(Snustad 5e, Ch.

16: 234, 456-467, 469-482, and 486-
492; 511-513;
Snustad 6e, Ch.15: 397-426, 429-434, 455-461)
Dr. Ray Lu

Ch. 15. Genomics
Chapter 15&16-2
Overview
I. Structural genomics
 Genetic Mapping
• Restriction Fragment Length Polymorphism (RFLP)
• Minisatellite and microsatellite DNA (DNA fingerprint)
• Their applications: forensic analysis and paternity test
 Physical Mapping
• (Chromosomal) Contig Map
• Strategies to generate contig maps
• The Human Genome Project
• The Human HapMap Project
II. Comparative genomics
Chromosomal and genome evolution; Bioinformatics
III. Functional genomics
DNA microarray; Use fluorescent proteins as reporters

Chapter 15&16-3
Structural Genomics
- Genetic and physical mapping and sequencing of
entire genomes
• Genetic maps
– Low resolution (1 cM = ~1 mb)
– Use genetic markers (e.g., RFLP, mini- and micro-satellites)
• Physical maps
– Higher resolution (in 100 kb or smaller)
– Common physical maps:
• Restriction map
• STS (sequence-tagged site) map
• Contig map
Chapter 15&16-4
Genetic Mapping
• Based on the use of genetic markers
(Note: Genetics markers are not necessarily genes!)
• Map distance is the frequency of genetic
recombination between loci. Distance is measured by
centi-Morgan (cM).
• Examples:
– RFLP (restriction fragment length polymorphism)
– Minisatellites (VNTRs) and Microsatellites/Short Tandom
Repeats (STRs)
Chapter 15&16-5
Restriction fragment length polymorphism
(RFLP)
• DNA polymorphisms
– Nucleotide sequence variation among individuals within a
population;
– Used as genetic markers;
• RFLP
– DNA polymorphisms due to addition or deletion of
restriction sites;
– RFLP mapping is to detect the presence or absence of
restriction sites at a genetic locus by restriction digestion
followed by Southern hybridization.
Chapter 15&16-6
The mutational origin and detection of RFLPs in different
ecotypes of a species.
Chapter 15&16-7
Chapter 15&16-8
Minisatellites (VNTRs) and Microsatellites
(STRs)
• Satellite DNAs are repetitive DNA
– Minisatellites: variable number of tandem repeats (VNTRs)
of ~10 – 100 nucleotide (n.t.) long;
– Microsatellites: short tandem repeats (STRs) of ~2-9 n.t.
long;
• This form of DNA polymorphism is due to the
variable number of the repeats
• Highly polymorphic genetic marker
• They can be readily analyzed by PCR and Southern
blotting (or capillary gel electrophoresis)

Chapter 15&16-9
Simplified diagram of the use of variable number tandem repeats in
preparing DNA fingerprints.
FBI Combined DNA Index System (CODIS)
Chapter 15&16-10
Chapter 15&16-11
Chapter 15&16-12
Fig 16.11
Summary chromatogram showing sizes of each
STR repeats at different loci for different individuals
(note allele standards with mixtures of PCR products having
all sizes of alleles as a reference)
Chapter 15&16-13
DNA fingerprinting
• DNA fingerprinting (DNA profiling):
– Detection of VNTR or STR polymorphisms by PCR and
Southern blotting/capillary gel electrophoresis is called DNA
fingerprinting.
– The resulting specific banding patterns are called DNA
fingerprints.
• The individual bands of DNA fingerprints represent
different alleles of VNTR/STR loci


Chapter 15&16-14
Paternity test
• Like other genetic markers, half of the
VNTR bands of the child should come
from each parent.
Application of DNA fingerprinting
http://www.imnotobsessed.com/20
07/04/10/the-anna-nicole-
paternity-test-results/
Chapter 15&16-15
Paternity Test
(From Klug and Cummings, 2002)
Chapter 15&16-16
Forensic analysis
Chapter 15&16-17
Physical maps
• Contig maps:
– Contigs: a set of overlapping genomic DNA clones
• Strategies to order genomic clones into contigs:
– Restriction mapping
– STS (sequence-tagged site) mapping
– DNA sequencing


Chapter 15&16-18
Ordering contigs by restriction mapping
Chapter 15&16-19
STS map

• STSs (sequence-tagged sites): short, unique
genomic sequences, ~200-500 bp
• The source of STSs are often ESTs (expressed
sequence tags) which are short cDNA sequences.
Chapter 15&16-20
Cytogenetic Map
• Position genes on chromosomes by in situ
hybridization, either using radioactive probes or
fluorescent probes;
• Fluorescent in situ hybridization is also called FISH.
Chapter 15&16-21
Correlation of the genetic, cytological, and physical
maps of a chromosome.
Chapter 15&16-22
Correlation of genetic and physical maps
• Correlate genetic maps with physical maps by using
anchor markers;
– Anchor markers: DNA sequences that are mapped both
genetically and physically (for instance, RFLPs).
• Genetic maps are often used to validate physical
maps.
• Physical map distances do not always correlate with
genetic distance because recombination frequencies
are not always proportional to the molecular
distances.
Chapter 15&16-23
Genome Sequencing
• Sequencing ordered clones (clone by clone method)
– A systemic albeit time- and labor-intensive approach;
– Used by the public funded human genome project;
• Sequencing unordered clones
– Also called as Shot-gun sequencing;
– Used by the private company, Celera, to sequence the
human genome;
– Genome-wide shot-gun sequencing could be problematic
because repetitive DNA can hinder contig ordering and
sequence assembly.
Chapter 15&16-24
(From Klug and Cummings, 2002)
Clone-by-clone method
Chapter 15&16-25
(From Klug and Cummings, 2002)
Shotgun method
Chapter 15&16-26
Human Genome Project
• The race between public funded
international Human Genome
Sequencing Project Consortium, or
Human Genome Organization
(HUGO) and the private company
Celera;
• Approximately 1.1% to 1.4% of our
genomic DNA encodes proteins;
~50% or more is transposable DNA!
It’s a Tie!*
* The original human genome publications:
Science Vol 291, No. 5507, Feb 16, 2001 (Celera)
Nature Vol 409, No. 6822, Feb 15, 2001 (HUGO)
Francis Collins J . Craig Venter
Chapter 15&16-27
(Interesting Story: Cracking the Code of Life - PBS Documentary)
Chapter 15&16-28
Uneven Distribution of Genes on Chromosomes
(From Klug and Cummings, 2002)
The Human HapMap Project
• A single-nucleotide polymorphism (SNP) is a
single base pair substitution.
• Most SNPs are in non-coding regions.
• Between two individuals, there is one SNP in every
1200 base pairs, on average.
• SNPs can be detected using gene chip technology.

• A haplotype is a set of SNPs on the same
chromosome that tend to be inherited together.
Haplotypes
The Significance of SNPs
• Tracing evolutionary history
• Predicting an individual’s susceptibility to
diseases such as cancer and heart diseases
• Genetic markers to map disease genes

• The goal of the HapMap Project is the
identification and mapping of SNPs from
many different human populations.
Chapter 15&16-32
Comparative Genomics
• Genome evolution involves gene duplication
(paralogue) as well as genome duplication.
• The source of complexity of human genome is not
simply due to the number of genes, but rather the
complexity of gene product processing, e.g.,
alternative RNA splicing and posttranslational
processing of proteins.
– (estimated number of coding genes: 6,000 for yeast, 13,000
for flies, 18,000 for worms and 26,000 for plants, ~20,000 for
humans)
Chapter 15&16-33
Chapter 15&16-34
Gene Duplication -- evolutionary history of the globin
gene superfamily
(From Klug and Cummings, 2002)
How many duplications
occurred to generate the
present day variety of 9
globin genes?
Chapter 15&16-35
Chromosome evolution in mammals.
Synteny
presence of blocks of linked genes/markers in a conserved gene order
Chapter 15&16-36
Simplified comparative map of the genomes of
seven cereal grasses.
Some “ogue” terminology
Homologue genes derived
from a common ancestor
Orthologue homologous gene
in different species
Paralogue duplicated gene in
one individual which evolve to
have a new function
Chapter 15&16-37
Bioinformatics
• The study to deduce the structure/function of a gene
or gene product through non-experimental (in silico)
comparison of genes or genomes;
• It is largely computer modeling of molecules based
on the knowledge of known sequence,
structure/function of homologs.
• A promising new field…
Homology of predicted human proteins to their
counterparts in other species
Chapter 15&16-38
Alignment of Zhangfei/CREBZF homologous
genes suggesting a conserved alternative splicing
site
Chapter 15&16-39
Alternative splicing site
I F F F R &
Human TCTCTTAAAATGTAGGG
Mouse TCTCTTAAAATGTAGGG
Rat TCTCTTAAAATGTAGGG
Cow TCTCTTAAAATGTAGGG
Ar madi l l o TCTCTTAAAATGTAGGG
S L K M &
TGACAGTTTCTTTTTTAGGTGAT
TGACAGTTTCTTTTTTAGGTGAT
TGACAGTTTCTTTTTTAGGTGAT
TGACAGTTTCTTTTTTAGGTGAT
TGACAGTTTCTTTTTTAGGTGAT
* * * * * * * * * *
Chapter 15&16-40
Annotated, sequence-based map of an 4-mb segment
of DNA at the tip of human chromosome 1
Synthetic Genomics
Chapter 15&16-41
Interviewer: “Couldn’t you be accused of playing God?”
Venter: “We’re not playing”
Chapter 15&16-42
Functional Genomics
• Assigning gene functions
– Homology search
• e.g., BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/)
– Gene knockout
• Transcriptome
– the entire set of mRNA transcripts produced by a given
organism
• Proteome
– the entire array of proteins encoded in an organism
– Proteomics: study of proteome
Chapter 15&16-43
Functional classification of the 26,383 genes predicted
by Celera Genomics
Chapter 15&16-44
DNA Microarray Technology
What is a DNA microarray?
Known DNA fragments corresponding to specific genes are laid
out in microscopic quantities on a solid surface (e.g. glass
slides) at defined positions at a very high density.
Two types of microarrays
– Spotted microarrays
• cDNA fragments or synthetic oligonucleotides are spotted or
“printed” onto a solid medium, often glass slides (or nylon
membranes for low-density microarrays).
• Printed DNAs are 50-200 µm apart, and up to ~20,000 per slide
– GeneChips®by Affymetrix
• Oligonucleotides are synthesized directly on the surface of a solid
support.
• More than 400,000 oligonucleotide sequences can be placed in a
1.28 cm x 1.28 cm area (10 nm apart).
Chapter 15&16-46
How do DNA Microarrays work?
1. DNA Microarrays are designed with genes of
interest represented on the microarrays.
2. DNA (sometimes mRNA) samples are labeled
fluorescently (or radioactively for low-density,
membrane-based arrays), and hybridized to the
microarray surface.
3. After extensive washing, bound DNAs are detected
by fluorescence (or autoradiography).
Chapter 15&16-49
Main applications of the DNA Microarray Technology
• Transcription profiling of an entire genome
– Examination of transcription levels of thousands of genes
simultaneously;
• Genotyping
– Labeled genomic DNA of a gene is hybridized to an array of
oligonucleotides representing different alleles of the gene.
Can be used in:
– Drug discovery;
– Toxicology studies;
– Mutation/Polymorphism detection (genetic testing etc);
– Disease management: facilitate research into associations
between mutations and therapeutic responses.
Green Fluorescent Protein (GFP) as a Reporter
- Study regulation of gene expression;
- Study subcellular localization of proteins

Sign up to vote on this title
UsefulNot useful