Vous êtes sur la page 1sur 7
Fish & Shell fi sh Immunology 31 (2011) 564 e 570 Contents lists available at ScienceDirect

Contents lists available at ScienceDirect

Fish & Shell sh Immunology

journal homepage: www.el sevier.com/locate/fsi

Immunology journal homepage: www.el sevier.com/locate/fsi Immune response of gilthead seabream ( Sparus aurata )

Immune response of gilthead seabream ( Sparus aurata ) following experimental infection with Aeromonas hydrophila

Martha Reyes-Becerril a , b , Tania López-Medina a , Felipe Ascencio-Valle a , María Ángeles Esteban b , *

a Centro de Investigaciones Biológicas del Noroeste (CIBNOR), Mar Bermejo 195, Col. Playa Palo de Santa Rita, La Paz, B.C.S. 23090, Mexico b Fish Innate Immune System Group, Department of Cell Biology and Histology, Faculty of Biology, University of Murcia, 30100 Murcia, Spain

article info

Article history:

Received 2 March 2011 Received in revised form 21 June 2011 Accepted 2 July 2011 Available online 12 July 2011

Keywords:

Aeromonas hydrophila Cellular immune system Gene expression Gilthead seabream ( Sparus aurata L.)

abstract

The Gram-negative bacteria Aeromonas hydrophila is a heterogeneous organism that causes the disease known as motile aeromonad septicaemia, which is responsible for serious economic loss in seabream culture due to bacterial infections. However, the immune mechanisms involved in this disease in sh are still poorly understood. For the purpose of this study, gilthead seabream ( Sparus aurata L.) specimens received a double intraperitoneal injection of bacterial inoculums: a primary infection with 1 10 7 cell ml 1 A. hydrophila , followed by a secondary infection with 1 10 8 cell ml 1 fourteen days later. Changes in cellular innate immune parameters e phagocytosis, respiratory burst activity and peroxidase leucocyte content e were evaluated 24 and 48 h after each injection. Simultaneously, the expression levels of nine immune-relevant genes ( TLR , NCCRP-1, HEP, TCR , IgM , MHC-II a, IL-1 b, C3 and CSF-1R ) were measured in the head-kidney, spleen, intestine and liver, by using q-PCR. Generally, the results showed a signi cant decrease in cellular immune responses during the primary infection and a signi cant enhanced during the second infection, principally in respiratory burst and peroxidase activity, thus indicating a recovery of the immune system against this bacterial pathogen. Finally, transcript levels of immune genes were down- regulated during the rst infection, except for the IL-1 b gene. In contrast, mRNA expression levels during the re-infection were signi cantly up-regulated. The results seem to suggest a relatively fast elimination of the bacteria and recovery of sh during the secondary infection. 2011 Elsevier Ltd. All rights reserved.

1. Introduction

Gilthead seabream is a marine sh with high economic value in the Mediterranean aquaculture sector due to its good market price, high survival rate and feeding habits. The most signi cant factor affecting aquaculture is the incidence of microbial pathologies, mainly bacterial in origin [1] . One of the major bacterial diseases is caused by the Gram-negative bacterium Aeromonas hydrophila , which produces diseases known as motile aeromonad septicaemia [2] affecting a wide variety of freshwater sh species and, occa- sionally, marine sh [3,4] . This bacterium can also behave as

a secondary opportunistic pathogen, by assailing already compro-

mised or stressed hosts [5] . Several extracellular toxins and enzymes have been described as responsible for the virulence of

A. hydrophila , including cytotoxins and enterotoxins [6] and

a repertoire of enzymes that digest cellular components, mostly

proteases and haemolysins [7] . Previous studies indicate that disease resistance in sh species is correlated with innate immune parameters, and that these parameters probably affect the inherent

* Corresponding author. Tel.: þ 34 868367665; fax: þ 34 868363963. E-mail address: aesteban@um.es (M. Á. Esteban).

1050-4648/$ e see front matter 2011 Elsevier Ltd. All rights reserved. doi: 10.1016/j.fsi.2011.07.006

capacity of sh to resist pathogens before a speci c immune response [2,8,9] . Innate immune response mechanisms against

A. hydrophila have been studied in several sh species [3,4,9] ; however little is known on gilthead seabream. Understanding the immune defence mechanisms of sh against bacteria is important

in terms of control and prevention, as it could provide the basis for

the development of improved vaccines [10] . The present work contributes to the understanding of the complex interactions between cellular immune parameters in head-kidney leucocytes (main haemopoietic organ) and the transcriptional activity of

a range of genes involved in the innate and adaptive immune

system in gilthead seabream ( Sparus aurata L.) responding to primary and secondary A. hydrophila infections. Additionally, the mechanisms involved in the A. hydrophila pathogenesis and the role displayed by the immune response of sh are discussed.

2. Materials and methods

2.1. Fish and rearing conditions

Forty-eight specimens (84 g mean body weight) of the hermaphroditic protandrous seawater teleost gilthead seabream

M. Reyes-Becerril et al. / Fish & Shell sh Immunology 31 (2011) 564 e 570

565

( S. aurata L.), obtained from CULMAREX S.A. (Murcia, Spain), were kept running in seawater aquaria ( ow rate 1500 l h 1 ) at 28 & salinity, 20 C and a 12 h light:12 h dark photoperiod. The animals were fed with a commercial pellet diet at a rate of 1% body weight day 1 . Animals were acclimated for 15 days prior to the experi- ments. Seabream were con rmed bacterial-free by standard microbiological techniques to determine the presence or absence of allochthonous A. hydrophila [11] and by a PCR technique using the primers combination strategy described by Vazquez-Juarez et al. [12] .

2.2. Bacteria

Virulent A. hydrophila was isolated from intestine of leopard grouper ( Mycteroperca rosacea ) during an experimental infection and maintained at the Laboratory of Microbial Pathogenesis of the Center of Biological Investigation of Northwest (CIBNOR), La Paz, B.C.S., México. Just before the experimental challenge in gilthead seabream, some bacteria were reactivated and cultured on Luria- Bertani, L3152 (LB, SIGMA) agar plates for 24 h at 30 C. Biomass was recovered from plates and resuspended in 10 ml of phosphate- buffered saline (PBS 7.4). The bacterial cells were then collected by centrifugation (2000 rpm, 10 min) and washed three times with PBS also by centrifugation. The pellet obtained was suspended in PBS at a concentration of 1 10 9 cells ml 1 , and then it was serially diluted to obtain the 1 10 8 and 1 10 7 cells ml 1 suspensions. Gilthead seabream were injected intraperitoneally twice with bacterial inoculum ( rst infection, day 1:200 ml of 1 10 7 cell ml 1 ; second infection, day 15:200 ml of 1 10 8 cell ml 1 ) or PBS ( rst infection, day 1:200 ml of PBS; second infection, day 15:200 ml of PBS) (control group). To con rm the ef cacy of infection, some bacteria were recov- ered from tissues of experimentally challenged sh and their identities were con rmed according to Popoff criteria [11] and polymerase chain reaction (PCR) detection [12] .

2.3. Sample collection

Six sh from each aquarium were randomly sampled at 24 and

48 h after each bacterial injection (days 2, 3, 16 and 17 after starting

the experimental design). Before sampling, the sh were starved for 24 h and, after being euthanized, head-kidney leucocytes (HKLs) were isolated from each sh under sterile conditions, according to Esteban et al. [13] . Brie y, the head-kidney was excised, cut into small fragments and transferred to 8 ml of sRPMI [RPMI-1640 culture medium (Gibco)] supplemented with 0.35% sodium chlo- ride, 100 IU ml 1 penicillin (Flow), 100 mg ml 1 streptomycin (Flow), 10 IU ml 1 heparin (Sigma) and 5% foetal calf serum (FCS, Gibco). Cell suspensions were obtained by forcing fragments of the organ through a 100 mm nylon mesh, washed twice (400 g, 10 min), counted (Z2 Coulter Particle Counter) and adjusted to 10 7 cells ml 1 in sRPMI. Cell viability was determined by the trypan blue exclu- sion test. Head-kidney, spleen, intestine and liver fragments were also sampled and immediately stored at 80 C in TRIzol Reagent (Invitrogen) for RNA extraction (see below).

2.4. Phagocytic activity

22 C for 30 min and then placed on ice to stop phagocytosis, at

which point 400 ml ice-cold PBS was added to each sample. The uorescence of the extracellular yeasts was quenched by the addition of 40 ml ice-cold trypan blue (0.4% in PBS). Standard samples of FITC labelled yeast or leucocytes were included in each phagocytosis assay. The samples were then analyzed in a FACScan (Becton Dickinson) ow cytometer with an argon-ion laser adjusted to 488 nm. Phagocytic ability was de ned as the percentage of cells with ingested yeast cells (green-FITC uorescent cells, FL1 þ ) within the phagocyte cell population. The relative number of ingested yeasts per cell (phagocytic capacity) was assessed in arbitrary units from the mean uorescence intensity of the phagocytic cells.

2.5. Respiratory burst activity

The respiratory burst activity of gilthead seabream HKLs was studied using the chemiluminescence method [15] . Brie y, samples of 10 6 leucocytes in sRPMI were placed in the wells of a at- bottomed 96-well microtitre plate and lled with 100 ml Hanks balanced salt solution (HBSS) containing 1 mg/ml phorbol myristate acetate (PMA; Sigma) and 10 4 M luminol (Sigma). The plate was shaken and immediately read in a microplate reader (BIO-RAD, model 3350-UV) for 1 h at 2-min intervals. The reaction kinetic was analyzed and the maximum slope of each curve was calculated. Backgrounds of luminescence were calculated using reagent solu- tions containing luminol but not PMA.

2.6. Leucocyte peroxidase activity

The peroxidase content inside HKLs was determined using

a colorimetric method [16] . Brie y, aliquots of 1 10 6 lysed leu- cocytes were dispensed in a 96-well plate containing 25 ml of

10 mM 3,3,5,5-tetramethylbenzidine hydrochloride and 5 mM

H 2 O 2 . The colour-change reaction was stopped after 2 min by

addition of 50 ml 2 M sulphuric acid and the optical density was read at 450 nm in a plate reader. Standard samples without HKL s

were used as blanks.

2.7. Real-time PCR

Twenty-four and forty-eight hours after each injection (days 2,

3, 16 and 17 after the start the experiment), total RNA was extracted

from 0.5 g of pooled seabream head-kidney (main haematopoietic organ), spleen and intestine (secondary immune organs) and liver using TRIzol Reagent (Invitrogen). It was then quanti ed and the purity assessed by spectrophotometry; 260:280 ratios were 1.8 e 2.0, and treated with DNase I (Promega) to remove genomic DNA contamination. Complementary DNA (cDNA) was synthesized from 1 mg of total RNA using the SuperScript III reverse transcrip- tase (Invitrogen) with an oligo-dT 18 primer. The expression of the nine immune-relevant genes selected was analyzed by real-time PCR, which was performed with an ABI PRISM 7500 instrument (Applied Biosystems) using SYBR Green PCR Core Reagents (Applied Biosystems). Reaction mixtures (containing 10 ml of 2 SYBR Green supermix, 5 ml of primers (0.6 mM each) and 5 ml of cDNA template)

were incubated for 10 min at 95 C, followed by 40 cycles of 15 s at

 

95

C, 1 min at 60 C, and nally 15 s at 95 C, 1 min at 60 C and 15 s

The phagocytosis carried out by HKLs of gilthead seabream was

5

10 7 cells ml 1 sRPMI. Phagocytosis samples consisted of

at

95 C. For each mRNA,

gene expression was corrected against the

studied by ow cytometry according to Rodríguez et al. [14] . Heat- killed and lyophilized yeast cells were labelled with uorescein isothiocyanate (FITC; Sigma), washed and adjusted to

labelled yeast cells and leucocytes. Samples were mixed, centri- fuged (400 g, 5 min, 22 C), resuspended in sRPMI, incubated at

endogenous level of the house keeping gene 18S content in each sample in order to standardize the results by eliminating variation in mRNA and cDNA quantity and quality [8] . No ampli cation product was observed in negative controls and no primer-dimer formations were observed in the control templates. The primers used are shown in Table 1. In all cases, each

566

M. Reyes-Becerril et al. / Fish & Shell sh Immunology 31 (2011) 564 e 570

Table 1 Primers used for real-time PCR.

Gene

GenBank number

Primer sequence (5 0 e 3 0 )

18S

AY587263

CGAAAGCATTTGCCAAGAAT

 

AGTTGGCACCGTTTATGGTC

TLR9A

AY751797

ATTCCCGGAGTCCCAACAAG

 

GCTGCTGAACCATGAAGAAAGC

NCCRP-1

AY651258

ACTTCCTGCACCGACTCAAG

 

TAGGAGCTGGTTTTGGTTGG

Hep

EF625900

GCCATCGTGCTCACCTTTAT

 

CTGTTGCCATACCCCATCTT

TCR a

AY751745

GGAAGTGGAACCAGACTGAACG

 

GATCACTCTGAGGCACAGGACG

IgM

AY619988

TTACTACTGTCAGAGTTTTC

 

ATCCCAGTGAGGGGAAGC

MHCII a

DQ019401

ATGATGAAGATGATGAAGATGATG

 

TCACGCTCTGTCCGTTCTTGG

IL-1b

SAU277166

GCTCAACATCTTGCTGGAGAGC

 

GGCACATATCCACTGGCTTG

C3

CX734936

ATAGACAAAGCGGTGGCCTA

 

GTGGGACCTCTCTGTGGAAA

CSF-1R

AM050293

ACGTCTGGTCCTATGGCATC

AGTCTGGTTGGGACATCTGG

concentration (1 10 8 cell ml 1 ) 14 days after the primary infec- tion. The sh infected during the rst infection showed typical signs of acute septicaemia with swollen, haemorrhages around the anus and the caudal ns. After the second infection no mortality was registered. On the other hand, external symptoms were not observed in re-infected sh (secondary infection). Internal clinical signs (visceral hemorrhages principally in liver) were detected in all infected sh and never in sh from control groups.

3.2. Phagocytic activity

A. hydrophila signi cantly inhibited the phagocytic ability (percentage of phagocytic cells) of leucocytes from sh sampled 24 and 48 h after the rst bacterial injection, if compared with those isolated from the control group (non-infected sh). However, after the second injection (1 10 8 cell ml 1 ), the phagocytic ability was enhanced in infected sh respect to the control group, observing a signi cant difference after 24 h ( Fig. 1 ). The phagocytic capacity of infected sh was no signi cantly affected at any time of the experiment ( Fig. 2 ).

PCR was performed with triplicate samples and repeated at least twice. Modi cation of gene expression is represented with respect to the control sampled at the same time of the treatment.

2.8. Statistical analysis

All bioassays were made in duplicate and all measurements were performed on three replicates; the mean standard error (SE) for each group was calculated. Two-way ANOVA was per- formed to determine the effects of treatments (non-infected and infected) on different parameters (injections and time) after checking for normality and homogeneity of variance by the Kolgomorov-Smirnov and Levene tests ( P > 0.05), respectively. All statistical tests were conducted using the computerized software Statistical Package for Social Sciences (SPSS) v.15.0 software. Differences were considered signi cant at P 0.05.

3.3. Respiratory burst activity

The respiratory burst activity e measured as the production of reactive oxygen species (ROS) from head-kidney leucocytes of experimentally infected sh e was signi cantly lower than that obtained from leucocytes of the control group, both 24 and 48 h after the rst injection. Conversely, leucocytes from re-infected sh increased signi cantly this activity after 24 and 48 h, if compared with the control group ( Fig. 3 ).

3.4. Leucocyte peroxidase activity

Peroxidase activity of head-kidney leucocytes was signi cantly lower 24 h but not 48 h after the rst bacterial injection in infected specimens. After the second injection, this activity was enhanced in infected sh, but the increase was not-statistically signi cant, if compared with the sh control group ( Fig. 4 ).

3. Results

3.5. Real-time PCR

3.1. Pathogenicity

A total of 40 sh (corresponding at 83% of survival) survived the primary infection and received re-infection with a highest

Genes considered important for the immune system were analyzed using real-time PCR from seabream head-kidney, spleen, intestine and liver ( Table 2 ). Low levels of constitutive expression of all the examined genes were detected 24 and 48 h during the

100 1st injection Non-infected 2nd injection Infected 80 60 * 40 * * 20 0
100
1st injection
Non-infected
2nd injection
Infected
80
60
*
40
*
*
20
0
24h
48h
24h
48h
Phagocytic cells (%)

Fig. 1. Effect of Aeromonas hydrophila infection 515 on gilthead seabream head-kidney leucocyte phagocytic ability. Data represent the mean SE ( n ¼ 6). Asterisk denotes statistically signi cant differences between control and challenged groups ( P 0.05).

Table 2 Quantitative expression (q-PCR) of immune genes in different tissues of gilthead seabream following primary and secondary infection with Aeromonas hydrophila .

Gene

Group Relative gene expression level

 
 

Spleen

Liver

Intestine

Head-kidney

1st injection

2nd injection

1st injection

2nd injection

1st injection

2nd injection

1st injection

2nd injection

24

48

24

48

24

48

24

48

24

48

24

48

24

48

24

48

TLR

Control

0.9 .0.04 1.1 0.06 0.2 0.02 5.9 0.95

0.1 0.00 0.3 0.00 9.9 1.30

1.1 0.00 0.9 0.02 0.4 0.00

1.3 0.01 0.8 0.01 0.4 0.00 2.3 0.20 0.1 0.00 8.0 0.50 1.0 0.00 1.1 0.03 0.5 0.00 2.1 0.08 3.7 0.60 0.3 0.03 0.2 0.00

4.2 1.60 14.1 0.04

0.9 0.02 0.8 0.03 0.9 0.06 1.3 0.10 0.4 0.00 2.2 0.20 1.0 0.01 1.0 0.02 1.0 0.00 1.0 0.00 1.4 0.06 0.7 0.02 0.0 0.00

1.3 0.08 0.7 0.04 0.7 0.00 1.6 0.03 0.2 0.00 5.6 0.10 0.9 0.00 1.0 0.00 0.4 0.00 2.7 0.08 3.8 0.09 0.3 0.01 0.4 0.00

0.5 0.06 2.0 0.20 0.8 0.04 1.3 0.00 1.5 0.06 0.7 0.02 2.1 0.08 0.5 0.01 8.1 3.00 0.1 0.02

2.9 0.06 0.4 0.05 2.4 0.01 0.4 0.04 0.5 0.00 2.0 0.04 4.8 0.60 0.2 0.02 7.2 0.80 0.1 0.00

1.0 0.02 1.0 0.00 0.9 0.01 1.1 0.04 0.8 0.06 1.2 0.02 0.5 0.00 1.8 0.04 1.6 0.21 0.6 0.02 0.5 0.00 1.9 0.00 0.2 0.00

0.4 0.01 2.4 0.20 0.8 0.02 1.2 0.04 0.3 0.00 3.7 0.20 0.7 0.00 1.4 0.09 0.3 0.00 3.1 0.10 0.9 0.08 1.0 0.03 0.1 0.00

0.4 0.01 2.3 0.07 0.5 0.01 1.9 0.05 1.0 0.06 1.0 0.06 6.2 0.57 0.2 0.01 2.9 0.93 0.4 0.07 3.9 0.24 0.3 0.01 0.0 0.00

1.4 0.08 0.7 0.02 0.5 0.00 1.9 0.20 1.0 0.06 1.1 0.06 3.1 0.50 0.3 0.00 11.8 1.00 0.1 0.01 0.5 0.06 2.7 0.03 0.0 0.00

1.7 0.00 0.6 0.02 0.5 0.00 2.0 0.06 0.5 0.01 2.4 0.30 1.1 0.60 1.0 0.01 0.9 0.04 1.0 0.04 1.8 0.09 0.5 0.02 0.2 0.00

0.8 0.00 1.3 0.10 0.2 0.00 4.4 0.30 0.2 0.00 5.7 1.00 0.6 0.01 1.3 0.06 0.8 0.00 1.3 0.04 2.9 0.08 0.3 0.00 0.0 0.00

Infected

0.3 0.10 1.0 0.20 1.0 0.20 2.6 0.04 0.4 0.00 5.9 0.28 0.2 0.00 48.1 8.47 0.0 0.00

0.7 0.02 0.7 0.00 1.4 0.03 0.8 0.00 1.3 0.09 3.1 0.60 0.3 0.07 0.8 0.11 1.3 0.10

NCCRP-1 Control

 

Infected

 

Hep Control 0.1 0.01 Infected 9.0* 1.50 TCR b Control 6.6 0.10

Infected

0.0 0.00 0.1 0.00

0.0 0.00 19.5* 2.70

2.2 0.04 0.0 0.00

0.1 0.00 0.2 0.00 0.1 0.00 0.0 0.00 0.0 0.00 0.0 0.00

1.7 0.02 0.6 0.02 0.9 0.00 1.0 0.02 1.5 0.01 0.7 0.01 0.2 0.00 7.3 0.60 0.3 0.00 3.6 0.20 1.5 0.00 0.7 0.00

IgM

Infected MHCII a Control Infected

Control

0.2 0.00 9.5 0.84 0.1 0.00 1.6 0.00 0.6 0.00

4.5 0.70 24.9 1.80

5.2 0.15 10.3 6.9

IL-1 b

Control

0.0 0.00 13.9 1.20

0.2 0.02 0.0 0.00

0.0 0.00 0.1 0.00

0.2 0.00 0.1 0.00

0.0 0.00 3.5 0.90

Infected 46.3* 0.90 C3 Control 4.8 0.08

Infected

0.0 0.00 0.8 0.00 1.9 0.01 0.9 0.00 0.0 0.00

5.7 0.10 53.4* 3.10 11.8 0.60 26.2* 3.20

2.2 0.05 11.8 1.00

0.3 0.02 4.5 0.04 12.4* 0.90 20.8* 0.70 49.6* 2.50 6.3 0.50 25.0* 0.10

0.2 0.00 5.8 0.40 1.2 0.04 0.9 0.03

4.0 0.05 0.3 0.00 0.7 0.00 0.1 0.00

0.9 0.00 1.1 0.03 2.3 0.06 0.4 0.01

0.5 0.00 2.2 0.03 0.6 0.01 1.7 0.06

0.4 0.00 2.5 0.10 1.0 0.02 1.0 0.01

0.9 0.08 1.2 0.10 7.1 0.90 1.2 0.00

1.1 0.04 0.9 0.05 3.7 0.57 0.3 0.00

1.2 0.02 0.8 0.05 0.7 0.00 1.4 0.10

0.2 0.00 4.6 0.70 0.2 0.00 5.4 0.04

2.2 0.05 0.4 0.10 9.0 1.30 0.3 0.00

0.1 0.00 12.7* 0.80 0.4 0.00 2.8 0.01

0.9 0.04 1.3 0.03 0.8 0.00 1.2 0.00

0.8 0.01 1.3 0.06 0.6 0.01 1.9 0.08

CSF-1R Control

0.2 0.00 0.1 0.00 0.1 0.00

 

Infected

24 and 48 h post-injection. Fold increase of target gene relative to elongation factor a ( S.D.). Expression was compared to controls injected with PBS. *Indicates signi cant up-regulation relative to control ( p < 0.05).

568

M. Reyes-Becerril et al. / Fish & Shell sh Immunology 31 (2011) 564 e 570

1400 Non-infected 1st injection 2nd injection Infected 1200 1000 800 600 400 200 0 24h
1400
Non-infected
1st injection
2nd injection
Infected
1200
1000
800
600
400
200
0
24h
48h
24h
48h
Mean fluorescence intensity
per phagocyte

Fig. 2. Effect of Aeromonas hydrophila infection on gilthead seabream head-kidney leucocyte phagocytic capacity. Data represent the mean SE ( n ¼ 6). Asterisk denotes statistically signi cant differences between control and challenged groups ( P 0.05).

25000 1st injection 2nd injection Non-infected * Infected 20000 * 15000 10000 * 5000 *
25000
1st injection
2nd injection
Non-infected
*
Infected
20000
*
15000
10000
*
5000
*
0
24h
48h
24h
48h
Respiratory burst activity
(Slope min )

Fig. 3. Effect of Aeromonas hydrophila infection on gilthead seabream head-kidney leucocyte respiratory burst activity. Data represent the mean SE ( n ¼ 6). Asterisk denotes statistically signi cant differences between control and challenged groups ( P 0.05).

primary infection ( Table 2 ). One of the most interesting results was that pro-in ammatory cytokine ( IL-1 b) expression levels were signi cantly regulated due to infection. Thus, IL-1 b was expressed in all the tissues sampled 24 h after the rst injection, although the greatest increase was observed in the liver (53.4 fold up-regulated), followed by the head-kidney (49.5 fold) 48 h after the st infection. During the re-infection period or secondary infection, the expres- sion of several genes was up-regulated after 24 and 48 h ( Table 2 ).

Again, we can observe an increase in IL-1 b level in the second injection any time of the experiment in all the tissues sampled. Pro- in ammatory cytokine IL-1 b expression was 26.1-fold higher in liver-infected sh 24 h after the secondary infection compared with the control group. On the other hand, the transcripts of the C3 and Hep were signi cantly increased in spleen and head-kidney during the rst and second injection, respectively. The number of C3 gene transcripts was 12.7 fold increased 48 h in the infected sh

50 1st injection Non-infected 2nd injection Infected 40 30 20 * 10 0 24h 48h
50
1st injection
Non-infected
2nd injection
Infected
40
30
20
*
10
0
24h
48h
24h
48h
Peroxidase activity
(Units 1
le0
ucocytes)

Fig. 4. Effect of Aeromonas hydrophila infection on seabream head-kidney leucocyte peroxidase content. Data represent the mean SE (n ¼ 6). Asterisk denotes statistically signi cant differences between control and challenged groups ( P 0.05).

M. Reyes-Becerril et al. / Fish & Shell sh Immunology 31 (2011) 564 e 570

569

(primary infection), whereas the antimicrobial peptide Hep was elevated 19.5 fold 24 h after re-infection.

4. Discussion

The present study reveals the changes in cellular innate immune response and immune-relevant gene expression of gilthead seab- ream exposed to primary and secondary infection with A. hydro- phila . The use of this bacterium as a model pathogen to elucidate immune mechanisms in seabream is of signi cance, because acute septicaemia caused by this pathogen is a serious threat to sh production [17] . The bacteria were isolated from the infected seabream and identi ed as a motile Aeromonas strain, and it was responsible for the disease outbreak. In this work, seabream infected with A. hydrophila showed typical signs of acute septi- caemia with gross haemorrhagic lesions on the ventral surface of the body, the n and the tail rot, as well as visceral haemorrhages. Similar lesions have also been described in Indian major carp, Labeo rohita [2] , zebra sh, Danio rerio [9] and leopard grouper, M. rosacea [4] , where external and internal symptoms (abdominal and visceral haemorrhages with abdominal distension) were always observed after experimental infections. It is evident that immune defence mechanisms play a critical role in preventing bacterial disease in sh [18] . Several authors have documented such changes in innate as well as in adaptive immune parameters in sh exposed to different pathogens [9,10,19,20] . However, the immunomodulation mechanism induced by A. hydrophila in sh is still poorly understood. In this study A. hydrophila did not cause signi cant mortality, although seabream specimens were found to be very sensitive to this bacterium, as it is reported above in the description of the gross lesions visible on skin and muscle. In this study a clear decrease in the main cellular immune parameters were observed after the rst infection. Similarly, phagocytosis and respiratory burst dimin- ished. Phagocytosis is a major mechanism used to remove path- ogens and cell debris; respiratory burst is the rapid release of reactive oxygen species from immune cells e mainly superoxide radical and hydrogen peroxide. Concomitantly, 24 h after the rst injection, the leucocyte peroxidase content of this group was signi cantly lower than that of the control group. The resistance of A. hydrophila to oxygen radicals has already been reported by some authors [21] . These authors have reported that some Aero- monas bacteria possess a Mn-superoxide dismutase (Mn-SOD) and catalase enzyme that protects them from the external anion superoxide and hydrogen peroxide generated by macrophages inhibiting phagocyte activity. Conversely, numerous experiments with a variety of microbes have demonstrated that the apoptosis of professional phagocytes is a common event in pathogenesis and plays a pivotal role in the initiation of the infection, the survival of the pathogens, and the evasion of the rst line of defence of the immune system [22] . Fourteen days following the rst infection, the surviving seab- ream were re-infected with a second injection using a concentra- tion (1 10 8 cell ml 1 ) higher than that used in the rst injection. Twenty-four and forty-eight hours after the second injection the innate immune parameters recovered e in contrast to the param- eters in the specimens of the control group e and no mortality was observed. The results demonstrate that a second challenge of gilt- head seabream with A. hydrophila confers them partial immunity. A similar recovery pattern of sh immune system was found in rainbow trout challenged twice with the enterobacterium Yersinia ruckeri [19] . Regarding the expression of the immune-relevant genes, the results show a pronounced increase of the cytokine interleukin- 1 b

in infected seabream in both primary and secondary infections, thus suggesting a strong in ammatory response to A. hydrophila . Evidence that many bacterial toxins induce cytokine release is accumulating in recent years [23] . IL-1 b is a major player in immune response of sh as in mammals [24] . It is a key mediator in the response to microbial invasion and tissue injury, and it can stimulate immune responses by activating lymphocytes, or by inducing the release of other cytokines capable of triggering macrophages, NK cells and lymphocytes. Macrophages are the primary source of IL-1 b, although it is also produced by a wide variety of other cell types. Bacterial components are known to stimulate rainbow trout macrophages, induce IL-1 b expression and stimulate lymphocyte proliferation [25,26] . This can explain the marked peak in transcript of IL-1 b, seen in different tissues of seabream during the primary infection. During the re-infection (secondary infection), the number of transcript such as Hep , C3 , CSF-1R , NCCR-1 genes was signi cantly up-regulated, if compared with their expression during the primary infection. Hepcidin is an antimicrobial peptide that acts against Gram-negative and Gram- positive bacteria [27] , and it has recently been suggested to also act as a central regulator of intestinal iron absorption and iron recycling by macrophages [28] . In mammalian, hepcidin is greatly stimulated by in ammation, and it is principally induced by interleukin-1, interleukin-6, LPS and iron overloading [29] . In this context, it is worth noting that a highly signi cant correlation exists between Hep and IL-1 b expression, as it was found in this work, and in agreement with some reactions found in other sh species following bacterial infection [19] . In addition, small but signi cant increases in complement factors C3 were noted during the secondary infection. Fish have a well-developed complement system that plays an important role in their innate immune response, including membrane attack complex (which lyses bacteria), opsonisation for phagocytosis, and release of the ana- phylatoxins C3a and C5a, which attract neutrophilic granulocytes to the site of in ammation and infection [30,31] . Finally, NCCRP-1 and CSF-1R genes were only up-regulated during the secondary infec- tion. These genes encode leucocyte receptors that, in some instances, might be considered cell markers for non speci c cyto- toxic cells (NCC), antigen cells and macrophages respectively, and several studies have concluded that they are very good candidates for this end [32,33] . In conclusion, this is the rst study on the immune response of gilthead seabream against primary and secondary infections with A. hydrophila . The cellular immune parameters, as well as the tran- script level (pro-in ammatory cytokines) studied in this research indicate immunodepresion of seabream during the primary infec- tion, but not in re-infection. The results suggest that recovery of cellular innate immune activities and up-regulation of cytokines (such IL-1 b) may play an active role for the rapid elimination of this pathogen during the re-infection period. Further extensive work is recommended to get an insight into the mechanisms involved in the recovery of the immune system following the rst infection and in the generation of immunological memory, which made the rapid elimination of bacteria possible in successive challenges.

Acknowledgements

The author thanks Francisco Guardiola and Rebeca Cerezuela for technical support. M. Reyes received a postdoctoral scholarship from the Mexican Consejo Nacional de Ciencia y Tecnología (CONACYT grant 164653). T. López has a fellowship from the CONACYT-México (grant 48444). This work was partially funded by the Spanish Ministry for Science and Innovation (AGL2008-05119-C02-01) and Fundación Séneca de la Región de Murcia, Spain (06232/GERM/07).

570

M. Reyes-Becerril et al. / Fish & Shell sh Immunology 31 (2011) 564 e 570

References

[1] Zorrilla I, Chabrillón M, Arijo S, Díaz-Rosales P, Martínez-Manzanares E, Balebona MC, et al. Bacteria recovered from diseased cultured gilthead sea bream ( Sparus aurata L.) in southwestern Spain. Aquaculture 2003;218:

11 e 20.

[2] Sahoo PK, Das Mahapatra K, Saha JN, Barat A, Sahoo M, Mohanty BR, et al.

Family association between immune parameters and resistance to Aeromonas hydrophila infection in the Indian major carp, Labeo rohita . Fish and Shell sh Immunology 2008;25:163 e 9. Sahu S, Das BK, Mishra BK, Pradhan J, Sarangi N. Effect of Allium sativum on the immunity and survival of Labeo rohita infected with Aeromonas hydrophila .

Journal of Applied Ichthyology 2007;23:80 e 6. [4] Reyes BM, Tovar RD, Ascencio VF, Civera CR, Gracia LV, Barbosa SV, et al. Effects of dietary supplementation with probiotic live yeast on the immune and antioxidant systems of leopard grouper Mycteroperca rosacea infected with Aeromonas hydrophila. Aquaculture Research; 2010:1 e 11. [5] Tellez BMC, Santerre A, Casas-Solis J, Zairseva G. Endosulfan increases seric interleukin-2 like (IL-2L) factor and immunoglobulin M (IgM) of Nile tilapia ( Oreochromis niloticus ) challenged with Aeromonas hydrophila . Fish and Shell sh Immunology 2010;28:401 e 5. [6] Yadav M, Indira G, Ansary A. Cytotoxin elaboration by Aeromonas hydrophila isolated from sh with epizootic ulcerative syndrome. Journal of Fish Diseases 1992;5:183 e 9. [7] Leung KY, Stevenson RMW. Characteristics and distribution of extracellular proteases from Aeromonas hydrophila . Journal of General Microbiology 1988; 134:151 e 60. [8] Reyes BM, Salinas I, Cuesta A, Meseguer J, Tovar RD, Ascencio VF, et al. Oral delivery of live yeast Debaryomyces hansenii modulates the main innate immune parameters and the expression of immune-relevant genes in the gilthead seabream ( Sparus aurata L.). Fish and Shell sh Immunology 2008;25:

[3]

433 e 8.

[9] Rodríguez I, Novoa B, Figueras A. Immune response of zebra sh ( Danio rerio ) against a newly isolated bacterial pathogen Aeromonas hydrophila . Fish and Shell sh Immunology 2008;25:239 e 49. [10] Raida MK, Buchmann K. Development of adaptive immunity in rainbow trout, Oncorhynchus mykiss (Walbaum) surviving an infection with Yersinia ruckeri . Fish and Shell sh Immunology 2008;25:533 e 41. [11] Popoff M. Aeromonas. In: Krieg NR, editor. Bergey s manual of systematic bacteriology. Baltimore, MD: Williams & Wilkins; 1984. p. 545 e 8. [12] Vazquez-Juarez RC, Barrera-Saldana HA, Hernandez-Saavedra NY, Gomez- Chiarri M, Ascencio F. Molecular cloning, sequencing and characterization of omp48, the gene encoding for an antigenic outer membrane protein from Aeromonas veronii . Journal of Applied Microbiology 2003;94:908 e 18. [13] Esteban MA, Mulero V, Muñoz J, Meseguer J. Methodological aspects of assessing phagocytosis of Vibrio anguillarum by leucocytes of gilthead seab- ream ( Sparus aurata L.) by ow cytometry and electron microscopy. Cell & Tissue Research 1998;293:133 e 41. [14] Rodríguez A, Esteban MA, Meseguer J. Phagocytosis and peroxidase release by seabream ( Sparus aurata L .) leucocytes in response to yeast cells. Anatomical Record 2003;272A:415 e 23. [15] Bayne CJ, Levy S. Modulation of the oxidative burst in trout myeloid cells by adrenocorticotropic hormone and catecholamines: mechanisms of action. Journal of Leukocyte Biology 1991;50:554 e 60.

[16] Quade MJ, Roth JA. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Veterinary Immunology and Immunopathology 1997;58:239 e 48. [17] Fang HM, Ling KC, Ge R, Sin YM. Enhancement of protective immunity in blue gourami, Trichogaster trichopterus (Pallas), against Aeromonas hydrophila and Vibrio anguillarum by A. hydrophila major adhesion. Journal of Fish Diseases 2000;23:137 e 45. [18] Mohanty BR, Sahoo PK, Mahapatra KD, Saha JN. Innate immune responses in families of Indian major carp, Labeo rohita deleting in their resistance to Edwardsiella tarda infection. Current Science 2007;92:1270 e 4. [19] Raida MK, Buchmann K. Innate immune response in rainbow trout ( Onco- rhynchus mykiss ) against primary and secondary infections with Yersinia ruckeri O1. Developmental and Comparative Immunology 2009;33:35 e 45.

[20] Mohanty BR, Sahoo PK. Immune responses and expression pro les of some immune-related genes in Indian major carp, Labeo rohita to Edwardsiella tarda infection. Fish and Shell sh Immunology 2010;28:613 e 21. [21] Leclere V, Bechet M, Blondeau R. Functional signi cance of a periplasmic Mn- superoxide dismutase from Aeromonas hydrophila . Journal of Applied Micro- biology 2004;96:828 e 33. [22] Hilbi H, Zychlinsky A, Sansonetti PJ. Macrophage apoptosis in microbial infections. Parasitology 1997;115:S79 e 87. [23] Henderson B, Wilson M, Wren B. Are bacterial exotoxins cytokine network regulators? Trends in Microbiology 1997;5:454 e 8. [24] Secombes CJ, Wang T, Hong S, Peddie S, Crampe M, Laing KJ. Cytokines and innate immunity of sh. Developmental and Comparative Immunology 2001; 25:713 e 23. [25] Ingerslev HC, Pettersen EF, Jakobsen RA, Petersen CB, Wergeland HI. Expres- sion pro ling and validation of reference gene candidates in immune relevant tissues and cells from Atlantic salmon ( Salmo salar L.). Molecular Immunology 2006;43:1194 e 201. [26] Panigrahi A, Kiron V, Satoh S, Hirono I, Kobayashi T, Sugita H, et al. Immune modulation and expression of cytokine genes in rainbow trout Oncorhynchus mykiss upon probiotic feeding. Developmental and Comparative Immunology 2007;31:372 e 82. [27] Shike H, Lauth X, Westerman ME, Ostland VE, Carlberg JM, Van Olst JC, et al. Bass hepcidin is a novel antimicrobial peptide induced by bacterial challenge. European Journal of Biochemistry 2002;269:2232 e 7. [28] Shi J, Camus AC. Hepcidins in amphibians and shes: antimicrobial peptides or iron-regulatory hormones? Developmental and Comparative Immunology 2006;30:746 e 55. [29] Lee P, Peng H, Gelbart T, Beutler E. The IL-6- and lipopolysaccharide-induced transcription of hepcidin in HFE-, transferrin receptor 2-, and b2- microglobulin- de cient hepatocytes. Proceedings of the National Academy of Sciences of the United States of America 2004;101:9263 e 5. [30] Lambris JD, Mavroidis M, Sunyer JO. In: Erdei A, editor. New aspects of complement structure and function. Austin, TX: R. G. Landes; 1994. p. 15 e 34. [31] Boshra H, Li J, Sunyer JO. Recent advances on the complement system of teleost sh. Fish and Shell sh Immunology; 2006:239 e 62.

[32]

Cuesta A, Esteban MA, Meseguer J. Molecular characterization of the nonspecic cytotoxic cell receptor (NCCRP-1) demonstrates gilthead seabream NCC heterogeneity. Developmental and Comparative Immunology 2005;29:637 e 50.

[33] Roca FJ, Sepulcre MP, López-Castejón G, Meseguer J, Mulero V. The colony- stimulating factor-1 receptor is a speci c marker of macrophages from the bony sh gilthead seabream. Molecular Immunology 2006;43:1418 e 23.