Molecular cloning and mRNA expression analysis of interleukin-8

gene in Japanese sea perch (Lateolabrax japonicus)

Lihua Qiu Hanhua Zhang Keng Yang
Shigui Jiang
Received: 16 April 2008 / Accepted: 2 June 2008 / Published online: 19 June 2008
Springer Science+Business Media B.V. 2008
Abstract Interleukin-8 (IL-8), the rst known chemo-
kine, is a CXC chemokine, which is cable of attracting
neutrophils and inducing them to release lysozomal
enzymes, triggering the respiratory burst. In the present
study, the cDNA of an IL-8 was cloned from Japanese sea
perch Lateolabrax japonicus (designated LjIL-8) by
homology cloning and rapid amplication of cDNA ends
(RACE) approaches. The full-length cDNA of LjIL-8
consisted of 803 nucleotides with a canonical polyadenyl-
ation signal sequence AATAAA and a poly(A) tail, and an
open reading frame (ORF) of 300 bp encoding a poly-
peptide of 99 amino acid residues with a predicted
molecular weight of 6.6 kDa. The high identity of LjIL-8
with IL-8 in other organisms indicated that LjIL-8 should
be a new member of the IL-8 family. By uorescent
quantitative real-time PCR, mRNA transcript of LjIL-8
was detectable in all the examined tissues with higher level
in spleen and head-kidney. The temporal expression of
LjIL-8 mRNA in the spleen was up-regulated by lipop-
olyssacharide (LPS) stimulation and reached the maximum
level at 6 h post-stimulation, and then dropped back to the
original level gradually. These results indicated that LjIL-8
was a constitutive and inducible acute-phase protein that
perhaps involved in the immune defense of L. japonicus.
Keywords Interleukin-8 Molecular cloning
mRNA expression Lateolabrax japonicus
Introduction
Cytokines are low molecular weight proteins that serve as
chemical messengers within the innate and adaptive immune
systems. Closely related pro-inammatory chemotactic
cytokines, called chemokines, attract and activate specic
types of leukocytes, such as lymphocytes and neutrophils [1].
The chemokines are a superfamily of approximately 40
different small secreted cytokines that direct the migration of
immune cells to sites of infection [2].
To date, four different subfamilies of chemokines have
been identied, based on highly conserved amino-terminal
cysteine residues. The two major subfamilies, CC and CXC,
are distinguished by the separation of the rst two cysteines in
their amino acid sequences by a single amino acid [3]. Inter-
leukin-8 (IL-8) is a CXC chemokine, and the rst known
chemokine, produced by monocytes/macrophages, bro-
blasts, vascular endothelial cells, mast cells, epithelial cells,
and a wide variety of tissue cells, upon exposure to inam-
matory stimulants [4]. IL-8 mainly attracts neutrophils and
induces them to release lysozomal enzymes [5], undergo a
change in shape, triggers the respiratory burst [67], and
increases the expression of adhesion molecules on the cell
surface [8]. IL-8 contains four cysteines, the rst two of which
are separated by one amino acid. Cysteine residues have an
important role in the tertiary structure of proteins [9]. The
neutrophil-attracting ability of IL-8 can be attributed to the
presence of a Glu-Leu-Arg (ELR) motif adjacent to the CXC
motif at its N-terminus, presumably by affecting its binding to
specic receptors. CXCchemokines lacking an ELRmotif, in
contrast, specically attract lymphocytes and not neutrophils.
L. Qiu H. Zhang K. Yang S. Jiang (&)
Biotechnology and aquiculture Laboratory, The South China Sea
Fisheries Research Institute, Chinese Academy of Fishery
Sciences, 231 Xingangxi Road, Guangzhou 510300,
Peoples Republic of China
e-mail: Jiangsg@21cn.com
L. Qiu
The Centre for Applied Aquatic Genomics, Chinese Academy
of Fishery Sciences, Beijing 100039,
Peoples Republic of China
1 3
Mol Biol Rep (2009) 36:10991105
DOI 10.1007/s11033-008-9284-6
With the development of the technique of gene cloning,
molecular techniques have recently enabled the identi-
cation of sh cytokine genes. Till now, the molecular
structure of IL-8 has been determined in many sh since its
initial isolation from humans, including rainbow trout
(Oncorhynchus mykiss) [10], ounder (Paralichthys oli-
vaceus) [11], lamprey (Lampreta uviatilis) [12], dogsh
(Triakis scyllia) [13], black seabream (Acanthopag-
rus schlegeli) (GenBank No. DQ000611).
Japanese sea perch is an important cultured marine sh
species in china. The main objectives of this study are (1)
to clone the full length cDNA of IL-8 from Japanese sea
perch and compare it to other known IL-8 genes to prove
the existence of IL-8 in sea perch, (2) to investigate the
expression pattern of IL-8 gene in the tissues, (3) to provide
information about if LPS could induce the expression of
IL-8 in Lateolabrax japonicus.
Materials and methods
Animals and immune challenge
The healthy Japanese sea perch sh (L. japonicus),
weighing about 200 g, were purchased from Guangzhou,
Guangdong province, P. R. China. Fifty sh were main-
tained in aerated seawater (salinity 30) at 2425C for
3 days before processing.
For gene cloning, three sh weighing about 200 g were
employed and kept in the tank. Two hundred microlitres of
LPS (10 lg ml
-1
, resuspended in water) was injected into
the muscle of each sh. Six hours later, the spleen from the
three sh was collected, mixed, and subjected to total RNA
extraction.
For the challenge experiment, 40 sh were employed.
Two hundred microlitres LPS (10lg ml
-1
) were injected
into the muscle of each sh and they were used as the
stimulated group. The untreated sh and sh injected with
200 ll water were used as the blank and the control
group, respectively. The injected sh were returned to
seawater tanks, and three individuals from the blank,
control, and stimulated group, respectively, were ran-
domly collected at 2, 4, 6, 8, and 10 h post-injection. At
each time point, the spleen from the three individuals
were collected and mixed. They were subjected to total
RNA extraction.
Total RNA isolation
Total RNA was isolated from the tissues of the shes using
Trizol (Invitrogen, Japan) reagent following the protocol of
the manufacturer, and resuspended in DEPC-treated water
and stored at -80C.
Synthesis of the cDNA rst strand
cDNA was synthesized from 2 lg of mRNA by Moloney
Murine Leukemia Virus reverse transcriptase (M-MLV,
Promega, USA) at 42C for 50 min with oligo-dT adaptor
primer (Table 1) following the protocol of the manufac-
turer. The cDNA was used as template for PCR reactions.
IL-8 gene cloning and sequencing
Initially, PCR was performed using the cDNA prepared
above as template, with the degenerated primers of Fe and
Re (Table 1) designed according to the conserved regions
of other known IL-8 gene sequences, in order to obtain
the partial fragment of IL-8 gene from sea perch. The
obtained PCR products were separated by 1.5% agarose
gel, and then puried by PCR purication kit. The puri-
ed PCR product was ligated with the PMD18-T vector
(TaKaRa, Japan), and transformed into the competent
Escherichia coli cells. The recombinants were identied
through bluewhite color selection and screened with
M13 forward and reverse primers. Three of the positive
clones were sequenced on an ABI3730 Automated
Sequencer (Applied Biosystem). Sequences generated
were analyzed for similarity with other known sequences
using the BLAST programs (http://www.ncbi.nim.nih.
gov/).
Having isolated a partial sea perch IL-8 sequence, the
5
0
and 3
0
ends of mRNA were obtained by rapid amplica-
tion of cDNA ends (RACE) methods, using gene-specic
primers shown in Table 1. In 3
0
RACE-PCR, PCR reaction
was performed with primer F1 and adaptor primer
(Table 1), while a second semi-nested PCR was carried out
with primer F2 and the adaptor primer. In 5
0
RACE PCR,
Table 1 Oligonucleotide primers used in experiments
Primer name (5
0
? 3
0
) Nucleotide sequence
Fe TGCCRCTGCATHGARAC
Re ACTTGTTVATGACYHTCTTVACCCA
F1 CAGAGAATCGGCACAGACAG
F2 GGCACAGACAGCAGATAAGG
R1 CTGTCTGTGCCGATTCTCTG
R2 CACATCACCTGTCTTTTGGC
oligo-dT adaptor GGCCACGCGACTAGTAC(T)
16
Adaptor GGCCACGCGACTAGTAC
oligo-dG GGGGGGGGGGGGGGGH
RactinF CAACTGGGATGACATGGAGAAG
RactinR TTGGCTTTGGGGTTCAGG
rIL8F GTGGTGCTCCTGGCTTTCTT
rIL8R ATGGGTTTGCTCTCCGTCTC
1100 Mol Biol Rep (2009) 36:10991105
1 3
the rst strand cDNA obtained was tailed with poly (C) at
the 5
0
ends using terminal deoxynucleotidyl transferase
(TdT, TaKaRa, Japan). PCR was performed initially with
primer R1 and Oligo-dG, followed by semi-nested PCR
with R2 and Oligo-dG. The PCR products were gel-puri-
ed, sequenced, and the resulted sequences were subjected
to be analyzed.
Generated sequences were analyzed for similarity with
other known sequences using the BLAST program (http://
www.ncbi.nlm.nih.gov/BLAST/). Multiple sequence
alignments were performed using the CLUSTAL W pro-
gram at the European Bioinformatics Institute (http://www.
ebi.ac.uk). Analyses of the deduced amino acid sequences
utilized the programs PSORT (Kenta Nakai, National
Institute Basic Biology), Scan Prosite (EXPASy Molecular
Biology Server), and Predict Protein (EMBL-Heidelberg).
The phylogenetic tree was constructed by the neighbor-
joining (NJ) method using the Treecon program (Van de
Peer and De Wachter 1994).
Quantication of PmcathepsinC expression by
quantitative real time PCR
Real-time quantitative PCR (qRT-PCR) was performed
with the SYBR Green 2 9 Supermix (Applied Biosystems,
USA) on an ABI 7300 Real-Time Detection System
(Applied Biosystems, USA) to investigate the expression
of LjIL-8. Two specic primers, rIF and rIR (Table 1) were
used to amplify a PCR product of 118 bp. b-actin was
chosen as the reference gene for internal standardization.
Two b-actin primers ractinF and ractinR (Table 1) were
used to amplify a b-actin gene fragment of 110 bp as the
internal control for qRT-PCR. The qRT-PCR amplica-
tions were carried out in triplicates in a total volume of
20 ll containing 10 ll of 2 9 Supermix (Applied Biosys-
tems, USA), 5 ll of the 1:5 diluted cDNA, 1 ll each of
forward and reverse primer and 3 ll PCR grade water, The
qRT-PCR program was 50C for 2 min, 95C for 10 min,
followed by 40 cycles of 94C for 15 s, 61C for 30 s,
72C 30 s. Melting curve analysis of amplication prod-
ucts was performed at the end of each PCR reaction to
conrm that only one PCR product was amplied and
detected. After the PCR program, qRT-PCR data from
three replicate samples were analyzed with a 7300 System
SDS Software v1.3.0 (Applied Biosystems, USA) to esti-
mate transcript copy numbers for each sample. To maintain
consistency, the baseline was set automatically by the
software. The comparative C
T
method was used to analysis
the expression level of LjIL-8. The C
T
for the target
amplication of IL-8 and the C
T
for the internal control
b-actin were determined for each sample. Differences
between the C
T
for the target and the internal control,
called DC
T
, were calculated to normalize the differences in
the amount of total nucleic acid added to each reaction and
the efciency of the RT-PCR. The blank group was used as
the reference sample, called the calibrator. The DC
T
for
each sample was subtracted from the DC
T
of the calibrator;
the difference was called DDC
T
value. The expression level
of LjIL-8 could be calculated by 2
-DDCT
, and the value
stood for an n-fold difference relative to the calibrator. The
average cycle threshold (C
T
) measurement for the three
determinations were used in calculations of relative
expression using b-actin as the internal control. The data
obtained from RT-PCR analysis were subjected to one-way
analysis of variance (one-way ANOVA) followed by an
unpaired, two-tailed t-test. Differences were considered
signicant at P\0.05.
Results
Cloning and sequence of LjIL-8 gene
Three overlapping products were obtained by RT-PCR
amplication (Fig. 1), which comprised the full-length sea
perch IL-8 cDNA. The sequence consisted of 803 nucleo-
tides including a 300 bp single open reading frame (ORF),
a 159 bp 5
0
untranslated region (5
0
UTR) and a 359 bp 3
0
UTR. In the 3
0
UTR, there were ve RNA instability motifs
(ATTTA), a 15 bp poly (A) tail and a putative polyade-
nylation signal (AATAAA) which located 17 bp upstream
of the poly (A)
+
tail. The open reading frame encoded a 99
amino acids precursor peptide with a molecular weight
about 6.6 kDa, and theoretical point of 5.51.
Four cysteine residues were present in the peptide at
positions 34, 36, 61, and 78, conforming to the CXC pat-
tern. Preceding the CXC motif were the residues Glu-Leu-
His
(ELH). Using the signal program, a putative signal
peptide was predicted at the N-terminus of the sea perch
peptide that would cleave between Gly
22
and Met
23
.
Homology analysis
Comparison of the trout sequence with some published
CXC chemokine sequences using the BLAST program
showed that this molecule was closest in identity to ver-
tebrate IL-8 molecules (Table 2). The sea perch chemokine
shared 39% amino acid identity to human IL-8, whereas
identity to other human CXC chemokines was lower.
Identity shared between the sea perch molecule and
chicken IL-8 was also high relative to the chicken CXC
chemokine. When compared to other sh chemokines, the
sea perch molecule showed high identity to the fugu
rubripes (85%) and black sea bream IL-8 (86%).
Mol Biol Rep (2009) 36:10991105 1101
1 3
Multiple alignments shows the predicted sea perch sig-
nal sequence aligns exactly with conrmed signal peptide
cleavage positions within vertebrate IL-8 molecules. And
all the four cysteine residues are in conserved positions
with respect to vertebrate IL-8 (Fig. 2).
Based on the nucleotide acid sequence of IL-8 genes, a
phylogenetic tree was constructed (Fig. 3). All the piscine
IL-8, such as those of ounder, black seabream, sea perch,
and carp, were clustered together and formed a group apart
from other animals IL-8 including the chicken, and other
mammalians. The relationships displayed in the phylogenic
tree were corresponded to their classication position.
Tissue distribution of the LjIL-8 transcripts
Real-time quantitative PCR was employed to quantify the
LjIL-8 expression in the tissues of heart, gill, head-kidney,
spleen, liver, and brain. The amplication specicity for
LjIL-8 and b-actin was determined by analyzing the dis-
sociation curves. Only one peak presented in the
dissociation curves for both the LjIL-8 and b-actin gene
(data not shown), indicating that the amplications were
specic.
LjIL-8 mRNA was found to be constitutively expressed
in all the examined tissues with signicant variation of
expression level. There was a high-level expression of
LjIL-8 in spleen and head-kidney, while a low-level
expression in gill, liver, heart, and brain. The highest level
of IL-8 expression was detected in spleen (Fig. 4).
Quantication of LjIL-8 mRNA expression after LPS
stimulation
The temporal expression of the LjIL-8 transcript in spleen
of sh after LPS stimulation was shown in Fig. 5. During
the rst 2 h after LPS stimulation, the IL-8 mRNA
remained at a low level. At 4 h after stimulation, the
expression of the LjIL-8 was up regulated and there was a
signicant increase in the relative abundance of LjIL-8
mRNA. At 4 and 6 h post-LPS stimulation, the LjIL-8 gene
expression level was 7.5- and 9.1-fold higher than that
observed in the control group, respectively. As time
Fig. 1 The Japanese sea perch IL8 sequence. The arrow indicated the
signal peptide cut site, and the signal peptide was in box; the CXC
motif was in the highlighted; the RNA instability motif were
underline and the polyadenylation signal sequence was highlighted
and underlined; the spark showed the stop code
Table 2 Homology of IL-8
protein of sea perch with other
known chemokines amino acids
Species Similarity (%) Identity (%) E-value Accession number
Human IL-8 59 39 6e-11 Z11686
Human CXCL1 55 36 6e-10 J03561
Human CXCL2 56 37 5e-10 M57731
Sheep IL-8 58 38 6e-11 X78361
Chicken IL-8 69 46 1e-13 NM205498
Chicken K60 62 45 5e-14 Y14971
Zebrash IL-8 77 58 9e-27 AY340959
Rainbow trout IL-8 78 63 2e-28 AY160981
Common carp IL-8 80 62 2e-29 DQ453125
Common carp CXC 79 63 1e-27 AJ550164
Flounder IL-8 88 72 8e-34 AF216646
Flounder CXC 87 72 2e-34 AB070837
Black sea bream IL-8 89 86 1e-36 DQ000611
Fugu rubripes IL-8 92 85 2e-38 AB125645
1102 Mol Biol Rep (2009) 36:10991105
1 3
progressed, the expression of LjIL-8 mRNA decreased and
almost recovered to the original level at 10 h post-stimu-
lation. The expression of LjIL-8 in control and blank
groups did not signicantly change at all time point. An
unpaired, two-tailed t-test with blank and challenged
groups showed statistically signicant difference in LjIL-8
gene expression at 1, 6, and 8 h (P\0.05) post-stimula-
tion. However, no signicant difference was observed in
other time point in challenge group (Fig. 5).
Discussion
This study presents the cloning of IL-8 in the Japanese sea
perch (L. japonicus) stimulated with LPS using the tech-
nique of homology. This cDNA contained an open reading
Fig. 2 Multiple alignments of
Japanese sea perch IL8 with
other known IL8 amino acids
sequences, residues aligned by
the CLUSTAL W program.
Identical and similar sites were
shown with sparks (*) and dots
(. Or : ) , respectively; the arrow
indicated the signal peptide cut
site; the conserved cysteines
were highlighted, and ELR
motif which associated with
neutrophil attracting in
mammalian was in the box
Black sea bream
81
76
Sea perch
64
Fugu rubripes
60
Flounder
100
Atlantic cod
Common carp
Common carp CXC 100
Chicken
Human
Cat
100
Sheep
86
Pig 59
0.1
Fig. 3 A molecular phylogenetic tree of IL-8 proteins based on the
NJ method with values for each internal branch determined by
bootstrap analysis with 1,000 replications. The values indicate
percentages along the branch
0
10
20
30
40
50
60
70
Heart Gill Brain Liver HK Spleen
Tissues
T
h
e

r
e
l
a
t
i
v
e

e
x
p
r
e
s
s
i
o
n

l
e
v
e
l

o
f

L
j

I
L
-
8
Fig. 4 qRT-PCR analysis of IL-8 expression in various tissues of
Japanese sea perch. HK: head-kidney
*
**
**
**
0
1
2
3
4
5
6
7
8
9
10
blank control 1 2 4 6 8 10
Stimulated time(h)
T
h
e

r
e
l
a
t
i
v
e

e
x
p
r
e
s
s
i
o
n

l
e
v
e
l

o
f

L
j

I
L
-
8
Fig. 5 qRT-PCR analysis of IL-8 expression in different stimulated
time point
Mol Biol Rep (2009) 36:10991105 1103
1 3
frame (ORF) of 300 nucleotides that translated into a
predicted 99 amino acid protein.
Several characteristics within the putative sea perch
peptide sequence ratify it as a CXC chemokine. First, in the
deduced amino acid sequence, four cysteine residues that
are essential for the formation of the tertiary structure and
consequently function [14] were identied at position 35,
37, 61, and 78, which lie in conserved positions when
compared to other CXC chemokines. Importantly, a single
arginine residue (Arg
36
) separated the rst and second
cysteines, creating the classical CXC motif. Second, the
rst 23 amino acid of sea perch IL-8 were predicted, using
the signal program, to represent a signal sequence that is
cleaved following Gly
23
. A high percentage of hydrophobic
residues in the N-terminal portion of sea perch IL-8, an
attribute of signal sequences, reinforce this nding and is
consistent with sea perch IL-8 being a secreted molecule,
as observed with other chemokines [15]. The IL-8 pre-
cursors of other vertebrates also have dened signal
peptides, whose cleavage points appear to align exactly
[16] with the predicted signal cleavage point of LjIL-8
(Fig 2). An ELR motif immediately upstream from the
CXC sequence is characteristic of chemokines that attract
neutrophils and have angiogenic effects [1718]. In con-
trast to IL-8 molecules of mammals and chicken, LjIL-8, in
common with other sh sequences such as ounder [11]
and trout [10], does not possess this motif. Instead, the sea
perch sequence contains an ELH motif representing a
conservative substitution, the ounder containing SLR,
black seabream containing ELH, carp containing DPR,
trout containing DLR (Fig. 2). Whether this change will
affect the functionality of the protein will require further
investigation. But when the ELR motif was mutated to
DLR, a 100-fold decrease in biological activity was
observed during studies with synthetic mammalian IL-8
peptides [19]. It suggests that although a DLR motif is
functional, it is signicantly less potent than an ELR motif.
We postulate that the lack of an ELR motif may be char-
acteristics of IL-8 genes in sh. An additional feature
supporting the sea perch sequence as a chemokine is the
presence of AU-rich motifs within its 3
0
UTR. Messenger
RNA containing AU-rich sequences such as ATTTA motif,
has been shown to have reduced stability in comparison to
those lacking AU-rich sequences. Transiently expressed
genes, such as cytokines, often contain AU-rich elements
repeated within the 3
0
UTR of their mRNAs [2022]. Five
ATTTA motifs are located within the 3
0
UTR of LjIL-8
suggesting that this transcript is unstable and agreeing with
observations of mammalian chemokines.
The LjIL-8 precursor, when compared to mammalian
CXC chemokines shows higher similarity to IL-8 mole-
cules. Relative to other available sh chemokine
sequences, high identity is observed with the IL-8 molecule
of the Fugu rubripes supporting the view these are related
molecules. Phylogenetic analysis of CXC chemokines
shows that LjIL-8 groups with other sh IL-8 sequences
supported with bootstrapping. This nding support the
conclusion that the CXC chemokine isolated during this
study is an IL-8 equivalent in sea perch.
IL-8 mRNA could be detected in various tissues of
unchallenged sea perch using qRT-PCR, indicating that
constitutive IL-8 expression occurs in many sea perch tis-
sues. However, there is some degree of tissue specic
expression for this gene because the IL-8 transcript in the
brain of the unchallenged sh is very weak and almost could
not be detected directly. This result is same as the report of
rainbow trout [10]. Constitutive expression of IL-8 has been
reported in mammalian macrophages, although expression
was induced with bacteria and LPS [2325]. LPS acts as a
powerful stimulator of innate immunity in diverse eukaryotic
species [2627]. In the present study, after LPS treatment,
the expression level of LjIL-8 was not changed signicantly
during the rst 2 h after LPS stimulation, and then up-reg-
ulated and increased signicantly at 4 h after LPS
stimulation. The expression level of LjIL-8 at 6 h post-LPS
stimulation was the highest, and from the 6 h post-LPS
stimulation the expression level became to decrease. The
result indicted that LjIL-8 was a constitutive and inducible
acute-phase protein. Because an inammatory insult in a
cytokine cascade, so the function of IL-8 is in the limitation
of the time [2]. Less is known about the role of IL-8 in viral
infections, although many of its known biological effects
would be expected to impact on antiviral defences [17].
Characterisation of the biological effects of IL-8 in sea perch
awaits production of the recombinant molecule, which will
establish the requirement for an ELRmotif for attraction and
activation of neutrophils at this level of phylogeny.
Acknowledgments This work was supported by a grant from the
GuangDong Province of China (2005B20301023), Agriculture
Department Project of China (06-05-01B) and National Project of
China (2006BAD01A13)
References
1. Baggiolini M (1998) Chemokines and leukocyte trafc. Nature
392:565568. doi:10.1038/33340
2. Secombes CJ, Wang T, Hong S et al (2001) Cytokines and innate
immunity of sh. Dev Comp Immunol 25:713723. doi:
10.1016/S0145-305X(01)00032-5
3. Ahuja SK, Murphy PM (1996) The CXC chemokines growth-
regulated oncogene (GRO) alpha, GRObeta, GROgamma, neu-
trophil-activating peptide-2, and epithelial cell-derived neutrophil
activating peptide-78 are potent agonists for the type B, but not
the type A, human interleukin-8 receptor. J Biol Chem
271:2054520550. doi:10.1074/jbc.271.34.20545
4. Baggiolini M, Clark-Lewis I (1992) Interleukin-8, a chemotactic
and inammatory cytokine. FEBS Lett 307:97101. doi:
10.1016/0014-5793(92)80909-Z
1104 Mol Biol Rep (2009) 36:10991105
1 3
5. Peveri P, Walz A, Dewald B, Baggiolini M (1988) A novel
neutrophil-activating factor produced by human mononuclear
phagocytes. J Exp Med 167:15471559. doi:10.1084/jem.
167.5.1547
6. Schroder JM, Mrowietz U, Morita E, Christophers E (1987)
Purication and partial biochemical characterization of a human
monocytes-derived, neutrophil-activating peptide that lacks
interleukin 1 activity. J Immunol 139:34743483
7. Thelen M, Peveri P, Kernen P, von Tscharaner V, Walz A,
Baggiolini M (1988) Mechanism of neutrophil activation by
NAF, a novel monocytes-derived peptide agonist. FASEB J
2:27022706
8. Paccaud JP, Shifferli JA, Baggiolini M (1990) NAP-1/IL-8
induces upregulation of CR1 receptors in human neutrophil leu-
kocytes. Biochem Biophys Res Commun 166:187192. doi:
10.1016/0006-291X(90)91929-M
9. Schmid J, Weissmann C (1987) Induction of mRNA for a serine
protease and a b-thromboglobulin-like protein in mitogen-stim-
ulated human leukocytes. J Immunol 139:250256
10. Kerry L, Zou J, Wang T, Bols N, Hirono I, Aoki T et al (2002)
Identication and analysis of an interleukin 8-like molecule in
rainbow trout Oncorhynchus mykiss. Dev Comp Immunol
26:433444. doi:10.1016/S0145-305X(01)00092-1
11. Eun-Young L, Hyoun-Hyang P, Young-Taae K, Tae-Jin C (2001)
Cloning and sequence analysis of the Interleukin-8 gene from
ounder (Paralichthys olivaceous). Gene 274:237243. doi:
10.1016/S0378-1119(01)00600-X
12. Najakshin AM, Mechetina LV, Alabyev BY, Taranin AV (1999)
Identication of an IL-8 homolog in lamprey (Lampetra uvia-
tilis): early volutionary divergence of chemokines. Eur J
Immunol 29:375382. doi :10.1002/(SICI)1521-4141(199902)
29:02\375::AID-IMMU375[3.0.CO;2-6
13. Yuuki I, Chiaki H, Kazushige U, Tadaaki M, Teruyuki N (2003)
Molecular cloning and sequenceing if the banded dogsh (Triakis
scyllia) interleukin-8 cDNA. Fish Shellsh Immunol 14:275281.
doi:10.1006/fsim.2002.0432
14. Rajarathnam K, Sykes BD, Dewald B, Baggiolini M, Clark I
(1999) Disulphide bridge in interleukin-8 probed using nonnat-
ural disulphide analogues:dissociation of roles in structure from
function. Biochemistry 38:76537658. doi:10.1021/bi990033v
15. Vaddi K, Keller M, Newton RC (1997) The chemokine facts-
book. Academic Press, London
16. Goodman RB, Foster DC, Mathewes SL, Osborn SG, Kuijper JL,
Forstorm JW et al (1992) Molecular cloning of porcine alveolar
macrophage-derived neutrophil chemotactic factorsIand II:
identication of porcine IL-8 and another intercrine-aprotein.
Biochemistry 31:1048310490. doi:10.1021/bi00158a011
17. Wuyts A, Proost P, Van Damme J (1998) Interleukin-8 and other
CXC chemokines. In: Thomson A (eds) The cytokine handbook,
3rd edn. Academic Press, London, pp 271311
18. Strieter RM, Polverini PJ, Kunkel SL, Arenberg DA, Burdick
MD, Kasper J et al (1995) The functional role of the ELR motif
in CXC chemokines-mediated angiogenesis. J Biol Chem
270:2734827357. doi:10.1074/jbc.270.45.27348
19. Hebert CA, Vitangcol RV, Baker JB (1991) Scanning mutagen-
esis of interleukin-8 identies a cluster of residues required for
receptor binding. J Biochem 266:1898918994
20. Caput D, Beutler B, Hartog K, Thayer R, Brown-Shimer S,
Cerami A (1986) Identication of a common nucleotide sequence
in the 3
0
-untranslated region of mRNA molecules specifying
inammatory mediators. Proc Natl Acad Sci USA 83:16701674.
doi:10.1073/pnas.83.6.1670
21. Shaw G, Kamen R (1986) A conserved AU sequence from the 30
untranslated region of GM-CFS mRNA mediates selective
mRNA degradation. Cell 46:659667. doi:10.1016/0092-
8674(86)90341-7
22. Roca FJ, Cayuela ML, Secombes CJ, Meseguer J, Mulero V
(2007) Post-transcriptional regulation of cytokine genes in sh: a
role for conserved AU-rich elements located in the 3
0
-untrans-
lated region of their mRNAs. Mol Immunol 44(4):472478. doi:
10.1016/j.molimm.2006.02.015
23. Morsey MA, Popowych Y, Kowalski J, Gerlach G, Godson D,
Campos M et al (1996) Molecular cloning and expression of
bovine interleukin-8. Microb Pathog 20:203212. doi:
10.1006/mpat.1996.0019
24. Nakamura H, Yoshimura K, Jaffe HA, Crystal RG (1991) Inter-
leukin-8 gene expression in human bronchial epithelial cells. J
Biol Chem 266:1961119617
25. Lin G, Pearson AE, Scamurra RW, Zhou Y, Baarsch MJ, Weiss
DJ et al (1994) Regulation of interleukin-8 expression in porcine
alveolar macrophages by bacterial lipopolysaccharide. J Biol
Chem 269:7785
26. Ulevitch RJ, Tobias PS (1995) Receptor-dependent mechanisms
of cell stimulation by bacterial endotoxin. Annu Rev Immunol
13:437457. doi:10.1146/annurev.iy.13.040195.002253
27. Lemaitre B, Nicolas E, Michaut L, Reichhart JM, Hoffmann JA
(1996) The dorsoventral regulatory gene cassette spatzle/Toll/
cactus controls the potent antifungal response in Drosophila
adults. Cell 86:973983. doi:10.1016/S0092-8674(00)80172-5
Mol Biol Rep (2009) 36:10991105 1105
1 3