Ciencias Plan Electivo

Biología
2008
Modelo del ADN
Replicación del ADN
Ingeniería genética
Guía Plan Electivo
BL11-1
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
2
CEPECH Preuniversitario, Edición 2008
3
CEPECH Preuniversitario, Edición 2008
2
CEPECH Preuniversitario, Edición 2008
3
CEPECH Preuniversitario, Edición 2008
2
CEPECH Preuniversitario, Edición 2008
3
Introducción
La presente guía tiene por objetivo proporcionarte distintas instancias didácticas relaciona-
das con el proceso de enseñanza – aprendizaje. Como cualquier otro material se requiere de
la mediación del profesor y de tu estudio sistemático.
Las guías del curso de Biología están organizadas de tal forma que primero se desarrollan
los contenidos, principalmente a través de una invitación a razonar los principales conceptos,
permitiendo un aprendizaje significativo de éstos. Para ello, nuestras guías muestran diversas
figuras que están asociadas a una serie de preguntas que permiten guiar la secuencia de la
clase. Finalmente, se presentan 10 preguntas de selección múltiple relacionadas con los con-
tenidos de la clase:
Estructura del ADN.
Replicación del ADN.
Habilidades de la clase
Uno de los principales cambios que se producen con la PSU es el desarrollo de habilidades,
más que el mero conocimiento. Con la cantidad de información que podemos acceder actual-
mente es necesario que el alumno sea capaz de construir su propio conocimiento y por ello
nuestra labor se centra en entregar las herramientas para que sea capaz autónomamente de
generar estas habilidades, las cuales se ordenan jerárquicamente:
Conocimiento: Se refi ere a recordar información específi ca, datos, defi niciones,
fechas, nombres, etc.
Comprensión: Se refi ere a la habilidad de relacionar información, explicar con tus
propias palabras, identifi car situaciones en otro contexto.
Aplicación: Es la habilidad de usar la información, ideas o conceptos en situaciones
nuevas para resolver un problema o situación.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
2
CEPECH Preuniversitario, Edición 2008
3
CEPECH Preuniversitario, Edición 2008
2
CEPECH Preuniversitario, Edición 2008
3
CEPECH Preuniversitario, Edición 2008
2
CEPECH Preuniversitario, Edición 2008
3
Análisis: Es una habilidad superior que consiste en dividir un todo para descubrir
la relación que se establece entre sus partes lo que determina la coherencia entre
ellas.
Los contenidos de esta clase los puedes encontrar en tu libro CEPECH entre las páginas 17
y 26.

Ideas fuerza


El ADN es la molécula que almacena la información genética de los organismos.
La forma de organización del ADN responde al modelo enunciado por Watson y
Crick que en lo esencial plantea que se trata de una doble hebra, con direcciones de
crecimiento opuestas, donde las dos hebras se unen por puentes de hidrógeno de
manera complementaria.
El ADN se duplica o replica por el modelo semiconservativo, que signifi ca que en las
hebras hijas la mitad de la información es original y la otra mitad nueva.
Aprovecha todas las instancias que te entregamos para que mejores tu aprendizaje. Tus progresos
pueden ser tan buenos como tu decidas que sean
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
4
CEPECH Preuniversitario, Edición 2008
5
CEPECH Preuniversitario, Edición 2008
4
CEPECH Preuniversitario, Edición 2008
5
CEPECH Preuniversitario, Edición 2008
4
CEPECH Preuniversitario, Edición 2008
5
Modelo del ADN
El ADN (ácido desoxirribonucleico) corresponde a una macromolécula de estructura com-
puesta. En ella concurren varios tipos de elementos que pasamos a revisar a continuación. Para
ello completa con la palabra correspondiente las frases que aparecen a continuación.
PURINAS
NH
2
N
N
N
C
C
C HC
CH
N
H
1
2
3
4
5
6
7
8
9
Adenina (A)
O
O
C
C
N
HN CH
CH
H
1
2
3
4
5
6
Uracilo (U)
PIRIMIDINAS
O
N
HN
N
C
C
C C
CH
N
H
1
2
3
4
5
6
7
8
9
Guanina (G)
H
2
N
O
O
C
C
N
HN C
CH
H
1
2
3
4
5
6
Timina (T)
CH
3
NH
2
O
C
C
N
N
CH
H
1
2
3
4
5
6
Citosina (C)
CH
Las bases nitrogenadas presentes en el
ADN se clasifican en dos tipos: _____
_______ y __________. Las púricas
corresponden a la __________ (A)
y __________ (G), que se caracte-
rizan por la presencia de dos anillos
en su estructura. Las bases pirimídicas
corresponden a la __________ (C) y
la __________ (T) y se caracterizan
por la presencia de un solo anillo. Es
necesario mencionar que en el caso
del ARN la base timina es reemplazada
por __________ (U).
O
OH
H
H
H
H
H
OH
HOCH
2
desoxirribosa
La pentosa que forma parte del ADN es la __
________, que da la base del nombre para esta
molécula. El átomo de hidrógeno en la posición
2 marca una diferencia importante con respecto
al ARN, ya que éste último es una molécula ___
_______.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
4
CEPECH Preuniversitario, Edición 2008
5
CEPECH Preuniversitario, Edición 2008
4
CEPECH Preuniversitario, Edición 2008
5
CEPECH Preuniversitario, Edición 2008
4
CEPECH Preuniversitario, Edición 2008
5
En la estructura de los ácidos nucleicos también participa un grupo fosfato, el cual es el mismo
para cualquier ácido nucleico.
Los elementos anteriormente mencionados concurren a la formación de los __________, las
unidades mínimas que permiten la organización de los ácidos nucleicos.
A continuación se presentan los cuatro nucleótidos que forman el ADN.
Desoxiribosa
Nucleótidos:
Fosfato
O
O O
O
P
5’
CH
2
O
H H
H
H OH
4’
1’
2’ 3’
H
N
N
N
N
NH
2
5
6
1
2
3
4
7
8
9
Adenina (A)
desoxiribosa
Fosfato
O
O O
O
P CH
2
O
H H
H
H OH
H
N
N
N
N
O
5
6
1
2
3
4
7
8
9
H
NH
2
Guanina (G)
Timina (T)
N
N
O
5
6
1
2
3
4
H
O
CH
3
H
O
H
H
H H
OH
O
O O
O
P CH
2
N
N
NH
2
5
6
1
2
3
4
O
H
Citocina (C)
desoxiribosa
Fosfato
O
O O
O
P CH
2
Fosfato
O
H H
H
H OH
Adenina:
Citosina:
Guanina:
Timina:
Desoxiribosa
El nombre que recibe un nucleótido tiene relación con la base nitrogenada que posee, ya que
éste es el único elemento __________ dentro de él.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
6
CEPECH Preuniversitario, Edición 2008
7
CEPECH Preuniversitario, Edición 2008
6
CEPECH Preuniversitario, Edición 2008
7
CEPECH Preuniversitario, Edición 2008
6
CEPECH Preuniversitario, Edición 2008
7
Modelo de Watson y Crick
Este modelo tiene varias características.
Dos largas cadenas polinucleotídicas están enrolladas
alrededor de un __________, formando una _____
_______________ hacia la derecha (dextrogira).
Las dos cadenas son __________, es decir, la orien-
tación 5’ a 3’ va en sentidos contrarios.
Extremo 5’ Extremo 3’
A
T
C
G
A
T
Extremo 3’
T
A
G
C
T
A
Extremo 5’
Ácido fosfórico
Desoxirribosa
Base nitrogenada

Diámetro
Esqueleto
Azúcar Fosfato
Eje Central
3,4 nm
20Aº
V
U
E
L
T
A

C
O
M
P
L
E
T
A
Las bases nitrogenadas de las dos cadenas yacen
formando estructuras planas y perpendiculares al
eje, están apiladas unas sobre las otras, separadas
__________, y se encuentran en el interior de
la estructura.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
6
CEPECH Preuniversitario, Edición 2008
7
CEPECH Preuniversitario, Edición 2008
6
CEPECH Preuniversitario, Edición 2008
7
CEPECH Preuniversitario, Edición 2008
6
CEPECH Preuniversitario, Edición 2008
7
Las bases nitrogenadas de las cadenas opuestas están apareadas como resultado de la formación
de ____________________. En el ADN sólo se permiten los emparejamientos __________
y __________.
G
C
3’
G
C
C
G
A
T
G
C
A
T
T
A
G
C
A
A
T
C
3’
5’
5’
A
T
C
T
G
C
G
G
• Cada vuelta completa de la hélice tiene una longitud de 3,4 nm, de este modo cada vuelta de
la cadena contiene __________.
• En cualquier segmento de la molécula, se observan un surco mayor y uno menor alternados
a lo largo del eje.
• La doble hélice mide 2,0 nm de ancho.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
8
CEPECH Preuniversitario, Edición 2008
9
CEPECH Preuniversitario, Edición 2008
8
CEPECH Preuniversitario, Edición 2008
9
CEPECH Preuniversitario, Edición 2008
8
CEPECH Preuniversitario, Edición 2008
9
Replicación del ADN
Helicasa
É
Ü
Ñ
á
à
Ö
Ñ
3’
5’
Dirección
general de la
replicación
Topoisomerasas
Horquilla de
replicación
Proteínas de unión
a la cadena simple
ADN
polimerasa
ARN
primasa
ADN
ligasa
ADN
polimerasa
Cadena retrasada con
fragmentos de Okazaki
Cadena
adelantada
3’
3’
3’
3’
3’
5’
5’
5’
Cebador de
ARN
5’
ARN
ADN
Fragmentos
de Okazaki
Ö
Cebador o
primer
Å
Ç
Å La enzima __________ se encarga de desenrrollar el ADN aliviando la tensión del
superenrrollamiento. Esta acción es necesaria para que las enzimas puedan actuar sobre
el ADN y replicarlo.
Ç Luego la enzima __________ continúa con el desenrrollamiento y además rompe
puentes de hidrógeno. La doble hebra se abre exponiendo los moldes, lo que se conoce
como ____________________.
É Existen ______________________________ que son importantes para mantener
la estabilidad de la horquilla de replicación.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
8
CEPECH Preuniversitario, Edición 2008
9
CEPECH Preuniversitario, Edición 2008
8
CEPECH Preuniversitario, Edición 2008
9
CEPECH Preuniversitario, Edición 2008
8
CEPECH Preuniversitario, Edición 2008
9
Ñ Las ADN polimerasas sólo adicionan nucleótidos sobre un fragmento previo de ácido
nucleico, ya sea ADN o ARN, lo que se denomina __________ o __________. La
enzima responsable es __________.
Ö Existen dos moldes para la síntesis de ADN, una hebra es de copia continua o _______
___ y la otra es discontinua o __________.
Ü En la hebra de copia continua se agregan nucleótidos por la actividad de la __________.
Esta misma enzima es capaz de corregir un error.
á La hebra retrasada se sintetiza de una forma más compleja. La ADN polimerasa agrega
nucleótidos luego del cebador. Cuando la doble hebra se vuelve a abrir para exponer más
del molde, se debe agregar un nuevo cebador y sintetizar el ADN correspondiente. Cada
segmento nuevo de ADN de la hebra retrasada se conoce como ________________
____________. A medida que avanza la copia de la hebra retrasada la ADN polimerasa
elimina los __________.
à Los espacios que se generan en la hebra retrasada son unidos por la ___________.
Ingeniería genética
A mediados de 1970 comienza una revolución en biología: la tecnología del ADN recombinante.
Esta técnica ha permitido realizar avances desde la biología celular hasta la evolución.
Se denomina ADN recombinante a las moléculas de ADN producidas por la unión de seg-
mentos que provienen de diferentes fuentes biológicas. Las técnicas de construcción de ADN
recombinante se conocen como técnicas de ingeniería genética.
El desarrollo de esta tecnología, que permite la obtención de grandes cantidades de ADN que
codifican para una proteína específica, no sólo ha facilitado la investigación de la organización,
estructura y expresión génica, sino que su aplicación ha supuesto un espectacular avance en el
diagnóstico de enfermedades metabólicas e infecciosas y en la obtención de fármacos y vacunas
recombinantes. En un futuro revolucionará el tratamiento de un gran número de enfermedades
mediante la terapia génica.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
10
CEPECH Preuniversitario, Edición 2008
11
CEPECH Preuniversitario, Edición 2008
10
CEPECH Preuniversitario, Edición 2008
11
CEPECH Preuniversitario, Edición 2008
10
CEPECH Preuniversitario, Edición 2008
11
Existe una serie de pasos básicos para la obtención de ADN recombinante:
a. En primer lugar, se necesita disponer del fragmento de ADN a recombinar. Éste se obtiene
de una fuente biológica a través de la utilización de ____________________ (enzimas que
cortan el ADN en sitios específicos conocidos).
+ Enzima de restricción
5’
3’
5’
3’
5’
3’
3’
5’ 5’
3’
3’
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
10
CEPECH Preuniversitario, Edición 2008
11
CEPECH Preuniversitario, Edición 2008
10
CEPECH Preuniversitario, Edición 2008
11
CEPECH Preuniversitario, Edición 2008
10
CEPECH Preuniversitario, Edición 2008
11
b. Una vez obtenido el fragmento, se inserta en otra molécula de ADN, que se denomina
__________, produciéndose así la molécula de ADN recombinante. Los vectores pueden
replicarse de manera autónoma en una célula hospedera, lo que permite la manipulación y
multiplicación de la nueva molécula de ADN recombinante construida.
un gen de interés
DNA de otro organismo
Ambos se tratan con enzima
de restricción
Plásmido de una bacteria
Se mezcla, se permite que los
extremos complementarios se
apareen, y los extremos cortados
se unen con ligasa de DNA
(a)
(b)
(c)
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
12
CEPECH Preuniversitario, Edición 2008
13
CEPECH Preuniversitario, Edición 2008
12
CEPECH Preuniversitario, Edición 2008
13
CEPECH Preuniversitario, Edición 2008
12
CEPECH Preuniversitario, Edición 2008
13
c. La molécula de ADN recombinante se transfiere a la célula hospedera, dentro de la cual se
replica intensamente, de tal forma que se generan numerosas copias, que se denominan
__________.
Fragmento 1 Fragmento 2
Fragmento 3 Fragmento 4
Sitios de escisión
Fragmento
de interés
Se corta con una enzima
de retricción
Gen para resistencia
a antibiótico
Las bacterias con el
plásmido viven y se
multiplican
Las bacterias sin el
plásmido no proliferan
Caja de Petri con el
medio que contiene
antibiótico
(a)
(b)
(c)
DNA humano
d. Al replicarse las células hospederas, las células descendientes heredan el ADN recombi-
nante, creándose una población de células idénticas, todas ellas portadoras de la secuencia
clonada. Las células más usadas son las bacterianas.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
12
CEPECH Preuniversitario, Edición 2008
13
CEPECH Preuniversitario, Edición 2008
12
CEPECH Preuniversitario, Edición 2008
13
CEPECH Preuniversitario, Edición 2008
12
CEPECH Preuniversitario, Edición 2008
13
Preguntas propuestas
1. ¿Qué proteína es la encargada de romper los puentes de hidrógeno que unen las dos
hebras del ADN?
A) Topoisomerasa.
B) Primasa.
C) ADN polimerasa.
D) ARN polimerasa.
E) Helicasa.
2. La replicación del ADN se define como semiconservativa, lo que significa que
A) cuando se duplica el ADN, las hebras contienen sólo ADN nuevo.
B) cuando el ADN se replica, el resultado es una mezcla desigual de ADN nuevo y
original.
C) luego de la replicación, cada cadena de ADN contiene la mitad del ADN nuevo y
la otra mitad original.
D) cada cadena de ADN conserva completamente la información de la cadena origi-
nal.
E) cada cadena resultante sufre una dispersión con respecto a la cadena original.
3. En el modelo de ADN de Watson y Crick, las hebras se caracterizan porque
I. tienen una disposición antiparalela.
II. se unen por puentes de hidrógeno entre las bases nitrogenadas.
III. se unen en forma exacta y complementaria.
A) Sólo I
B) Sólo II
C) Sólo III
D) Sólo I y II
E) I, II y III
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
14
CEPECH Preuniversitario, Edición 2008
15
CEPECH Preuniversitario, Edición 2008
14
CEPECH Preuniversitario, Edición 2008
15
CEPECH Preuniversitario, Edición 2008
14
CEPECH Preuniversitario, Edición 2008
15
4. ¿Qué cambio(s) debe(n) ocurrir para que el ADN se pueda replicar?
I. La doble hebra se debe desenrollar.
II. Se deben romper los puentes de hidrógeno.
III. El ADN se debe encontrar en el estado de cromatina.
A) Sólo I
B) Sólo II
C) Sólo III
D) Sólo I y II
E) I, II y III
5. ¿Qué condiciones se deben cumplir para que ocurra replicación del ADN?
I. Nucleótidos libres.
II. Cebadores sobre los moldes de ADN.
III. Presencia de horquilla de replicación.
A) Sólo I
B) Sólo II
C) Sólo I y II
D) Sólo I y III
E) I, II y III
6. En el marco de la ingeniería genética las enzimas de restricción tienen como obje-
tivo
A) generar copias de los fragmentos de ADN a recombinar.
B) cortar un segmento de ADN para recombinar.
C) unir segmentos de ADN a recombinar con ADN del vector.
D) degradar copias defectuosas de ADN recombinante.
E) limitar el número de copias que se hacen del ADN a recombinar.
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
14
CEPECH Preuniversitario, Edición 2008
15
CEPECH Preuniversitario, Edición 2008
14
CEPECH Preuniversitario, Edición 2008
15
CEPECH Preuniversitario, Edición 2008
14
CEPECH Preuniversitario, Edición 2008
15
7. ¿En cuál de las siguientes situaciones se debe aplicar una mayor cantidad de energía para
separar las hebras del ADN?
A) 75% pares de bases AT y 25% pares de bases GC.
B) 50% pares de bases AT y 50% pares de bases GC.
C) 25% pares de bases AT y 75% pares de bases GC.
D) 80% pares de bases AT y 20% pares de bases GC.
E) 60% pares de bases AT y 40% pares de bases GC.
8. ¿Qué pareja(s) de conceptos está(n) incorrectamente combinada(s)?
I. Pares de bases complementarias = adenina y citosina.
II. Bases = adenina, timina, citosina y guanina.
III. Cromosoma eucariótico = ADN y proteínas.
A) Sólo I
B) Sólo II
C) Sólo III
D) Sólo I y II
E) Sólo II y III
9. El uso de la terapia génica en el futuro apuntará a
I. la ubicación de genes defectuosos para reemplazarlos por los normales.
II. la identificación de enfermedades genéticas en personas que aún no las hayan
desarrollado.
III. prevenir el desarrollo de enfermedades genéticas.
A) Sólo I
B) Sólo II
C) Sólo I y II
D) Sólo II y III
E) I, II y III
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
16
CEPECH Preuniversitario, Edición 2008
17
CEPECH Preuniversitario, Edición 2008
16
CEPECH Preuniversitario, Edición 2008
17
CEPECH Preuniversitario, Edición 2008
16
CEPECH Preuniversitario, Edición 2008
17
10. El proceso de replicación semiconservativa se refiere a que
A) cada nueva molécula de ADN contiene dos nuevas cadenas individuales de ADN
B) las enzimas encargadas de la síntesis de ADN utilizan nucleótidos libres para
realizar la síntesis.
C) algunas bases nitrogenadas se aparean con bases nitrogenadas específicas.
D) cada una de las hebras de la cadena de ADN sirve de molde para formar una
cadena nueva.
E) se producen errores durante la replicación de ADN.
Pregunta Alternativa Habilidad
1 Comprensión
2 Comprensión
3 Conocimiento
4 Comprensión
5 Comprensión
6 Comprensión
7 Aplicación
8 Comprensión
9 Conocimiento
10 Comprensión
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
16
CEPECH Preuniversitario, Edición 2008
17
CEPECH Preuniversitario, Edición 2008
16
CEPECH Preuniversitario, Edición 2008
17
CEPECH Preuniversitario, Edición 2008
16
CEPECH Preuniversitario, Edición 2008
17
Amplía tus conocimientos
De acuerdo con lo que has aprendido y lo que plantea tu libro de biología, responde las
siguientes preguntas.
1. ¿Cómo se descubrió que los genes están compuestos de ADN?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
2. Investiga en qué consiste el experimento de Avery.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
3. ¿De qué forma el proceso de replicación del ADN asegura la constancia genética?
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
4. A partir de la siguiente secuencia de ADN, determine la secuencia de la hebra de ADN
hermana y la secuencia del ARNm
5` CTGCCATTGTCACAGATACCGGATTAGGCCTAAAGCCC 3`
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
18
CEPECH Preuniversitario, Edición 2008
19
CEPECH Preuniversitario, Edición 2008
18
CEPECH Preuniversitario, Edición 2008
19
CEPECH Preuniversitario, Edición 2008
18
CEPECH Preuniversitario, Edición 2008
19
5. Investiga acerca de las aplicaciones de la ingeniería genética.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
6. ¿Qué utilidad presentará en el futuro el uso de la terapia génica? ¿Qué enfermedades podrán
ser tratadas? Menciona algunos ejemplos.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
7. Investiga acerca de la tecnología que ha llevado a la fabricación industrial de insulina
humana.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
8. Investiga acerca del proyecto genoma humano.
__________________________________________________________________
__________________________________________________________________
__________________________________________________________________
B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

B
i
o
l
o
g
í
a

2
0
0
8

Guía Plan Electivo
Biología 2008
G
u
í
a

P
l
a
n

E
l
e
c
t
i
v
o

CEPECH Preuniversitario, Edición 2008
18
CEPECH Preuniversitario, Edición 2008
19
CEPECH Preuniversitario, Edición 2008
18
CEPECH Preuniversitario, Edición 2008
19
CEPECH Preuniversitario, Edición 2008
18
CEPECH Preuniversitario, Edición 2008
19

En la próxima clase, estudiarás los siguientes temas:

Síntesis de proteínas. Transferencia del mensaje genético desde el
ADN a la maquinaria de síntesis de proteínas.
- Correspondencia entre codón del ARNm, anticodón del ARNt
y el aminoácido correspondiente.
- Traducción del mensaje genético durante la síntesis de proteí-
nas.
- Interpretación del significado de una mutación a nivel molecu-
lar.

Relación entre estructura y función de las proteínas.
- Albinismo y anemia falciforme.

Enzimas, como ejemplo de la importancia de la estructura tridi-
mensional de las proteínas.
Consulta el índice de tu libro para preparar estos temas.
Prepara tu próxima clase

Sign up to vote on this title
UsefulNot useful