TAREA # 1. Entrega por equipo para 12/02/14.

Introducción a la Genómica. Gpo
04.
FA!"TA# #E $!%&IA' !(A&
1. El análisis químico del DNA extraído por primera vez de un virus desconocido indica la
siguiente composición: 4! A" #! $" 1%! &" #%! '. ()u* implicaciones tiene este
resultado en relación a la estructura del DNA vírico+
#,-. 'on la siguiente secuencia de DNA"
trascri.a a /NA:
a0 De acuerdo al código gen*tico" identi1icar el codón de inicio dentro
del 2/3 .0 'ortar la secuencia en codones de tres p. 4asta encontrar
un codón de paro c0 $raducir cada codón en su correspondiente
aminoácido 5aa0
%6,
&&&A$'&A$&''''$$AAA&A&$$$A'A$A$$&'$&&A&&'&$$AA'''
'&&A,76 DNA
'onsidere la anterior secuencia como la secuencia silvestre. A continuación le proporciono
algunas secuencias mutantes de la misma 5%8,780. Diga (qu* tipo de mutación ocurrió" $iene
alg9n e1ecto en la proteína+" sí" cuál+
&&&A$'&A$&''''$$$AA&A&$$$A'A$A$$&'$&&A&&'&$$AA'
'''&&A DNA
&&&A$'&A$&''A'$$AAA&A&$$$A'A$A$$&'$&&A&&'&$$AA'
'''&&A
DNA
&&&A$'&A$&''''$$AAA&A&$$$A'A$A$$&'$&&A&&'&$AAA'
'''&&A
DNA
:. ('uántos ; cuáles son todos los marcos de lectura posi.les de la
secuencia
%<,
A=&A===A'A'==&='A''&A&A=AA'=&
=,7<+
>. ('uál es la secuencia de aminoácidos codi1icada por la secuencia %<,
A=&A===A'A'==&='A''&A&A=AA&AA'=&=,7<+
?. Escri.e la secuencia de /NA que podría codi1icar el siguiente p*ptido: Amino,3,@,3,A,B,
C, car.oxilo
1. A partir del siguiente polip*ptido escri.a la secuencia del /NAm del cual se traduDo.
Arg, 4is,l;s,leu,val,asp,trp
11,17. 'on la siguiente secuencia 4aga lo que se indica:
a0 @intetizar la 4e.ra complementria del DNA
.0 Euscar el 2/3 más largo en am.as 4e.ras" en direción %<,7<
c0 $rascri.a
d0 $raduzca" u.ique extremos car.oxilo ; amino terminales
%6,atgcccaagctgaatagcgtagaggggttttcatcatttgaggacgatgtataa,76
/epasa estos conceptos en: &enetic @cience Fearning 'enter" G$ranscri.e and $ranslate
a &ene"G Learn.Genetics" 71 Decem.er 1?-?"
H 4 t tp: II le a rn .g en e t ic s .ut a 4 .e d u I c o n te n t I.e gi n Id n a I tra n s c ri.e IJ
14. En clase se comentó que la tasa de mutación del genoma mitocondrial es 1 veces ma;or
que la del nuclear en 4umanosK(por qu* es ma;or+ (qu* es la tasa de mutación+
1%. (Lor qu* el análisis de DNA mitocondrial se usa en estudios de ancestría+ D* un eDemplo.
1-,1>. 'on respecto al gen 4umano que codi1ica para la distro1ina" conteste lo siguiente:
a0 Focalización cromosómica
.0 Erevemente" descri.a la 1unción del producto proteico para el que codi1ica.
c0 $amaMo del gen ; la proteína.
d0 A partir de un solo segmento de DNA" ('uántas iso1ormas tiene" dónde se expresan ; por
qu* mecanismos se producen+
e0 (Lor qu* las mutaciones en este gen producen dos cuadros clínicos di1erentes+ 5Distro1ia
muscular tipo Duc4enne ; distro1ia muscular tipo EecNer0 5$ipo de mutación ; 2/30
1?,#. 'omplete la siguiente ta.la" de acuerdo a la 1unción del nc/NA:
R(A Función
miR(
A
)iR(A
)nR(
A
)noR(
A
*I+T
R(A
#1,##. Fa siguiente secuencia corresponde a un gen 4ipot*tico de un organismo cu;o genoma es de
DNA do.le cadena.
• Fas direcciones de las secuencias son %6,76.
• 'onteste las siguientes preguntas:
• ('uántos exones e intrones posee este gen+
• @o.re la secuencia de DNA" encierre en un círculo los sitios donadores ; aceptores de
splicing.
• @o.re la secuencia del /NA" seMale el 2/3 ; con un color di1erente marque las
secuencias que corresponden a %6=$/" 76=$/.
DNA genómico
.......gaaagtggcggtaggcgggagggagaggaacgcgggccctgagccgcccgCGCGCGCGCCTCCCTACGGGCGCCTCCG
GCAGCCCTTCCCGCGTGCGCAGGGCTCAGAGCCGTTCCGAGATCTTGGAGGTCCGGGTGGGAGTGGGGGTGGGGTGGGGGTGGGG
GTGAAGGTGGGGGGCGGGCGCGCTCAGGGAAGGCGGGTGCGCGCCTGCGGGGCGGAGATGGGCAGGGGGCGGTGCGTGGGTCCCA
GTCTGCAGTTAAGGGGGCAGGAGTGGCGCTGCTCACCTCTGGTGCCAAAGGGCGGCGCAGCGGCTGCCGAGCTCGGCCCTGGAGG
CGGCGAGAACATGGTGCGCAGGTTCTTGGTGACCCTCCGGATTCGGCGCGCGTGCGGCCCGCCGCGAGTGAGGGTTTTCGTGGTT
CACATCCCGCGGCTCACGGGGGAGTGGGCAGCGCCAGGGGCGCCCGCCGCTGTGGCCCTCGTGCTGATGCTACTGAGGAGCCAGC
GTCTAGGGCAGCAGCCGCTTCCTAGAAGACCAGGTAGGAAAGGCCCTCGAAAAGTCCGCTGACCATTCTGTTCTCTCTGGCAGGT
CATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACC
CGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCG
ATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGG
CACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGatttattgtcaacatttattgagcacctattacaa
caatttcatcgcatg..........

RNA complementario
CGCGCGCGCCUCCCUACGGGCGCCUCCGGCAGCCCUUCCCGCGUGCGCAGGGCUCAGAGCCGUUCCGAGAUCUUGGAGGUCCGGG
UGGGAGUGGGGGUGGGGUGGGGGUGGGGGUGAAGGUGGGGGGCGGGCGCGCUCAGGGAAGGCGGGUGCGCGCCUGCGGGGCGGAG
AUGGGCAGGGGGCGGUGCGUGGGUCCCAGUCUGCAGUUAAGGGGGCAGGAGUGGCGCUGCUCACCUCUGGUGCCAAAGGGCGGCG
CAGCGGCUGCCGAGCUCGGCCCUGGAGGCGGCGAGAACAUGGUGCGCAGGUUCUUGGUGACCCUCCGGAUUCGGCGCGCGUGCGG
CCCGCCGCGAGUGAGGGUUUUCGUGGUUCACAUCCCGCGGCUCACGGGGGAGUGGGCAGCGCCAGGGGCGCCCGCCGCUGUGGCC
CUCGUGCUGAUGCUACUGAGGAGCCAGCGUCUAGGGCAGCAGCCGCUUCCUAGAAGACCAGGUCAUGAUGAUGGGCAGCGCCCGA
GUGGCGGAGCUGCUGCUGCUCCACGGCGCGGAGCCCAACUGCGCCGACCCCGCCACUCUCACCCGACCCGUGCACGACGCUGCCC
GGGAGGGCUUCCUGGACACGCUGGUGGUGCUGCACCGGGCCGGGGCGCGGCUGGACGUGCGCGAUGCCUGGGGCCGUCUGCCCGU
GGACCUGGCUGAGGAGCUGGGCCAUCGCGAUGUCGCACGGUACCUGCGCGCGGCUGCGGGGGGCACCAGAGGCAGUAACCAUGCC
CGCAUAGAUGCCGCGGAAGGUCCCUCAG
,R-TE%(A
MVRRFLVTLRIRRACGPPRVRVFVVHIPRLTGEWAAPGAPAAVALVLMLLRSQRLGQQPLPRRPGHDDGQRPSGGAAAAPRRGAQ
LRRPRHSHPTRARRCPGGLPGHAGGAAPGRGAAGRARCLGPSARGPG
#7,#4., Onvestigue" cuántos genes con1orman la 1amilia de los genes HOX en el 4umano"
c4impanc* ; en la mosca de la 1ruta+
D* un eDemplo de una 1amilia g*nica clásica ; una s9per 1amilia g*nica en 4umano.
#%,#-. )u* es el nucl*olo" la región organizadora del nucl*olo 5N2/0" cómo está constituida.
Lor qu* algunas c*lulas no tiene nucl*olo ; otrs tienen varios+ 5EDemplos0. En qu* etapa de la
división celular aparece ; desaparece esta estructura.
#:. Diga el tamaMo" n9mero de genes ; aMo en que 1ue secuenciado el genoma de:
E. coli
D. melanogaster
'. elegans
Recuerde .eri/icar la ortogra/0a' la redacción e incluir la 1i1liogra/0a completa que 2a3a
con)ultado.

Sign up to vote on this title
UsefulNot useful