Endometrial inammation and abnormal expression of extracellular

matrix proteins induced by Mycoplasma bovis in dairy cows

Mengyao Guo
a,1
, Guoqing Wang
a, b,1
, Tingting Lv
a,1
, Xiaojing Song
a
, Tiancheng Wang
a
,
Guanghong Xie
a
, Yongguo Cao
a
, Naisheng Zhang
a,
*
, Rongfeng Cao
a, c,
**
a
Department of Clinical Veterinary Medicine, College of Veterinary Medicine, Jilin University, Changchun, Jilin Province, China
b
Institute of Biosciences and Biotechnology, Northeastern University, Shenyang, China
c
College of Animal Science and Veterinary medicine, Qingdao Agricultural University, Qingdao, Shandong, China
a r t i c l e i n f o
Article history:
Received 17 May 2013
Received in revised form 21 September 2013
Accepted 1 October 2013
Keywords:
Dairy cow
Mycoplasma bovis
Extracellular matrix
Endometrial inammation
a b s t r a c t
Mycoplasma bovis infection can cause endometrial inammation leading to infertility and
involuntary culling in dairy cows. Because extracellular matrix (ECM) proteins affect the
adherence of mycoplasma to eukaryotic cell surface, they may play a role in the patho-
genesis of the bacteria. The objective of the present study was to evaluate the endometrial
inammatory response and ECM protein expression induced by M bovis. Endometrial
concentrations of inammatory cytokines tumor necrosis factor (TNF)-a, interleukin
(IL)-1b, IL-6, and mRNA and protein expression of collagen IV (CL-IV), bronectin (FN), and
laminin (LN) were evaluated 10, 20, and 30 days after M bovis intrauterine infusion in
breed cows 18 days postpartum. The presence of the bacteria in the uterus was detected by
nested polymerase chain reaction and denaturing gradient gel electrophoresis. Endome-
trial TNF-a, IL-1b, and IL-6 concentrations in the treatment group were greater (P < 0.05)
than in the positive and negative control groups 20 and 30 days after infusion. Endometrial
CL-IV, FN, and LN mRNA and protein expression increased (P < 0.01) 20 days after infusion
in all groups. However, the increase was more pronounced in the treatment group and
reactive expressions were greater (P < 0.05) than in the positive and negative control
groups 10, 20, and 30 days after infusion. In conclusion, M bovis triggered endometrial
inammatory response and increased CL-IV, FN, and LN mRNA and protein expression. The
abnormal expression of ECM these proteins may promote the pathogenic effects of M bovis
that lead to endometrial tissue damage and infertility.
2014 Published by Elsevier Inc.
1. Introduction
Endometrial inammation induced by bacterial infec-
tion is a signicant pathology that results in decreased
productivity and fertility in dairy cows, which leads to
involuntary culling [13]. Mycoplasma are opportunistic
organisms that might cause ascending uterine infection
after adsorption into the tunica mucosa through skin deep
adhesion factors and related proteins [46]. Mycoplasma-
induced genital system infection has been implicated in
many diseases, such as endometritis, metritis, abortion,
premature rupture of membranes, and premature delivery
[710]. Studies have shown that these diseases might be
result of toxic metabolites released by mycoplasma after
invading the hosts cells [11,12]
The adherence of M bovis to the surface of eukaryotic
cells is a key step in the development of pathopoiesis [13]
and virulence mutants [14,15]. Study have showed that
binding to plasminogen, an extracellular matrix (ECM)
* Corresponding author. Tel./fax: 86 431 87835140.
** Alternative corresponding author. Tel./fax: 86 431 87835140.
E-mail addresses: naisheng.zhang@wur.nl (N. Zhang), qing0001@163.
com (R. Cao).
1
These authors contributed equally to this work.
Contents lists available at ScienceDirect
Theriogenology
j ournal homepage: www. t heri oj ournal . com
0093-691X/$ see front matter 2014 Published by Elsevier Inc.
http://dx.doi.org/10.1016/j.theriogenology.2013.10.004
Theriogenology 81 (2014) 669674
protein, promotes mycoplasma adherence to HeLa cells [16].
Furthermore, expression of host ECMproteins is inuenced
bytheadherence of mycoplasmatotheECM[17]. TheECMin
uterus tissues predominantly contains collagen IV (CL-IV),
bronectin (FN), and laminin (LN) [18]. These proteins play
animportant roleintheinvolutionof theuterus, anessential
process for the establishment of next pregnancy. The invo-
lution of the uterus follows the initial attachment of endo-
metrial cells rapidly implanting ECM beneath the
mesothelium, proliferating and forming newuterus lesions
[19,20]. Studies have shown that ECM proteins are consis-
tently expressed in utero at estrous and during pregnancy
and that abnormal expression leads to dysgenesia [21].
The objective of the present study was to evaluate the
endometrial inammatory response and ECM protein
expression induced by M bovis and provide in insight on
potential mechanism of infertility in dairy cows.
2. Materials and methods
2.1. Animals and experimental design
The procedures were conducted in accordance with the
US National Institutes of Health Guide for the Care and Use
of Laboratory Animals and approved through the Animal
Welfare and Research Ethics Committee at Jilin University
(Approval ID: 20111210-3). Eighteen healthy breed dairy
cows (3 year old, weight 600 kg, well-grown without any
abnormity and clinical symptoms, cervical orice closed)
from the Baishan Co. Ltd., Jilin Province, China, were
selected 18 days postpartum to be used in this study. Feed
and tap water were supplied ad libitum. All experimental
procedures, and the care, housing and handling of the an-
imals, were conducted according to accepted commercial
management practices. We obtained M bovis (ATCC25523)
from the American Type Culture Collection. Bacteria were
cultured in pleuropneumonia-like organism broth at 37

C
in a 5% CO
2
atmosphere for 3 days on an orbital shaker.
Cows were randomly assigned to three groups: (1)
Treatment group (n 6), in which the cows received an
intrauterine infusion of M bovis (10
8
CFU/mL, 50 mL), (2)
positive control group (n 6), in which the cows received
an intrauterine infusion of pleuropneumonia-like organism
broth containing no M bovis, and (3) negative control group
(n 6), inwhich the cows received no treatment. Two cows
were humanely killed with sodium pentobarbital 10, 20,
and 30 days after treatment in each group. After the uterus
was exposed and incised, sterile cotton was used for col-
lecting uterine mucus. These samples were preserved in
liquid nitrogen for bacterial identication using nested
polymerase chain reactiondenaturing gel gradient elec-
trophoresis (PCR-DGGE). Uterine tissue was scraped using a
scalpel blade, rinsed with ice-cold sterile deionized water,
immediately frozen in liquid nitrogen, and stored at 80

C
for subsequent cytokine assays and the determination of
the mRNA and protein expression of CL-IV, FN, and LN.
2.2. Bacterial identication
Uterine mucus samples were centrifuged, and the pre-
cipitation was collected and washed with 2 mL of
physiologic saline. Total DNA was isolated from the pre-
cipitation and subjected to rst-step PCR using forward-1
and reverse-1 primers (Table 1) to amplify a 500-bp frag-
ment of the 16S rDNA gene [22]. The PCR product was used
as template in second-step PCR to amplify a 250-bp frag-
ment using GC-clamp and forward-2 and reverse-2 primers
(Table 1). All primers were designed according to the
evolutionarily conserved universal 16S rDNA sequences for
bacteria and mycoplasma. The nal product was analyzed
using DGGE performed using the Dcode system (BioRad
Laboratories Inc., Richmond, CA). The nested PCR products
were loaded onto 6% denaturing polyacrylamide gradient
gels ranging from40% to 60%. The denaturant was 3.5 mol/L
urea in 40% deionized formamide. The electrophoresis was
performed in 1 tris-acetate EDTA buffer at 120 V for 6
hours at 60

C. Gels were subsequently stained for 90 mi-
nutes in 0.5 tris-acetate EDTA buffer containing ethidium
bromide and visualized using ultraviolet illumination. Im-
ages of the gels were obtained using a Fluor-STM Multi-
Imager (BioRad). The desired band was veried and cut
from the gel and DNA was extracted using a PAGE-DNA
purication kit (Aoxing; Beijing, China) according to the
manufacturers instructions. The DNA sequence analysis
was performed at Sheng Gong Biotechnological Co. Ltd.
(Shanghai, China). The results were compared with the
National Center for Biotechnology Information online
standard BLAST (Basic Local Alignment Search Tool) pro-
gram (http://www.ncbi.nlm.nih.gov/).
2.3. Evaluation of inammatory response and ECM protein
expression
For cytokine assays, the uterine tissue was weighed and
homogenized in PBS (w/v: 1/9) on ice, followed by centri-
fugation at 2000g for 40 minutes at 4

C. The supernatant
was collected and assayed for TNF-a, IL-1b, and IL-6
expression using ELISA kits according to the manufac-
turers instructions.
For evaluation of ECM protein expression, total RNA (50
mg tissue) was isolated from the uterine tissue samples
using TRIzol reagent according to the manufacturers in-
structions (Invitrogen, Beijing, China). Dried RNA pellets
were resuspended in 50 mL of diethyl-pyrocarbonate
treated water. Concentration and purity of total RNA were
determined spectrophotometrically at 260/280 nm. First-
strand cDNA was synthesized from 5 mg of total RNA
using oligo dT primers and superscript II reverse tran-
scriptase according to the manufacturers instructions
(Invitrogen). Synthesized cDNA was diluted ve-fold with
sterile water and stored at 80

C before use.
Table 1
Oligonucleotide primers of nest polymerase chain reaction.
Primer Sequence (5
0
-3
0
) Product
size (bp)
Forward-1 AGAGTATGATCCTGGCTCAG 500
Reverse-1 CTACGTCTACCTTGTTACGA
Forward-2 GC-clamp
a
-CCTACGGGAGGCAGCAG 250
Reverse-2 ATTACCGCGGCTGCTGGTGCGGCT
a
GC-clamp: CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGG.
M. Guo et al. / Theriogenology 81 (2014) 669674 670
Specic primers for CL-IV, FN, LN, and b-actin were
designed based on known sequences using the Primer
Premier Software (PREMIER Biosoft International, Palo Alto,
CA) (Table 2). Quantitative real-time PCR was performed
using an ABI PRISM 7500 Detection System (Applied Bio-
systems, Foster City, CA) in a 25-mL reaction mixture, con-
taining 12 mL of 2 SYBR Green I PCR Master Mix (TaKaRa,
Dalian, China), 2 mL of diluted cDNA, 0.5 mL of each primer
(10 mmol/L), 0.8 mL of 50 ROX reference Dye II, and 9.2 mL
of PCR-grade water. The PCR protocol for CL-IV, FN, LN, and
b-actin consisted of 95

C for 30 seconds, followed by
40 cycles of 95

C for 15 seconds, 62

C for 30 seconds, and
60

C for 30 seconds. The melting curve analysis showed a
single peak in every PCR product. A dissociation curve was
run for each plate to conrm the generation of a single
product. The amplication efciency for each gene was
determined using the DART-PCR program [23]. The mRNA
relative abundance was calculated using the Pfaf method
[24], accounting for gene-specic efciencies, and the re-
sults were normalized to the mean expression of b-actin
and expressed as the ratio of mRNA. The results (fold-
changes) were expressed as 2
DDCt
in which DDCt (C
tCL-
IV/FN/LN
Ct
b-actin
)t (Ct
CL-IV/FN/LN
Ct
b-actin
)c, where Ct
CL-
IV/FN/LN
and Ct
b-actin
are the cycle thresholds for carp CL-IV/
FN/LN and b-actin genes, t is the treatment group, and c is
the control group.
The uterine tissue samples were homogenized, total
protein was extracted, and protein concentrations were
determined by Western blot analysis using a BCA protein
assay kit according to the manufacturers instructions. Pro-
tein samples (50 mg) were fractionated on 10% SDS poly-
acrylamide gels, transferred to a polyvinylidene diuoride
membrane, and blocked in 5% skim milk in TTBS for 2 hours
at room temperature. The membranes were subsequently
incubated overnight at 4

C with primary antibodies (1:1000

dilution). After washing with TTBS, the membranes were
further incubated with secondary antibodies (1:5000 dilu-
tion; v/v) for 1 hour at room temperature. The protein
expression was detected using an enhanced chem-
iluminescence detection system, and the membrane was
exposed to x-ray lm; b-actin was used as a loading control.
2.4. Statistical analysis
The statistical analysis was performed using SPSS soft-
ware (version 13 for Windows; SPSS Inc., Chicago, IL).
Differences among groups were determined using the
one-way ANOVA Tukey-Kramer method for multiple
comparisons.
3. Results
When the presence of M bovis in the uterus was evalu-
ated using the rst-step PCR product as a template, the
resulting second-step PCR product was a 250-bp fragment
of the 16S rDNA gene product. The nal nested PCR product
was analyzed through DGGE to detect differences in the
nucleotide sequence. Only one band was observed on the
denaturing polyacrylamide 40% to 60% gradient gel.
Compared with the NCBI online standard BLAST program,
the homology between the obtained DNA fragment and the
16S rDNA from M bovis (GenBank: AY729934.1) was 100%.
Endometrial TNF-a, IL-1b, and IL-6 concentrations
increased (P < 0.01) 20 days after infusion in the treatment
group. Inammatory cytokine concentrations in treatment
group were also greater (P < 0.05) than in the positive and
negative control groups 20 and 30 days after infusion
(Fig. 1). Endometrial CL-IV, FN, and LN mRNA expression
increased (P <0.01) 20 days after infusion in all groups. The
increased was more pronounced in the treatment group
and ECMprotein expression were greater (P <0.05) than in
the positive and negative control groups 10, 20, and 30 days
after infusion (Fig. 2).
The endometrial ECM proteins (CL-IV, FN, and LN) were
measured through Western blot and analyzed by Fluor-
STM MultiImager (BioRad; Fig. 3). Endometrial CL-IV, FN,
and LN protein expression was signicant increased (P <
0.05) after infusion in the treatment group. The CL-IV
protein was increased 20 days after infusion in the treat-
ment group, followed by a subsequent slight increase and
the maintenance of persistent expression levels thereafter.
The FN protein reached maximum 20 days after infusion in
the treatment group and maintained persistent expression
levels thereafter. The expression of LN protein was persis-
tently increased after infusion in the treatment group.
4. Discussion
To characterize the pathogenic effects characteristic of
M bovis infection, the interference from other micro-
organisms must be removed. At rst, we select the cows
18 days postpartum. Their cervical orice was closed,
without any clinical symptoms. It was thought that there
were no bacteria in uteri on breed aquatics. If some bacteria
were in uterus, the cervical orice did not close and should
display some clinical symptoms of disease. Then using
specic primers designed for nested PCR-DGGE analysis,
according to the evolutionarily conserved 16S rDNA from
bacterium and mycoplasma. Only a single band was
Table 2
Primers used for quantitative real-time polymerase chain reaction.
Target Gene
(Dairy cow)
GenBank Accession No. Primer Sequence(5
0
-3
0
) Product
size (bp)
Collagen IV NM 174765.2 Forward ACCAGGAGATTAGCAGGGAC 104
Reverse CTTTGCCACTGCCCGTAA
Laminin NM 001206817.1 Forward CTACGGGACGGTGAAGCA 161
Reverse AACCCAAAGCGTGGCAGT
Fibronectin NM 001163778.1 Forward TGTCCCTCCTCCCACTGATTTGCGA 161
Reverse TTTCACAGGCGAGTAGCG
b-Actin NM 173979 Forward GCTGCGTTACACCCTT 150
Reverse TTCACCGTTCCAGTTTT
M. Guo et al. / Theriogenology 81 (2014) 669674 671
observed and the homology between the obtained DNA
fragment and the 16S rDNA of Mbovis was 100%. At present,
PCR-DGGE has proven to be a powerful technique for the
culture-independent detection and characterization of
micro-organism [25]. This technique was used for identi-
fying pathogenic bacterium on some disease [26,27]. For
pathogenic bacterium of bovine mastitis studies, PCR-
DGGE was demonstrated to be complimentary to cloning
strategies by tentatively identifying cloned 16S rDNA frag-
ments by comparison to community DGGE banding pat-
terns [28]. In present study, the primer was only specically
appeared to mycoplasmas and bacterium (based on data-
base check). The DGGE differentiate one base composition
discrepancy. The results indicated that Mbovis was the only
etiologic micro-organism in the treatment group in the
present study.
The role of inammatory cytokines has been well-
established in host defenses, physiologic responses
against infections, and inammatory diseases [2932]. In
addition, TNF-a and IL-1b are considered early or pro-
inammatory cytokines, that serve as indicators of
inammation [3335].
Endometrial TNF-a, IL-1b, and IL-6 concentrations were
signicantly greater in the treatment group, indicating that
M bovis induced inammatory responses in uterine tissue.
Expression of IL-6 was also signicantly increased. Optimal
levels of cytokines are important for host defenses, but
excessive concentrations lead to systemic inammation,
with destructive, rather than protective, effects on the host
[36]. In addition, increased cytokines concentrations have
Fig. 1. Cytokine concentrations. (A) Tumor necrosis factor (TNF)-a level in
uterus tissue. (B) Interleukin (IL)-6 level in uterus tissue. (C) Interleukin-1b
level in uterus tissue. The data were derived from the contents of 1 mL of
uterus tissue lysate and presented as the mean values standard error of
the mean (n 6). Treatment group: Intrauterine infusion of Mycoplasma
bovis (10
8
CFU/mL, 50 mL), positive control intrauterine infusion of
pleuropneumonia-like organism broth containing no M bovis; negative
control, no treatment. Samples were collected at 10, 20, or 30 days.
a
P <
0.05 versus the control group.
x
P < 0.01 versus samples collected after 10
days in the same group.
Fig. 2. Effects of Mycoplasma bovis on the levels of collagen IV (CL-IV),
bronectin (FN), and laminin (LN) mRNA. Quantitative PCR was performed
to detect the mRNAs of CL-IV, FN, and LN; b-actin was used as a control. (A)
The CL-IV mRNA level in uterus tissue. (B) The FN mRNA level in uterus
tissue. (C) The LN mRNA level in uterus tissue. Treatment group: Intrauterine
infusion of M bovis (10
8
CFU/mL, 50 mL), positive control intrauterine
infusion of pleuropneumonia-like organism broth containing no M bovis;
negative control, no treatment. Samples were collected at 10, 20, or 30 days.
The values are presented as the means standard error of the mean (n 6).
a
P < 0.05 versus the control group.
x
P < 0.01 versus samples collected after
10 days in the same group.
M. Guo et al. / Theriogenology 81 (2014) 669674 672
been associated with inhibited endometrial stromal cell
proliferation [37], endometrial adhesion, and hindered
involution of the uterus [38], with endometriosis leading to
infertility [39].
Endometrial ECM proteins play an important role in the
involution of the uterus, an essential process for the estab-
lishment of the next pregnancy. Although CL-IV, FN, and LN
mRNA and protein levels increased during the postpartum
inall groups, signicantly greater levels were observed after
intrauterine M bovis infusion in present study. This increase
in ECM proteins may facilitate M bovis binding, thereby
increasing pathogenicity [17]. Excess CL-IV, FN, and LN
expression has also been associated with dysgenesis and
breakdown of reproductive capacity barriers [21].
In conclusion, M bovis triggered endometrial inam-
matory response and increased CL-IV, FN, and LN mRNA
and protein expression. The abnormal expression of these
ECM proteins might promote the pathogenic effects of M
bovis that lead to endometrial tissue damage and infertility.
References
[1] Williams EJ, Fischer DP, Noakes DE, England GCW, Rycroft A,
Dobson H, et al. The relationship between uterine pathogen growth
density and ovarian function in the postpartum dairy cow. Ther-
iogenology 2007;68:54959.
[2] Chapwanya A, Meade KG, Doherty ML, CallananJJ, Mee JF, OFarrelly C.
Histopathological andmolecular evaluationof Holstein-Friesiancows
postpartum: toward an improved understanding of uterine innate
immunity. Theriogenology 2009;71:1396407.
[3] Chapwanya A, Meade KG, Foley C, Narciandi F, Evans ACO,
Doherty ML, et al. The postpartum endometrial inammatory
response: a normal physiological event with potential implications
for bovine fertility. Reprod Fertil Dev 2012;24:102839.
[4] Nicholas RAJ, Ayling RD, Stipkovits LP. An experimental vaccine for
calf pneumonia caused by Mycoplasma bovis: clinical, cultural,
serological and pathological ndings. Vaccine 2002;20:356975.
[5] Gomez-Martin A, Corrales JC, Amores J, Sanchez A, Contreras A,
Paterna A, et al. Controlling contagious agalactia in articial insemi-
nation centers for goats and detection of Mycoplasma mycoides
subspecies capri in semen. Theriogenology 2012;77:12526.
[6] Razin S. Adherence of pathogenic mycoplasmas to host cells.
Bioscience Rep 1999;19:36772.
[7] Nicholas RA. Bovine mycoplasmosis: silent and deadly. Vet Rec
2011;168:45962.
[8] Nicholas RA, Ayling RD. Mycoplasma bovis: disease, diagnosis, and
control. Res Vet Sci 2003;74:10512.
[9] Maunsell FP, Woolums AR, Francoz D, Rosenbusch RF, Step DL,
Wilson DJ, et al. Mycoplasma bovis infections in cattle. J Vet Intern
Med 2011;25:77283.
[10] Ghanem ME, Higuchi H, Tezuka E, Ito H, Devkota B, Izaike Y, et al.
Mycoplasma infection in the uterus of early postpartum dairy cows
and its relation to dystocia and endometritis. Theriogenology 2013;
79:1805.
[11] Cohen CR, Manhart LE, Bukusi EA, Astete S, Brunham RC, Holmes KK,
et al. Association between Mycoplasma genitalium and acute
endometritis. Lancet 2002;359:7656.
[12] Senturk S, Mecitoglu Z, Buyukcangaz E, Ozyigit O. Toxic epidermal
necrolysis associated with Mycoplasma bovis in calves. Vet Rec
2012;170:566.
[13] Rottem S. Interaction of mycoplasmas with host cells. Physiol Rev
2003;83:41732.
[14] Patti JM, Hook M. Microbial adhesins recognizing extracellular
matrix macromolecules. Curr Opin Cell Biol 1994;6:7528.
[15] Rosengarten R, Citti C, Glew M, Lischewski A, Droesse M, Much P,
et al. Host-pathogen interactions in mycoplasma pathogenesis:
virulence and survival strategies of minimalist prokaryotes. Int J
Med Microbiol 2000;290:1525.
[16] Yavlovich A, Katzenell A, Tarshis M, Higazi AA, Rottem S. Myco-
plasma fermentans binds to and invades HeLa cells: involvement of
plasminogen and urokinase. Infect Immun 2004;72:500411.
[17] Yavlovich A, Rottem S. Binding of host extracellular matrix proteins
to Mycoplasma fermentans and its effect on adherence to, and in-
vasion of HeLa cells. FEMS Microbiol Lett 2007;266:15862.
[18] Witz CA, Montoya-Rodriguez IA, Cho S, Centonze VE, Bonewald LF,
Schenken RS. Composition of the extracellular matrix of the peri-
toneum. J Soc Gynecol Invest 2001;8:299304.
[19] van der Linden PJ. Theories on the pathogenesis of endometriosis.
Hum Reprod 1996;11(Suppl 3):5365.
[20] Grifth JS, Rodgers AK, Schenken RS. In vitro models to study the
pathogenesis of endometriosis. Reprod Sci 2010;17:512.
[21] Sueoka K, Shiokawa S, Miyazaki T, Kuji N, Tanaka M, Yoshimura Y.
Integrins and reproductive physiology: expression and modulation
in fertilization, embryogenesis, and implantation. Fertil Steril 1997;
67:799811.
[22] Ajitkumar P, Barkema HW, De Buck J. Rapid identication of bovine
mastitis pathogens by high-resolution melt analysis of 16S rDNA
sequences. Vet Microbiol 2012;155:33240.
[23] Peirson SN, Butler JN, Foster RG. Experimental validation of novel
and conventional approaches to quantitative real-time PCR data
analysis. Nucleic Acids Res 2003;31:e73.
[24] Pfaf MW. A new mathematical model for relative quantication in
real-time RT-PCR. Nucleic Acids Res 2001;29:e45.
Fig. 3. Effects of Mycoplasma bovis on collagen IV (CL-IV), bronectin (FN),
and laminin (LN) proteins. Western blotting was performed to detect CL-IV,
FN, and LN protein, and analyzed by Fluor-STM MultiImager. b-Actin was
used as a control. (A) The CL-IV protein level in uterus tissue. (B) The FN
protein level in uterus tissue. (C) The LN protein level in uterus tissue.
Treatment group, intrauterine infusion of M bovis (10
8
CFU/mL, 50 mL);
positive control, intrauterine infusion of PPLO broth containing no M bovis;
negative control, no treatment. Samples were collected at 10, 20, or 30 days.
The values are presented as the means standard error of the mean (n 6).
a
P < 0.05 versus the control group.
x
P < 0.01 versus the samples collected
after 10 days in the same group.
M. Guo et al. / Theriogenology 81 (2014) 669674 673
[25] Konstantinov SR, Zhu WY, Williams BA, Tamminga S, de Vos WM,
Akkermans ADL. Effect of fermentable carbohydrates on piglet
faecal bacterial communities as revealed by denaturing gradient gel
electrophoresis analysis of 16S ribosomal DNA. Fems Microbiol Ecol
2003;43:22535.
[26] deOliveiraJCM, SiqueiraJF, Rocas IN, Baumgartner JC, Xia T, PeixotoRS,
et al. Bacterial community proles of endodontic abscesses from Bra-
zilian and USA subjects as compared by denaturing gradient gel elec-
trophoresis analysis. Oral Microbiol Immun 2007;22:148.
[27] Donskey CJ, Hujer AM, Das SM, Pultz NJ, Bonomo RA, Rice LB. Use of
denaturing gradient gel electrophoresis for analysis of the stool
microbiota of hospitalized patients. J Microbiol Meth2003;54:24956.
[28] Kuanga Y, Tania K, Aidan J. Characterization of bacterial population
of raw milk from bovine mastitis by culture-independent PCR
DGGE method. Biochem Engineering J 2009;45:7681.
[29] Boudjellab N, Chan-Tang HS, Zhao X. Bovine interleukin-1 expres-
sion by cultured mammary epithelial cells (MAC-T) and its
involvement in the release of MAC-T derived interleukin-8. Comp
Biochem Phys A 2000;127:1919.
[30] Miller LS, Pietras EM, Uricchio LH, Hirano K, Rao S, Lin H, et al.
Inammasome-mediated production of IL-1beta is required for
neutrophil recruitment against Staphylococcus aureus in vivo. J
Immunol 2007;179:693342.
[31] Li B, Li J, Pan X, Ding G, Cao H, Jiang W, et al. Artesunate protects
sepsis model mice challenged with Staphylococcus aureus by
decreasing TNF-alpha release via inhibition TLR2 and Nod2 mRNA
expressions and transcription factor NF-kappaB activation. Int
Immunopharmacol 2010;10:34450.
[32] Lee JW, Bannerman DD, Paape MJ, Huang MK, Zhao X. Character-
ization of cytokine expression in milk somatic cells during intra-
mammary infections with Escherichia coli or Staphylococcus aureus
by real-time PCR. Vet Res 2006;37:21929.
[33] Li B, Li J, Pan XC, Ding GF, Cao HW, Jiang WW, et al. Artesunate
protects sepsis model mice challenged with Staphylococcus aureus
by decreasing TNF-alpha release via inhibition TLR2 and Nod2
mRNA expressions and transcription factor NF-kappa B activation.
Int Immunopharmacol 2010;10:34450.
[34] Vincent JL, Sun QH, Dubois MJ. Clinical trials of immunomodulatory
therapies in severe sepsis and septic shock. Clin Infect Dis 2002;34:
108493.
[35] Harbarth S, Holeckova K, Froidevaux C, Pittet D, Ricou B, Grau GE,
et al. Diagnostic value of procalcitonin, interleukin-6, and
interleukin-8 in critically ill patients admitted with suspected
sepsis. Am J Respir Crit Care 2001;164:396402.
[36] Boulanger D, Brouillette E, Jaspar F, Malouin F, Mainil J, Bureau F,
et al. Helenalin reduces Staphylococcus aureus infection in vitro and
in vivo. Vet Microbiol 2007;119:3308.
[37] Zarmakoupis PN, Rier SE, Maroulis GB, Becker JL. Inhibition of
human endometrial stromal cell proliferation by interleukin 6. Hum
Reprod 1995;10:23959.
[38] Agic A, Xu H, Finas D, Banz C, Diedrich K, Hornung D. Is endome-
triosis associated with systemic subclinical inammation? Gynecol
Obstet Invest 2006;62:13947.
[39] Okai T. Immunological factors and their role in the genesis and
development of endometriosis (Retraction of vol. 32, pg 162, 2006).
J Obstet Gynaecol Res 2009;35:390.
M. Guo et al. / Theriogenology 81 (2014) 669674 674