndose en forma de lluvia
que llen las cuencas de la corte-
za terrestre. El agua fua corriente
abajo formando los nuevos mares y
disolviendo minerales tales como el
fsforo de las rocas. El agua tambin
llevaba gases en solucin. Estos compuestos disueltos formaron mezclas de sustancias muy ricas
en los mares primitvos.
Algunas fuentes de energa sobre la superfcie terrestre estaban presentes. Por ejemplo, la
atmsfera primitva no tena capa de ozono que la protegiera y sin esta, enormes cantdades de
energa, en forma de radiacin ultravioleta, llegaban a la Tierra. Las descargas elctricas en la
atmsfera tambin pueden haber contribuido con grandes cantdades de energa elctrica. Los
cientfcos teorizan que las condiciones de la Tierra hace 4 mil millones de aos favorecieron la
aparicin de la vida.
Origen de las primeras clulas
Despus de haberse presentado estas condiciones, se calcula que tuvieron que pasar 500 millo-
nes de aos para que apareciera la vida. Se piensa que la vida se origin por un proceso complejo,
mismo que se resume de acuerdo con las siguientes etapas:
La sntesis de molculas orgnicas simples
La formacin de polmeros
La formacin de membranas y gotas
Los inicios de la herencia y de la replicacin
Tabla 5.1 Comparacin de las atmsferas
terrestres primitva y actual
Atmsfera
primitva
92.2 %
5.1
2.3
0.2
0.1
0.1
0.0
0.0
Atmsfera
moderna
0.03 %
78.1
trazas
trazas
trazas
trazas
20.9
0.9
GAS
Bixido de carbono
Nitrgeno
Bixido de azufre
Sulfuro de hidrgeno
Amonaco
Metano
Oxgeno
Argn
190
U 5 UAS
Sntesis de molculas orgnicas
Desde 1924, Alexander I. Oparin public un libro ttula-
do El Origen de la Vida, donde reconoce que el proble-
ma del origen de la vida pertenece a la categora de los
problemas fundamentales de las ciencias naturales. En su
obra, postula su teora en los siguientes trminos gene-
rales: La vida se origin debido a una larga evolucin,
organizacin y especializacin de la materia.
Cuatro aos despus de la aparicin de este primer
libro de Oparin, un bilogo ingls, John Haldane, public
un artculo tambin ttulado El origen de la vida, donde
presentaba una hiptesis muy parecida a la de Oparin.
En 1949, John D. Bernal argument que las sustancias
necesarias para la aparicin de la vida debieron haber te-
nido lugar en las arcillas formadas en pequeos charcos
y lagunas poco profundas sujetas a desecaciones peri-
dicas.
Con motvo de la visita que Oparin realiz en Mxico, en 1978, fue entrevistado por Antonio
Lazcano Araujo, reconocido cientfco mexicano. En dicha entrevista, Oparin resumi su propuesta
acerca del proceso general de la aparicin de la vida, de la manera siguiente:
La ausencia de oxgeno, una de las condiciones ambientales de la Tierra primitva, permita
la sntesis y acumulacin de compuestos orgnicos sintetzados abitcamente a partr de
molculas ms simples. Estos compuestos orgnicos se disolvieron en los mares primitvos, y
su acumulacin posterior en gottas microscpicas formadas por ellas, separadas del medio
ambiente por membranas primitvas que permitan el intercambio de materia y energa con
su entorno, marc la aparicin de sistemas precelulares. De la evolucin gradual de estos
sistemas precelulares surgieron los primeros seres vivos, pequeos microorganismos heter-
trofos, pues se nutran a partr de los compuestos orgnicos acumulados en los mares de la
Tierra primitva. A partr de ese momento, se inicia la evolucin biolgica que llevara a todas
las formas de vida pasadas y presentes que han poblado el planeta, incluyendo al propio ser
humano.
Experimentos que apoyan la teora de Oparin-Haldane
En 1953, Stanley Miller, trabajando en el laboratorio de Harold C. Urey, en la Universidad de Chi-
cago, hizo el primer experimento diseado para reconocer las reacciones qumicas que ocurrie-
ron en la Tierra primitva. Lo importante de este experimento fue la simulacin de las condiciones
que deban existr en la atmsfera primitva. Para su experimento, Miller construy un aparato de
vidrio cerrado hermtcamente, en el cual coloc una mezcla de gases de metano (CH
4
), amona-
co (NH
3
) e hidrgeno (H
2
) , los cuales eran sometdos a descargas elctricas constantes producidas
por los electrodos instalados en el aparato (fgura 5.5), adems se produca vapor de agua que
actuaba como lluvia que transportara cualquier molcula orgnica.
Figura 5.4 Alexander I. Oparin.
191
Evoiuci ovoXic DGEP
Las sustancias circulaban con-
tnuamente por el aparato debido
a la ebullicin y la condensacin
constantes. Despus de una sema-
na, Miller analiz el agua conden-
sada encontrando que ahora con-
tena algunos aminocidos como
glicina, alanina, cido asprtco y
cido glutmico y otras sustancias
orgnicas consttuyentes de los
seres vivos. De esta manera se de-
mostr que los compuestos funda-
mentales para la aparicin de los
seres vivos se podan originar abi-
tcamente.
A partr del experimento de
Miller y Urey, otros cientfcos han
llevado a cabo simulaciones de la-
boratorio de las condiciones primit-
vas usando otros gases y fuentes de
energa. De esos experimentos se
han obtenido diversas sustancias de
importancia biolgica, entre las que
se cuentan, adems de los amino-
cidos, sustancias almacenadoras de
energa como el atp y las bases ni-
trogenadas adenina y guanina que
forman parte del arn y adn.
Polimerizacin
Despus de que se formaron las
molculas orgnicas sencillas, estas
reaccionaron para formar largas ca-
denas de polmeros. Este proceso
en los seres vivos se realiza por la
accin de las enzimas Qu pudo haber causado estos eventos sin que existeran las enzimas?
Una hiptesis establece que las reacciones de polimerizacin ocurrieron sobre la superfcie
de ciertos minerales que pudieron haber absorbido los monmeros, que luego dieron lugar a los
polmeros respectvos. Este tpo de proceso pudo haber ocurrido a orillas de los mares y en acu-
mulaciones de agua que existan en pequeos charcos y lagunas someras (poco profundas) don-
de las soluciones se concentraban rpidamente al evaporarse el agua de ellas. Al suceder esto,
la materia orgnica se depositaba en las arcillas y lodos as formados donde fcilmente podan
ocurrir las reacciones de polimerizacin en pequeos charcos del mar.
Figura 5.5 Aparato utlizado por Stanley Miller en su experimento,
mediante el cual mostr que molculas orgnicas sencillas podan
sintetzarse bajo las condiciones de la vida primitva. Qu molcu-
las orgnicas se obtuvieron en este experimento?
Mezcla de
gases que
simulan la
atmsfera
de la Tierra
primitiva
Chispa que simula
tormentas elctricas
CH
4
NH
3
H
2
O
H
2
Cmara de
condensacin
Vapor
de agua
Agua que
enfra la
cmara y
hace que
se formen
gotitas
Lquido
que contiene
aminocidos y
otros compuestos
orgnicos
192
U 5 UAS
Membranas y protoclulas
Paralelamente a la formacin de polmeros, se daba la formacin de pequeos sistemas de gottas
microscpicas en las que se encontraban disueltas grandes cantdades de polmeros y de muchas
otras sustancias orgnicas, permitendo la formacin de molculas aun ms complejas. Este tpo
de sistemas, seguramente antecedieron a las primeras clulas, y se les ha llamado coacervados o
microesferas proteicas. Ambos son propuestos como modelos precelulares.
Un paso importante en el origen de las primeras clulas fue la formacin de membranas. Por
medio de las membranas, el ambiente interno de una clula es separado del medio que la rodea.
Una vez que ya existan las grandes molculas orgnicas, pudieron tener interacciones qumicas
con sustancias presentes en los alrededores. Si los tpos correctos de protenas son mezclados
con el agua, formarn delgadas cubiertas, parecidas a las membranas, alrededor de las gotas de
agua.
Herencia y replicacin
Las primeras protoclulas probablemente absorbieron molculas ricas en energa de sus alrede-
dores, entonces se agrandaron y se dividieron. Algunas protoclulas fueron probablemente me-
jor que otras para absorber nutrientes ricos en energa. Cuando esas protoclulas se dividan, no
tenan posibilidad de pasar sus caracterstcas a sus descendientes; las caracterstcas no fueron
pasadas a las siguientes protoclulas hasta que evolucionaron los cidos nucleicos.
El arn fue probablemente la primera molcula capaz de replicarse a s misma. Si el arn es
mezclado en un tubo de ensayo con nucletdos libres de arn, se forman pequeos fragmentos
de arn. Esta replicacin ocurre sin la ayuda de las enzimas. Ciertos tpos de arn pueden actuar
de forma parecida a la de las enzimas en las clulas y pueden, eventualmente, partcipar en la
formacin de otros tpos de arn. Es posible que de esta manera el arn en clulas primitvas haya
sido capaz de dirigir su propia replicacin.
Primeras formas de vida
Las evidencias de lo que fueron las primeras clulas que los cientfcos han encontrado son de
fsiles de 3 mil 500 millones de aos de antgedad. Por lo tanto, los cientfcos saben que la vida
apareci cuando menos desde entonces. Esos fsiles son similares a las bacterias modernas, es de-
cir, clulas procariotas. Observa en la fgura 5.6 el proceso de formacin de estas primeras clulas.
Primeros hetertrofos
La mayora de los cientfcos estn de acuerdo en que las primeras clulas fueron hetertrofas. Estas
obtenan energa al absorber molculas orgnicas ricas en energa de su entorno. Como las clulas
se reproducan y su nmero se incrementaba, los nutrientes orgnicos fueron usados ms rpido
que lo que se producan por reacciones al azar. Se desarroll una fuerte competencia entre las clu-
las por las molculas nutritvas.
Muchas posibilidades de variacin ocurrieron en los primeros mil millones de aos despus
de que apareci la vida; algunas de esas variaciones capacitaron a las clulas para usar la energa
193
Evoiuci ovoXic DGEP
4 mil 600 millones de aos
Formacin de molculas orgnicas complejas
cidos nucleicos
3 mil 500 millones de aos
Escape
hidrotermal
Procariotas
Preclulas
de inorgnicas
a molculas
orgnicas
Figura 5.6 Durante los primeros mil millones de aos despus de la formacin de la Tierra,
surgieron los procariotas, parecidos a las bacterias fotosntetcas que existen actualmente.
proveniente del Sol. Las clulas que desarrollaron este proceso de captacin de energa lumi-
nosa conocido como fotosntesis, dejaron de competr por las sustancias orgnicas del mar. Las
evidencias del desarrollo de las primeras bacterias fotosinttcas fue encontrada en rocas llama-
das estromatolitos, que se muestran
en la fgura 5.7. Los estromatolitos
son los restos fosilizados de capas
de bacterias y sedimentos de piedra
caliza. Estos estromatolitos tenen
forma de cojn y fueron descubiertas
en la baha de Shark, en Australia.
Los primeros organismos foto-
sinttcos no producan oxgeno;
sin embargo, al menos desde hace
2 mil 500 millones de aos la foto-
sntesis, tal y como se realiza en la
actualidad en las plantas, se desa-
rroll en ciertas clulas. Por prime-
ra vez, el oxgeno gaseoso fue libe-
rado en el agua y eventualmente,
en la atmsfera.
Respiracin aerbica
A consecuencia de que el oxgeno libre nunca haba estado presente, las clulas eran estricta-
mente anaerobias. Los organismos anaerobios son daados por el oxgeno, por ello la mayora de
las clulas sobre la Tierra fueron incapaces de sobrevivir en la atmsfera de oxgeno.
Aunque la mayora de las clulas murieron, algunas alcanzaron a sobrevivir debido a que vi-
van en lugares exentos de oxgeno como lo son las bacterias actuales anaerbicas. Pocas clulas
quedaron adaptadas a tolerar el oxgeno; eventualmente hubo posibles variaciones que les per-
miteron usar el oxgeno para tomar energa de los alimentos. Estas variaciones fueron los inicios
de la respiracin aerbica.
Figura 5.7 Fotografa de estromatolitos a los que se les calcula
una edad de 3 mil 500 millones de aos.
Evoiuci ovoXic DGEP
194
U 5 UAS
4 mil 600 m. a. (millones de aos)
Era arqueozoica
4 mil 600 a 570 m. a.
Era paleozoica
570 a 250 m. a.
Era mesozoica
250 a 65 m. a.
Era cenozoica
65 m. a. al
presente
2.5 m. a.
Figura 5.8 Tabla del tempo geolgico que muestra la enorme diversidad de organismos del pasado y del presente.
Observa que a partr de la era paleozoica aparecen miembros de todos los flos y clases de animales, excepto aves y
mamferos. En qu era aparece el ser humano?
195
Evoiuci ovoXic DGEP
Eucariotes
Se piensa que las primeras clulas eucariotas se desarrollaron hace 1500 millones de aos.
Cmo lograron desarrollar una membrana nuclear y membranas en los organelos tales como las
mitocondrias y los cloroplastos?
La investgadora americana Lynn Margulis, de la Universidad de Massachusets, desarroll
una hiptesis para contestar esta pregunta. Ella propuso que la mitocondria evolucion de proca-
riotas aerbicos de vida libre y los cloroplastos, de clulas procariotas fotosinttcas. De acuerdo
con esta idea, llamada hiptesis endosimbitca, los ancestros de vida libre de las mitocondrias
y de los cloroplastos fueron englobadas por clulas ms grandes. Quizs las clulas ms grandes
las apresaron para alimentarse y algunas de ellas permanecieron sin digerirse.
Muchas evidencias apoyan la hiptesis de Margulis. Por ejemplo, las mitocondrias y cloro-
plastos parecen clulas procariotas; contenen su propio adn y ribosomas, por lo que pueden
elaborar sus propias protenas y reproducirse. El adn de la mitocondria y del cloroplasto es circu-
lar como en los cromosomas de las bacterias. Finalmente, los ribosomas de esos organelos son
parecidos a los de las bacterias y no a los de las clulas eucariotas.
Evolucin de la vida multcelular
Los gelogos han dividido la historia de la vida en grandes perodos geolgicos. Cada unidad de
tempo est caracterizada por ciertos cambios que tuvieron lugar en la Tierra en el pasado. Las
unidades ms grandes, que se miden en varios millones de aos, se llaman eras; las eras son
divididas en perodos y estos perodos en pocas. Cada divisin es marcada por la extncin de
muchas formas de vida y la aparicin de muchas otras nuevas. Toda esta informacin se resume
en una tabla llamada tabla del tempo geolgico (vase fgura 5.8). Un aspecto sobresaliente
en el estudio de la tabla del tempo geolgico es el que la mayora de la informacin se deriva del
registro fsil de las capas de la corteza terrestre, de lugares como el Can del Colorado, en Ari-
zona. Este can es un valle profundo que alcanza en ocasiones los 1 800 metros y que se form
por la erosin causada a la meseta de Arizona por el fujo de las aguas del ro Colorado, a lo largo
de millones de aos.
Otro conocimiento que los gelogos han mantenido desde hace mucho tempo es el que la
corteza de la Tierra es inquieta, esto es, que cambia constantemente. Los gelogos, basados en
datos cientfcos obtenidos de eventos como la tectnica de placas y el comportamiento mag-
ntco del planeta, reconstruyen el pasado de la corteza terrestre, que revela no slo su com-
portamiento anterior, sino el presente y algunos cambios futuros. Por ejemplo, la Tierra tene un
movimiento regular y constante de dos centmetros por ao en el rea de las Bajas Californias,
las cuales se calcula que se separarn del territorio mexicano, dentro de 30 o 40 millones de aos
para formar unidas un microcontnente.
En la actualidad, se sabe que hace 530 millones de aos se form un supercontnente llamado
Pangea, el cual inici su desintegracin hace unos 230 millones de aos durante la era Paleozoica.
Esa separacin de Pangea dio lugar a la distribucin de los contnentes que tene nuestro planeta
actualmente.
Todava en 1965, en los mapas donde se reconstrua ese supercontnente, Mxico no apa-
reca. En fecha reciente, el descubrimiento hecho por el mexicano Fernando Ortega Gutrrez,
196
U 5 UAS
Investgador del Insttuto de Geologa de la Universidad Nacional Autnoma de Mxico (unam),
ubica a una parte de nuestro pas en un supercontnente todava ms antguo que Pangea de mil
millones de aos, llamado Rodinia. Ese fragmento de territorio mexicano descubierto por el doc-
tor Ortega recibe el nombre de Oaxaquia y en l se localizan antqusimas rocas a las que se les
calcula una edad de mil millones de aos. Oaxaquia se extende desde Oaxaca hasta Tamaulipas
con 1000 kilmetros de largo y 500 de ancho. Con este descubrimiento se coloca a Mxico en el
mapa ms antguo del planeta.
Teora de la evolucin
La teora de la evolucin, nos dice Francisco Ayala
2
(1994), se ocupa de tres condiciones dife-
rentes. La primera es el hecho de la evolucin; esto es, que las especies vivientes cambian a
travs del tempo y estn emparentadas entre s debido a que descienden de antepasados co-
munes. La segunda condicin es la historia de la evolucin, es decir, las relaciones partculares
del parentesco entre unos organismos y otros, y cuando se separaron unos de otros para dar
lugar a las especies vivientes. La tercera condicin se refere a las causas de la evolucin de los
organismos.
Los cambios que han ocurrido en una poblacin mediante los cuales se han formado nuevas
especies a lo largo del tempo es un proceso que se conoce como evolucin. Se considera un
hecho cientfco que la evolucin ha ocurrido a travs de la historia de la vida. La teora de la evo-
lucin explica cmo los cambios han ocurrido en todas las poblaciones, proponiendo, adems, los
mecanismos mediante los cuales ha tenido lugar.
Todas las culturas humanas tenen mitos sobre el origen y desarrollo del mundo y de los seres
vivos. La idea de la evolucin ya era discutda por los flsofos de la antgua Grecia desde hace
ms de 2 mil aos. En realidad, el estudio de la evolucin como un proceso biolgico fue desa-
rrollado a partr del siglo XIX, aunque, la palabra evolucin fue empleada por primera vez por el
naturalista suizo Charles Bonnet a mediados del siglo XVIII. Bonnet encontr fsiles sepultados
en rocas que no representaban a las especies de plantas y animales vivientes. l explicaba estas
diferencias asegurando que ocurran peridicamente en la Tierra catstrofes que modifcaban
las formas vivientes. Los fsiles eran los restos de plantas y animales que vivieron antes de las
catstrofes. La hiptesis de Bonnet es conocida como catastrofsmo, la cual fue muy popular
hasta que otras ideas como las de Lamarck, en 1809, avanzaban en el pensamiento evolutvo de
la humanidad.
Hiptesis de Lamarck
La primera hiptesis completa de la evolucin fue la del naturalista francs Jean Baptste de La-
marck, publicada en 1809 en su libro Filosofa Zoolgica. Fue el primer naturalista moderno que
descart el concepto de las especies fjas (aquellas que no han sufrido variaciones desde su crea-
2
Cientfco espaol especializado en el tema de Evolucin biolgica; ha publicado doce libros, entre ellos La teoria
de la evolucin, en 1994.
197
Evoiuci ovoXic DGEP
cin) y que consider a la especie como poblaciones cambiantes. La hiptesis de Lamarck com-
prende tres ideas principales:
Primera: Lamarck pens que los organismos constantemente luchan para mejorarse y
estar ms avanzados.
Segunda: el esfuerzo de mejorar causa el desarrollo de las estructuras del cuerpo que ms
se usan, mientras que las estructuras que no se usan se degradan. Esta segunda idea fue
llamada el principio del uso y desuso.
Tercera: una vez que una estructura est modifcada por el uso y desuso, la modifcacin
es heredable a la descendencia. Esta idea se conoce como el principio de la herencia de
los caracteres adquiridos y es la base de la hiptesis de Lamarck.
Los ejemplos con que Lamarck quiso ilustrar el mecanismo fundamental de su hiptesis son
muy conocidos; aparte del ms utlizado, que consista en el estramiento del cuello de la jirafa
debido a que su alimento se iba encontrando en ramas cada vez ms altas (fgura 5.9), Lamarck
us el ejemplo de los cuernos de algunos rumiantes, como los venados, que a fuerza de darse
Para Lamarck el cuello largo de las jirafas era el resultado del esfuerzo hecho por sus antepasados al querer alcanzar las hojas altas
de los rboles y poder alimentarse. En cada generacin, el cuello se alargaba un poco ms y esta caracteristica adquirida se heredaba.
Segn Darwin, haba variabilidad en el largo del cuello de las jirafas, unas lo tenan corto y otras largo, y que la naturaleza selec-
ciona generacin tras generacin a las de cuello largo por ser las que mejor pueden alimentarse.
Figura 5.9 Comparacin de las teoras de Lamarck y Darwin con el ejemplo de las jirafas.
198
U 5 UAS
topes con la cabeza cuando los machos peleaban por una hembra, fueron desarrollando corna-
mentas ms grandes. Otro ejemplo es el de las aves acutcas, que al encontrarse en un lago ne-
cesitaban nadar, para lo cual abran los dedos de las patas a fn de impulsarse mejor, de manera
que se estraba la piel entre los dedos hasta que se desarrollaba una pata membranosa como la
de los patos.
En 1889, el bilogo alemn Augusto Weismann mostr que la idea de Lamarck era incorrecta.
Weismann cort las colas de cientos de ratones durante 22 generaciones. La hiptesis de Lamarck
predeca que eventualmente los ratones pudieran nacer con colas cortas o sin cola. Sin embargo,
los ratones de Weismann contnuaban naciendo con cola normal. Weismann concluy que los
cambios en el cuerpo durante la vida de un individuo no afectan a las clulas reproductvas y, por
lo tanto, a la descendencia. Actualmente, la hiptesis de Lamarck basada en la herencia de los ca-
racteres adquiridos es inaceptable ya que las pruebas gentcas son decisivas en el sentdo de que
las caracterstcas adquiridas por el uso y el desuso no se heredan. A partr de lo que se sabe en la
actualidad sobre los mecanismos de herencia, resulta claro que los rasgos adquiridos no pueden
ser heredados, ya que tales cambios ocurren en las clulas del cuerpo, mientras que los rasgos
hereditarios son transmitdos por los gametos. La hiptesis de Lamarck tuvo una gran infuencia
en el siglo XIX y en un joven ingls que naci en 1809. Este joven, Charles Darwin, desarroll un
extenso trabajo de investgacin que lo condujo a la elaboracin de la teora que revolucion a
las ciencias naturales.
El viaje de Darwin
Charles Darwin naci en Inglaterra el 12 de febrero de 1809. De familia acomodada Darwin in-
gres a la escuela de medicina cuando tena 16 aos de edad, sin embargo, encontr a la ciruga
mdica muy desagradable. Como no haba anestesia en aquella poca, no poda soportar el su-
frimiento de los pacientes en ciruga. No complet los estu-
dios de medicina y fue enviado a Cambridge a estudiar para
ministro religioso, donde tampoco fue un buen alumno.
Mientras estudiaba en Cambridge, Darwin conoci a
John S. Henslow, un profesor de botnica. Henslow se hizo
amigo de Darwin y lo anim para que estudiara geologa y
biologa junto con teologa. Despus de que Darwin sali de
Cambridge, Henslow lo present con gente importante en
la ciencia, recomendndolo para partcipar como naturalista
en una importante expedicin cientfca a bordo del barco
h.m.s. Beagle en 1831. El Beagle tena la funcin de hacer
un estudio sobre el litoral de Amrica del Sur, elaborar los
mapas correspondientes y coleccionar especmenes. De esta
manera, Darwin que tena en ese entonces 22 aos tuvo la
oportunidad de colectar, observar y anotar cualquier cosa
nueva que hubiera que registrar en historia natural, adems
de hacer estudios geolgicos en esa rea localizando mine-
rales para explotacin minera. El viaje dur cinco aos alre-
dedor del mundo; la trayectoria aparece en la fgura 5.10.
Figura 5.10 Retraro de Charles
Darwin a la edad de 31 aos, autor de
la teora de la evolucin por seleccin
natural.
199
Evoiuci ovoXic DGEP
Darwin desarroll sus conocimientos de
geologa, durante el viaje ley un libro del
gelogo Charles Lyell llamado Principios de
Geologa. Tambin hizo cuidadosas observa-
ciones geolgicas en las reas a travs de las
cuales viajaban.
Debido a que Darwin sufra mareos fre-
cuentes en el barco, decida caminar por
terra hasta el siguiente punto
donde el barco anclara. Esto le
permit tomar notas sobre ani-
males y plantas que encontraba
Figura 5.11 Trayectoria seguida por el Beagle. Darwin viaj en este barco durante cinco aos en los cuales visit
varios contnentes e islas lejanas como las Galpagos. Por qu fue tan importante este viaje para Darwin?
Figura 5.12 Durante su viaje Darwin encontr y recolect los restos
fsiles de varios mamferos extntos como el perezoso terrestre gigan-
te, el mastodonte y gliptodonte como el aqui representado. Pesaba
dos toneladas y era parecido a un armadillo.
Figura 5.13 Las tortugas de las Galpagos. Darwin se pregunto si todas las tortugas de las diversas islas eran des-
cendientes de un ancestro comn. a) ya que las tortugas de la Isla Isabela tenen caparazones en forma de domo
y cuellos cortos. Su alimentacin es a base de hierbas que se encuentran a raz del suelo ya que la isla es hmeda,
b) mientras que las tortugas de la Isla Hood poseen caparazones planos y cuellos largos que utlizan para alcanzar y
poder alimentarse del fruto del cactus ya que esta isla es rida.
200
U 5 UAS
en su camino. De esta manera, tuvo oportunidad de hacer maravillosas colecciones de todos los
organismos fsiles que encontr.
Las diferencias graduales entre animales y plantas que encontraba a lo largo de las costas, le
impresionaron. Por ejemplo, observ aves parecidas a un avestruz chica llamadas ands (Rhea
americana). Cada poblacin de andes era ligeramente diferente de la anterior; cada grupo pare-
ca haber sido modifcado en algo para adaptarse a las condiciones diferentes del ambiente a lo lar-
go de la costa. Muchos otros animales y plantas parecan mostrar los mismos cambios graduales.
Darwin qued impresionado con los organismos que vio en las Islas Galpagos. Muchos ani-
males y plantas eran nicos en cada isla. Por ejemplo, varios tpos de pinzones no eran parecidos
a los que Darwin ya conoca; cada tpo de esas aves tenan sus propios hbitos de alimentacin
y su propio tpo de alimento. Aun as, todos los pinzones parecan muy emparentados. Darwin
tambin tuvo la oportunidad de ver las poblaciones diferentes de tortugas gigantes que hacen fa-
mosas a estas islas. Un ex gobernador de las islas, le explic a Darwin que cada isla tena su propio
tpo de tortuga, las cuales se podan identfcar por la forma del caparazn.
Teora de Darwin
Despus de regresar a Inglaterra, Darwin dedic mucho tempo a organizar y estudiar sus notas
de viaje. Durante ms de 20 aos trabaj rigurosamente al mismo tempo que construa los
conceptos evolucionistas. Algunas publicaciones muy importantes de aquella poca tuvieron
fuerte efecto en el pensamiento de Darwin; incluso conversaciones con amigos tales como el
ms famoso explorador de su tempo, el gelogo Charles Lyell, le mostraron, por ejemplo, que
las fuerzas (fenmenos) geolgicas son extremadamente lentas y son procesos uniformes. Lyell
le indic que, considerando que estos procesos toman mucho tempo, la Tierra debe ser muy
antgua. En ese tempo, la gente crea que la Tierra slo tena pocos miles de aos. Esta infor-
macin sugera a Darwin que los cambios geolgicos graduales en grandes perodos infuiran
lentamente en plantas y animales.
Darwin ley, entre otros, el libro acerca del crecimiento poblacional escrito por Thomas
Malthus. En ese libro, Malthus establece que la poblacin humana crece tan rpido que un da
crecera ms que la cantdad de alimentos disponibles. Los recursos naturales no podrn abas-
tecer lo que la poblacin necesita. El resultado es la muerte de las personas por el hambre, las
enfermedades y la guerra. Claramente advierte que estos factores detendrn el crecimiento de
la poblacin humana.
Darwin asumi que las predicciones de Malthus eran verdad, no slo para los humanos, sino
para todas las poblaciones de organismos. Si toda la descendencia producida por una poblacin
sobreviviera, la poblacin rpidamente se acabara sus recursos; es decir, todos producen ms
descendientes que los que pueden sobrevivir. Darwin se dio cuenta que siempre hay competen-
cia por el alimento, agua, espacio, luz y otros recursos naturales. Aquellos individuos que ganan
en la competencia son aquellos que sobreviven y se reproducen. La capacidad para reproducirse
y transmitr aquellas caracterstcas que permiten sobrevivir es tan importante como la sobrevi-
vencia misma.
Histricamente el ser humano ha domestcado una gran diversidad de plantas y animales; aun
ms, ha tratado de mejorar las caracterstcas de tales plantas y animales, de tal manera que se
puede hablar de una seleccin artfcial de los mejores miembros de alguna especie en partcular.
201
Evoiuci ovoXic DGEP
Esa seleccin se hace con base en las caracterstcas de alta productvidad o de resistencia a las
enfermedades. Es el caso de las vacas lecheras, caballos veloces, suculencia de los frutos y rendi-
miento de semillas y muchos otros casos. Darwin supuso que este proceso de seleccin tambin
se daba en la naturaleza, pero a un ritmo ms lento. Darwin haba observado que exista mucha
variacin en las caracterstcas de los organismos de una especie, y pens que los organismos que
tenen una caracterstca partcular que les da ms probabilidades de sobrevivir sern selecciona-
dos en forma natural.
Seleccin natural
Para Darwin, la seleccin natural fue el mecanismo mediante el cual se llev a cabo la evolucin.
En realidad, Charles Darwin fue el fundador de la moderna teora de la evolucin. La grandeza
de Darwin en este campo no radic nicamente en su reconocimiento y desarrollo de la seleccin
natural como concepto unifcador del cambio y estabilidad evolutvo, sino en su mente extraordi-
nariamente sinttca; desarroll cierta habilidad para ver relaciones entre hechos aparentemente
no relacionados incluso antes de concebir su teora.
Las ideas de Darwin tomaron forma, y en 1844 escribi un ensayo explicando su nueva teo-
ra acerca de la evolucin. Pero no fue sino hasta 1859 que la public en el libro conocido como
El origen de las especies por la seleccin natural. La primera edicin del libro, que constaba de
1250 ejemplares, se vendi en un da; el libro caus una gran controversia principalmente en-
tre los miembros de la Iglesia.
La teora de Darwin de la evolucin por seleccin natural est basada en cuatro conceptos
centrales:
Variacin. Todos los miembros de una especie diferen entre s. Aunque no es fcil de-
tectarlo en muchas especies, las variaciones entre los individuos son marcadas como las
que reconocemos entre la especie humana. Esas diferencias no solamente se referen a
caracterstcas morfolgicas, sino tambin a aspectos fsiolgicos y de comportamiento.
Un ejemplo bien conocido de dicha variabilidad son las diferencias entre las razas hu-
manas. La falta de un conocimiento gentco por parte de Darwin (en esa poca, nada se
saba de los mecanismos hereditarios), lo incapacit para sealar las razones para estas
variaciones, pero estaba convencido que el mecanismo de variacin era el secreto de las
diferencias entre las especies.
Sobreproduccin. De cualquier especie nacen ms individuos de los que pueden obtener
su alimento y sobrevivir. Por ejemplo, los abetos de un bosque requieren que una sola
plntula logre establecerse para reponer cada uno de los organismos presentes; sin em-
bargo, cada rbol de abeto puede producir decenas de miles de semillas, de las cuales es
posible que no llegue a establecerse ninguna plntula. En realidad, se trata de un mecanis-
mo de seguridad por parte de los organismos ante lo imprevisible y variable de los factores
ambientales causantes de la mortalidad de la progenie; esto es, incrementar las probabili-
dades de que algunos vstagos puedan sobrevivir a todas las causas de mortalidad.
Lucha por la existencia. Como los organismos producen ms descendientes de los que
pueden sobrevivir, se genera una lucha por la existencia; esto es, una competencia por los
recursos disponibles tales como fuentes de alimento y territorio propio.
202
U 5 UAS
Seleccin natural. Los individuos de una poblacin que tenen una caracterstca partcu-
lar que les da ms probabilidades de sobrevivir en un ambiente dado; es decir que estn
mejor adaptados, sern seleccionados naturalmente sobre aquellos individuos menos
adaptados. La seleccin natural acta como un fltro que separa a los individuos menos
adaptados y permite que slo los ms adaptados sobrevivan y se reproduzcan. Los indivi-
duos que sobreviven se reproducen y pueden pasar sus caracterstcas a su progenie. En
el transcurso de numerosas generaciones, y si las condiciones ambientales se mantenen
constantes, la proporcin de individuos bien adaptados tender a aumentar, hasta fnal-
mente aparecer en toda la poblacin. De esta manera, en trminos generales, ocurre la
evolucin de los organismos.
Alfred Russel Wallace
A principios de 1858, un joven bilogo ingls
llamado Alfred Russel Wallace escribi un do-
cumento que ttul Sobre la tendencia de las
variedades a diferenciarse indefnidamente de
los tpos originales. En ese documento de quin-
ce cuartllas, llegaba a las mismas conclusiones
que Darwin acerca de cmo evolucionan los
organismos. Wallace, al igual que Darwin, rea-
liz algunos viajes principalmente a Brasil y a
Malasia donde realiz muchas observaciones y
colecciones de especmenes. Tambin ley las
publicaciones de Malthus, Humboldt, Lyell y al
mismo Darwin. Wallace no present un cmulo
de pruebas documentales debido a que trgica-
mente sus notas y sus especmenes colectados
durante cuatro aos en los ros Amazonas y Ori-
noco se quemaron cuando el barco en que regresaba a Inglaterra se incendi. Wallace se salv
al estar a la deriva en las lanchas salvavidas durante varios das. A pesar de sus prdidas, Wallace
escribi a Darwin explicndole sus conclusiones. Darwin se sorprendi cuando estudi el trabajo
de Wallace y vio la coincidencia en ideas y conceptos que ambos tenan sobre la evolucin.
El 1 de julio de 1858, Charles Lyell y Joseph Hooker presentaron los trabajos de Darwin y
Wallace ante la Sociedad Linneana de Londres. Wallace, con una acttud caracterstca de los
grandes hombres le dio el crdito a Darwin por haber desarrollado primeramente la teora.
Mecanismos de seleccin natural
La teora de la evolucin por seleccin natural de Darwin, permanece como una de las ideas
principales en Biologa. A partr de la muerte de Darwin, otros cientfcos a la luz de nuevos descu-
brimientos, han aclarado partes de la teora que el mismo Darwin no pudo explicar. Por ejemplo,
un punto dbil es la propuesta acerca de las variaciones en la poblacin. Darwin no poda explicar
cmo se producan las variaciones ni cmo se pasaban a los descendientes.
Figura 5.14 Alfred Russel Wallace (1823-1913).
203
Evoiuci ovoXic DGEP
Figura 5.15 En ambas fotografas se observan las dos formas de Biston betularia, la moteada gris y la negra. El rbol
de la izquierda est limpio y con lquenes, y el rbol de la derecha tene su tronco ennegrecido por el holln y sin
lquenes. Qu forma de palomilla ser la ms facil de localizar en cada rbol?
Fuentes de variacin
Con el uso de la gentca moderna, los cientfcos pueden ahora contestar dos importantes pre-
guntas De dnde vienen las variaciones heredadas? Cmo se heredan las variaciones? Los cien-
tfcos saben ahora que las nuevas variaciones vienen de dos fuentes: mutacin y recombinacin.
Recientemente, los cientfcos han reconocido que las mutaciones en los genes pueden pro-
ducir cambios estructurales. Los primeros descubrimientos con la mosca de la fruta muestran
que las moscas con mutaciones tenen caracterstcas tan extraas como pares extras de piernas y
alas creciendo sobre la cabeza. Las mutaciones pueden explicar los cambios repentnos de nuevas
caracterstcas en un individuo y eventualmente en toda la poblacin.
La mayora de las variaciones en una poblacin, sin embargo, no viene de nuevas mutacio-
nes. En su lugar, las variaciones usualmente resultan de la recombinacin de los alelos existentes.
Durante la reproduccin sexual, los alelos se recombinan por medio de tres mecanismos: la dis-
tribucin independiente de cromosomas, entrecruzamiento y la combinacin de genes del vulo
y del espermatozoide durante la fecundacin. Es notable el hecho de que la teora moderna de la
evolucin incluye principios de gentca.
En la teora de la evolucin orgnica hay tres procesos principales que son consecuencia de
la naturaleza de los organismos, de la estructura gentca de las poblaciones y de la diversidad
de las interacciones de la poblacin y su medio ambiente: mutacin, recombinacin gentca
y seleccin natural.
Seleccin y nicho
Es tl saber cul es la diferencia entre dnde vive un organismo y lo que hace en ese lugar don-
de vive. Esto nos lleva al concepto de nicho, que es la funcin o papel que tene un organismo
dentro de la comunidad a la que pertenece. El nicho depende del comportamiento del organis-
mo, respuestas fsiolgicas y adaptaciones estructurales; es decir, el nicho no es un espacio fsico,
sino la interaccin entre los factores fsicos, qumicos, fsiolgicos y bitcos necesarios para el
204
U 5 UAS
organismo. Para describirlo, es necesario saber qu come, dnde se mueve, sus efectos sobre
otros organismos y sobre la parte fsica de su medio.
El nicho de una poblacin es defnida por su forma de vida y el uso del medio ambiente.
El nicho incluye todos los factores a los cuales las poblaciones estn adaptadas. El concepto de
nicho es tl en el estudio de la evolucin a partr de que el nicho de un organismo es un factor
importante en la seleccin natural. Siempre que dos poblaciones intenten ocupar el mismo nicho,
resultar una fera competencia. Eventualmente, slo una de esas poblaciones probar estar me-
jor adaptada al nicho y se saldr de la competencia.
Suponiendo que cambien las condiciones del nicho, algunos individuos en la poblacin
pueden tener caracterstcas que encajen en las nuevas condiciones mejor que otros indivi-
duos. Aquellos con las caracterstcas favorables, sobreviven y se reproducen, pasando las ca-
racterstcas a la nueva descendencia. Aquellos que no reciben las caracterstcas favorables
estn con menores posibilidades de sobrevivir y reproducirse. Este proceso se puede reconocer
como seleccin natural.
Hay muchos ejemplos de seleccin natural como resultado de los cambios ambientales,
uno de los ms famosos es Biston betularia, la palomilla inglesa. Estas palomillas viven en zo-
nas boscosas. Antes de la revolucin industrial, los troncos de los rboles en los bosques de
Inglaterra fueron cubiertos de lquenes de color gris claro. La mayora de las palomillas tenan
un color moteado gris claro que se confunda con el gris de los troncos de los rboles. Ocasio-
nalmente, en la poblacin nacan palomillas de color negro, probablemente como resultado
de alguna mutacin. Sin embargo, estas palomillas eran fcilmente visibles, de tal manera que
eran presa fcil de las aves que se alimentaban de ellas. Esta seleccin haca que el nmero de
polillas negras fuera muy bajo.
Cuando Inglaterra se industrializ, el humo y el holln de las fbricas instaladas en las reas
rurales ennegrecieron a los troncos de los rboles. En pocos aos, se not que haba pocas palo-
millas de color gris, y la mayora de ellas eran de color negro. La contaminacin industrial cambi
el fondo en el que las palomillas descansaban. As, las palomillas negras eran menos visibles a las
aves y ellas podan vivir hasta reproducirse. En slo unas pocas generaciones, la seleccin natural
cambi el color de la mayora de las palomillas de gris a oscuro. Este caso es un fenmeno muy
conocido como melanismo industrial y aunque no es el nico, es un claro ejemplo del efecto del
ambiente para producir una seleccin direccional sobre el contenido gentco de una especie,
que signifca que la seleccin en cierto tpo de mutaciones puede ser muy alta al darse una res-
puesta muy sensible a los cambios del ambiente. Compara la visibilidad de las polillas en los dos
tpos de troncos en la fgura 5. 15.

Pruebas de la evolucin
El registro fsil
Los fsiles son los restos o impresiones de organismos que vivieron hace muchos aos y que se
han preservado por diversos procesos naturales. Por ejemplo, se han descubierto varias especies
de mamuts congelados en regiones polares de ms de 25 mil aos. Es interesante mencionar aqu
que el ltmo mamut descubierto fue encontrado en Siberia en 1997, y que se trata de un mamut
macho, el cual se mantendr congelado con dos fnalidades: estudiarlo y tratar de realizar su clona-
205
Evoiuci ovoXic DGEP
cin. Otro tpo de fsil
es aqul que sus par-
tes duras y blandas
han sido susttuidas
por minerales tales
como el hierro y el s-
lice, este proceso se
conoce como petrif-
cacin. Los bosques
petrifcados que exis-
ten en muchos lugares
del mundo son ejem-
plo de este proceso. El
caso de los insectos atrapados en mbar (resina endurecida de un rbol) es otro buen ejemplo de
fsiles. Muchos otros son esqueletos de vertebrados; algunos ms son las impresiones dejadas
en el fango por plantas y animales. A medida que el organismo se descompone, su forma queda
grabada en el fango, mismo que con el tempo se endurece formando una roca con la impresin
visible del fsil. En la fgura 5.16 se muestran algunos de los tpos ms comunes de fsiles.
Los fsiles son la prueba ms concreta de la evolucin y de que esta es un fenmeno cont-
nuo, ya que nos permiten conocer los cambios de los organismos a travs del tempo. Por ejem-
plo, se han encontrado las series contnuas de fsiles de organismos como el elefante, el came-
llo y el caballo (fgura 5.20). Tambin se han encontrado fsiles de organismos a los que se les
identfca como formas de transicin, ya que tenen caracterstcas intermedias entre dos clases
de organismos diferentes. Entre estos fsiles tenemos el del pezanfbio Eusthenopteron, el del
anfbio-reptl Seymouria y el del reptlave Archaeopteryx. Observa las fguras 5.21 y 5.22.
Actualmente los paleontlogos han descrito y nombrado unas 300 mil especies fsiles, y
siempre estn descubrindose ms.
Figura 5.16 Fsiles: a) Esqueleto de ictosaurio, b) impresin de helecho, c) impresin de un trilobites, d) insecto
en mbar, e) un caracol petrifcado, f) heces fosilizadas (coprolitos) de perezoso con una antgedad de 20 mil
aos, g) huellas de un dinosaurio.
a c
d
b
e
Figura 5.17 Esqueleto fsil de un anfbio Eryops megacelus que vivi hace unos
200 millones de aos en los terrenos que corresponden hoy a Texas, en Estados
Unidos.
f
g
206
U 5 UAS
Determinacin de la edad
de los fsiles
Siempre ha sido una inquietud cmo
saber qu edad o qu tan antguos
son aquellos fsiles que se han encon-
trado. La antropologa, para determi-
nar la edad de los fsiles, ha usado
diversas tcnicas sofstcadas con ba-
ses cientfcas como son los mtodos
de los istopos radiactvos. Algunos
de los elementos que consttuyen los
fsiles o la roca en la que se encuen-
tran son radiactvos, mismos que se
descomponen en otros elementos no
radiactvos a una velocidad conocida.
La edad de un fsil puede ser de-
terminada a partr de la posicin de
la roca donde se le encuentra. Las ca-
pas de roca se acomodan unas sobre
otras con el paso del tempo, por lo
que las capas ms antguas estn en
el fondo, y las ms recien-
tes estn en la parte ms
alta. Un fsil es considera-
do ms antguo que otro
si se encuentra en capas
ms profundas. Tal com-
paracin, no proporciona
la edad, slo nos indica
si un fsil es ms antguo
que otro.
Figura 5.19 Paleontlogo chino
con huevos fosilizados de diver-
sos dinosaurios. Al investgar los
nidos, huevos y embriones dentro
de ellos, se ha logrado saber mu-
cho acerca de la vida de los dino-
saurios. La mayora de ellos vivie-
ron en el perodo Cretcico, entre
los 145 y 65 millones de aos. Los
depsitos de huevos ms ricos se
localizan en China, Mongolia, Ar-
gentna, India y en las grandes pla-
nicies de Norteamrica.
Figura 5.18 Esqueleto de mamut. Este animal tena el aspecto de
un elefante cubierto de pelo espeso, con colmillos muy largos y
curvos. Viva en rebaos y se alimentaba de plantas; se extngui
hace unos 30 mil aos.
207
Evoiuci ovoXic DGEP
Figura 5.20 En el caballo, los restos fsiles encontrados han permitdo conocer las etapas evolutvas por las que ha
pasado esta especie. Observa la reduccin progresiva del nmero de dedos hasta transformarse en un slo dedo.
La edad de la roca puede ser estmada por anlisis de los elementos que contene. Muchos
elementos existen en uno o ms istopos, algunos de los cuales son radiactvos. Los istopos
radiactvos son los que sufren cambios por desintegracin radiactva. Durante la desintegracin
del tomo, se desprende una partcula y una cantdad de energa, lo que hace que el tomo
original se vaya transformando a cierta velocidad que se le conoce como vida media. La vida
media de un elemento es el tempo que toma la mitad de los tomos en una muestra en trans-
formarse en tomos de otro elemento. Un istopo muy conocido es el potasio, con un peso
atmico de 40 y se simboliza como K
40
; su vida media es de 1 300 millones de aos, transfor-
mndose en argn 40 (Ar
40
).
Este mtodo para determinar la edad de las rocas utlizando el K
40
, es conocido como pota-
sio-argn. El potasio es localizado en los cristales de ciertos tpos de rocas, es ese potasio el que
se va transformando, con el paso del tempo, en argn gaseoso que queda atrapado en la misma
roca. La cantdad de argn se com-
para con la cantdad de K
40
que exis-
te en la roca. De esta proporcin, los
cientfcos calculan desde cuando se
form la roca. Los fsiles que se en-
cuentran en esa roca, se asume que
tenen la misma edad. Por ejemplo,
si en cierta roca se encuentra que
existe la misma cantdad de potasio
y argn, esa roca tene una edad de
1 300 millones de aos; si encon-
trramos 75 por ciento de argn, la
edad ser de 2 600 millones de aos.
Otro mtodo para determinar la
edad en fsiles jvenes es el del car-
Evoiuci ovoXic DGEP
Hyracotherium
Mesohippus
Equus
Pliohippus
Merychippus
Figura 5.21 Esqueleto fsil de Seymouria baylorensis, vertebra-
do del perodo prmico (era paleozoica) con caracterstcas in-
termedias entre los anfbios y los reptles.
208
U 5 UAS
bono 14 (C
14
), que es un istopo radiac-
tvo. Recordemos que el carbono que cono-
cemos es el carbono 12 (C
12
) y no es radiactvo;
en la atmsfera, los dos istopos son encontra-
dos en cierta proporcin. Considerando que los organismos vivos siempre estn tomando car-
bono va de los alimentos, la proporcin de C
12
y C
14
es la misma que en la atmsfera. Cuando el
organismo muere, ya no incorpora carbono, solamente se transforma el C
14
ya existente en C
12
.
La vida media del C
14
es de 5 mil 600 aos. Por comparacin de la nueva proporcin de estos
istopos en un organismo, se puede determinar la edad de un fsil menor de 50 mil aos, como
puede ser el caso del humano.
Evidencias en los organismos actuales
Los organismos que actualmente viven se consideran como los extremos de ramas en un rbol
flogentco; el tronco individual de un rbol flogentco representa el primer organismo vivo.
Todos los organismos comparten un antecesor comn que sera la primera clula viviente; los
organismos que son muy diferentes, tales como una planta y un animal, comparten un antecesor
extremadamente antguo. Sus dos ramas fueron separados en la historia evolutva. Los organis-
mos cercanamente relacionados, tales como el perro y el coyote, tenen muchas caracterstcas
similares porque comparten un antecesor comn reciente. Sus dos ramas en el rbol flogen-
tco se separaron hace relatvamente poco tempo. El antecesor comn ms reciente es el ms
relacionado con los dos organismos. Los cientfcos identfcan la evidencia de esas relaciones al
estudiar diferencias y similitudes entre las caracterstcas de los organismos.
Figura 5.22 Fsil y reconstruccin
de Archaeopteryx, unas de las pri-
meras aves. Tena el tamao aproxi-
mado de una paloma y es conocido
como una forma de transicin ya
que tene tanto caracterstcas de
reptl (dientes y larga cola sea)
como de ave (alas con plumas).
Uioo UAS
Ala
Ala
Cabeza
Pata
Plumas
Dientes
Garras
Cola con vrtebras
Cola
209
Evoiuci ovoXic DGEP
Anatoma comparada
Las caracterstcas similares en la anatoma o estructura de los organismos provee evidencias de que
la evolucin ha ocurrido y es usada como criterio para determinar los ancestros comunes. Algunos
organismos pueden parecer diferentes superfcialmente, siendo similares internamente. Estas simi-
litudes fueron heredadas de una especie antecesora.
Las estructuras que son similares a causa de ser heredadas de un antecesor comn y que
pueden tener funciones diferentes, son llamadas estructuras homlogas. La estructura here-
dada puede ser modifcada al desarrollarse en diferentes ambientes, pero la estructura bsica
contna siendo la misma. Por ejemplo, la mayora de los anfbios, reptles, aves y mamferos
tenen un cuerpo con cuatro extremidades y cabeza con dos ojos, una nariz, y una boca. Estas
estructuras son homlogas porque ellos las heredaron de un antecesor comn. En la fgura 5.23
observa la homologa estructural entre el brazo humano, la pata delantera de un gato, la aleta
de una ballena y el ala de un mircilago. Determina cules son los huesos homlogos en cada
extremidad.
Algunas veces, los organismos tenen porciones de rganos o estructuras que no tenen uso,
pero que existen porque han sido heredados de su antecesor. Estas estructuras sin funcin son
llamadas estructuras vestgiales. Estas estructuras son homlogas a estructuras funcionales en
otros organismos. Las estructuras vestgiales sugieren algunas de las caracterstcas de los ante-
Figura 5.23 Homologa estructural. El brazo humano, la pata delantera del gato, la aleta de una ballena y el ala del
murcilago comparten una semejanza estructural sea bsica porque todos provienen de un ancestro comn. Los
huesos homlogos se indican con el mismo color.
Evoiuci ovoXic DGEP
Ser humano
Hmero
Hmero
Radio
Radio
Radio
Cbito
Cbito
Carpianos
Carpianos
Carpianos
Metacarpianos
Metacarpianos
1
1
1
1
2
2
2
2
3
3
3
3
4
4
4
4
5
5
5
5
Falanges
Falanges
Ballena
Murcilago
Gato
210
U 5 UAS
cesores de los organismos modernos. En el ser humano, ms de 100 estructuras se consideran
vestgiales, como el apndice, el cccix (vrtebras caudales fusionadas), el vello corporal, los ter-
ceros molares o muelas del juicio y los msculos que mueven las orejas. La fgura 5.24 muestra
algunos rganos vestgiales en el
ser humano. Otro ejemplo son
los intles huesos de patas en
algunas serpientes. Estos hue-
sos son evidencia de que los an-
tecesores de las serpientes te-
nan patas funcionales, por eso
se cree que evolucionaron de los
lagartos. Las ballenas y los pito-
nes tenen huesos de patas tra-
seras vestgiales localizados en
el abdomen.
Embriologa comparada
Los embriones de organismos emparentados se desarrollan en formas muy similares. Frecuente-
mente, las caracterstcas que tenen han sido perdidas en los adultos de una especie, pero contna
estando presente en el embrin. Los embriones de diferentes vertebrados son estructuralmente
semejantes durante ciertas etapas primarias, en estas primeras etapas es difcil diferenciar un em-
brin de otro. As, en todos los embriones de vertebrados, incluyendo a los humanos, hay pliegues
de tejido en la regin del cuello llamados hendiduras o sacos branquiales. Estas hendiduras se
desarrollan en branquias funcionales en peces y anfbios jvenes. Por supuesto, reptles, aves, y
mamferos nunca desarrollan branquias funcionales; sin embargo, los pliegues aparecen en los em-
briones y se piensa que han sido heredados de un antecesor comn parecido a los peces. Observa
la fgura 5.26 y localiza en los embriones las hendiduras branquiales. Otras similaridades tambin
existen entre las larvas y embriones de otros animales, y entre los embriones de las plantas.
Figura 5.25 Las ballenas no tenen piernas
funcionales pero, aun as, desarrollan hue-
sos plvicos vestgiales y huesos miniatura
de pierna.
Figura 5.24 Algunas estructuras vestgiales en el ser humano.
Pezn en el varn
Ballena
Membrana nictitante
Muela de juicio
Msculos de
la nariz y del oido
Vello corporal
Segmentacin
del msculo
abdominal Cccix
Apndice
211
Evoiuci ovoXic DGEP
Bioqumica comparada
Todos los organismos tenen una gran similitud en su composicin qumica. Algunas de las evi-
dencias ms convincentes del ancestro comn de todas las formas de vida se encuentra en la
bioqumica de las clulas. Por ejemplo, la dependencia de todos los seres vivos sobre el agua es
una caracterstca bsica que es compartda por todas las formas vivientes.
Hay tambin similaridades impresionantes en los compuestos orgnicos encontrados en to-
dos los organismos; todas las formas de vida encontradas en la Tierra estn basadas en el car-
bono, hidrgeno, nitrgeno, oxgeno y fsforo. Estos cinco elementos junto con otros elementos
en pequeas cantdades forman las molculas orgnicas comunes a todas las clulas: lpidos,
carbohidratos, protenas y cidos nucleicos. Adems, todos los organismos utlizan las molculas
de atp en la transferencia de energa.
Un aspecto fundamental que muestra fuerte evidencia acerca del origen comn de todas las
formas de vida desde el punto de vista de la bioqumica es el cdigo gentco, expresado por
la partcipacin del adn y arn. El alfabeto gentco de cuatro letras (adenina, tmina, citosina y
guanina ) existe en cada forma de vida en la Tierra, aun ms, los procesos de sntesis de protenas
son casi idntcos en todos los eucariotes. Los organismos que tenen un antecesor comn reciente
tenen una gentca similar. Puede decirse que el cdigo gentco es universal, o sea, que existe
un cdigo nico para todos los organismos presentes y pasados. Ha quedado claro que el cdigo
gentco pudo haberse desarrollado junto con la primera bacteria hace unos 3 mil 500 millones de
aos y, desde entonces, ha cambiado relatvamente poco a travs de la evolucin biolgica.
Figura 5.26 Diferentes estados en el desarrollo de dos organismos vertebrados. Observa la gran similitud de los embriones en la
cuarta semana. En este estado, el embrin humano y el del cerdo presentan hendiduras branquiales y cola. Las diferencias se
acentan a medida que avanza el desarrollo.
Embrin a la 4ta. semana Feto a la 12va. semana Al nacimiento
Humano
Hendiduras
branquiales
Hendiduras
branquiales
Cabeza
Corazn
Cola
Cola
Cerdo
212
U 5 UAS
Especiacin
Una especie es una poblacin de organismos que pueden aparearse y producir descendencia
saludable y frtl. La seleccin natural modifca las poblaciones de una generacin a la siguiente
tanto como se pueda adaptar al ambiente. Algunas veces los cambios evolutvos son tan grandes
que los organismos resultantes no pueden entrecruzarse con la poblacin original. Cuando esto
ocurre, la poblacin que sufri los cambios se le considera una nueva especie. Cuando una o ms
nuevas especies se ramifcan de la antecesora, se habla de que la especiacin ha tenido lugar.
Aislamiento
La especiacin usualmente inicia con el aislamiento de una parte de la poblacin. El aislamiento
puede ocurrir cuando un grupo emigra lejos de las poblacin principal, tambin puede ser causa-
do por la formacin de barreras naturales tales como los ros que dividen la poblacin. El entre-
cruzamiento se difculta entre dos grupos separados por la distancia o por barreras.
Despus de que los dos grupos son aislados unos de otros, las diferencias entre ellos se em-
piezan a acumular. En efecto, es probable que las dos poblaciones tengan algunas diferencias
entre ellas desde el inicio a causa de su acervo gentco o conjunto de genes (poza gnica o pool
gnico).Por casualidad, el acervo de genes en los dos nuevos grupos puede no ser exactamente el
mismo que el acervo gentco en la poblacin original. Tal diferencia es especialmente probable
si uno de los grupos es pequeo.
En cada grupo, la mutacin y la recombinacin producir variacin. Si las poblaciones de cada
grupo son aisladas, los cambios que suceden en cada una de ellas sern diferentes; cada pobla-
cin est ahora evolucionando independientemente. Cuando las poblaciones aisladas evolucio-
nan independientemente, el proceso es llamado evolucin divergente. Si las dos poblaciones
permanecen separadas lo sufciente, ellas eventualmente estarn aisladas reproductvamente y
sern tan diferentes que no podrn entrecruzarse los miembros de las dos poblaciones. Una vez
que el aislamiento reproductvo se
da, los dos grupos sern especies
diferentes.

Radiacin adaptatva
Sobre el curso del tempo, mu-
chas nuevas especies han venido
de especies ancestrales. La rami-
fcacin de un ancestro que da
origen a nuevas especies que se
adaptan a nichos diferentes es lla-
mado radiacin adaptatva. Este
proceso es un resultado de la evo-
lucin divergente. Un ejemplo de
evolucin adaptatva es la de los
Figura 5.27 Tanto el koala
como el canguro son ejemplos
de la radiacin adaptatva que
se llev a cabo hace millones
de aos en Australia, a partr
de un marsupial ancestral.
213
Evoiuci ovoXic DGEP
Foca
Pingino
Figura 5.29 Un ejemplo de evolucin convergente
son la foca (mamfero) y el pingino (ave), ya que
ambos animales desarrollaron caracterstcas pare-
cidas al adaptarse a un medio ambiente similar. Am-
bos poseen un cuerpo aerodinmico, capas de grasa
bajo la piel y aletas que usan para nadar.
marsupiales (mamferos con bolsa) en Australia. Se cree que hace millones de aos, a partr de
un marsupial ancestral, han evolucionado los actuales marsupiales (fgura 5.27). Evidentemente,
este es un proceso evolutvo que se dio en gran escala tanto en tempo como en espacio.
La radiacin adaptatva tambin puede tener lugar en una escala muy pequea, como la re-
presentada por los pinzones de Darwin y las tortugas gigantes de las Islas Galpagos.
Evolucin convergente
Los organismos con ancestros diferentes
pueden evolucionar desarrollando caracte-
rstcas parecidas como resultado de adap-
tarse a un medio ambiente similar. Cuando
diferentes tpos de organismos desarrollan
caracterstcas similares, esto se conoce
como evolucin convergente. Por ejemplo,
las alas han evolucionado no slo en las aves,
sino en los mamferos (murcilagos) y en in-
sectos. Las alas del murcilago, pjaros e in-
sectos se denominan estructuras anlogas.
Las estructuras anlogas son similares
en funcin y apariencia, pero no en el ori-
gen. Se consideran el resultado de la evo-
lucin convergente. Observa un ejemplo de
evolucin convergente en la fgura 5.29.
Figura 5.28 En las Islas Galpagos, Darwin encontr trece especies de pinzones, cuya principal diferencia era su pico
adaptado a un determinado alimento. Aqu se muestran cuatro de esas especies. La similitud entre las trece especies
de pinzones haca pensar a Darwin que estos se haban originado de una sola especie que lleg a la isla.
a) Pinzn de tierra grande, con pico ade-
cuado para comer semillas grandes
b) Pinzn de tierra
pequeo, con pico
adecuado para comer
semillas pequeas
c) Pinzn gorjeador,
con pico adecuado
para comer insectos
d) Pinzn arbreo
vegetariano, con
pico adecuado
para comer hojas
Evoiuci ovoXic DGEP
214
U 5 UAS
Evolucin humana
Hemos llegado a un tema por dems interesante para todos nosotros: el origen del ser humano.
No fue sino hasta fnales del siglo XIX que se escribieron algunos artculos y libros cientf-
cos sobre el posible origen de los seres humanos, uno de los ms conocidos y polmicos fue el
libro escrito por Charles Darwin ttulado La descendencia del hombre, publicado en 1871. En
este libro, Darwin explicaba que el ser humano era un animal y descenda de animales similares
al mono, en lugar de haber sido creado tal como actualmente existe. Darwin apoy su idea en
pruebas tomadas de seres humanos y de otros primates vivos, ya que hasta ese momento no
se haban encontrado fsiles de ancestros humanos. A partr de entonces, empez a afanzarse
la idea de que los seres humanos y los monos actuales haban evolucionado de un ancestro co-
mn muy antguo. La historia de nuestros ancestros o de la evolucin humana est basada en la
serie de fsiles hasta ahora encontrados, los cuales, lamentablemente, no son comunes y estn
incompletos. Sin embargo, a pesar de esta limitacin, hay pruebas fsiles sufcientes para sugerir
la secuencia de cambios corporales que deben de haber ocurrido durante el proceso de homini-
zacin o aparicin del humano actual (Homo sapiens). Los fsiles indican que la especie humana,
tal y como es en la actualidad, ya exista hace 50 mil aos.
Primates
El ser humano, como especie biolgica, fue denominada por Carlos Linneo con el nombre cien-
tfco de Homo sapiens (homo= hombre; sapiens= sabio, conocedor) y, actualmente, se incluye
dentro de los mamferos placentarios, en el orden de los primates. Adems del humano, este
orden est consttuido por los lmures, tarsios, monos y simios. Los cientfcos ubican a los hu-
manos entre los primates porque comparten caracterstcas importantes. Los primates tenen
manos fuertes y dedos largos con pulgares oponibles que pueden asirse a las ramas; uas planas
sobre los dedos de manos y patas. Los brazos de los primates pueden moverse libremente al
estar artculados con el hombro. Tal movimiento del hombro permite a los primates columpiarse
de mano en mano mientras escala. Los ojos estn ubicados en el frente de la cara, as pueden
calcular las distancias y ver a sus presas.
Estas caracterstcas se encuentran en los primates arborcolas, pero los primates tales como
los humanos y gorilas que no viven en los rboles, conservan esas caracterstcas. Los cient-
fcos inferen que las caracterstcas fueron heredadas de un ancestro arborcola compartdo
por humanos y otros primates. Adems de las adaptaciones para escalar rboles, los primates
comparten otros rasgos; tenden a ser animales inteligentes con cerebro relatvamente grande.
La mayora de ellos tenen una conducta social compleja y toman el cuidado de sus cras por un
largo tempo despus de su nacimiento. Los cuidados paternos prolongados pueden ser, quizs,
una adaptacin a la vida arborcola. Un beb no puede volar o escalar, y no sobrevivir mucho en
los rboles sin la atencin constante de la madre.
Los humanos comparten todas esas caracterstcas, pero tambin hay otras que los separan.
Por ejemplo, ningn otro primate puede caminar erguido unos cuantos pasos a la vez. La postura
erguida capacita a los primates para desplazarse y viajar ms facilmente. La capacidad para cami-
nar sobre las dos piernas se llama locomocin bpeda. El caminar con las piernas permite tener
215
Evoiuci ovoXic DGEP
las manos libres para usar herramientas y otros objetos. El cerebro es mucho ms grande que el
de cualquier otro primate, incluido el gorila, cuyo cuerpo es generalmente ms grande que el del
humano. Adems, el cerebro humano tene reas que controlan el habla y el entendimiento del
lenguaje. Otros primates pueden comunicarse con sonidos y gestos, pero slo los humanos han
desarrollado el habla que lo capacita para acumular informacin y compartr ideas complejas con
sus cras. El habla es un factor importante en la civilizacin humana.
Evolucin de los primates
De todos los primates fsiles conocidos, el ms antguo tene 65 millones de aos y fue encon-
trado en una colina del estado norteamericano de Montana, en 1965. Este primate conocido
como Purgatorius vivi en los ltmos aos de los dinosaurios, se alimentaba de hojas e insec-
tos, habitaba en los
rboles y se pareca
a las musaraas ar-
borcolas de hoy.
Muchos grupos de
los primeros mam-
feros aparecieron
al mismo tempo
en el registro fsil.
Hace 35 millones de
aos, los primeros
primates se dividie-
ron en dos grupos,
los prosimios y los
antropoides.
Prosimios
Los prosimios son
los primates ms
primitvos debido
a que son los ms
similares a los pri-
meros primates an-
cestrales. Los prosi-
mios son animales
arborcolas pequeos , parecidos a los monos. La mayora de ellos son nocturnos. Tambin po-
seen grandes ojos dirigidos hacia adelante; el tamao de sus ojos es una adaptacin a sus act-
vidades nocturnas. Los prosimios abundaron en el pasado en todo el mundo. Actualmente, slo
se localizan en las regiones tropicales de frica, Asia y en la Isla de Madagascar. Los prosimios
actuales incluyen a los trsidos, lmures y glagos, los cuales varan muy poco de los prosimios
originales. Identfcalos en la fguras 5.30 y 5.31.
Figura 5.31 Tarsio, se les localiza sola-
mente en las Indias Orientales. Es un
animal pequeo de grandes ojos, con
hbitos nocturnos, con cojinetes adhe-
sivos en los dedos, lo cual le permite
colgarse de los rboles.
Figura 5.30 Lmur, animal pequeo y ar-
borcola. Actualmente viven en Asia y fri-
ca tropicales y en la Isla de Madagascar.
216
U 5 UAS
Antropoides
La palabra antropoide signifca
parecido a humano. En los antro-
poides se incluye a los monos, los
simios y los humanos. Poco despus
de que los antropoides y los prosi-
mios se separaron, los antropoides
se desarrollaron en dos grupos. Un
grupo se desarroll en el contnente
americano y el otro en los contnen-
tes asitco, europeo y africano, por
lo que evolucionaron independien-
temente.
Los antropoides del contnente
americano o monos del Nuevo Mun-
do se localizan en Amrica Central y
del Sur. Estos monos tenen nariz cha-
ta y ancha, largas colas prensiles me-
diante las cuales pueden agarrarse
fuertemente a las ramas de los rbo-
les. Son ejemplos, los monos araa,
capuchinos, aulladores y los tts. Ob-
serva el mono araa de la fgura 5.32.
Los antropoides de Europa-
Asia-frica, se desarrollaron en dos
grupos. Uno de ellos formado por
los monos del Viejo Mundo y otro
por los grandes simios y el humano.
Los monos del Viejo Mundo tenen
una nariz mucho ms estrecha que
los del Nuevo Mundo y sus colas no
son prensiles. Algunos monos del
Viejo Mundo son el papin, el man-
dril, el macaco, el mono rhesus y el
babuino.
Los grandes simios consttuyen
la familia Pongidae y son; el gibn, el
orangutn, el chimpanc y el gorila.
Evidencias recientes de estudios
gentcos muestran que los chim-
pancs son los ms cercanos al ser
humano. Comparten un 98% de
adn.
Figura 5.32 Mono araa, habitante de las selvas americanas. Po-
seedor, al igual que el resto de los monos del Nuevo Mundo, de
una cola prensil que utlizan como una quinta mano.
Figura 5.33 Los grandes simios; a) orangutn, b) chimpanc, c)
gorila y d) gibn.
b
c d
a
217
Evoiuci ovoXic DGEP
Primeros homnidos
Todos los antropoides que pertenecen a la familia humana son llamados homnidos; el humano
moderno pertenece, como ya se mencion, a la especie Homo sapiens. Esa especie es la nica
de los homnidos que vive en la actualidad. En el pasado, sin embargo, haba varias especies de
homnidos. Algunos de esos homnidos extntos fueron los antecesores del humano actual. Otros
fueron ramas laterales del rbol genealgico del ser humano. El cientfco que estudia los orge-
nes y la evolucin biolgica y cultural del ser humano es llamado antroplogo.
Durante la mayor parte de la historia de los homnidos, ms de una especie vivi al mismo
tempo. Los antroplogos no estn de acuerdo en el porqu hoy estn extntos esos homnidos;
sin embargo, algunos piensan que pudo haber sido por competencia con otros homnidos. Ense-
guida se describen algunos de los fsiles de ancestros del ser humano ms conocidos.
Australopithecus
Los cientfcos an no identfcan el primer ancestro humano que lo separa de los monos. La
evidencia fsil sugiere que la separacin ocurri hace aproximadamente 5 u 8 millones de aos.
Los Australopithecus son los fsiles de homnidos ms antguos descubiertos hasta la fecha.
Son varias las especies que se han encontrado, la primera apareci hace 4.4 millones de aos
y la ltma se extngui hace apenas un milln de aos
3
. Los cientfcos los han nombrado Aus-
tralopithecus, que signifca mono del Sur, ya que el primer fsil fue descubierto en el Sur de
frica.
Figura 5.34 Los estudios comparatvos de las secuencias de bases nitrogenadas del adn muestran que los chimpan-
cs estn ms emparentados al humano que a los gorilas o a cualquier otro simio. Qu porcentaje de ADN compar-
ten humanos y chimpancs?
3
(4 .4 millones): 4 millones 400 mil aos
Del grupo de los monos
Humano
98.2%similar
97.7%similar
96.3%similar
Presente
5 8 15 Millones de aos
92.0%similar
Chimpanc
Gorila
Orangutn
218
U 5 UAS
En 1924, el anatomista Raymond Dart
hizo el primer descubrimiento de un Aus-
tralopithecus. El fsil era el crneo de un
nio (fgura 5.35) y fue encontrado en una
cantera en Taung Sudfrica. Dart le llam
Australopithecus africanus y se cree que
vivi entre 2.7 y 2.1 millones de aos. El
hallazgo de este fsil es un tanto curioso
ya que fue encontrado por el gelogo G. B.
Young, en el despacho del director de una
mina en Taung, donde era utlizado como
pisapapeles. Young se lo llev a Dart, quien
lo identfc.
Otra especie de Australopithecus fue
descubierta en 1974 por el norteamerica-
no Donald Johanson en la regin de Afar,
en Etopa. Johanson encontr 52 huesos
del esqueleto de un homnido de sexo
femenino (fgura 5.36). En esos aos, la
cancin de moda era Lucy en el cielo de
diamantes, lo que dio motvo para que llamaran Lucy a este es-
queleto. Johanson y su equipo decidieron que el esqueleto de
Lucy era lo sufcientemente diferente de los otros fsiles de Aus-
tralopithecus como para ser ubicado entre estos. Por lo que le
nombraron Australopithecus afarensis, en referencia a la re-
gin en la que fue encontrado. A. afarensis es ms antguo que
A. africanus, estmndose que vivi hace 3 millones de aos.
Ambas especies de Australopithecus son considerados hom-
nidos, principalmente por la forma en que caminaban. Los hue-
sos de la cadera indican que caminaban erguidos sobre las dos
piernas como los humanos en la actualidad. El Australopithecus
Figura 5.35 Crneo del nio de Taung, que fue encontrado
en una cantera de piedra caliza en 1924.
Figura 5.36 Reconstruccin y esqueleto de Lucy. Debido a la gran
cantdad de huesos encontrados es una de los Australopithecus mejor
estudiados. Lucy tena una estatura de 105 cm. y pesaba 27 kg. Cmo
era su locomocin?
218
219
Evoiuci ovoXic DGEP
tambin tena estructuras como las de los monos. Compa-
rados con sus piernas, los brazos eran ms largos que los
brazos humanos modernos. Tambin, su cerebro tena di-
mensiones similares a la de los monos con una capacidad
craneal de 350-400 centmetros cbicos.
La locomocin bpeda, o en dos pies de los Australo-
pithecus se corrobora con el descubrimiento, en 1977, de
las huellas de pisadas en Laetoli, Tanzania, por la antrop-
loga Mary Leakey. A estas huellas fsiles (ver fgura 5.38)
se les calcula una antgedad de aproximadamente 3 mi-
llones 700 mil aos.
La especie de Australopithecus ms antgua fue descu-
bierta en Etopa, a partr de 1992, por el equipo que dirige
Tim White, de la Universidad de Berkeley. Los fsiles en-
contrados son fragmentos de crneos y huesos de brazos
con una edad de 4.4 millones de aos. A esta especie se le
denomin Australopithecus ramidus.
Hace dos millones de aos, aproximadamente, apare-
cieron otras dos especies de Australopithecus. Estas dos
especies tenan huesos ms duros y gruesos que los an-
teriores. Los cientfcos llamaron a estas nuevas especies
A. robustus y A. boisei. Se est de acuerdo en que estas
dos especies no fueron antecesores del hombre moderno,
pero que s fueron ramas del rbol genealgico que se ex-
tnguieron apenas hace un milln de aos.
Casi todos los antroplogos estn de acuerdo con que
el A. afarensis o el A. africanus es el antepasado de los
homnidos modernos, incluidos los seres humanos, mien-
tras que otras especies como el A. robustus y A. boisei se
extnguieron sin dejar descendientes.
Figura 5.37 Mary Leakey cientfca in-
glesa que ha realizado algunos de los
descubrimientos arqueolgicos y an-
tropolgicos ms signifcatvos del si-
glo XX.
Figura 5.39 Dibujo que nos muestra un grupo de Australopithecus afaren-
sis. Pasaban parte del tempo en los rboles y su locomocin era bpeda.
Figura 5.38 Huella fosilizada de pisada
de Australopithecus, descubiertas por
Mary Leakey. Estas huellas se extenden
a lo largo de 25 metros.
220
U 5 UAS
Homo habilis
En 1964, el famoso equipo de ar-
quelogos de Louis y Mary Leakey
anunciaron el descubrimiento de
lo que pareca ser el primer hom-
nido que us herramientas talladas.
Debido a que ellos hacan diferen-
tes tpos de instrumentos de pie-
dra y hueso, esa nueva especie fue
llamada Homo habilis que signifca
"hombre habilidoso" El nombre del
gnero Homo indica que el fsil est
ms relacionado con el humano
moderno, Homo sapiens, que con
otras especies de homnidos. Aus-
tralopithecus fue el otro gnero de
homnidos. Los cientfcos generalmente estn de acuerdo en que Homo habilis fue el ancestro
directo del humano moderno.
A mediados de la dcada de 1960, un grupo de cientfcos de Londres descubri un pequeo
fragmento de crneo de homnido cerca de un lago en Kenya, en frica. La pieza de crneo fue
depositada en el Museo Nacional de Kenya. Despus de 25 aos, otro grupo de cientfcos decidi
estudiar el fragmento; resultando que era un fsil ms antguo de lo que se pensaba y con carac-
terstcas del gnero Homo. Se determin la edad del fsil en alrededor de 2.5 millones de aos.
Algunos guijarros tallados fueron encontrados cerca del fsil.
El cerebro de Homo habilis fue mucho ms grande que alguno de las especies de Australo-
pithecus, cerca de la mitad del moderno cerebro humano. El gran tamao del cerebro evolucion
junto con la habilidad de fabricacin de herramientas de estos primates inteligentes. H. habilis
hered de sus antecesores la habilidad para caminar erguido; la postura erguida permita dejar
las manos libres para usar herramientas que l mismo haca.
Los Homo habilis comparteron territorio africano con A. robustus y A. boisei casi un milln
de aos. Alrededor de 1.5 millones de aos, H. habilis dio lugar a otra especie con cerebro ms
desarrollado, el Homo erectus u hombre erguido.
Homo erectus
El cerebro de Homo erectus fue mucho ms grande que el de H. habilis, aunque no tan gran-
de como el del humano moderno. H. erectus era de cara ancha y voluminosa con mandbula
saliente, una amplia arcada dental con fuertes molares y premolares. Trabaja la piedra de una
manera ms refnada que H. habilis. Los grupos de H. erectus fueron los primeros humanos que
emigraron de frica hasta Asia y Europa. Huesos de H. erectus se han hallado en frica, en la Isla
de Java y en China. Los cientfcos siguen interpretando la evidencia fsil de H. erectus. Algunos
arquelogos piensan que saba cmo producir el fuego. H. erectus tambin pudo haber vivido
de la cacera y la recoleccin, como lo hizo el H. habilis. Los investgadores tambin piensan que
Figura 5.40 El crneo de Australopithecus afarensis (derecha)
tene una capacidad craneal de 400 cm
3
, en el Homo erectus
(centro) es de 850 cm
3
y en el Homo sapiens moderno, el
vlumen promedio es de 1 360 cm
3
. Este incremento en la ca-
pacidad craneal se ha dado en los ltmos 3 millones de aos.
221
Evoiuci ovoXic DGEP
pudo haber vivido en refugios y haber
usado ropa, debido a que vivieron en
Europa del norte y Asia durante la po-
ca de los glaciares.
Homo sapiens
Los primeros miembros del Homo sa-
piens pueden haberse desarrollado del
H. erectus hace entre 300 mil a 500 mil
aos. Dos grupos de H. sapiens estn
representados en el registro fsil: los
Neanderthal y los Cro-Magnon. Los
Cro-Magnon eran idntcos a los huma-
nos modernos, diferan de los humanos
de hoy slo en su forma de vivir. Por otra parte, el destno que tuvieron los Neanderthal es una
controversia en el debate de la evolucin del ser humano.
Neanderthal
Los fsiles de los primeros humanos conocidos como Neanderthal fueron hallados por primera
vez en el Valle de Neander en Alemania, en 1856. Estos fueron los primeros fsiles de los humanos
prehistricos. La mayora de los cientfcos clasifcan a los Neanderthal como una subespecie de H.
sapiens y, posiblemente,
un ancestro de los hu-
manos modernos. Otros
los consideran como
una rama trunca del r-
bol humano; es decir,
una raza de H. sapiens
extnta.
Se han encontrado
casi 100 esqueletos de
Neanderthal localizados
en Europa, Asia, Siberia
y Africa del Norte. Los
Neanderthales vivieron
en la Tierra desde hace
250 mil aos hasta su
extncin, hace 35 mil
aos. Sus restos indican
que eran de baja estatu-
ra, como de 1.5 m, muy
fuertes y tenan el cere-
Figura 5.41 Hombre de Java, crneo y reconstruccin del as-
pecto probable de su cara.
Figura 5.42 Neanderthales. Estos seres humanos primitvos eran de corta es-
tura y complexin fuerte. Cazaban grandes animales y utlizaban el fuego.
222
U 5 UAS
bro tan grande como el del humano moderno. Los crneos fsiles indican que tenan reas de ha-
bla en el cerebro, aunque la naturaleza de su lenguaje era hipottco. Se han reconstruido sus ca-
ras, las cuales presentan marcados bordes de las cejas, muy pobladas, boca grande y una barbilla
pequea. Los Neanderthales eran hbiles cazadores de mamuts, tenan armas y herramientas de
piedra; utlizaban el fuego y hay evidencias de que enterraban a sus muertos. Se han encontrado
esqueletos en posiciones cuidadosamente arregladas que sugieren sepulturas rituales. Con estas
evidencias, los cientfcos creen que los Neanderthal probablemente eran religiosos y tenan una
estructura social.
Cro-Magnon
El Cro-Magnon vivi en Europa hace cerca de 90 mil aos. Los primeros restos de los Cro-Mag-
non se encontraron en 1868, en la gruta de Cro-Magnon en el sur de Francia, de ah su nombre.
Estos primeros restos fueron cinco esqueletos: el de un anciano, dos hombres adultos, una mu-
jer y un nio. Los Cro-Magnon eran altos, musculosos, de facciones fnas, idntcos al humano
actual.Vivan en cuevas y eran grandes artstas, prueba de ello son las hermosas pinturas rupes-
tres de animales y escenas de caza plasmadas en las paredes de las cuevas.
Los Cro-magnon coexisteron con los
Neanderthales en Europa y en Medio Orien-
te durante quiz 50 mil aos, hasta que el
Neanderthal desapareci. Los cientfcos no
saben qu fue de los Neanderthal, tal vez
los Cro-Magnon eran mejores cazadores y
llevaron a los Neanderthales a la extncin
por competencia. Quizs la habilidad supe-
rior de lenguaje de los Cro-Magnon tam-
bin les dio supremaca. Algunos cientfcos
piensan que se
dio el entrecru-
zamiento y se
mezclaron los
grupos. Eviden-
cias recientes,
sin embargo, no
apoyan la teo-
ra del entre-
cr uzami ento.
En la fgura 5.44
se muestra un
posible rbol
evolutvo de los
seres humanos.
Figura 5.43 Hombre de Cro-magnon pintando alrededor de su mano. A la derecha una
pintura rupestre pintada por ellos.
223
Evoiuci ovoXic DGEP
Figura 5.44 Posible rbol evolutvo de los seres humanos que muestra crneos y reconstrucciones faciales de espec-
menes representatvos.
A. boisei
A. afarensis
A. africanus A. robustus
Homo habilis Homo erectus Homo sapiens
4 3 2 1 0
hace millones de aos
Australopithecus
ramidus
224
U 5 UAS
Autoevaluacin
Repaso de la unidad
Contesta las siguientes preguntas:
1. Qu es la evolucin?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
2. En que consist el experimento de Pasteur mediante el cual se descarta defnitvamente
la hiptesis de la generacin espontnea?
________________________________________________________________________
_______________________________________________________________________
3. Cules eran las condiciones probables de la Tierra primitva?
________________________________________________________________________
________________________________________________________________________
4. Qu evidencia proporcion el experimento de Miller-Urey para apoyar la teora de
Oparin?
________________________________________________________________________
________________________________________________________________________
5. En qu se basan los cientfcos para calcular que la vida se inici hace 3 mil 500 millones
de aos?
________________________________________________________________________
6. Qu es un estromatolito?
________________________________________________________________________
7. Qu tpo de informacin contene una tabla del tempo geolgico?
________________________________________________________________________
________________________________________________________________________
8. Qu revelan las pruebas fsiles sobre la evolucin?
________________________________________________________________________
225
Evoiuci ovoXic DGEP
9. Qu es un rgano vestgial? Da un ejemplo.
________________________________________________________________________
10. En qu consiste el mtodo del Carbono 14 utlizado para determinar la edad de los
fsiles.
________________________________________________________________________
________________________________________________________________________
11. Por qu los cientfcos rechazan la hiptesis de Lamarck sobre cmo ocurre la evolucin?
________________________________________________________________________
12. Cules son los puntos principales de la teora de la evolucin de Darwin?
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
13. Cmo puede la seleccin natural provocar la evolucin?
________________________________________________________________________
________________________________________________________________________
14. Qu importancia tenen las mutaciones en el proceso evolutvo?
________________________________________________________________________
15. Qu es la especiacin?
________________________________________________________________________
16. Cules son los fsiles de homnidos que pueden ser antepasados de los seres
humanos actuales.
________________________________________________________________________
________________________________________________________________________
________________________________________________________________________
17. A qu gnero y especie pertenece el humano actual?
________________________________________________________________________
18. Por qu es incorrecto decir que el ser humano desciende del mono? Cul es la afrmacin
correcta?
________________________________________________________________________
________________________________________________________________________
226
U 5 UAS
Indica cual de las siguientes afrmaciones son verdaderas (v) o falsas (f).
19. Una especie es un grupo de organismos que pueden aparearse y producir
descendencia saludable y frtl.
20. La especiacin usualmente inicia con el aislamiento de una parte de la
poblacin.
21. El cerebro de Homo erectus fue mucho ms grande que el de Homo habilis.
22. El principio de la herencia de las caracterstcas adquiridas, es la base de la
hiptesis de Darwin.
23. La lucha por la existencia es una competencia por los recursos disponibles
como fuente de alimento y territorio propio.
24. El principio del uso y desuso de las estructuras del cuerpo, fue enunciada
por Lamarck.
25. Todos los integrantes de una especie son idntcos entre s.
26. El nicho de una poblacin es defnida por su forma de vida y el uso del medio
ambiente.
27. Los pinzones y las tortugas gigantes de las Islas Galpagos estudiada por
Darwin, son resultado de la radiacin adaptatva.
28. Los Australopithecus son los fsiles de los homnidos descubiertos ms
recientemente.
En la siguiente sopa de letras, localiza la respuesta de lo que se te pide:
29. Tipo de evolucin en la que las poblaciones aisladas evolucionan independientemente.
30. Las alas de los murcilagos, pjaros e insectos, se denominan estructuras:
31. Son los primates ms primitvos.
32. Es la funcin que desempea un organismo dentro de la comunidad,
33. Son los cambios que han ocurrido en una poblacin mediante los cuales se han formado
nuevas especies, a lo largo del tempo.
34. Realiz un sencillo y bien diseado experimento para poner a prueba la generacin
espontnea.
35. Para este investgador, la seleccin natural fue el mecanismo mediante el cual, se llev
a cabo la evolucin.
36. Las muelas del juicio, la apndice vermiforme y el cccix, son ejemplo de estructuras:
37. Realiz un experimento que puso fn a la teora de la generacin espontnea.
38. Estableci que la poblacin humana crece tan rpido que un da crecer ms que la
cantdad de alimentos disponibles.
( )
( )
( )
( )
( )
( )
( )
( )
( )
( )
227
Evoiuci ovoXic DGEP
Aplicacin de conceptos
39. Explica el mecanismo de la elongacin evolutva del cuello de la jirafa, de acuerdo con
Lamarck y con Darwin.
________________________________________________________________________
________________________________________________________________________
40. Usa tus conocimientos de gentca para explicar por qu las caracterstcas adquiridas no
son pasadas a la progenie.
________________________________________________________________________
41. Si visitaras una isla donde se encuentran varios tpos de plantas que estn relacionadas y
que son diferentes a las encontradas en terra frme, cmo explicaras esta observacin
a alguien que no est familiarizado con las teoras de la evolucin?
________________________________________________________________________
________________________________________________________________________
42. Explica el uso de la radiactvidad para conocer la edad de las rocas.
________________________________________________________________________
________________________________________________________________________
Elabora un mapa conceptual sobre las diversas pruebas de la evolucin.
D A R W I N A R A N E P
I N V E S T I G A D O R
V E S T I G I A L E S O
E V O L U C I O N U E S
R E D I N F R A E S P I
G U S T A V O L I N A M
E U F A M A L T H U S I
N I C H O L E G A R T O
T E N A C I D A D G E S
E N C O N T R E M O U V
V E L C O M P U T A R E
S A N A L O G A S A L I
Gua
didctica
A
c
t
i
v
i
d
a
d
e
s

d
e

l
a
b
o
r
a
t
o
r
i
o
231
La didctca en la actvidad experimental de biologa
L
a biologa, como la ciencia del estudio de la vida, es un cuerpo de conocimientos adquiridos
a travs de la observacin y de la experimentacin. Esta ciencia se ha desarrollado a una
velocidad muy rpida de tal manera que el conocimiento que se alcanza en el medio escolar
acerca de los seres vivos, se ha estado quedando rezagado. Por este motvo, se hace necesario
recurrir a la didctca como una base terica para facilitar la labor del maestro.
La didctca de la biologa generaliza y sistematza las experiencias del trabajo escolar. Este
ordenamiento signifca una gua segura y concreta en el proceso de enseanza-aprendizaje de la
biologa, adems de contribuir al dominio de las tcnicas de enseanza.
En el ambiente escolar y en la asignatura de biologa, tenemos una tarea que es decisiva y
que consiste en Familiarizar a los alumnos con los hechos, mtodos y pensamientos biolgicos a
fn de capacitarlos y motvarlos para observar los fenmenos naturales.
Para poder adquirir los conocimientos biolgicos se tenen que desarrollar ciertas apttudes y
habilidades. Es fundamental desarrollar la capacidad de observacin, de anlisis y de experimen-
tacin. Es imprescindible descubrir o redescubrir de un modo creatvo, independiente y refexivo
las partcularidades cualitatvas y cuanttatvas de los hechos y procesos biolgicos. Es necesario
buscar las causas para responder a las interrogantes que le plantea la naturaleza, para establecer
las relaciones entre los organismos y sus manifestaciones. La gran diversidad de las formas vivien-
tes y de sus condiciones de vida nos ofrece muchas oportunidades para ejercitar el pensamiento
causal.
La observacin, la investgacin, el anlisis y el experimento estn ntmamente relaciona-
dos en la enseanza de la biologa. Mediante la observacin y el experimento fjamos nuestra
atencin en algn cambio que se est produciendo; observar signifca contemplar un proceso y
reconocer modifcaciones. Es uno de los fundamentos de la enseanza de la biologa, para ello
primero se considera el aspecto general del objeto, despus se sealan sus caracterstcas ms
importantes, y, por ltmo, se hace la sntesis en un nivel de mayor complejidad, el cual permite
comprender la interaccin de las partes con el todo.
El experimento
Durante la observacin, no es fcil comprender plenamente las manifestaciones de los hechos
biolgicos, adems de las fuerzas que actan sobre ellas y cmo se relacionan entre s. En tales
casos, es necesario experimentar, o sea, separar cuidadosamente a los factores individuales que
interactan en cualquier proceso biolgico. As, por ejemplo, los procesos metablicos que ocu-
rren en la gran diversidad de formas vivientes y muchos fenmenos evolutvos se aclaran nica-
mente con el experimento. Pero es muy claro que para desarrollar esta actvidad experimental
debe haberse dado primero por una cuidadosa observacin e investgacin, para que, de esta
manera, se disponga de hechos que despierten el inters por la propia experimentacin. En la
escuela es muy probable que no vayamos a descubrir algo nuevo, pero como resultado de la in-
vestgacin experimental, se establecern verdaderos redescubrimientos.
232
Ac:ivioovs ov inov:ovio UAS
El mtodo de las ciencias
Cules son los mtodos usados por los cientficos? Por lo general, la investigacin cientfica
se lleva a cabo de acuerdo con ciertos pasos ordenados que producen resultados precisos y
confiables. Estos pasos conforman lo que es el mtodo cientfco y signifcan el modo lgico
y ordenado de resolver un problema o dar respuesta a una pregunta. No hay un solo mtodo
cientfco pues se han planteado muchas propuestas para realizar actvidades de investgacin ex-
perimental. Aun as, aqu se enlistan los pasos o fases ms comunes, las cuales sirven de modelo
experimental en las prctcas de laboratorio de biologa en el bachillerato, stas son:
l Planteamiento del problema. No se puede resolver un problema si primero no es delimi-
tado, es decir, formular con claridad el problema a investgar o a qu pregunta se quiere
responder.
l Bsqueda de informacin acerca del problema. Debemos obtener informacin que tenga
relacin con nuestro problema y, adems, estudiarla para saber si ya hay respuestas a ese
problema planteado. Los libros de la biblioteca, las revistas de divulgacin cientfca, los
libros de texto y la gua para el laboratorio, junto con los resmenes de clases, servirn en
esta parte de la investgacin.
l Construccin de una hiptesis. Despus de recolectar la informacin y hacer observaciones,
se procede a construir una explicacin o una respuesta probable al problema. Esta explica-
cin se llama hiptesis. Para que una hiptesis sea vlida, debe ser demostrable por medio
de la experimentacin. A veces hay que cambiar la hiptesis si con los resultados de los
experimentos no se ve apoyada.
La hiptesis gua la observacin y experimentacin porque sugiere qu es lo que debe ser obser-
vado.
l Procedimiento. Este paso consiste en experimentar para probar la hiptesis. Se principia
con el diseo del experimento a partr de un bosquejo de la disposicin experimental sen-
cilla, en el cual se incluye la seleccin del equipo de laboratorio tales como el microscopio,
material de vidrio y el material biolgico, adems de los instrumentos de medicin para
control de variables del fenmeno o problema a investgar, instalar todo el dispositvo de
ensayo y comprobacin de las condiciones experimentales. Lgicamente se incluye la eje-
cucin del experimento.
l Observacin y registro de datos del experimento. Es preciso un control del desarrollo expe-
rimental. Todo lo que tene que ver con el experimento debe ser anotado felmente Qu
pas durante el experimento? Cules fueron los cambios cuanttatvos y cualitatvos?
Cules fueron los resultados? El registro puede incluir notas, dibujos, tablas y grfcas.
l Anlisis y conclusiones. El anlisis o interpretacin de los resultados obtenidos nos llevar a
dar respuesta al problema o pregunta inicialmente planteada.
Con los resultados del experimento, se sacan conclusiones vlidas de ellos. Tales conclusiones
deben estar basadas en los hechos del experimento para poder aceptar o rechazar la hiptesis
propuesta.
233
G DGEP
Se acepta como cierta una hiptesis cuando la prediccin es confrmada por los resultados del
experimento. Basta que exista un solo dato que no concuerde con la explicacin para desecharla.
Habilidades
Adems de las fases vistas anteriormente, este modelo se inicia con un apartado inttulado Habi-
lidades, en el cual se mencionan tanto las habilidades intelectuales como las manuales o psico-
motoras (destrezas) que el alumno va a desarrollar durante la realizacin del programa de prc-
tcas experimentales a nivel escolar. No es un objetvo nuestro presentar una lista exhaustva de
habilidades y destrezas, sin embargo mencionaremos algunas que tenen que ver con el trabajo
en los laboratorios.
Observar e inferir
La observacin es la base de todas las investgaciones cientfcas. Las observaciones se realizan
por medio de los sentdos. Por ejemplo, en un ave podemos observar mediante los sentdos de
la vista, tacto y odo, el colorido y textura de su plumaje y el sonido que emite, respectvamente.
La observacin da informacin sobre las cosas o eventos que suceden. Los cientfcos intentan
ser precisos y cuidadosos en sus investgaciones, para ello utlizan instrumentos como el micros-
copio, a fn de ayudar a ampliar lo que solamente se perciben por medio de los sentdos. Entre
otros instrumentos que se utlizan, tales como el termmetro o la balanza de platllos, miden las
observaciones. Las medidas proporcionan datos numricos que signifcan un medio concreto de
comparar datos que pueden ser repetdos.
Algunas observaciones describen algo usando solamente las palabras. Estas observaciones
son llamadas cualitatvas. Otras observaciones, las cuanttatvas, describen cunto hay de algo.
Las observaciones cuanttatvas usan nmeros tanto como palabras en la descripcin. Para reali-
zarlas se utlizan herramientas o equipo para medir ciertas caracterstcas. Por ejemplo, las obser-
vaciones cualitatvas sobre un perro sern que es algo, chaparro, de pelo corto, orejas largas, et-
ctera, y las observaciones cuanttatvas sern, por ejemplo, que tene un peso de 45 kilogramos,
una altura de 50 centmetros y una edad de 10 meses.
Los cientfcos frecuentemente usan sus observaciones para hacer inferencias. Una inferen-
cia es una explicacin tentatva o interpretacin de observaciones para determinar qu es lo que
causa lo observado. Por ejemplo, si alrededor del medioda t observas el letrero de cerrado en
la puerta de una tenda, mediante el razonamiento t puedes inferir que el dependiente sali a
comer. La nica forma de estar seguro si tu inferencia es correcta es investgndolo.
Cuando se hace una inferencia, debemos hacer observaciones precisas, registrarlas cuidado-
samente y recolectar toda la informacin posible. Entonces, basado en todo lo que sabes, trata
de explicar o interpretar qu es lo que has observado. Si es posible, investga posteriormente para
ver si tu inferencia es correcta.
Comparar y contrastar
Las observaciones pueden ser analizadas y, entonces, organizadas anotando las similitudes y dife-
rencias entre dos o ms objetos o situaciones. Cuando se examinan los objetos para determinar
234
Ac:ivioovs ov inov:ovio UAS
similitudes, se est comparando. Contrastar es buscar en objetos y situaciones similares las dife-
rencias existentes entre ellos.
Vamos utlizando el siguiente ejemplo: suponiendo que t quieres comparar y contrastar un
chapuln de un cigarrn, empezars por hacer tus observaciones. En este momento es tl que
tomes una hoja de papel y la dividas en dos columnas. Enlista todo aquello que es similar a los dos
insectos en una columna y en las otras, todas aquellas caracterstcas que los hacen diferentes.
Despus de completar tu lista, reporta tus hallazgos en una tabla o en una grfca.
Las similitudes que se encuentran son: el cuerpo tene tres partes, dos pares de alas y un
rgano bucal mastcador. Las diferencias pueden incluir: grandes patas traseras en el chapuln,
pequeas piernas en el cigarrn. Las alas estn muy pegadas al cuerpo, en el chapuln, y extendi-
das en el cigarrn.
Algunas habilidades manuales o destrezas son la manipulacin o manejo de instrumentos
como el microscopio o el manejo de material de cristalera como los portaobjetos y cubreobjetos
que se utlizan al realizar una preparacin hmeda. Otra destreza es dibujar, o sea, representar
fguras en una superfcie, lo cual permite que el alumno reafrme su conocimiento sobre las ca-
racterstcas morfolgicas del organismo que se est estudiando.
La seguridad en el laboratorio
El laboratorio de biologa es un lugar donde muchas cosas interesantes pueden pasar. Es tambin
un lugar donde existen riesgos y materiales peligrosos. Para garantzar que el trabajo en el labora-
torio sea seguro y positvo, debemos seguir ciertas precauciones. Lee las siguientes indicaciones
antes de iniciar cualquier trabajo en el laboratorio, y revsalas de vez en cuando durante el trans-
curso de las actvidades.
Reglas de seguridad
1. Lee todos los procedimientos de cada actvidad de laboratorio antes de empezar a traba-
jar, de tal manera que ests completamente familiarizado con lo que se tene que hacer.
2. El laboratorio no es un lugar para correr, empujar y bromear. Esta conducta tan poco
apropiada puede causar accidentes. Toma en serio el laboratorio.
3. Indaga dnde se localiza el extnguidor, la regadera, el botqun y la alarma de fuego.
4. Usa una bata para proteger tu ropa; si las mangas son largas, sbelas enrollndolas.
5. Recgete el pelo largo.
6. No comas ni bebas en el laboratorio.
7. Nunca inhales sustancias ni pruebes ni lleves ninguna sustancia o material a la boca.
8. Lvate las manos antes y despus de cualquier actvidad.
9. Mantn limpia el rea de trabajo en el laboratorio; sin libros ni papales ni equipo alguno
innecesario.
10. Lava cuidadosamente todos los utensilios antes y despus de usarse.
11. No experimentes ni mezcles sustancias por tu cuenta. Recuerda que algunas mezclas son
txicas o explosivas.
12. Cuando uses tjeras, navaja o bistur, corta lo ms alejado de los dems y de tu propio
cuerpo. Nunca cortes un espcimen mientras lo tenes en tu mano.
235
G DGEP
13. Usa lentes de proteccin cuando se vayan a utlizar sustancias qumicas peligrosas que
puedan salpicarte y daar tus ojos.
14. Cuando calientes alguna sustancia en un tubo de ensayo, siempre inclnalo de forma que
la boca no se dirija a t o a tus compaeros.
15. Etqueta todos los frascos con los nombres de los materiales que se usen en la prctca.
16. Inmediatamente, reporta cualquier accidente a tu maestro, incluyendo el quebrar el ma-
terial de vidrio, derrame de sustancia o lesiones fsicas.
17. No recojas con las manos material de vidrio que se haya quebrado, hay que hacerlo con
cepillo y recogedor y depositarlo en el recipiente destnado para desecho de vidrio.
18. Las sustancias qumicas que no hayan sido usadas, no se devuelven al frasco original para
evitar que haya contaminacin. Se dispondr de las sustancias qumicas segn lo indique
el profesor del laboratorio.
19. Asegrate de que todo el material utlizado quede bien limpio y guardado en el lugar
correcto, y que el rea de trabajo est limpia, antes de salir del laboratorio.
20. Asegrate que todos los mecheros de Bunsen, salidas de gas y llaves de agua estn cerra-
das antes de salir del laboratorio.
Orientaciones para el laboratorista sobre las actvidades
Al inicio de la actvidad, el laboratorista deber cuestonar a los alumnos sobre el contenido de
sta, con el fn de saber qu tanto saben o conocen sobre el tema biolgico que se est tratando.
Esto es con la fnalidad de que los conceptos bsicos que se requieren para un desarrollo ptmo
de la prctca surjan de los alumnos. Si el nivel de conocimientos que se presentan los alumnos es
bajo, el laboratorista deber explicar de una manera clara y sencilla los principales conceptos del
tema tratado en la prctca. Esta explicacin deber apoyarse en material didctco como mode-
los tridimensionales, lminas y especmenes vivos o conservados.
Algunas diapositvas que se requieren mnimamente en este primer semestre son:
l Microscopio compuesto
l Elaboracin de una preparacin hmeda
l Organismos representantes de los 6 reinos
l Proceso de smosis
l Clula vegetal
l Clula animal
l Ciclo celular
l Fases de la mitosis
l rbol genealgico
l Cariotpo humano
l Cdigo gentco
Antes de fnalizar la actvidad, el laboratorista deber preguntar a los alumnos sobre la con-
clusin a la que llegaron para constatar si la hiptesis planteada al inicio es verifcada de acuerdo
con los resultados.
236
Ac:ivioovs ov inov:ovio UAS
actividad 1
Conocimiento del microscopio ptco compuesto
El microscopio es una de las ms importantes herramientas de estudio en Biologa. El microscopio
es un aparato ptco, cuyo objetvo es aumentar considerablemente el tamao de los objetos de
observacin; por tal motvo y por ser un aparato de constante uso en las prctcas de laboratorio,
es necesario conocer sus partes y manejarlo perfectamente. El tpo de microscopio usado en la
mayora de los laboratorios escolares es el microscopio compuesto, el cual usa dos lentes para
ampliar la imagen: el ocular y el objetvo.
Descripcin del microscopio
Escucha con atencin la descripcin que har del microscopio tu profesor de laboratorio. Al
mismo tempo, localiza cada parte descrita en el microscopio de tu mesa de trabajo.
El microscopio se divide en tres sistemas:
l Mecnico, ptco y de iluminacin.
El sistema mecnico est integrado por:
l Tubo: Proporciona sostn a los objetvos y a los oculares mantenindolos separados a la
distancia de trabajo correcta.
l Revlver: En l se localizan los objetvos, los cuales, mediante un movimiento de rotacin,
se ubican en posicin de trabajo.
l Brazo: Pieza de forma curva por donde se toma al microscopio.
l Platna: Pieza donde se colocan las preparaciones para su observacin; presenta un orifcio
central por el que penetra la luz y sobre el cual se coloca la preparacin.
l Pinzas: Se localizan en la platna y sujetan la preparacin.
l Columna: Se encuentra entre el brazo y la base; en ella se localizan los tornillos macrom-
trico y micromtrico.
l Tornillo macrmtrico o de avance rpido: Mueve la platna hacia arriba o hacia abajo acer-
cando el objetvo a la distancia de trabajo.
l Tornillo micromtrico o de avance lento: Permite enfocar con precisin (logrando la mayor
claridad) subiendo y bajando lentamente a la platina.
l Base: Soporte frme para el resto del microscopio. Palanca del condensador: Cierra y abre
el diafragma. Botn regulador de la lmpara: Proporciona la cantdad de luz necesaria para
cada enfoque.
l Palanca del condensador: cierra y abre el diafragma.
l Botn regulador de la lmpara: proporciona la cantdad de luz necesaria para cada enfoque.
237
G DGEP
El sistema ptco est integrado por:
l Ocular: Est compuesto por lentes que aumentan las imgenes producidas por el objetvo.
Puede ser reemplazado por otro ocular de menor o mayor aumento. El ocular es nombrado
as por estar cerca del ojo del observador. Por lo general posee 10 aumentos (10X). Se les
llama oculares por encontrarse cerca de los ojos.
l Objetvos:Consttuidos por lentes de diferentes aumentos (magnifcaciones), stos pueden
ser:
Objetvo de enfoque (lupa)... 4X a 6X Con l localizamos la imagen.
Objetvo seco dbil... 10X a 20X Se emplean sin que haya necesidad de agre-
gar una sustancia entre la preparacin y el
objetvo.
Objetvo seco fuerte...40X a 45X
Objetvo de inmersin 100X
Requiere el uso de aceite de cedro (de inmer-
sin) entre la preparacin y el objetvo.
Se les llama objetvos por encontrarse cerca del objeto que se va a examinar.
La amplifcacin del objeto se logra con
los aumentos del ocular y los objetvos. Para
calcular el aumento total (nmero de veces
que se amplifca un objeto), se multplica el
aumento del objetvo por el del ocular.
Ejemplo: Ocular: 10X Objetvo: 4X
Nmero total de aumentos:
10 x 4 = 40 dimetros 40 veces
El sistema de iluminacin est integrado por:
l Lmpara: Proporciona la luz que se re-
quiere para poder realizar la observa-
cin.
l Diafragma: Regula la cantdad de luz que
va a pasar a travs de la preparacin.
l Condensador: Concentra el haz de luz
en la preparacin.
Anlisis
1. En la fgura 1.1 seala y nombra
cada una de las piezas del micros-
copio y anota si corresponde al sis-
tema mecnico (M), ptco (O) o de
iluminacin(I).
Figura 1.1 Microscopio ptco compuesto.
238
Ac:ivioovs ov inov:ovio UAS
2. Completa lo que se pide sobre las siguientes observaciones.
Si el ocular con el que se observ esta sangre de rana es de 10X y el objetvo es de 40X, est au-
mentada _________ veces.
Esta epidermis de cebolla, est aumentada 100 veces, por lo tanto el ocular es de: ________ y el
objetvo es de: ________
Figura 1.2
Figura 1.3
Glbulo blanco
Citoplasma
Pared celular
Ncleo
Glbulo rojo
239
G DGEP
actividad 2
Cuidado y uso del microscopio
Cuidado del microscopio
Al hacer uso del microscopio, debes tener muy presente que ests usando un aparato de preci-
sin mecnica y ptca, as que debes tratarlo con cuidado y slo para los fnes que est construi-
do; por lo tanto, al utlizarlo toma en cuenta las siguientes consideraciones:
1. Para trasladarlo de un sito a otro, debes utlizar ambas manos, coloca una mano bajo
la base y con la otra sujtalo del brazo (fgura 2.1) No lo intentes de otra manera ya que
podras daarlo.
2. No coloques el microscopio en el borde de la mesa, ya que cualquier movimiento invo-
luntario puede trarlo al suelo. Asegrate de que se encuentre a unos 20 cm de los bordes
de la mesa.
3. Las lentes del ocular y objetvos deben estar siempre limpios; para ello, primero se quita
el polvo con un pincel de pelo fno y despus se limpian con un lienzo suave humedecido
con un poco de ter o alcohol. As se evita que al frotar el polvo con el lienzo, las superf-
cies de los lentes que estn fnamente pulidas se daen.
4. Cuando utlices aceite de inmersin, debers
limpiar inmediatamente la lente del objetvo
100X con un lienzo suave empapado con la si-
guiente solucin: 30% de acetona, 30% de ter
etlico y 30% de alcohol.
5. No debe forzarse ningn mecanismo.
6. Cuando termines de hacer tus observaciones,
debers colocar el microscopio en posicin de
descanso (bajar la platna hasta el tope y colo-
car en posicin ptca el objetvo de enfoque).
7. Por ltmo, debers limpiarlo y guardarlo en
su caja o funda de plstco para protegerlo del
polvo.
Uso del microscopio
Elabora la preparacin, recortando un pedazo pe-
queo de peridico que contenga una letra a mi-
nscula de aproximadamente 4 mm.
1. Conecta el microscopio a la corriente elctrica
y acciona el control de encendido.
Figura 2.1 Manera de transportar el mi-
croscopio.
240
Ac:ivioovs ov inov:ovio UAS
2. Girando el revlver, coloca el objetvo de enfoque en posicin ptca.
3. Coloca la preparacin sobre la platna, procurando que el objeto que vas a observar coin-
cida con el orifcio de la platna.
4. Sube la platna hasta el tope (girando el tornillo macromtrico).
5. Ahora, observa a travs del ocular y baja la platna con el tornilo macromtrico hasta que
la imagen aparezca.
6. Afna la imagen subiendo o bajando la platna lentamente con el tornillo micromtrico.
7. Regula la cantdad de luz abriendo y cerrando el diafragma o girando el botn regulador
de la lmpara.
8. Antes de que observes con un mayor aumento (objetvo 10X), centra perfectamente la
imagen.
9. Siempre que cambies de objetvo, afna la imagen empleando el tornillo micromtrico.
Anlisis
1. De acuerdo con el objetvo utlizado, dibuja lo que observaste en los siguientes campos
visuales.
De acuerdo con las tres observaciones anteriores; qu sucedi con la imagen? _______
_______________________________________ y con el rea que la circunda? _______
_______________________________________________________________________.
2. Qu observas en cuanto a la orientacin de la imagen? __________________________
A qu se debe esto? ______________________________________________________
3. Cuntos objetvos tene el microscopio qu utlizaste? ___________.
Qu graduacin presenta cada uno de ellos? Enfoque:________ Seco dbil: _________
Seco fuerte: _________ Inmersin: _________
4. Cul es la graduacin del ocular? ________________.
Dibujo 2.1 Objetvo
de enfoque
Dibujo 2.2 Objetvo
seco dbil
Dibujo 2.3 Objetvo
seco fuerte
241
G DGEP
actividad 3
Los seis reinos
Habilidades
Observar, comparar y determinar.
Problema
Cules son las principales caracterstcas de cada uno de los seis reinos?
Estrategia
Durante esta investgacin, observars organismos y determinars a que reino pertenecen.
Hiptesis
Los integrantes de los reinos arqueobacterias y eubacterias son procariotas, mientras que los
reinos protsta, fungi, plantae y animalia son eucariotas.
Materiales
Equipo: Microscopio, portaobjetos, cubreobjetos, goteros.
Material biolgico:
Agua estancada (charco, forero, etc.), levadura del pan (dos pastllas de levadura disuelta
en 20 ml de agua), pan con hongos, championes, diversos representantes de la mayora
de las divisiones y phyla de plantas y animales respectvamente. Estos especmenes pue-
den estar vivos, disecados o conservados en formol.
Procedimiento
1. Elabora una preparacin microscpica con:
a) Una gota de agua estancada.
b) Una gota de suspensin de levadura.
2. Observa cada una de ellas al microscopio.
3. Observa los organismos macroscpicos.
4. Determina a que clase, phylum (divisin) y reino pertenecen. Escribe su nombre donde
corresponda.
Reino Arqueobacteria____________________________________________________________
______________________________________________________________________________
Reino Eubacteria________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
242
Ac:ivioovs ov inov:ovio UAS
Reino Protsta
Protstas tpo animal (protozoarios)________________________________________________
__________________________________________________________________________
Protstas tpo vegetal (algas)____________________________________________________
__________________________________________________________________________
Protstas tpo hongo___________________________________________________________
__________________________________________________________________________
Reino Hongos
Phylum quitridiomicetos_______________________________________________________
Phylum cigomicetos___________________________________________________________
Phylum ascomicetos __________________________________________________________
Phylum basidiomicetos________________________________________________________
Phylum deuteromicetos________________________________________________________
Reino Plantas
Clase flicinae________________________________________________________________
Clase gimnospermae__________________________________________________________
Clase angiospermae___________________________________________________________
Reino Animal
Invertebrados inferiores
Phylum porfera___________________________________________________________
Phylum cnidaria (celenterados)_______________________________________________
________________________________________________________________________
Phylum platelmintos _______________________________________________________
Phylum nematodos ________________________________________________________
Invertebrados superiores
Phylum anlidos __________________________________________________________
Phylum moluscos _________________________________________________________
________________________________________________________________________
Phylum artrpodos_________________________________________________________
________________________________________________________________________
________________________________________________________________________
Phylum equinodermos______________________________________________________
243
G DGEP
Cordados
Subphylum vertebrados
Clase peces______________________________________________________________
Clase anfbios_____________________________________________________________
Clase reptles_____________________________________________________________
Clase aves_______________________________________________________________
Clase mamferos__________________________________________________________
Anlisis
De acuerdo a las caracterstcas de cada reino. Llena con una (x) la siguiente tabla de clasif-
cacin.
Arqueobacteria Eubacteria Protsta Fungi Plantae Animalia
Eucariotas
Procariotas
Auttrofos
Hetertrofos
Unicelulares
Pluricelulares
Conclusin
Basndote en tus observaciones, redacta un prrafo donde expreses tu conclusin.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
244
Ac:ivioovs ov inov:ovio UAS
actividad 4
Carbohidratos, lpidos y protenas
Habilidades
Observar, manipular, deducir.
Problema
Qu molculas orgnicas consumo diariamente?
Estrategia
Durante esta investgacin, analizars diversos alimentos para saber que molculas orgnicas
(carbohidratos, lpidos o protenas) contenen.
Hiptesis
Los carbohidratos tenen diferente estructura a la de las protenas y a la de los lpidos, es
decir, cada molcula orgnica tene una estructura propia, por lo tanto, al agregarles ciertos
reactvos, presentan reacciones caracterstcas que se emplean para identfcarlas.
Materiales
Equipo: Goteros, cuchillo, vidrios de reloj, agitador de vidrio.
Reactvos: lugol, Fehling A y Fehling B, sudn III, NaOH (hidrxido de sodio) y Cu SO
4
(sulfato
de cobre).
Material biolgico: Jugo de naranja, salchicha fnamente picada, carne de pollo fnamente
picada y clara de huevo.
Procedimiento
1. Coloca en 4 tubos de ensayo aproximadamente 3 ml de jugo de naranja. Haz lo mismo
con los otros alimentos.
2. Para investgar si un alimento contene almidn, agrega unas 3 gotas de lugol, mzclalo y
si adquiere una coloracin azul hasta negro, indica que si contene.
3. Para saber si un alimento contene lpidos, agrega 5 gotas de sudn III, mzclalo, djalo
reposar aproximadamente 5 minutos. Observa si aparece una coloracin anaranjada-
rojiza que indica la presencia de lpidos.
4. Para investgar azcares, agrega al alimento 1 ml del reactvo Fehling A y 1 ml de Fehling
B, mzclalos. Colcalo a la fama del mechero o en bao Mara y si observas una colo-
racin amarilla indica que el alimento contene poco azcar. Si aparece un rojo ladrillo
indica que contene mayor concentracin de azcar.
5. Para investgar protenas, agrega al alimento 2 ml de NaOH (hidrxido de sodio), mez-
cla, agrega CuSO
4
(sulfato de cobre) gota a gota, si observas una coloracin azul intenso
indica poca concentracin de protenas. En cambio, si la coloracin es violeta contene
una alta concentracin de protenas.
245
G DGEP
Anlisis
Llena la siguiente tabla de comparacin con una ( ) de acuerdo a tus observaciones:
Almidn Lpidos Azcares Protenas
Jugo de naranja
Salchicha
Carne de pollo
Clara de huevo
Conclusin
En base a la hiptesis planteada, escribe un prrafo manifestando tus conclusiones, apyate
en tus observaciones.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
246
Ac:ivioovs ov inov:ovio UAS

actividad 5
smosis en papas
Habilidades
Observar, manipular y experimentar.
Problema
Qu es la smosis? Cmo se afecta la papa al ser expuesta a diferentes soluciones?
Estrategia
Durante esta investgacin, observars el proceso de smosis en la papa y el efecto de dos
soluciones en la estructura de una rebanada de papa.
Hiptesis
Las sustancias que se incorporan o abandonan las clulas por smosis, causan cambios en la
estructura natural de la papa.
Materiales
Equipo: un cuchillo, pelapapas, dos vasos de precipitado de 250 ml, un plato hondo desecha-
ble.
Material biolgico: una papa grande, solucin de sal, agua, una cucharada de azcar.
Procedimiento
1. Quitale la cscara a la papa y crtala por la mitad.
2. A una de las mitades, frmale un hueco con la ayuda del pelapapas.
3. En el plato hondo, coloca la cantdad sufciente de agua para que cubra la papa, pero
cuidando que no la rebase.
4. Deposita una cucharada de azcar en el hueco de la papa.
Figura 5.1 A la izquierda se muestra el paso 2 y a la derecha se muestra el paso 4.
247
G DGEP
5. Despus de 20 minutos, observa lo que sucede.
6. De la otra mitad de papa, corta dos rebanadas aproximadamente del mismo tamao y
coloca cada una de ellas en un vaso de precipitado.
7. Agrega a uno de los vasos 200 ml de agua y al otro, 200 ml de solucin salina.
8. Despus de 20 minutos, coloca cada rebanada de papa entre tu dedo pulgar e ndice y
trata de doblarlas.
Anlisis
1. Qu sucedi con el azcar que colocaste en el hueco de unas de las mitades de la papa?
______________________________________________________________________________
2. Cientfcamente, cmo explicas el proceso anterior?
______________________________________________________________________________
3. Qu cambios tuvo la flexibilidad de la rebanada de papa en el agua?
______________________________________________________________________________
4. Cmo explicas cientficamente lo que le sucedi a la rebanada de papa anterior?
______________________________________________________________________________
5. Qu cambios tuvo la flexibilidad de la rebanada de papa en la solucin salina?
______________________________________________________________________________
6. Cmo explicas cientfcamente lo que le sucedi a la rebanada de papa en solucin salina?
______________________________________________________________________________
Conclusin
Utlizando el concepto de smosis, escribe tu conclusin. Apyate en tus observaciones.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
248
Ac:ivioovs ov inov:ovio UAS
actividad 6
Clula vegetal y clula animal
Habilidades
Observar, manipular, identfcar, dibujar, comparar, contrastar y refexionar.
Problema
Cules son las diferencias estructurales entre una clula vegetal y una clula animal?

Estrategia
Durante esta investgacin, observars clulas vegetales y clulas animales e identfcars las
similitudes y diferencias entre ellas.
Hiptesis
Las diferencias entre clulas vegetales y animales residen en la presencia o ausencia de es-
tructuras tales como los cloroplastos y la pared celular.
Materiales
Equipo: microscopio, portaobjetos, cubreobjetos, palillos de dientes
Reactvos: colorantes de lugol y azul de metleno.
Material biolgico: hojas de Elodea, una cebolla y epitelio bucal.
Procedimiento
Elabora las siguientes preparaciones hmedas:
1. Toma una hoja de Elodea y depostala en el centro de un portaobjetos, agrgale una gota
de agua, coloca el cubreobjetos y observa al microscopio.
Figura 6.1 Preparacin hmeda de una hoja de Elodea.
Planta de Elodea
Hoja de Elodea
Agua
249
G DGEP
2. Coloca un fragmento de epidermis
de cebolla en un portaobjetos, agr-
gale una gota de lugol, coloca el cu-
breobjetos y observa al microscopio.
3. En un portaobjetos, de-
posita una gota de azul
de metleno, y con el ex-
tremo grueso de un pa-
lillo, frota la cara interna
de tu mejilla, coloca este
material en la gota de co-
lorante, mueve rotatva-
mente el palillo para que
las clulas se separen,
coloca un cubreobjetos y
procede a observar.
4. En los siguientes espacios, dibuja lo que observaste; nombra las partes identfcadas
Figura 6.2 Observa como
con la ayuda de unas pin-
zas se retra la epidermis
de la cebolla.
Figura 6.3 Elaboracin de una preparacin de clulas del epitelio bucal.
Dibujo 6.1 Clulas de Elodea. Dibujo 6.2 Clulas de Cebolla.
250
Ac:ivioovs ov inov:ovio UAS
Anlisis
1. De las clulas vegetales observadas, cules poseen cloroplastos? ________________
Cules no poseen cloroplastos?____________________________________________
Explica lo anterior_________________________________________________________
2. De las clulas que observaste, en cul de ellas tuviste difcultad para observar el ncleo?
__________________________________________.
3. En la epidermis de la cebolla y la hoja de Elodea, qu apariencia tene el contorno de las
clulas y cmo se llama esta estructura?_______________________________________
4. Qu organelo observaste en las clulas del epitelio bucal?______________________
Qu organelos de las clulas vegetales no observaste en las clulas anima-
les?____________________________________________________________________
Por qu?_______________________________________________________________
5. Qu otros organelos tanto de la clula vegetal como animal no se observaron?_______
_______________________________________________________________________
Por qu?_______________________________________________________________
Conclusin
Basndote en las diferencias y similitudes que observaste, escribe un prrafo manifestando
tu conclusin.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Dibujo 6.3 Clulas de epitelio bucal
251
G DGEP
actividad 7
Mitosis e interfase
Habilidades
Observar, comparar, identfcar, dibujar.
Problema
Cmo identfcas las fases de la mitosis?
Estrategia
Durante esta investgacin, observars e identfcars cada una de las fases de la mitosis y la
interfase.
Hiptesis
Debido a que la raz de cebolla se encuentra en crecimiento, sus clulas se estn reprodu-
ciendo por mitosis y se pueden observar todas las fases as como tambin la fase donde est
duplicando todas sus molculas y organelos (interfase).
En la profase desaparecen los nuclolos y la membrana nuclear, la cromatna se compacta y
se llama cromosoma, aparece el huso mittco. En la metafase los cromosomas se acomodan
en el ecuador del huso mittco. En la anafase, la mitad de los cromosomas, en forma de V
migran hacia los polos. En la telofase reaparecen la membrana nuclear y los nuclolos, los
cromosomas se vuelven laxos y se les llama cromatna.
Materiales
Equipo: diapositvas o lminas del ciclo celular y de la mitosis.

Procedimiento
1. Observa las diaposotvas de interfase y de las diferentes fases de la mitosis: profase, me-
tafase, anafase y telofase.
2. Dibjalas en el crculo de la pgina siguiente.
Anlisis
1. En esta fase del ciclo celular, es cuando se duplica el adn, todas las dems molculas y
organelos:_______________________________________________________________
252
Ac:ivioovs ov inov:ovio UAS
Conclusin
Basndote en tus dibujos, redacta un prrafo donde expreses las caracterstcas de cada una
de las fases de la mitosis.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
Ac:ivioovs ov inov:ovio UAS
253
G DGEP
actividad 8
Herencia humana
Habilidades
Observar, comparar, interpretar datos y deducir.
Problema
Qu caracterstcas o rasgos humanos podemos determinar a simple
vista y cmo se construye un rbol genealgico?
Estrategia
Durante esta investgacin, determinars tu fenotpo y genotpo para algunos rasgos; ade-
ms, construirs un rbol genealgico familiar.
Hiptesis
Algunas caracterstcas pueden ser fcilmente identfcadas mediante la observacin y com-
paracin de las caracterstcas visibles o fenotpo. Adems, podemos deducir cules genes
estn presentes y reconocer el gen dominante
o recesivo para esa caracterstca. Al determinar
qu genes estn presentes, determinamos el
genotpo.
Materiales
Diapositvas sobre algunas caracterstcas here-
ditarias y un rbol genealgico.
Procedimiento
Parte 1. Tu fenotpo y genotpo de algunos ras-
gos comunes
Determina tu fenotpo y establece tu genotpo
para los rasgos listados en la tabla 1. Recuerda
que si tenes un rasgo dominante, entonces se
porta cuando menos un gen dominante (hetero-
cigoto dominante) o incluso los dos genes sern
dominantes (homocigoto dominante). Si identf-
camos la caracterstca recesiva es porque se por-
ta los dos genes recesivos. Como no sabes si eres
homocigoto dominante o heterocigoto dominan-
te, escribe un guin (-) para el segundo gen; si
posees el rasgo recesivo, antalo como dos ge-
nes recesivos. Apyate en la siguiente fgura.
Figura 8.1 Algunas caracterstcas hereditarias.
254
Ac:ivioovs ov inov:ovio UAS
1. Con la ayuda de alguno de tus compaeros, revisa los lbulos de tu oreja. El lbulo de oreja
despegado es dominante (L); las personas con el lbulo pegado tenen el genotpo recesivo
(II). Anota tu fenotpo y genotpo en la tabla 1. Recuerda que si tenes un rasgo dominante,
an no puedes saber si eres homocigoto o heterocigoto, en tal caso, registra L -en la tabla.
2. Con la ayuda de tu compaero, revisa la lnea de tu pelo. El pico de viuda es un rasgo
hereditario que aparece como una saliente triangular de pelo en la frente. Esto se debe
a la presencia de un gen dominante (W). Las personas que tenen la lnea recta del pelo
tenen el genotpo recesivo (ww). Anota tu fenotpo y genotpo en la tabla 1.
3. Un gen dominante (F) da la capacidad de separar el dedo pulgar del ndice formando un n-
gulo de 90. Las personas con los genes recesivos, f, slo forman un ngulo de 45. Observa
la separacin entre tus dedos ndice y pulgar. Anota tu fenotpo y genotpo en la tabla 1.
Tabla 1. Fenotpos y Genotpos de algunas caracterstcas humanas
Caracterstca Fenotpo Genotpo
Forma del lbulo de la oreja
Forma de la lnea del pelo
Posicin del pulgar
Parte II. rbol genealgico

Un diagrama que muestra la transmisin de un rasgo a travs de varias generaciones en una
familia es llamado rbol genealgico. En la fgura 8.2, la generacin I est representada por
los abuelos, la generacin II, por los hijos y la generacin III, por sus nietos. Estudia el siguien-
te rbol genealgico y aprende los smbolos.
1
1 2 3 4
I
II
III
1
Hermanos
producto del
apareamiento
Apareamiento
2
2
3
3
4
4 5
Clave:
Mujer normal
Hombre normal
Mujer albina
Hombre albino
Figura 8.2 rbol
genealgico.
255
G DGEP
El albinismo en los seres humanos se manifesta en forma de piel y pelo blanco y ojos
rosados. Es causado por un gen defectuoso que codifca a su vez una enzima defectuosa que
partcipa en la sntesis de la melanina (pigmento de la piel). Especfcamente, el albinismo se
presenta solo cuando el individuo tene dos genes defectuosos (recesivos), ya que el gen de la
pigmentacin normal es dominante.
1. Usa la letra D para representar al gen dominante y dd para representar el genotpo
de albinismo.
2. Basndote en el siguiente rbol genealgico, enlista los genotpos de cada individuo en el
cuadro de la izquierda.
Individuo Genotpo
I 1
2
3
4
II 1
2
3
4
III 1
2
3
I
II
III
Hombre
Albino
Piel de
pigmentacin
normal
Mujer
Figura 8.3 rbol genealgico. La pareja de la fotografa representa
a los individuos 2 y 3 de la generacin II. El nio es el individuo 3 de
la generacin III.
1
1
1
2
2
2 3
3
3
4
4
256
Ac:ivioovs ov inov:ovio UAS
Parte III. rbol genealgico para un rasgo
1. En el espacio para dibujo 8.1, construye un rbol genealgico de tu familia para la
caracterstca Pico de viuda (W). Elabralo de dos generaciones (tus padres, t y tus
hermanos).
Dibujo 8.1
Anlisis
Basndote en la tabla 1, contesta las primeras 5 preguntas.
1. Cules son las caracterstcas dominantes que encontraste en t mismo?_____________
__________________________________________________________________________
2. Cules recesivos? ________________________________________________________
__________________________________________________________________________
3. Cul es el rasgo ms comn en tu clase?______________________________________
257
G DGEP
4. Cul es el rasgo menos comn en tu clase?____________________________________
5. Podras esperar que el rasgo ms comn sea dominante?________________________
6. En el rbol genealgico de la fgura 8.3, los individuos 2 y 3 tenen tres hijos. Cuntos
son albinos? __________. El albinismo es una caracterstca ______________________.
7. Mediante un cuadro de Punnet cul es la probabilidad de que sean albinos los indivi-
duos 1, 2 y 3 de la III generacin? _____________.
Dibujo 8.2 Cuadro de Punnet.
Conclusin
Anota en los siguientes renglones tus conclusiones.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
258
Ac:ivioovs ov inov:ovio UAS
actividad 9
Cariotpo humano
Habilidades
Observar, deducir, manipular, comparar.
Problema
Cmo se diagnstcan las alteraciones cromosmicas?
Estrategia
Durante esta investgacin aprenders como se elabora un cariotpo humano y su utlidad.
Hiptesis
Los sndromes (Down, Klinefelter, Turner, etc.) se diagnostcan mediante un cariotpo huma-
no. Para elaborarlo, se realiza un estudio citogentco en el cual se cultvan linfocitos (un tpo
de glbulo blanco), se les rompe su membrana nuclear cuando se encuentran en metafase,
para que queden visibles los cromosomas y poder contarlos y acomodarlos de acuerdo a su
tamao y forma en bloques (del A al G).
Materiales
Diapositvas de un cariotpo humano normal y de diversos cariogramas, tjeras y resistol.
Procedimiento
1. Saca una co-
pia a los cario-
gramas de las
pginas 259 y
260. Recrta-
los y pgalos
en los blo-
ques corres-
pondi entes,
guate con el
cariotpo hu-
mano sus cro-
mosomas X y
Y. normal de la
fgura 9.1
Figura 9.1 Cariotpo humano de un varn normal. Observa.
A B
C
1
6
13
2
7
14
3
8
15
4
9
16
5
10
17
11
18
12
19 20
21 22
D E F
G
X
Y
259
G DGEP
Figura 9.1 Cariograma para recortar, pegar y armar el cariotpo en la parte superior. Los cromosomas de color negro
son los sexuales.
23
A B
C
1
6
13
2
7
14
3
8
15
4
9
16
5
10
17
11
18
12
19 20
21 22
D E F
G
260
Ac:ivioovs ov inov:ovio UAS
Figura 9.2 Cariograma para recortar, pegar y armar el cariotpo en la parte superior. Los cromosomas de color negro
son los sexuales.
23
A B
C
1
6
13
2
7
14
3
8
15
4
9
16
5
10
17
11
18
12
19 20
21 22
D E F
G
261
G DGEP
Anlisis
Cariotpo I
1. Cuntos cromosomas son en total? __________.
2. Cuntos son autosomas? __________.
3. Cuntos son cromosomas sexuales? __________.
4. Su cariotpo es ____________________.
5. Por lo tanto, se trata del sndrome de _____________________________________.
Cariotpo II
1. El nmero total de cromosomas es __________.
2. El nmero de autosomas es __________.
3. El nmero de cromosomas sexuales es __________.
4. Su cariotpo es ____________________.
5. Por lo tanto, se trata del sndrome de _______________, sexo __________________.
Conclusin
Basndote en tus observaciones, redacta un prrafo donde expreses en cul de los sndromes
se altera los autosomas y en cual se alteran los cromosomas sexuales.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
262
Ac:ivioovs ov inov:ovio UAS
actividad 10
Genes y relaciones evolutvas
Habilidades
Analizar, comparar, anotar informacin e inferir.
Problema
Puede la secuencia de los genes ser utlizada para llegar a determinar relaciones evolutvas?
Estrategia
Durante esta investgacin, anotars el adn, arnm y las secuencias de aminocidos para la
protena hemoglobina en tres diferentes animales. Tambin comparars las secuencias e in-
ferirs las relaciones evolutvas entre dichos organismos.
Hiptesis
La secuencia de los genes puede ser utlizada para ayudar a determinar relaciones evolutvas
entre organismos.
Materiales
Papel cuadriculado y lpiz.
Procedimiento
1. La fgura 10.1 muestra las secuencias parciales del adn de la protena hemoglobina en un
humano, en un gorila y en un caballo. Convierte las secuencias adn en secuencias arnm.
Escribe cada secuencia ARNm en la hoja de papel cuadriculado que se te proporciona.
Humano
GCAGAGGAACCGCTACAAGAGCATACGCAAGAG
CGGGTAGTAAAACCATACCTTAAATGGGG
GGGCCACCTTCGGCGGATACTCTTTCAA
Gorila
GAGGAGGAACCGCTACAAGAGCATACGCAA
GAACGCGTAGTAAAACCATACCTTAAATGGGGG
GGCCACCTTCGGCGGATACTCTCTTTCA
Caballo
GCAGAGGAACCGCTACAAGAGCGGGAGCAA
GAACGCGCAGTAAAACCTTACCTAAAATGCGG
GCTTGACCTTCGAAGTATACTCTTTCAT
2. Utliza el cdigo gentco para cambiar las secuencias de arnm en secuencias de amino-
cidos. Escribe la secuencia de aminocidos en papel cuadriculado de tal manera que cada
codn o triplete de arnm se alinee con su respectvo aminocido.
Figura 10.1 Secuencia parcial de un gen de la protena hemoglobina de tres mamferos.
263
G DGEP
3. Encierra en un crculo los tripletes en las secuencias de arnm en el caballo y el gorila que
diferan de los tripletes en la misma posicin de la secuencia del arnm humano. Cuenta
el nmero de tripletes diferentes.
4. Encierra en un crculo los aminocidos de las secuencias de aminocidos en el caballo y
en el gorila que diferan de las secuencias de aminocidos del humano. Cuenta el nmero
de aminocidos diferentes y antalos.
Anlisis
1. Cuntos tripletes difieren entre las secuencias arnm del humano y del gorila?_______.
2. Cuntos tripletes difieren entre las secuencias arnm del humano y el caballo?_______.
3. Cuntos aminocidos del humano son diferentes a los del gorila?__________________.
4. Cuntos aminocidos del humano son diferentes a los del caballo?________________.
5. Cul par de organismos est ms cercanamente relacionado, basado en sus secuencias
de ARNm y de aminocidos?________________________________________________.
Figura 10.2 Cdigo gentco. Para decodifcar un codn,
inicia por el centro del crculo y contnua hacia afuera.
264
Ac:ivioovs ov inov:ovio UAS
arnm
Humano
Aminocidos
Humanos
arnm
Gorila
Aminocidos
Gorila
arnm
Caballo
Aminocidos
Caballo
c g u Arginina c u c Leucina c g u Arginina
265
G DGEP
Conclusin
Escribe un prrafo con tu conclusin. Apyate con tus observaciones.
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
______________________________________________________________________________
267
Bibliografa
l Alexander, P.; Bahret, M.J. et al. Biologa. Estados Unidos: Prentce Hall, 1992.
l Arsuaga, J.L. Cuando salimos de frica. Muy Interesante. Num. 19, 1998.
l Audesirk, T. y Audesirk, G. Biologa 1. Unidad en la diversidad. 4
ta
edicin. Mxico: Prentce
Hall, 1996.
l Audesirk, T. y Audesirk, G. Biologa3. Evolucin y Ecologa. 4
ta
edicin. Mxico: Prentce
Hall, 1998.
l Audesirk, T.; Audesirk, G.y Byers, B.E. Biologa. Ciencia y naturaleza. Mxico: Pearson, 2004.
l Avers, Charlote J. Biologa celular. Mxico: Iberoamericana,1995.
l Campbell, N.A. et al. Biologa. Conceptos y relaciones. 3
ra
edicin. Mxico: Pearson Educa-
cin, 2001.
l Cerril, Knot. Orangutanes al natural. Natonal Geographic en espaol. Vol 3, Nm.2, agos-
to de 1998.
l Coperas, E.M. Esto es un hombre. Los 18 minerales de la vida. Muy Interesante. Mxico:
ao XIV, nm. 3, febrero 1995.
l Currie, P. J. The Great Dinosaur Egg Hunt. Natonal Geographic en ingls. Vol 189, nm.
5, 1996.
l Curts, H. et al. Biologa. Espaa: Mdica Panamericana, 2000.
l Curts, H. et al. Invitacin a la Biologa. 6
ta
edicin, Buenos Aires: Mdica panamericana,
2006.
l El mundo de la Biologa, tomo 2. Barcelona: Ocano- xito, 1985.
l Enciclopedia juvenil Grijalvo. Biologa tomo 2. Barcelona: ediciones Grijalbo, 1981.
l Essenfeld, B.E.;Gontang, C.R. y Moore, R. Biology. California: Addison- Wesley, 1994.
l Fachini F. Origen y Evolucin. El hombre. Miln: Jaca Book spa, 1994.
l Freeman, Scot. Biologa. 3
ra
edicin. Madrid: Pearson Educacin, 2009.
l Fried, H.G. Biologa. Mxico: McGraw Hill, 1995.
l Garassino, A. Origen y Evolucin. La vida. Miln: Jaca Book spa, 1994.
l Holgun, Z. G. Mapa completo del genoma humano. La jornada, lunes en la ciencia, 17 de
abril de 2000.
l Holloway, M. Profle: Mary Leakey. Scientfc American. Octubre de 1994.
l Lachtermacher, Triunfo I M. La evolucin es cosa de tu cabeza. Cmo ves? Mxico:
UNAM, ao 4, nm.45, agosto de 2002.
268
BiniioovrI UAS
l Lehninger, et al. Principios de Bioqumica. 3
ra
edicin. Omega, 2000.
l Lewontn, R.C. La adaptacin. Investgacin y Ciencia. Noviembre de 1978.
l Mader, S. Biology. 9
na
edicin. Estados Unidos: McGraw Hill, 2007.
l Margulis, L. y Schwartz, K. V. The Five Kingdoms. A Ilustrated Guide o the Phyla of life on
Earth. 3
ra
Nueva York: Freeman, 1999.
l Martnez, M.; Corts, L. y Lujn, E. Maravillas de la biologa 2. Mxico: McGraw Hill, 2006.
l Mayr, E. Madrid: Debate, 1998.
l Miller, K. y Levine, J. Biologa1. La naturaleza de la vida. Mxico: Pearson Educacin, 2007.
l Miller, K. y Levine, J. Biologa. Estados Unidos: Pearson Prentce Hall, 2004.
l Miller, K. y Levine, J. Biologa. Estados Unidos: Pearson Prentce Hall, 2010.
l Oram, R. F. Biology. Living Systems. Ohio: Glencoe/ Macmillan/ McGraw Hill, 1994.
l Oto, J.H. y Towle, A. Biologa moderna. Mxico: McGraw Hill, 1995.
l Ruiz, R. y Ayala, F.J. El mtodo en las ciencias. Epistemologa y Darvinismo. Mxico: Fondo
de Cultura Econmica, 1998.
l Sherman, I.W. y Sherman, V.G. Biologa. Perspectva Humana. Mxico: McGraw Hill, 1994.
l Solomon, E. P.; Ville, C.A. y Davis, P. W. Biologa. Mxico Interamericana, 1987.
l Solomon, E.; Berg, L. y Martn, D. Biologa. 8
va
edicin. China: McGraw Hill Interamericana,
2008.
l Solomon, E. P; Berg, L. y Martn, D. Biologa. 5
ta
edicin. Mxico: McGraw Hill Interamerica-
na, 2001.
l Starr, C. y Taggart, R. Biologa. Unidad y diversidad de la vida. Mxico: Thomson editores,
2004.
l Vzquez Conde, R. Biologa 1. Mxico: Publicaciones Cultural, 1999.
l Ville, Claude A. Biologa. Mxico: McGraw Hill, 1997.
269
Procedencia de las ilustraciones
Unidad 1
Figura 1.1, 1.4 y 1.6 tomadas de Miller, K. y Levine, J. Biologa.
Figura 1.3 tomada de Essenfeld-Gontand-Moore, Biology.
Fiigura 1.7 tomada de Heimler-Daniel-Lockard, Facus on life science.
Figura 1.8 tomada de calendario 2010 Planeta Tierra/BBC.
Figura 1.9 tomada de Audesirk, T. y Audesirk, G. Biologa 3. Evolucin y Ecologa.
Figura 1.10 tomada de Audesirk, T. y Audesirk, G. y Byers, B.E. Biologa. Ciencia y naturaleza.
Figura 1.1 tomada de Oram, R.F. Biology. Living Systems.
Figuras tomadas de internet
Figura de portadilla htp://www.bioparcvalencia.es/site/wp-content/uploads/2011/10/Bioparc-
Valencia-Jirafas-recorriendo-la-Sabana-octubre-2011.jpg
Fiigura 1.2 htp://abusoinfantl-pediatriasocial.blogspot.mx/2011/11/vacunas.html
Figura 1.5 htp://sabiduriainutl.fles.wordpress.com/2009/05/1243540607489edit.jpg
Unidad 2
Figura de portadilla tomada Miller, K. y Levine, J. Biologa.
Figuras 2.1 y 2.4 tomadas de Oram, R.F. Biology. Living Systems.
Figuras 2.2, 2.3, 2.8, 2.15, 2.16 y 2.18 tomadas de Audesirk, T. y Audesirk, G. Biologa1.
Figura 2.5 tomada de Miller, K. y Levine, J. Biologa.
Figura 2.6 tomada de Freeman, S. Biologa.
Figura 2.7 tomada de Curts, H. y Barnes, S. Biologa.
Figura 2.9 tomada de Campbell, N. A. Biologa.
Figuras 2.10, 2.11 y 2.12 tomadas de Audesirk, T. y Audesirk, G. Biologa1.
Figuras 2.13 y 2.14 tomadas de Mader, S. Biology.
Figuras tomadas de internet
Figura 2.17 htp://dalsgaard.eu/2009-04.Mexico/2009-04-06.077.Mexico.Villahermosa.La.Venta.
Tucan.PS2.jpg
Figuras 2.19 y 2.20 htp://1.bp.blogspot.com/_Og1JC2lq7dw/TPAQ833nWuI/AAAAAAAAAAY/lg-
CH2IVEKrY/s1600/arn-y-adn.jpg
htp://www.fsicanet.com.ar/biologia/introduccion_biologia/ap1/nucleotdos_y_acidos_nuclei-
cos02.jpg
270
Pvocvovci ov is iius:vciovs UAS
Unidad 3
Figura de portadilla tomada de Miller, K. y Levine, J. Biologa.
Figura 3.2 tomada de Enciclopedia Juvenil Grijalbo. Biologa.
Figura 3.3 tomada de Cronquist, A. Botnica bsica.
Figura 3.4 y 3.5 tomadas de Starr, C. y Taggart, R. Biologa. Unidad y diversidad de la vida.
Figura 3.6 adaptada de Curts, H. et al. Biologa y Alexander, P. Biologa.
Figuras 3.1, 3.7, 3.21, 3.22, 3.24, 3.29, 3.31, 3.32, 3.34, 3.39 y 3.42 tomadas de Audesirk, T. y
Audesirk,G. Biologa 1. Unidad en la diversidad.
Figutas 3.9, 3.10 y 3.57 tomadas de Audesirk, T.; Audesirk, G.y Byers, B.E. Biologa. Ciencia y na-
turaleza.
Figuras 3.8, 3.15, 3.38 y 3.45 tomadas de Curts, H. y Barnes, S. Biologa.
Figura 3.11 tomada de Alexander, P.Biologa/ Sherman-Sherman. Biologa. Perspectva humana/
Starr, C. y Taggart, R. Biologa. Unidad y diversidad de la vida.
Figuras 3.13 y 3.16 tomadas de Essenfeld-Gontand-Moore, Biology.
Figuras 3.17, 3.18, 3.19, 3.20, 3.23, 3.27, 3.28 y 3.33 tomadas de Oram, R.F. Biology. Living Sys-
tems.
Figuras 3.25, 3.36, 3.41, 3.50. 3.51, 3.52 y 3.54 tomadas de Miller, K. y Levine, J. Biologa.
Figura3.30 tomada de Solomon, Berg, Martn. Biologa, 8 edicin.
Figura 3.40, 3.43,y 3.47 tomadas de Mader, S. Biology.
Figura 3.48 tomada de Alexander, P. et al. Biologa.
Figuras 3.53 y 3.56 tomadas de Miller, K. y Levine, J. Biologa1. La naturaleza de la vida.
Figura 3.55 tomada de Curts, H. et al. Invitacin a la Biologa.
Figuras tomadas de internet
Figura 3.3 htp://upload.wikimedia.org/wikipedia/commons/7/78/Mathias_Jakob_Schleiden_
Litho.jpg
Figura 3.12 htp://f3rnandofores.site50.net/blog/wp-content/uploads/2011/08/EscherichiaCo-
li_NIAID.jpg
htp://mycozynook.com/4_1parameciumSEM.jpg
htp://www.bewie.de/Suchbar/Monatsbilder/Images/1008_Stentor1.JPG
htp://www.lareserva.com/home/fmage/dia01.jpg
Figura 3.14 htp://fickrhivemind.net/Tags/greenalgae/Interestng
Figura 3.37 htp://www.edukatvos.com/preparatoria/el-citoplasma-y-el-citoesqueleto.html
Figura 3.44 htp://neetciencia.com/las-plantas-pueden-sentr/
271
Pvocvovci ov is iius:vciovs DGEP
Unidad 4
Figura de portadilla de Starr, C. y Taggart, R. Biologa. Unidad y diversidad de la vida.
Figura 4.1 y 4.37 tomadas de Miller, K. y Levine, J. Biologa1. La naturaleza de la vida.
Figuras 4.2, 4.3, 4.4, 4.5, 4.11, 4.12, 4.13, 4.15, 4.19, 4,21, 4.24, 4.25, 4.27, 4.28, 4.33, 4.35 y 4.39
y tabla 4.1 tomadas de Oram, R.F. Biology. Living Systems.
Figura 4.6 adaptada de Alexander, P. et al. Biologa.
Figuras 4.8, 4.16 y 4.17 adaptadas de Oram, R.F. Biology. Living Systems.
Figura 4.7 tomada de Essenfeld-Gontand-Moore, Biology.
Figuras 4.9, 4.10 y 4.14 adaptadas de Essenfeld-Gontand-Moore, Biology.
Figura 4.22 tomada de Coperias, A.M. Muy interesante.
Figuras 4.23 y 4.29 tomadas de Miller, K. y Levine, J. Biologa1. La naturaleza de la vida.
Figuras 4.26 y 4.30 tomadas de Oto, S.H. y Towle, A. Biologa moderna.
Fiiguras 4.36, 4.37 y 4.40 tomadas de Audesirk, T.; Audesirk, G.y Byers, B.E. Biologa. Ciencia y
naturaleza.
Figura 4.31 tomada de Alexander, P.et al. Biologa.
Figura 4.38 tomada de Freeman, Scot. Biologa.
Figura 4.39 y 4.41 tomadas de Miller, K. y Levine, J. Biologa.
Figuras tomadas de internet
Figura 4.18 htp://www.originalstore.it/prodot/MICROBI-OVULO/MICROBI-OVULO_3318.jpg
htp://www.telefuerza.com/sabias_que/archivos/c3feda_espermatozoide%205.jpg
Unidad 5
Figura de portadilla tomadas de Currie, P.J. Natonal Geographic en ingls.
Figura 5.1 y 5.19 tomada de Currie, P.J. Natonal Geographic en ingls.
Figuras 5.2, 5.6, 5.8, 5.14, 5.26, 5.34 y 5.40 tomadas de Oram, R.F. Biology. Living Systems.
Figura 5.3 tomada de Qu quieres saber de la ciencia? tomo IV, 1 edicin, Editorial Ocano.
Figura 5.5 tomada de Curts, H. et al. Invitacin a la Biologa.
Figura 5.9 tomada de Garassino, A. Origen y Evolucin. La vida.
Figura 5.10 tomada de Sherman, I. W y Sherman V.G. Biologa. Perspectva Humana.
Figura 5.11 tomada de Miller, K. y Levine, J. Biologa. Biologa III. Evolucin y Ecologa.
Figura 5.12 Adaptada de Curts, H. et al. Invitacin a la Biologa y Mader, S. Biology.
Figura 5.13, 5.15 y 5.42 tomadas de Mader, S. Biology.
Figura 5.16 tomada de Essenfeld-Gontand-Moore, Biology/ de Oram, R.F. Biology. Living Sys-
tems/ Solomon, Berg, Martn. Biologa, 8 edicin.
Figura 5.17, 5.18 y 5.21 tomadas de Enciclopedia Juvenil Grijalbo.
272
Pvocvovci ov is iius:vciovs UAS
Biologa bsica, de Alma Rebeca Galindo Uriarte, Roberto C. Avendao y Amada Aleyda Angulo Rodrguez.
Se termino de imprimir en el mes de mayo del 2012, en los talleres de servicios editoriales once
ros, Ro Usumacinta No. 821, Col. Industrial Bravo, 7 12-29-50. Culiacn, Sinaloa.
Tiraje: 19,000 ejemplares.
Figura 5.20 tomada de Alexander, P. et al. Biologa.
Figura 5.22 tomada de Alexander, P. et al. Biologa/ Mader, S. Biology.
Figura 5.23 y 5.43 tomada de Solomon, Berg, Martn. Biologa, 8 edicin.
Figura 5.24 tomada de Ville, C. Biologa.
Figura 5.25, 5.28 y 5.44 tomadas de Audesirk- Audesirk- Byers, B.E. Biologa. Ciencia y naturaleza.
Figura 5.29 tomada de Lewontn R.C. en Investgacin y ciencia. Nov., 1978.
Figuras 5.41 tomadas de Sherman-Sherman. Biologa. Perspectva humana.
Figuras 5.35, 5.36 y 5.39 tomadas de Fichini, F. Origen y Evolucin. El hombre.
Figura 5.37 tomada de Holloway, M. revista Scientfc American, 1994.
Figua 5.38 tomada de Arsuaga, J. revista Muy interesante, No. 19, 1998.
Figuras tomadas de internet
Figura 5.7 htp://ftopasion.blogspot.mx/2012/01/los-fosiles-mas-antguos-del-mundo.html
Figura 5.14 htp://www.lessing-photo.com/dispimg.asp?i=39180169+&cr=13&cl=1
Figura 5.27 htp://en.wikipedia.org/wiki/File:Friendly_Male_Koala.JPG
http://www.taringa.net/posts/ecologia/11163060/especies-en-via-de-extincion-mas-causas.
html
Fugura 5.30 htp://upload.wikimedia.org/wikipedia/commons/thumb/9/93/Ring.tailed.lemur.
situp.arp.jpg/442px-Ring.tailed.lemur.situp.arp.jpg
Figura 5.31 htp://upload.wikimedia.org/wikipedia/commons/e/ec/Tarsier_Hugs_Mossy_
Branch.jpg
Figura 5.32 htp://www.natura-digital.com/backup/index.php/javascript/historia-natural/94-
fauna/125-los-monos-ateles
Figura 5.33 htp://virunga.webs.com/CAK96B0P.jpg
htp://cometvedo.fles.wordpress.com/2008/07/gorila.jpeg
htp://www.animalesextncion.es/images/notcias/1610080113_chimpance.jpg
htp://www.fotonatura.org/revista/fotos/issue25/GIBON.jpg
Figura 5.43 htp://4.bp.blogspot.com/_HZ-TNJec_BY/S8p7KnWhWQI/AAAAAAAABck/W3bK-
smeIAuU/s1600/51-Lascaux.jpg
Portadilla de Actvidades de laboratorio
htp://i00.i.aliimg.com/img/pb/952/703/303/303703952_736.jpg