0 évaluation0% ont trouvé ce document utile (0 vote)
72 vues7 pages
A real-time PCR-based amelogenin Y (AMELY) allele dropout assessment model in gender typing of degraded DNA samples. Allelic dropout due to stochastic variation in degraded small quantity DNA appears to be one of the most serious genotyping errors.
A real-time PCR-based amelogenin Y (AMELY) allele dropout assessment model in gender typing of degraded DNA samples. Allelic dropout due to stochastic variation in degraded small quantity DNA appears to be one of the most serious genotyping errors.
A real-time PCR-based amelogenin Y (AMELY) allele dropout assessment model in gender typing of degraded DNA samples. Allelic dropout due to stochastic variation in degraded small quantity DNA appears to be one of the most serious genotyping errors.
assessment model in gender typing of degraded DNA samples Kyung-Yong Kim & Younghyuk Kwon & Munkhtsetseg Bazarragchaa & Ae-Ja Park & Hyowon Bang & Won-Bok Lee & Junyoung Lee & Kwang-Ho Lee & Bum-Joon Kim & Kijeong Kim Received: 13 October 2011 / Accepted: 20 December 2011 / Published online: 12 January 2012 #Springer-Verlag 2012 Abstract Allelic dropout due to stochastic variation in de- graded small quantity DNA appears to be one of the most serious genotyping errors. Most methods require PCR rep- lication to address this problem. The small amounts of valuable samples are often a limitation for such replications. We report a real-time PCR-based amelogonin Y (AMELY) allele dropout estimation model in an AMEL-based gender typing. We examined 915 replicates of AMELY-positive modern male DNA with varying amounts of DNA and humic acid. A male-specific AMEL fragment (AMELy) dropped out in 143 genuine male replicates, leading to gender typing errors. By graphing a scatter plot of the crossing point versus the end cycle fluorescence of the male replicates, a standard graph model for the estimation of Electronic supplementary material The online version of this article (doi:10.1007/s00414-011-0663-5) contains supplementary material, which is available to authorized users. K.-Y. Kim : A.-J. Park : H. Bang Institute for Medical Sciences, Chung-Ang University, Seoul 156-756, South Korea Y. Kwon : M. Bazarragchaa Department of Microbiology, College of Medicine and Medical School, Chung-Ang University, Seoul 156-756, South Korea K.-Y. Kim : W.-B. Lee Department of Anatomy, College of Medicine and Medical School, Chung-Ang University, Seoul 156-756, South Korea A.-J. Park Department of Laboratory Medicine, College of Medicine and Medical School, Chung-Ang University, Seoul 156-756, South Korea H. Bang Department of Physiology, College of Medicine and Medical School, Chung-Ang University, Seoul 156-756, South Korea K.-H. Lee Department of Life Science, College of Natural Science, Chung-Ang University, Seoul 156-756, South Korea J. Lee The Hun School of Princeton, Princeton, NJ 08540, USA B.-J. Kim Department of Microbiology, College of Medicine, Seoul National University, Seoul 110-799, South Korea K. Kim (*) Institute for Medical Sciences, College of Medicine and Medical School, Chung-Ang University, 221, Heukseok-dong, Dongjak-gu, Seoul 156-756, South Korea e-mail: kimkj@cau.ac.kr K. Kim Department of Microbiology, College of Medicine and Medical School, Chung-Ang University, 221, Heukseok-dong, Dongjak-gu, Seoul 156-756, South Korea Int J Legal Med (2013) 127:5561 DOI 10.1007/s00414-011-0663-5 the AMELy allele dropout was constructed with the dropout-prone and dropout-free zones. This model was then applied to ancient DNA (aDNA) samples. Nine samples identified as female were found in the dropout- prone zone; with higher DNA concentrations, six were shifted to the dropout-free zone. Among them, two female identifications were converted to male. All the aDNA gender was confirmed by sex-determination region Y marker amplification. Our data suggest that this model could be a basic approach for securing AMELy allele dropout-safe data from the stochastic variation of degraded inhibitory DNA samples. Keywords AMELYalleledropout . Ancient bone . Real-time PCR . Melting curve analysis . Amelogenin Introduction DNA analysis of degraded or ancient samples suffers from reduced reproducibility due to DNA degradation, contami- nation with other DNA, and the presence of PCR inhibitors [1]. These conditions severely increase the probability of a genotyping error [2]. Stochastic variation results in a loss of the true signals: heterozygote peak imbalance and increased stutter products and a gain of false signal; allele dropout and contamination (drop-in) [3]. The most frequent error reported is allelic dropout [4]. Contamination can be con- trolled by following stringent laboratory protocols and the inclusion of multiple negative controls. False alleles are considerably less frequent and often show an unusual spec- tral pattern. In contrast, an allele that has dropped out leaves no trace of itself in the genotype data [5]. Despite many methods introduced to overcome these problems [1, 6, 7], exaggerated stochastic sampling effects still occur [8]. This stochastic fluctuation makes interpreta- tion of the data problematic. When PCR inhibition is sus- pected, dilution of the extracts is often an undesirable application involving the highly degraded or otherwise low-copy templates and is sometimes impossible due to further reduction of the template amounts [9]. In this study, we present a comprehensive real-time PCR-based approach to estimate the amelogonin Y (AMELY) allele dropout in degraded and low amount DNAs with PCR inhibitors. We introduce a laboratory standard graph model plotted with two variables, crossing point (CP) and end cycle fluores- cence (ECFL), for dropout. The CP is defined as the point at which the fluorescence rises appreciably above the back- ground fluorescence. The ECFL is defined as the fluores- cence at the final cycle of amplification. The standard model will be a useful guide for the quick tracing of allele dropout data and securing dropout-safe results in AMEL-based gen- der typing of degraded samples. Materials and methods Modern and ancient human DNA samples A total of 50 modern DNA samples and 100 ancient DNA (aDNA) samples were used in this study. The aDNA was extracted twice from different fragments of ten ancient hu- man bones excavated from Mongolia and Korea and aged 10010,000 years (ESM 1). Single extractions were carried out for 90 ancient human bones excavated from Mongolia, Korea, and Uzbekistan and aged 105,000 years (ESM 1). We strictly followed a previously described protocol for aDNA extraction [1, 10]. Real-time PCR Gender was determined based on the melting temperature (T m ) difference of AMEL amplicons produced using pri- mers that co-amplify large fragments of AMELX (184 bp) and AMELY (190 bp) and a small Y-specific fragment of AMELY (AMELy, 92 bp). AMELy binds specifically to a 6- bp insertion present only in Y-DNA (Table 1). Real-time PCR was performed using the LightCycler system (version 2.0) (Roche). Reactions were performed with at least dupli- cate samples in 5 l reaction mixtures containing 2 l template DNA, 1 l 5x LightCycler FastStart DNA Master- PLUS SYBR Green I reagent (Roche), 0.15 M AMEL- specific forward primer (F_amXY), 0.8 M AMELY- specific forward primer (F_amY), 0.8 M AMEL-specific reverse primer (R_amXY), 0.9 mg/ml BSA (Ambion), and DNA/DNase-free deionized water. A 3-l aliquot of the master mix was placed in the capillaries using an elec- tronic pipet, and 2 l template DNA was added and slowly mixed three times. Cycling conditions were pre- incubation for 15 min at 95C and 45 cycles of 10 s at 95C, 20 s at 56C, and 30 s at 72C. Melting curves were generated by measuring the fluorescence signal while raising the temperature as follows: 10 s at 95C, 1 min at 70C, and an increase from 70C to 90C at a rate of 0.05C/s. The T m was measured using Light- Cycler software V 4.05. T m s of AMEL amplicons pro- duced from modern male and female DNA templates were estimated by calculations with LC PDS (version 2.0) software before real-time PCR (Table 1). To quantify the number of amelogenin DNA mole- cules in the DNA samples, tenfold serial dilutions (from 510 6 to five copies) of purified male (195 and 201 bp) and female (195 bp) amelogenin PCR products that were quantified by a NanoPhotometer (IMPLEN) were tested to generate a standard curve. The PCR conditions have been described previously [10]. Standard curves showing trendline correlation coefficients greater than 0.95 were used (ESM 2). 56 Int J Legal Med (2013) 127:5561 Plotting an allele dropout estimation model with CP and ECFL To test the sensitivity and reproducibility of the real-time PCR method, modern male and female DNA samples were serially diluted with different amounts of humic acid. A total of 915 male and 135 female DNA replicates were tested. By graphing a scatter plot of CP versus ECFL values of the male replicates, a model of AMELy drop-out prone and drop-out free zones was constructed. Table 1 Primers used for the detection of amelogenin fragments and calculated melting temperatures (T m s) of products Primer a Product Name Sequence (53) T m (C) b Target Size (bp) T m (C) b F_amXY GGTTATATCAACTTCAGCTATGAG 56.6 AMELX 184 79.1 AMELY 190 79.5 F_amY GGATTCTTCATCCCAAATAAAGT 57.1 AMELy 92 77.7 R_amXY GCCAACCATCAGAGCTTAAAC 60.8 AMELX AMELY AMELX large fragment of amelogenin gene on X chromosome, AMELY large fragment of amelogenin gene on Y chromosome, AMELy male- specific small fragment of amelogenin gene on Y chromosome a Kim et al. [1] b Calculated by using LC PDS software (version 2.0) 68.3% 46.7% Humic acid 0 ng 0% 20% 40% 60% 80% 100% 100-1000 50 20 10 Template (pg) Failed y-dropout y + X/Y 60 60 0 6 0 6 23.3% Template 50 pg 0% 20% 40% 60% 80% 100% 0 200 300 400 Humic acid (ng) Failed y-dropout y X/Y 30 30 5 1 0 6 Template 20pg 0% 20% 40% 60% 80% 100% 0 25 50 100 150 200 300 400 500 Humic acid (ng) Failed y-dropout y X/Y 15 30 5 1 0 6 60 0 6 0 6 60 60 Template 10pg 0% 20% 40% 60% 80% 100% 0 25 50 100 150 200 300 400 500 Humic acid (ng) Failed y-dropout y X/Y 15 15 5 1 0 6 60 5 1 0 6 30 30 30% 30% Fig. 1 Amelogenin real-time PCR sensitivity in male gender determi- nation with different amounts of male DNA templates and humic acid (HA). The male-specific small amelogenin amplicon (y) dropped out with template amounts less than 50 pg for about 30% of the replicates without HA and for about 18% with HA. PCR failures often occurred with the smallest amounts of templates or the largest amounts of HA. X/Y, large amelogenin amplicon of X chromosome and/or Y chromo- some; y, male-specific small amelogenin amplicon Int J Legal Med (2013) 127:5561 57 Gender determination of aDNA samples Gender determination using amelogenin could be erroneous [1115]. We determined gender by three independent meth- ods, the amelogenin real-time PCR, a sex-determination region Y (SRY) PCR [16], and a method using an ABI PRISM 310 automatic sequencer with AmpFlSTR Mini- filer
PCR Amplification Kit (ABI). Single extracts of 90
aDNA samples were analyzed at least in duplicate by real- time PCR and SRY PCR. Results and discussion The CP and ECFL values obtained from the AMEL real-time PCR with male DNA samples were used to graph a standard scatter plot with experimentally iden- tified gender and to delineate the Y allele dropout-free and dropout-prone zones. When a test sample generated a female result with a CP/ECFL value entering the Y allele dropout-prone zone of the standard graph, the gender determination was considered unreliable. The real-time PCR with a more concentrated sample DNA could shift the CP/ECFL spot from the unreliable zone to the reliable zone; this might convert the female identification to male. T m s for gender determination and AMELy dropout Only a single distinct T m (79.980.5C) of the large AMELX fragment was identified for 120 female replicates by real-time PCR (ESM 1; ESM 2). The clear differentiation of T m s of AMELX/Y (80.080.6C) and AMELy (77.9 Humic acid 0 ng 0 5 10 15 20 25 30 35 40 45 1000 100 50 20 10 Template (pg) C P 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 E C F L CP ECFL (30/30) (30/30) (60/60) (59/60) (46/60) Template 50 pg 0 5 10 15 20 25 30 35 40 45 0 200 300 400 Humic acid (ng) C P 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 E C F L CP ECFL (30/30) (30/30) (15/15) (0/15) Template 20 pg 0 5 10 15 20 25 30 35 40 45 0 25 50 100 150 200 300 400 500 Humic acid (ng) C P 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 E C F L CP ECFL (59/60) (58/60) (25/30) (58/60) (59/60) (6/15) (57/60) (58/60) (0/15) Template 10 pg 0 5 10 15 20 25 30 35 40 45 0 25 50 100 150 200 300 400 500 Humic acid (ng) C P 0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 E C F L CP ECFL (46/60) (10/15) (10/15) (52/60) (52/60) (7/15) (25/30) (25/30) (0/15) Fig. 2 Crossing point (CP) and end cycle fluorescence (ECFL) values produced by replicated real-time PCR with various amounts of tem- plate DNA and humic acid. CP was inversely proportional to DNA amount but was directly proportional to HA amount. ECFL values were inversely proportional to the amount of HA Fig. 3 A standard graph model for the estimation of AMELy dropout of unknown DNA samples (a) and its application to ancient DNA samples (b). a Values of CP versus ECFL of the gender data deter- mined by real-time PCR from the male replicates were plotted to define the dropout-prone (shaded) and dropout-free (not shaded) zones. b The female gender of nine aDNA samples (20 replicates) was located in the dropout-prone zone based on this model, and the concentration of six unreliable samples shifted the coordinates to the dropout-free zone. The genders of three replicates were converted from female to male (big arrow) b 58 Int J Legal Med (2013) 127:5561 Int J Legal Med (2013) 127:5561 59 78.5C) for the male identification was possible regardless of the amount of humic acid. Humic acid decreased the AMEL T m s only slightly. The T m of AMELy was detectable even though those of AMELX/Y were not detected at higher levels of humic acid. A blind gender test of all 50 modern human DNAs showed consistent results with the phenotype (ESM 2). AMELy dropout began to occur in male templates with less than 50 pg DNA and at a CP range higher than 34, regardless of the amount of humic acid (ESM 1; Fig. 1). For 10- and 20-pg male DNA without humic acid (120 repli- cates), AMELy dropped out in 37 male replicates, and thus, the gender was falsely determined as female. There was no significant change in the rate of AMELy dropout for varying amounts of humic acid. Frequent AMELy dropouts and PCR failures were observed for the decreased amounts of DNA. AMELy allele dropout estimation model The CP was inversely proportional to the amount of DNA but was proportional to the amount of humic acid; ECFL was inversely proportional to the amount of humic acid (Fig. 2 and ESM 2). The CP was also proportional to the AMELy dropout rate in the male templates (ESM 1). When humic acid was added to the templates, the CP ranges in which the AMELy dropout was not observed were expand- ed (ESM 1). These data suggested that humic acid increased the reliable range of CP. For example, the female gender results with 20 pg DNA and CP 35 were not reliable if the template had no humic acid but were reliable if the template contained 25 ng humic acid (ESM 1). It thus appeared that the amount of humic acid, which could be estimated by ECFL, should be considered to determine the reliable range of CP. We used CP and ECFL values to build a novel standard graph model for the estimation of the male-specific allele dropout in the gender determination of unknown aDNA samples (Fig. 3a). The dropout-prone zone of the plot was delineated by the CP/ECFL values of the false-positively determined female data due to the AMELy dropout from male DNA replicates. The dropout-free zone was deter- mined by those of the correctly determined male data with- out the AMELy dropout. This model may be used for the prediction of AMELy allele dropout of an unknown sample with the given CP and ECFL values. Gender determination of aDNA samples with the model The AMEL real-time PCR gender data from the duplicate extracts of nine aDNA samples except for one sample (MN128) were all within the dropout-free zone (ESM 1 and ESM 2). There were no conflicting results among the three gender typing methods (ESM 1). Low ECFL values of aDNA samples indicated a large amount of PCR inhibitors. The CP did not reflect the aDNA amount because of the interference of PCR inhibitors. Supposing that there was no PCR inhibition in these ten aDNAs, the copy numbers would range from 0.9 to 87.3. The real-time PCR-based gender of one aDNA sample (MN128) showed both genders from each extract. The female CP/ECFL spots were in the dropout-prone zone. The results of the other methods were also inconsistent. Real-time PCR of the concentrated sample shifted the spots to the dropout-free zone, converting it from female to male; the SRY marker was also amplified. From single extractions of 90 ancient human bones, female identification of nine aDNA samples was unreliable because their CP/ECFL spots were in the dropout-prone zone. Upon concentration, the spots of six aDNA samples shifted to the reliable range, and two were identified as male (Fig. 3b). To our best knowledge, this study is the first report of gender determination based on a melting curve analysis and of an allele dropout estimation standard model, which can- not be achieved with conventional PCR. At present, the recommended way to solve the stochastic variation problem is simply based on replicated PCR. The advantages of our method come from real-time PCR technology, which is rapid, sensitive, quantitative, and DNA- and labor-saving. Our method, however, has some limitations. First, it depends on the PCR product T m s, so the gender determina- tion could be difficult for aDNAs with an ambiguous T m s. In these cases, probe-based methods or nested PCR methods can be used. Second, each laboratory should set up its own model with CP and ECFL if other real-time PCR conditions are used. Third, the sizes of AMELX/Y fragments might be too big for the degraded DNA analysis. However, they are not larger than the maximum size in the STR analysis kits developed for the degraded DNA samples. Lastly, gender determination is based on the amelogenin locus, which is reported to be unreliable. Therefore, the sole use of our method is not appropriate for gender determination. In conclusion, we have developed a method and model applicable to the assessment of the AMELy allele dropout potential for degraded DNAs with/without PCR inhibitors. Further study is required to examine the possible use of our strategy for estimating the allele dropout in short tandem repeat genotyping assays. Acknowledgments We thank Jehyeok Lee and Yeong-mi Chang for their kind assistance in administration work and purchase of laboratory materials. We also thank Jee-hyun Yoon for the maintenance of the real-time PCR system. This research was supported by the Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2010-0021367). 60 Int J Legal Med (2013) 127:5561 Ethical standards All sampling was done according to Korean laws and ethical standards. Conflict of interest The authors declare that there is no conflict of interest. References 1. Kim K, Kim KY, Jeon E, Togloom A, Cho YO, Lee MS, Lkhag- vasuren G et al (2008) Technical note: improved ancient DNA purification for PCR using ion-exchange columns. Am J Phys Anthropol 136:114121 2. Taberlet P, Friffin S, Goossens B, Questiau S, Manceau V, Escaravage N, Waits LP, Bouvet J (1996) Reliable genotyping of samples with very low DNA quantities using PCR. Nucleic Acids Res 24:31893194 3. Cowen S, Debenham P, Dixon A, Kutranov S, Thomson J, Way K (2011) An investigation of the robustness of the consensus method of interpreting low-template DNA profiles. Forensic Sci Int Genet 5:400406 4. Gagneux P, Boesch C, Woodruff DS (1997) Microsatellite scoring errors associated with noninvasive genotyping based on nuclear DNA amplified from shed hair. Mol Ecol 6:861868 5. Miller CR, Joyce P, Waits LP (2002) Assessing allelic dropout and genotype reliability using maximumlikelihood. Genetics 160:357366 6. Hanson EK, Ballantyne J (2005) Whole genome amplification strategy for forensic genetic analysis using single or few cell equivalents of genomic DNA. Anal Biochem 346:246257 7. Strom CM, Rechitsky S (1998) Use of nested PCR to identify charred human remains and minute amounts of blood. J Forensic Sci 43:696700 8. Budowle B, Eisenberg AJ, van Daal A (2009) Validity of low copy number typing and applications to forensic science. Croat Med J 50:207217 9. King C, Debruyne R, Kuch M, Schwarz C, Poinar H (2009) A quantitative approach to detect and overcome PCR inhibition in ancient DNA extracts. Biotechniques 47:941949 10. Kim K, Brenner CH, Mair VH, Lee KH, Kim JH et al (2010) A western Eurasian male is found in 2000-year-old elite Xiongnu cemetery in Northeast Mongolia. AmJ Phys Anthropol 142:429440 11. Jobling MA, Lo IC, Turner DJ et al (2007) Structural variation on the short armof the human Ychromosome: recurrent multigene deletions encompassing amelogenin Y. Hum Mol Genet 16:307316 12. Cadenas AM, Regueiro M, Gayden T, Singh N, Zhivotovsky LA, Underhill P, Herrera RJ (2007) Male amelogenin dropouts: phylo- genetic context, origins and implications. Forensic Sci Int 166:155163 13. Kumagai R, Sasaki Y, Tokuta T, Biwasaka H, Aoki Y (2008) DNA analysis of family members with deletion in Yp11.2 region con- taining amelogenin locus. Leg Med (Tokyo) 10:3942 14. Yong RY, Gan LS, Chang YM, Yap EP (2007) Molecular charac- terization of a polymorphic 3-Mb deletion at chromosome Yp11.2 containing the AMELY locus in Singapore and Malaysia popula- tions. Hum Genet 122:237249 15. Mitchell RJ, Kreskas M, Baxter E, Buffalino L, van Oorschot RA (2006) An investigation of sequence deletions of amelogenin (AMELY), a Y-chromosome locus commonly used for gender determination. Ann Hum Biol 33:227240 16. Drobni K (2006) A new primer set in a SRY gene for sex identification. Int Congr Ser 1288:268270 Int J Legal Med (2013) 127:5561 61
Tumor Suppressor APC Blocks DNA Polymerase - Dependent Strand Displacement Synthesis During Long Patch But Not Short Patch Base Excision Repair and Increases Sensitivity To Methylmethane Sulfonate