M olecular biology is having a profound im pact in m ost areas of the

biosciences. To date, the tools of m olecular biology have not been directly
applied to the study of Fasciola hepatica to any great extent. W here they
have been applied it has been w ith essentially tw o aim s. These have been to
utilize the ability of appropriate expression system s to produce quantities of
uke proteins for further study generally as potential vaccines or to m ake
use of the unique ability of this technology to provide inform ation relating to
genetic organization and diversity. This chapter deals w ith the lim ited inroads
achieved to date and uses inform ation obtained from related organism s to
obtain an insight into the m echanism s that contribute to the survival of F.
hepatica. As the concepts underlying research in genetic diversity m ay not be
fam iliar to those w ith a background in m olecular sciences, w e have included
an introduction to this area w hich w e hope w ill allow readers to appreciate
the potential for the application of m olecular biological techniques to these
questions.
G enetic diversity w ithin a species is the fundam ental m aterial upon w hich
selective environm ental pressures can act. It is thus essential for the process of
evolution. As a digenic parasite Fasciola is found in both m am m als and
m olluscs. W ithin the de nitive m am m alian host there m ay be great differences
in the environm ent to w hich the uke is exposed. This m ay range from the
highly surfactant m ilieu of the bile duct to the physiologically less extrem e
environm ent of the gastrointestinal tract, peritoneal cavity and liver
parenchym a. W hile physiologically less dem anding these latter regions m ay
present their ow n dangers for the uke as it is here that the hosts im m une
effector m echanism s w ill be m ost active. The free-living m iracidium encounters
14 Molecular Biology
MICHAEL PANACCIO
1
AND ALAN TRUDGETT
1
1
Nomura/JAFCO Investments (Asia) Ltd, Level 44, 55 Collins Street,
Melbourne 3000, Australia;
2
School of Biology and Biochemistry, Medical
Biology Centre, The Queens University of Belfast, 97 Lisburn Road, Belfast
BT9 7BL, UK
Introduction
CAB INTERNATIONAL 1999.
Fasciolosis (ed. J.P. Dalton) 449
Genetic Diversity and its Role in the Biology of Fasciola hepatica
a com pletely different environm ent in w hich it has to nd and infect a snail,
and w ithin the snail the sporocysts face new pressures. This succession of
contrasting environm ents, each w ith its ow n set of selective pressures, is itself
changing as the snail and m am m alian hosts w ill also be subject to genetic
diversity and hence selection for certain traits, w hich m ay include resistance to
parasitism by Fasciola.
There are constraints im posed on the divergence of genetic m aterial in
that it is necessary not only for the products of the genes involved to
continue to function and interact w ith other genes of the uke but there m ust
also be lim its beyond w hich if the parasite changes it w ill no longer be able
to interact w ith and survive in its tw o hosts.
The m echanism s by w hich diversity can arise are the sam e for Fasciola as
for other organism s but again there are certain unique points w hich m ay
affect the rate at w hich diversity can arise. The liver uke is a herm aphroditic
species, w hich m ay confer the ability to m aintain a population w here the
parasite is greatly overdispersed, but under these circum stances there w ill
also be an accom panying tendency tow ards a genetically hom ogeneous
population. This w ill be exacerbated by the production of rediae follow ing
asexual divisions in the snail (polyem bryony). A single m iracidium m ay give
rise to 600 cercariae. The overdispersal of parasites, herm aphroditism ,
polyem bryony and the need for the life cycle of the parasite to be interw oven
w ith tw o hosts m ay all act to reduce the rate at w hich genetic diversity can be
exhibited. H ow ever, these factors do not affect the selective pressures
w orking tow ards the creation of genetically diverse populations. These selec-
tive pressures m ay be considered as falling into tw o groups.
1. Habitat variability. In Fasciola it could be considered to be advantageous
to the spread of the parasite if there w ere to be m inim al restrictions on the
range of host species in w hich the parasite com pletes its life cycle. The de ni-
tive m am m alian hosts are generally sheep or cattle but Fasciola does not seem
to be speci c to this group alm ost any m am m al that ingests m etacercariae
m ay be infected. The interm ediate host is a freshw ater snail; in Europe this is
generally of the fam ily Lym naeidae but other snails ful l this role elsew here.
O ne m ight expect that there w ould be a trend tow ards the selection of certain
alleles associated w ith particular prim ary and secondary hosts. W ith the w ide
geographic range of Fasciola it m ight be expected that som e degree of
allopatric speciation (speciation due to geographic isolation) w ould have
occurred. W e m ight assum e that fascioliosis originated in Eurasia as an infec-
tion of herbivores living in tem perate clim ates as em bryonation is inhibited
below 10C and hatching of the eggs requires a tem perature of 22C or
greater. The spread of fascioliosis to the Am ericas and Australasia has been
brought about by the introduction of infected livestock from Europe. This has
necessitated Fasciola nding a different species of snail to serve as its
secondary host in these continents.
2. Host immune system variability. Both the de nitive and interm ediate hosts
possess system s to lim it infection. In outbred populations there w ill be a
variation in the effectiveness of this response w hich w ill relate to the balance
450 M. Panaccio and A. Trudgett
betw een different effector system s brought into play (see Chapter 10 of this
volum e). This serves as a further selective pressure on the uke population
and w here the adaptive im m une system is involved it m ight be expected to
lead to the developm ent of antigenically diverse strains. W here the hosts m ay
be of different species in different geographical areas, as is the case w ith the
interm ediate host for Fasciola, then the conditions exist for the developm ent
of sym patric evolution (speciation w ithin a geographical area) w hich m ay
serve to increase diversity.
An assessm ent of the genetic diversity of Fasciola hepatica has the potential
to answ er several questions, som e of interest to the theoretical biologist w hile
others m ay have im portant consequences for applied biologists concerned
w ith the control of fascioliosis. Am ong these questions are the follow ing:
1. H as co-evolution occurred betw een Fasciola and its hosts? If this w ere to
be the case, then one m ight expect to see the developm ent of strains w hich
preferentially infect certain species of snail or a divergence betw een the
ukes found in cattle and those found in sheep.
2. The life cycle of the parasite m akes it extrem ely susceptible to founder
effects w hen introduced into new geographical areas. W ould this result in the
developm ent of unique strains in those regions (such as Australasia and the
Am ericas) w here it has been im ported in historical tim es?
3. G enetic diversity is necessary for the selection of strains resistant to either
drugs or the hosts im m une response. Bearing in m ind the probable existence
of alm ost clonal populations due to founder effects are w e m ore likely to see
the developm ent of resistance occurring in Eurasian populations than in
those of Australia/Am erica?
Morphology. This is the oldest technique and has been the basis of the
determ ination of species w ithin the fasciolids. Its lim itations are illustrated
by the failure of m orphological techniques to allow the determ ination of
species of Fasciola from Japan (K endall, 1965). There have been
occasional com m ents in the literature suggesting that ukes from cattle are
larger than those from sheep but no de nitive study has been reported.
Isoenzyme patterns. Isoenzym es encoded by different loci m ay show , as
a result of changes in am ino acid sequence, differences in m igration rates
during electrophoresis. This provides a m eans of studying the variability
of speci c alleles encoding the enzym es w hose presence m ay be
revealed by the use of an appropriate substrate. This technique has been
successfully applied to the question as to the origin of Japanese Fasciola
species (Agatsum a et al., 1994).
Antigenic diversity. The production of m onoclonal antibodies speci c for
the m ajor tegum ental antigen and other proteins of the uke (H anna and
Molecular Biology 451
The importance of genetic diversity for Fasciola hepatica
The techniques of genetic diversity studies parameters measured
Trudgett, 1983; H anna et al., 1988) provided the opportunity to determ ine
w hether m ajor antigenic differences existed betw een populations of
ukes. Although no system atic study has been carried out in this area
there are no reports indicating that antigenic diversity poses a problem
for potential vaccination program m es. Although diversity m ay be seen in
the am ino acid sequence of tegum ental antigens (see below ) the struc-
tural m otif is m aintained and as such it is probable that their ability to
function as epitopes is not com prom ised.
Restriction enzyme mapping. Restriction enzym es cleave D N A at sites
bearing speci c sequences. Thus EcoRI w ill cleave D N A at each
G AATTC, Sau961 at each G G N CC and HaeIII at each G G CC. The
probability of these sites occurring in a sequence and hence the size of
the resulting fragm ents is a function of the size of the site. Six-m ers such
as the cleavage site of EcoRI occur m ore rarely (every 4096 bases on
average w ith an AT usage of 50% ) than four-m ers (every 256 bases).
The correct choice of enzym e w ill give a num ber of w ell-de ned bands
readily resolvable after agarose electrophoresis. This technique has been
used to distinguish betw een fasciolid species but m ay not be of suf -
cient discrim ination to detect variation betw een individuals (Blair and
M cM anus, 1989).
Sequence analysis. W ith the advance of m olecular biology its techniques
are being increasingly applied to a w ide range of biological problem s.
Although, theoretically, sequence data provide the ultim ate argum ent in
discussions of genetic diversity caution m ust be exercised in the inter-
pretation of such evidence. G enerally speaking in these studies only
short sequences produced by polym erase chain reaction (PCR) am pli ca-
tion have been sequenced and the degree of diversity that they can be
expected to exhibit w ill vary w ith their function in the ukes genom e.
Expressed sequences w ill be required to m aintain structural features
required for their function this w ill w ork against the generation of
diversity by genetic drift but m ay also com e under selective pressures
w hich w ill encourage the developm ent of variant form s. U nexpressed
regions of the genom e such as introns w ill not be exposed to these
in uences and therefore m ay not show the sam e rate of variability. Little
is know n of the genom ic structure of fasciolids and although large
intronic sequences have been reported for schistosom es (M arkovics et al.,
1994) it has been suggested that they m ay be of lim ited size in Fasciola
hepatica (Panaccio and G ood, 1998).
In com parison to schistosom es there are few published papers w hich deal
directly w ith variability w ithin Fasciola hepatica. There are reports of size
differences betw een ukes from cattle and those from sheep and one study
show ed that the ionic com position of ukes from cattle differs from sheep
ukes (Caseby et al.,1995), although these ndings m ay re ect physiological
adaptations by the uke to different environm ents rather than genetically
452 M. Panaccio and A. Trudgett
Evidence for diversity in fasciolids
determ ined traits. U sing restriction enzym e m apping of ribosom al D N A, Blair
and M cM anus (1989) studied 21 ukes w hich differed in their geographical
origin sam ples being provided from M exico, Ireland, N ew Zealand,
Australia, H ungary and Spain. The Australian sam ples w ere from w ell-
established strains, m aintained by Professor J.C. Boray, w hich had been
passaged through differing de nitive and interm ediate hosts and in som e
cases selected for resistance to salicylanilides. W ithin the species there w as no
variation in restriction sites but there w as considerable variation in the size of
the non-transcribed spacer region (N TS). N TS from individual ukes ranged in
size from 5.38 kb to 8.74 kb, suggesting that considerable genetic diversity
m ay exist in the eld. Interpretation of these results is com plicated, how ever,
by the nature of the N TS. In schistosom es this is know n to be com posed of a
series of repeats and as such is constrained in its sequence variability.
Another exam ple of the use of a region w hich m ay be constrained in its
variability is the second internal transcribed spacer (ITS1) region of ribosom al
D N A. W orking w ith this region Adlard and colleagues (1993) w ere able to
distinguish species differences w ithin the fasciolids but found only one
nucleotide change in 600 bp of sequence from Fasciola hepatica specim ens
isolated from N ew Zealand, M exico, H ungary and Australia (0.4% ). U sing both
ITS1 and the m itochondrial gene N D 1 they com pared ukes from cattle and
sheep and from a variety of geographical locations (D osay et al., 1996). A
greater am ount of sequence divergence for both genes (17% ) w as found,
w ith ukes collected in Ireland show ing greater diversity than specim ens from
the Am ericas (Trudgett, personal com m unication). It is probably prem ature to
conclude that this is evidence for the N ew W orld ukes exhibiting the founder
effect proposed above, although recent evidence that the interm ediate host for
F. hepatica in Bolivia Lymnaea viatrix is probably of European origin m ay
strengthen this association (JabbourZahab et al., 1997). Parsim ony analysis of
the data yielded trees w ith m ixed groupings of ukes derived from cattle and
sheep suggesting that co-evolution w ith the de nite hosts has not occurred
to a degree that w ould be re ected in changes in regions of the genom e not
directly in uenced by the selective factors.
There is, how ever, indisputable evidence for host effects in selecting
strains of ukes. Professor Boray and colleagues have reported variability in
the isoenzym e patterns of glutathione S-transferase (G ST) from isolates of
ukes from cattle, sheep and rats. Cattle ukes show ed the greatest variability.
The level of G ST activity w as low est in those hosts w hich becam e resistant to
reinfection by Fasciola, and w as interpreted as being the result of m odulation
of the activity by the host im m une system (M iller et al., 1993). A further
exam ple of diversity induced by the host im m une response is seen in Fig.
14.1. The T1 antigen provides the m ajor antigenic stim ulus during the m igra-
tion of the uke in the de nitive host (H anna and Trudgett, 1983). The
carboxy term inal regions of T1 isolated from different ukes show great varia-
tion in their sequence w hile m aintaining their structural con guration and anti-
genicity.
These data m ay underestim ate the degree of variability in the T1 protein,
as part of the procedure by w hich the sequence data w ere obtained involved
Molecular Biology 453
im m unoscreening of cD N A libraries. Any variants w hich had changed
suf ciently to destroy the m ajority of their epitopes w ould have escaped
detection.
The high degree of variation seen in the TI proteins has also been
con rm ed in other proteins. From a cD N A library produced from Com pton
Paddock F. hepatica m RN A it is rare that totally identical cD N As encoding the
sam e protein can be obtained (Panaccio and G ood, 1998). O ver 50 G ST
clones w ere isolated and found to encode four distinct classes of G STs,
G ST-1, G ST-7, G ST-47 and G ST-51 (Panaccio et al., 1992). H ow ever, each
clone of the sam e class had m inor nucleotide changes that distinguished it
from other clones. This sam e phenom enon w as also observed for cathepsin
proteases. O f the ten cathepsin L1 cD N A isolated none w ere com pletely
identical. It is highly likely that these differences are not the products of
different genes but a re ection of the genetic diversity found w ithin the
population. M ost of the m olecular characterization of F. hepatica is based on
uke derived from Com pton Paddock Laboratories w hich are not derived
from a clonal source. It is therefore necessary to produce strains of F.
hepatica that have been derived from a single individual before one can
conclude that these observations are due to the genetic diversity found w ithin
F. hepatica populations.
From the lim ited evidence presented above it w ould appear that there is
genetic diversity in uke populations in the eld. The reliance by m any
laboratories on m etacercariae derived from a single supplier, coupled w ith
the asexual reproductive stages in the life cycle and founder effects outside
Eurasia, m ay have served in the past to obscure this phenom enon w hen
using traditional techniques.
G enetic variants becom e apparent w hen conditions change to favour their
selection. In recent years w e have seen the dom inance of triclabendazole in
the treatm ent of fasciolosis. This has to som e extent overshadow ed the
dem onstration of the developm ent of strains of uke resistant to other
454 M. Panaccio and A. Trudgett
Fig. 14.1. Diversity in tegumental protein (T1) carboxy terminal sequences: 1,
sequence from ukes grown in rats using metacercariae supplied by Compton; 25,
sequences from ukes obtained from different cattle at slaughter. Conserved residues
are underlined, many of the substitutions are conservative, i.e. T/S, V/L. (A. Trudgett,
A.T. McNair, E. Hoey and P. Ramasamy, unpublished data.)
The Practical Importance of Diversity
ukicides such as the salicylanilides in eld populations (Boray, 1990). M ore
recently, and perhaps inevitably, there are now reports of resistance to
triclabendazole in Australia and Europe (O verend and Bow en, 1995). In order
to deal w ith this potentially devastating problem , those seeking control of
ukes by either chem otherapy or vaccination w ill, in the future, be conscious
of the need to develop treatm ent strategies w hich allow for genetic diversity in
the target population. For this to be done in a rational m anner there is a need
for considerably m ore research to determ ine the extent of diversity in dem es
(local population of interbreeding individuals) in the regions in w hich control
is to be attem pted. This necessity prom otes the study of genetic diversity from
an interesting question for evolutionary biologists to a prom inent position in
our arm oury against parasite disease.
The inability of F. hepatica to synthesize nucleotides de novo m ay in fact
be a contributing factor to the developm ent of genetic diversity. U sing
standard m olecular techniques it has been know n for som e tim e that D N A
polym erases of high delity can be forced to m ake errors by m anipulating
the concentration of each of the four nucleotides necessary for D N A
synthesis. Since adult parasites have a relatively high rate of egg production,
their requirem ents for each nucleotide m ust also be high. U nder certain
biological situations, for exam ple in calci ed bovine bile ducts, it m ay be
extrem ely dif cult for F. hepatica to scavenge from its host all the necessary
raw m aterials to m aintain its rate of egg output and hence D N A synthesis. In
these situations the D N A synthesis m achinery m ight be forced into m aking a
high degree of errors w hich are then passed on to future generations.
It has been know n for som e tim e that trem endous changes in uke biology
m ust occur during the developm ent of m ature uke from m etacercariae. The
best described m etabolic changes are those that occur in energy m etabolism
(review ed by Tielens, 1994; see also Chapter 8 of this volum e). For exam ple,
new ly excysted juveniles rely solely on the K rebs cycle for energy. By day 20,
aerobic acetate production is the m ain energy source w hile by day 50, the uke
rely on anaerobic dism utation. These changes in uke biology are a function of
the changing size and developm ent stage of the uke, the changing environ-
m ent w ithin the host and the need to evade the hosts im m une response.
Tkalcevic et al. (1997) used three speci c m onoclonal antibodies, FY 31,
FY 32 and FY 47 to dem onstrate that the antigens recognized by these
antibodies are expressed for only 2 days follow ing infection. This study
provides direct evidence that uke rapidly express different proteins for short
periods during developm ent.
M olecular techniques such as differential display can be applied to rapidly
identify stage-speci c m olecules (Liang and Pardee, 1992; Liang et al., 1992).
Since differential display w as developed there have been m any im provem ents
Molecular Biology 455
The Application of Molecular Biological Techniques to Other Areas of
the Biology of Fasciola hepatica
Stage-specic expression and its importance in the development of Fasciola hepatica
to this technique (Liang et al., 1993; Li et al., 1994). A sim ple differential
display technique involves using a random com bination of tw o ten-m er
prim ers to am plify cD N A that w as produced from m RN A using only one of the
prim ers. If the resulting PCR fragm ents incorporate a radioactive label the
resultant products can be displayedon D N A sequencing gels. The pow er of
this technique lies in the ability to perform identical displays using different
starting sources of m RN A. For exam ple, displaying side by side the PCR
products derived from both m ature and im m ature uke allow s one to identify
w hich transcripts are com m on to both developm ental stages and w hich are
unique to each stage. The technique is designed to detect absolute differences
in gene expression but in practice also detects som e quantitative differences.
Reed (1997) used differential display to study the differences in gene
expression betw een m ature and im m ature uke (14 days post-infection). For
any given prim er com bination used to produce these displays there w ere, on
average, 22% apparently adult-speci c and 14% apparently im m ature-speci c
cD N A products able to be identi ed. These differences in percentages relate
to the total num ber of bands produced from each prim er com bination using
m RN A from each developm ental stage. Assum ing that an adult uke expresses
betw een 2000 and 5000 genes at any one tim e, this study suggests that
approxim ately 4001000 genes could be speci c to the adult stage w hen
com pared w ith 14-day-old ukes. This num ber m ay be feasible w hen one
considers the num ber of genes needed for reproduction and feeding. These
results are consistent w ith the notion that there is a very high degree of
differential gene expression during parasite developm ent.
To con rm that the differences observed in the displays did in fact indicate
differential gene expression Reed (1997) isolated several cD N A fragm ents
speci c to im m ature parasites and used them to screen an im m ature uke
cD N A library. O ne clone identi ed an abundant 400500 bp RN A species by
N orthern blot that w as expressed at levels at least tenfold higher in im m ature
parasites relative to adult parasites. The rem aining cD N A fragm ents (D D 14,
D D 16, D ISP10 and D ISP2) w ere apparently expressed at levels below the
sensitivity lim its of N orthern analysis, although differential expression of these
transcripts w as con rm ed by the m ore sensitive reverse transcriptase PCR
(RT-PCR) technique. This study dem onstrates the utility of differential display to
study even rare m RN A transcripts. Apart from their stage-speci c expression
pattern the function of D D 14, D D 16, D ISP10 and D ISP2 is not know n since
these sequences do not have any hom ology to any know n genes. The
system atic application of differential display and related techniques w ill provide
an understanding of the changing patterns in gene expression during uke
developm ent. H ow ever, currently the m olecular m echanism by w hich uke are
able to regulate the com plex changes in gene expression is not know n.
In nem atodes, m any m RN As have been show n to contain a com m on 5
term inal sequence, term ed a spliced leader (SL). This sequence is added to
456 M. Panaccio and A. Trudgett
Possible role of trans-splicing of premessenger RNAin facilitating stage-specic
expression
the 5 end of m RN A transcripts in a trans-splicing reaction in w hich the 5
term inal exon from a SL RN A is spliced on to a m RN A transcript. The SL RN A
is a trim ethylguanosine capped 100 nt RN A w hich is bound to Sm protein and
is contained w ithin a sm all nuclear ribonucleoprotein particle (Thom as et al.,
1988; Van D oren and H irsh, 1988; Van D oren and H irsh, 1990). The process
of trans-splicing is very sim ilar to the conventional nuclear pre-m RN A
splicing (cis-splicing) that rem oves introns from prim ary transcripts. In fact
both trans-splicing and cis-splicing are catalysed by the sam e snRN Ps
(Thom as et al., 1988; H annon et al., 1991), proceed through a branched inter-
m ediate (M urphy et al., 1986; Sutton and Bothroyd, 1986; Bektesh and H irsh,
1988; Thom as et al., 1988) and use the sam e splice site border sequences
(H uang and H irsh, 1992 ).
Caenorhabditis elegans is the best studied system for trans-splicing in
nem atodes. At least tw o SL sequences have been described, SL1 (Bektesh et
al., 1988; Takacs et al., 1988; N ilsen et al., 1989) and SL2 (H uang and H irsh,
1989). SL1 is the m ost com m only used splice leader sequence found on
5080% of m RN A transcripts (N ilsen, 1993). SL1 is conserved in all nem atode
species studied thus far (Bektesh et al., 1988; Takacs et al., 1988; N ilsen et al.,
1989). SL2 has been found in only tw o m RN As of C. elegans (H uang and
H irsh, 1989; O kkem a and K im ble, 1991). In vivo experim ents suggest SL1 is
trans-spliced to prim ary transcripts w hich begin w ith an intron (term ed
outron). In contrast, SL2 is trans-spliced to dow nstream coding regions of
polycistronic m RN A precursors (Spieth et al., 1993).
Trans-splicing has also been show n to occur in som e trem atodes. In
contrast to the conservation in spliced leader sequence w ithin the nem atodes,
spliced leader sequences have not been found to be conserved in
trem atodes. Rajkovic et al. (1990) found that the spliced leader sequence of S.
mansoni failed to hybridize to m RN A from F. hepatica. Recently, D avis et al.
(1994) described a spliced leader gene of F. hepatica and provided the rst
evidence that trans-splicing occurs in Fasciola. The spliced leader sequence
w as found to be 37 nucleotides in length and as predicted by Rajkovic et al.
(1990) is not conserved w ith the spliced leader found in S. mansoni.
Trem atode spliced leader sequences have not been as w ell conserved as
w ithin nem atode species. The percentage of m RN A transcripts of F. hepatica
that are trans-spliced is unknow n. D avis et al. (1994) have identi ed 19
m RN A transcripts that are trans-spliced. O nly for one of these m RN A
transcripts w as the protein encoded identi ed (G enbank Accession N o.
U 10297).
FH 37-NT AACCTTA ACGGTTCTCTGCCCTGTATATTAGTGCATG
SM 36NT AACCGTC ACGGTTTTACTCT TGTGATTTGTTGCATG
CONSENSUS AACC T ACGGTT T C TGT TT TGCATG
The function of trans-splicing is currently unknow n. There is strong
evidence that trans-splicing, at least in nem atodes, is not obligatory for any
general aspect of m RN A m etabolism (Conrad et al., 1991, 1993). N ilsen (1993)
suggested that trans-splicing m ay play a role in the processing of polycistronic
transcription units. D avis and H odgson (1997), using prim er extension, RT-PCR
Molecular Biology 457
and RN ase m apping, dem onstrated that tw o closely linked genes in S.
mansoni, the enolase gene and the gene encoding a com ponent of ubiquol
cytochrom e c reductase com plex, are transcribed on a single RN A transcript
that is processed into m onocistronic m RN As. It is interesting to note that the
close linkage of these tw o genes is also conserved in F. hepatica.
The synthesis of polycistronic RN A follow ed by trans-splicing m ay in fact
be the m echanism by w hich F. hepatica is able to achieve the rapid changes
in protein expression during developm ent. As show n in Fig. 14.2, genes that
are expressed at the sam e developm ental stage are predicted to be physically
linked on the genom e. Expression of the polycistronic unit w ill result in the
sim ultaneous production of all proteins encoded by the unit. For exam ple,
FY 31, FY 32 and FY 47, w hich share the sam e stage-speci c expression
pattern, are predicted to be encoded by genes that are physically linked and
form part of the sam e polycistronic unit.
Adlard et al. (1993), using the second internal transcribed spacer, dem onstrated
that the identity betw een F. hepatica and F. gigantica w as 97.2% and that
betw een F. hepatica and Fascioloides magna w as 86.8% . They w ere also able
to show that the Fasciola species from Japan w as alm ost identical to F.
gigantica. This w ork w as recently con rm ed by H ashim oto et al. (1997) w ho
used the second internal transcribed spacer and m itochondrial cytochrom e c
oxidase subunit I sequences to show that the Japanese Fasciola species w as a
strain of F. gigantica.
458 M. Panaccio and A. Trudgett
Fig. 14.2. Demonstration of how a polycistronic mRNA leads to co-expression.
The relationship of Fasciola hepaticato other species as revealed by sequencing
studies
A m axim um parsim ony tree based on 18S sequences (Panaccio and
G ood, 1998) revealed that the m olecular phylogenetic tree w as very sim ilar to
that derived on taxonom ic features except for a few notable differences. A
m olecular tree suggests that Fellodistomun fellis should be in the order
Echinostom ida rather that Strigeatida. The suborder Param phistom ata should
be in an order of its ow n rather than a suborder of Echinonostom ida. It is
questionable w hether the fam ily Schistosom a should m ap w ithin the subclass
D igenea.
The cloning strategies applied to the study of F. hepatica have been lim ited.
The m ajority of w orkers have used antisera to identify expressed proteins
from cD N A libraries. This approach has led to the isolation of G ST (Panaccio
et al., 1992), cathepsin L proteases (Yam asaki and Aoki, 1993; W ijfffels et al.,
1994; D ow d et al., 1997; Roche et al., 1997), arc-2 (M uro et al., 1994), fatty
acid binding protein (Rodrigues-Perez et al., 1992), peroxiredoxin (M cG onigle
et al., 1997) and a gut m ucin-like protein (M arin et al., 1992).
O ne of the m ore interesting cloning strategies w as em ployed by H eussler
and D obbelaere (1994) w here they used prim ers hom ologous to the active sites
of cathepsin proteases to am plify cD N A fragm ents encoding this enzym e. Their
w ork w as a signi cant advance in that they w ere able to dem onstrate that F.
hepatica expresses a fam ily of cathepsin L proteases as w ell as cathepsin B
proteases. Localization studies have dem onstrated that cathepsin L proteases
are expressed in the intestine and are a m ajor com ponent of secreted/excreted
protein (Yam asaki and Aoki, 1993; W ijffels et al., 1994). H ollyw ell (personal
com m unication) localized the site of cathepsin L expression to the M ehlis gland
as w ell as the intestine. These data suggest that apart from playing a role in
feeding, cathepsin L proteases play a role in egg production possibly through
the processing of eggshell precursor proteins. Even though cathepsin B
proteases had been dem onstrated to play an im portant role in feeding in S.
mansoni the role of this enzym e in F. hepatica is unclear. H ow ever, Creaney et
al. (1996) have localized the expression of cathepsin B proteases to the gut
lum en and to secretory granules w ithin the gut epithelia in juvenile uke.
The random cloning of transcripts containing spliced leader sequences as
dem onstrated by D avis et al. (1994) is a rapid m ethod to identify genes that are
part of polycistronic units. In nem atodes, approxim ately 80% of all genes are
predicted, based on the occurrence of spliced leader sequences, to be found in
polycistronic units. The num ber of F. hepatica genes involved in trans-splicing
is unknow n. The com bination of differential display and probing for spliced
leader sequences w ill provide a rapid m ethod for determ ining the potential
role trans-splicing plays in coordinating stage-speci c expression.
For m olecular biology to provide further functional data it is necessary that a
suitable transform ation is developed for the expression of F. hepatica
Molecular Biology 459
Cloning Strategies Applied to Fasciola hepatica
Expression of Fasciola hepaticaproteins
proteins. A transform ation system for F. hepatica or any other trem atode has
not yet been described. The developm ent of a reliable continuous culturing
system for F. hepatica cells w ould be an im portant rst step.
Currently studies on protein function are reliant on expression in other
system s. Even though the transform ation system s of choice for F. hepatica
w ould be the nem atode C. elegans due to its relatively sim ple transform ation
m ethod, to our know ledge, expression of a F. hepatica protein in C. elegans
has not been attem pted. G rant (1992) successfully used parasite genes from
Trichostrongylus colubriformis to successfully transform C. elegans. The
availability of genetic m utants of C. elegans w ould allow com plem entation
studies to be perform ed using F. hepatica D N A.
Escherichia coli, due to its ease of use, is the m ost w idely used expression
system . The success of obtaining functional F. hepatica proteins in this system
has been som ew hat lim ited. A notable exception is the expression of
glutathione S-transferase (G ST). D ue to the high solubility of this protein, high
yields of soluble recom binant G ST have been obtained using E. coli
expression. N ot only have the rG ST (recom binant G ST) retained the ability to
bind glutathione, enzym e studies con rm ed that the rG ST have the sam e
enzym atic activities as their native counterparts (Salvatore et al., 1995). The
puri cation of active rG ST has allow ed the substrate speci cities of the four
described m u G STs to be determ ined. Creaney et al. (1995), using rabbit sera
raised to peptides speci c to each G ST, w ere able to con rm that the different
G STs have different sites of expression in adult parasites. Together these
studies provide a basic understanding of the substrate speci city and site of
expression of each G ST.
This success is in total contrast to the failure of E. coli to express
functional cathepsin proteinase. Even though Fhcat-L1 and Fhcat-L2 could be
obtained in very high yields (3040 m g) of puri ed recom binant protein per
litre of culture, the protein w as totally insoluble and localized to inclusion
bodies. The failure to encode the prepropeptides m ay have signi cantly
contributed to the failure to produce soluble protein.
Roche et al. (1997) w ere able to express active Fasciola cathepsin L1 in
Saccharomyces cerevisiae. The recom binant cathepsin L1 had sim ilar
speci cities for substrates w ith hydrophobic residues in the P2 position as the
native cathepsin L1. They dem onstrated that to obtain functionally active
enzym e, it w as necessary to express the com plete prepropeptide. D ow d et al.
(1997) used the sam e approach to express F. hepatica cathepsin L2 in S.
cerevisiae, and obtained a functionally m ature enzym e.
The expression of biologically active recom binant protein has now
allow ed the substrate speci cities of a num ber of F. hepatica enzym es to be
determ ined. This w ork is especially relevant w hen ascribing possible
functions to m em bers of a highly related gene fam ily.
Even though the am ount of freely available D N A sequence data of F. hepatica
is lim ited, being restricted to a total of 89 partial and com plete sequences, the
460 M. Panaccio and A. Trudgett
The More We Know the Less We Understand
data raise m ore questions than solutions. O f the 19 trans-spliced genes
identi ed by D avis (1994) only one transcript w as hom ologous to any know n
gene. This result is a re ection of both the lim ited size of the D N A sequence
databases and the evolutionary distance F. hepatica is from m ost studied
organism s. In a few cases w here sequenced databases have provided a clue
to the identity of a m olecule, its function w ithin F. hepatica often rem ains
unclear. For exam ple, Reed (1997) described a m olecule w ith a high degree
of identity to am oebapore, a m olecule found in Entamoeba histolytica and
involved in cell lysis (Leippe et al., 1994). The role of the am oebapore-like
m olecule in F. hepatica is unknow n. Likew ise, Bozas et al. (1995) described a
low m olecular m ass m onom eric protein that had signi cant sim ilarity to the
K unitz-type (BPTI) fam ily of proteinase inhibitors. Im m unolocalization
studies revealed that Fh-K TM is localized to the gut, parenchym al tissue and
the tegum ent of adult parasites. The possible role of this proteinase inhibitor
in F. hepatica is unknow n.
The m olecular biology of F. hepatica is very m uch still in its infancy. W e still
do not understand the m echanism w hich drives the genetic diversity seen in
F. hepatica populations and the m echanism by w hich ukes can coordinate
the com plex changes in gene expression that need to occur during develop-
m ent. W ith techniques such as differential display and in situ PCR the
developm ental stage of expression and site of expression of any gene can be
quickly determ ined. The use of C. elegans as a m ajor genetic m odel, together
w ith its sequenced genom e, w ill provide m olecular biologists w ith a pow erful
tool w hich w ill greatly facilitate a better understanding of F. hepaticas
m olecular biology.
Adlard, R.D ., Barker, S.C., Blair, D . and Cribb, T.H . (1993) Com parison of the second
internal transcribed spacer (ribososm al D N A) from populations and species of
Fasciolidae (D igena). International Journal for Parasitology 23, 423425.
Agatsum a, T., Terasaki, K ., Yang, L. and Blair, D . (1994) G enetic variation in the
triploids of Japanese Fasciola species, and relationships w ith other species in the
genus. Journal of Helminthology. 68, 181186.
Bektesh, S. and H irsh, D . (1988) C. elegans m RN As acquire a spliced leader through a
trans-splicing m echanism . Nucleic Acids Research 16, 5692.
Bektesh, S., Van D oren, K . and H irsh, D . (1988) Presence of the Caenorhabditis
elegans spliced leader on different m RN As and in different genera of nem atodes.
Genes and Development 2, 12771283.
Blair, D . and M cM anus, D .P. (1989) Restriction enzym e m apping of ribosom al D N A
can distinguish betw een fasciolid (liver uke) species. Molecular and
Biochemical Parasitology 36, 201208.
Boray, J.C. (1990) D rug resistance in Fasciola hepatica. In: Boray, J.C., M artin, P.J. and
Roush, R.T. (eds) Resistance of Parasites to Antiparasitic Drugs. M SD AG VET,
M erck & Co., Rahw ay, N ew Jersey, N o. 51, pp.5160.
Molecular Biology 461
Conclusion
References
Bozas, S.E., Panaccio, M ., Creaney, J., D osen, M ., Parsons, J.C., Vlasuk, G .V., W alker, I.D .
and Spithill, T.W . (1995) Characterisation of a novel K unitz-type m olecule from the
trem atode Fasciola hepatica. Molecular and Biochemical Parasitology74(1), 1929.
Caseby, R.H ., H arriot, M . and Fairw eather, I. (1995) Ionic com position of the liver
uke Fasciola hepatica from different m am m alian hosts and com parison w ith
host bile. Parasitology Research 81, 394397.
Conrad, R., Thom as, J., Spieth, J. and Blum enthal, T. (1991) Insertion of part of an
intron into the 5 untranslated region of a Caenorhabditis elegansgene converts it
into a trans-spliced gene.Molecular and Cellular Biology 11, 19211926.
Conrad, R., Liou, R.F. and Blum enthal, T. (1993) Conversion of a trans-spliced C.
elegans gene into a conventional gene by introduction of a spliced donor site.
EMBO Journal 12, 12491256.
Creaney, J., W ijfells, G .L., Sexton, J.L., Sandem an, R.M ., Spithill, T.W . and Parsons, J.C.
(1995) Fasciola hepatica: localisation of glutathione S-transferase isoenzym es in
adult and juvenile liver uke. Experimental Parasitology 81, 106116.
Creaney, J., W ilson, L., D osen, M ., Sandem an, R.M ., Spithill, T.W . and Parsons, J.C.
(1996) Fasciola hepatica: irradiation-induced alterations in carbohydrate and
cathepsin-B protease expression in new ly excysted juvenile liver uke.
Experimental Parasitology 83(2), 202215.
D avis, R.E., Singh, H ., Botka, C., H ardw ick, C., M eanaw ay, M . and Villanueva, J.
(1994) RN A trans-splicing in Fasciola hepatica: identi cation of a spliced leader
(SL) RN A and spliced leader sequences on m RN As. Journal of Biological
Chemistry, 269, 2002620030.
D avis, R.P. and H odgson, S. (1997) G ene linkage and steady state RN As suggest trans-
splicing m ay be associated w ith a polycistronic transcript in Schistosoma
mansoni. Molecular Biochemical Parasitology 98, 2529.
D osay, M ., Trudgett, A. and Stanhope, M . (1996) A m olecular evolutionary genetic
perspective on biodiversity w ithin the liver uke Fasciola hepatica. Proceedings
of the British Society for Parasitology, Bangor, 1996.
D ow d, A.J., Tort, J., Roche, L., Ryan, T. and D alton, J.P. (1997) Isolation of a cD N A
encoding Fasciola hepatica cathepsin L2 and functional expression in
Saccharomyces cerevisiae. Molecular and Biochemical Parasitology 88, 163174.
G rant, W . (1992) Transform ation of Caenorhabditis elegans w ith genes from parasitic
nem atodes. Parasitology Today, 8, 244246.
H anna, R.E.B. and Trudgett, A. (1983) Fasciola hepatica: production of m onoclonal
antibodies speci c for the glycocalyx. Parasite Immunity 5, 409425.
H anna, R.E.B., Trudgett, A. and Anderson, A. (1988) Fasciola hepatica: developm ent of
m onoclonal antibodies against som atic antigens and their characterization by
ultrastructural localization of antibody binding. Journal of Helminthology62, 1528.
H annon, G .J., M aroney, P.A. and N ilsen, T.W . (1991) U sm all nuclear ribonucleo-
protein requirem ents for nem atode cis- and trans-splicing in vitro. Journal of
Biological Chemistry 266, 2279222795.
H ashim oto, K ., W atanobe, T., Liu, C.X., Init, I., Blair, D ., O hnishi, S. and Agatsum a, T.
(1997) M itochondrial D N A and nuclear D N A indicate that the Japanese Fasciola
species is F. gigantica. Parasitology Research 83, 220225.
H eussler, V. and D obbelaere, D . (1994) Cloning of a protease gene fam ily in Fasciola
hepatica using the polym erase chain reaction (PCR). Molecular and Biochemical
Parasitology 64(1), 1123.
H uang, X.-Y. and H irsh, D . (1989) A second trans-spliced RN A leader sequence in the
nem atode Caenorhabditis elegans. Proceedings of the National Academy of Sciences
USA 86, 86408644.
462 M. Panaccio and A. Trudgett
H uang, X.-Y. and H irsh, D . (1992) RN A trans-splicing. In: Setlow , J.K . (ed.) Genetic
Engineering. Plenum Press, N ew York, pp. 211229.
JabbourZahab, R., Pointier, J.P., Jourdane, J., Jarne, P., O viedo, J.A., Bargues, M .D .,
M asCom a, S., Angles, R., Perera, G ., Balzan, C., K hallayoune, K . and Renaud, F.
(1997) Phylogeography and genetic divergence of som e lym naeid snails,
interm ediate hosts of hum an and anim al fascioliasis w ith special reference to
lym naeids from the Bolivian Altiplano. Acta Tropica 64, 191203.
K endall, S.B. (1965) Relationships betw een the species of Fasciola and their m olluscan
hosts. Advances in Parasitology 3, 5998.
Leippe, M ., Andra, J., N ickel, R., Tannich, E. and M uller-Eberhard, H .J. (1994)
Am oebapores, a fam ily of m em branolytic peptides from cytoplasm ic granules of
Entamoeba histolytica: isolation, prim ary structure, and pore form ation in bacterial
cytoplasm ic m em branes. Molecular Microbiology 14(5), 895904.
Li, F., Barnathan, E.S. and K ariko, K .(1994) Rapid m ethod for screening and cloning
cD N As generated in differential m RN A display: application of N orthern blot for
af nity capturing of cD N As.Nucleic Acids Research 22, 17641765.
Liang, P. and Pardee, A.B. (1992) D ifferential display of eukaryotic m essenger RN A by
m eans of the polym erase chain reaction. Science257, 967971.
Liang, P., Averboukh, L., K eyom arsi, K ., Sager, R. and Pardee, A.B.(1992) D ifferential
display and cloning of m essenger RN As from hum an breast cancer versus
m am m ary epithelial cells. Cancer Research 52, 69666968.
Liang, P., Averboukh, L. and Pardee, A.B. (1993) D istribution and cloning of eukaryotic
m RN As by m eans of differential display: re nem ents and optim ization. Nucleic
Acids Research 21, 32693275.
M arin, M .S, Prieto, M ., M artin, J.M ., Casais, R., Boga, J.A. and Parra, F. (1992)
Identi cation and expression of a Fasciola hepatica gene encoding a gut antigen
protein bearing repetitive sequences. Molecular and Biochemical Parasitology
55(12), 155165.
M arkovics, A., Ram , D ., G rossm an, Z., Ziv, E., Lantner, F. and Schechter, I. (1994)
Cloning and characterisation of the Sm IM P25 integral m em brane protein of the
parasitic helm inth Schistosoma mansoni. Biochimica et Biophysica Acta Gene
Structure and Expression 1218, 273282.
M cG onigle, S., Curley, G .P. and D alton, J.P. (1997) Cloning of peroxiredoxin, a novel
antioxidant enzym e, from the helm inth parasite Fasciola hepatica. Parasitology
115, 101104.
M iller, C.M .D ., H ow ell, M .J. and Boray, J.C. (1993) H ost efects of glutathione s-
transferase activity in Fasciola hepatica. International Journal for Parasitology 23,
10731076.
M uro, A., M artin, F.S., Rodriguez-M edina, J.R. and H illyer, G .V. (1994) Identi cation of
genes that encode Fasciola-speci c arc 2 antigens. American Journal of Tropical
Medicine and Hygiene51(5), 684689.
M urphy, W .J., W atkins, K .P. and Agabian, N . (1986) Identi cation of a novel Y branch
structure as an interm ediate in trypanosom e m RN A processing: evidence for
Trans-splicing. Cell 47, 517525.
N ilsen, T.W . (1993) Trans-splicing of nem atode prem essenger RN A. Annual Review of
Microbiology 47, 413440.
N ilsen, T.W ., Sham baugh, J., D enker, J., Chubb, G ., Fraser, C., Putnam , L. and Bennett,
K . (1989) Characterisation and expression of a spliced leader RN A in the parasitic
nem atode Ascaris lumbricoides. Molecular and Cellular Biology 9, 35433547.
O kkem a, P.G . and K im ble, J. (1991) M olecular analysis of tra-2, a sex determ ining
gene in C. elegans. EMBO Journal 10, 171176.
Molecular Biology 463
O verend, D .J. and Bow en, F.L. (1995) Resistance of Fasciola hepatica to
triclabendazole. Australian Veterinary Journal 72, 275276.
Panaccio, M . and G ood, R.T. (1998) Recent advances in the m olecular biology of
Fasciola hepatica. In: Boray, J.C. (ed.) Immunology, Pathology and Control of
Fasciolosis. M SD AG VET, Rahw ay, N ew Jersey, pp. 5664.
Panaccio, M ., W ilson, L.R., Cram eri, S.L., W ijffels, G .L. and Spithill T.W . (1992)
M olecular characterisation of cD N A sequences encoding glutathione S-transferase.
Experimental Parasitology 74, 232237.
Rajkovic, A., D avis, R.E., Sim onsen, J.N . and Rottm an, F.M . (1990) A spliced leader is
present on a subset of m RN As from the hum an parasite Schistosoma mansoni.
Proceedings of the National Academy of Science USA, 87, 88798883.
Reed, M .B. (1997) D evelopm ental gene expression in Fasciola hepatica. PhD thesis,
The U niversity of M elbourne.
Roche, L., D ow d, A.J., Tort, J., M cG onigle, S., M cSw eeney, A., Curley, G .P., Ryan, T.
and D alton J.P. (1997) Functional expression of Fasciola hepatica cathepsin L1 in
Saccharomyces cerevisiae. European Journal of Biochemistry 245, 373380.
Rodriguez-Perez, J., Rodriguez-M edina, J.R., G arcia-Blanco, M .A. and H illyer, G .V.
(1992) Fasciola hepatica: m olecular cloning, nucleotide sequence, and expression
of a gene encoding a polypeptide hom ologous to a Schistosoma mansoni fatty
acid-binding protein. Experimental Parasitology 74(4), 400407.
Salvatore, L., W ijffels, G ., Sexton, J., Panaccio, M ., M ailer, S., M cCauley, I. and Spithill,
T.W . (1995) Biochem ical analysis of recom binant glutathione S-transferase of
Fasciola hepatica. Molecular and Biochemical Parasitology 69, 281288.
Spieth, J., Booke, G ., K uersten, S., Lea, K . and Blum enthal, T. (1993) O perons in C.
elegans: Polycistronic m RN A precursors are processed by transplicing of SL2 to
dow nstream coding regions. Cell 73, 521532.
Sutton, R.E. and Bothroyd J.C. (1986) Evidence for Trans splicing in trypansom es. Cell
47, 527535.
Takacs, A.M ., D enker, J.A., Perrine, K .G ., M aroney, P.A. and N ilsen, T.W . (1988) A 22-
nucleotide spliced leader sequence in the hum an parasitic nem atode Brugia
malayi is identical to the trans-spliced leader exon in Caenorhabditis elegans.
Proceedings of the National Academy of ScienceUSA 85, 79327936.
Thom as, J.D ., Conrad, R.C. and Blum enthal, T. (1988) The C. elegans Trans-spliced
leader RN A is bound to Sm and has a trim ethylguanosine cap. Cell 54, 533539.
Tielens, A.G .M . (1994) Energy generation in parasitic helm inths, Parasitology Today
10, 346352.
Tkalcevic, J., Brandon, M .R. and M eeusen, E.N . (1996) Fasciola hepatica: rapid
sw itching of stage-speci c antigen expression after infection. Parasite
Immunology 18, 139147.
Van D oren, K . and H irsh, D . (1988) Trans-spliced leader RN A exists as sm all nuclear
ribonucleoprotein particles in Ceanorhabditis elegans. Nature335, 556559.
Van D oren, K . and H irsh, D . (1990) m RN As that m ature through trans-splicing in
Caenorhabditis elegans have a trim ethylguanosine cap at their 5 term ini.
Molecular and Cellular Biology 10, 17691772.
W ijffels, G .L., Panaccio, M ., Salvatore, L., W ilson, L., W alker, I.D . and Spithill, T.W . (1994)
The secreted cathepsin L-like proteinases of the trem atode, Fasciola hepatica,
contain 3-hydroxyproline residues. Biochemical Journal 299(3), 781790.
Yam asaki, H . and Aoki, T. (1993) Cloning and sequence analysis of the m ajor cysteine
protease expressed in the trem atode parasite Fasciola sp. Biochemical Molecular
Biology International 31(3), 537542.
464 M. Panaccio and A. Trudgett