Vous êtes sur la page 1sur 3

Soeren Junge Nielsen

*
Jens F. Rehfeld
Jens Peter Goetze
Department of Clinical Biochemistry
Rigshospitalet
University of Copenhagen
Denmark
* Address correspondence to the author at:
Department of Clinical Biochemistry
Rigshospitalet
9 Blegdamsvej, DK-2100
Copenhagen, Denmark.
Fax 4535454640
e-mail soerenjunge@gmail.com
DOI: 10.1373/clinchem.2007.096172
Hexaprimer Amplification
Refractory Mutation System
PCR for Simultaneous Single-
Tube Genotyping of 2 Close
Polymorphisms
To the Editor:
Tetraprimer amplification refrac-
tory mutation system PCR (T-
ARMS-PCR) is a simple and inex-
pensive genotyping method for
differentiating both alleles of a
polymorphism/mutation(bothsingle-
nucleotide polymorphisms and
small insertions/deletions) with a
single-tube PCR (1). In T-ARMS-
PCR, a pair of common (outer)
primers produces a nonallele-
specific control amplicon and in
combination with 2 allele-specific
(inner) primers (designed to anneal
in the opposite orientation) pro-
duces 2 allele-specific amplicons.
These allele-specific amplicons have
different sizes because the poly-
morphism/mutation is asymmetri-
cally located with respect to the
common primers. Thus, the ampli-
cons can be separated by standard
gel electrophoresis. T-ARMS-PCR
has alsobeendesignedina multiplex
fashion to genotype more than one
polymorphism/mutation by a sin-
gle-tube PCR (2).
We describe a modified multi-
plex T-ARMS-PCR, the hexaprimer
ARMS-PCR (H-ARMS-PCR), which
is for when 2 polymorphisms are
close in the sequence. H-ARMS-
PCR uses only 6 primers and pro-
vides direct information about hap-
lotype structure.
The CTLA4 gene (cytotoxic T-
lymphocyteassociated protein 4;
also known as CD152) is a negative
regulator of T-cell function (3).
The CTLA4 polymorphisms 318
CT (rs5742909) and 49 AG
(rs231775) are associated with
susceptibility to autoimmune dis-
eases and cancer (3, 4). To geno-
type these 2 polymorphisms,
which are only 365 bp apart in the
5 region of the CTLA4 gene, we
designed an H-ARMS-PCR that
combines a single pair of com-
mon primers and 2 pairs of allele-
specific primers in the same tube
(Fig. 1A).
The PCR reaction (25 L)
contained 200 mol/L de-
oxynucleoside triphosphates, 100
ng of genomic DNA, 1.25 U of
HotStarTaq DNAPolymerase with
its buffer (Qiagen), and the follow-
ing primers at the indicated con-
centrations (deliberate mis-
matches from the reference
sequence, GenBank no. M74363,
are in boldface italics): 318fo, 5-
CAATGAAATGAATTGGACTGGA
TG-3 (0.5 mol/L); 49ro, 5-TA
CAGAGCCAGCCAAGCCAGATT-
3 (0.8 mol/L); 318fi(c), 5-CTC
CACTTAGTTATCCAGATCGTC-3
(2.5 mol/L); 318ri(t), 5-AC
TGAAGCTTCATGTTCACTCTA-3
(0.5 mol/L); 49fi(a), 5-GCACA
AGGCTCAGCTGAACCTGGATA-
3 (0.1 mol/L); and 49ri(g),
5-ACAGGAGAGTGCAGGGCCAG
GTCCTAGC-3 (0.5 mol/L).
Cycling conditions were 12
min at 95 C, followed by 5 cycles
of 94 Cfor 30 s, 62 Cfor 30 s, and
72 Cfor 45 s; 30 cycles of 94 Cfor
30 s, 57 Cfor 30 s, and 72 Cfor 45
s; and a final cycle at 72 C for 10
min.
We genotyped both the 318
CT and 49 AG CTLA4 poly-
morphisms with this newly de-
signed H-ARMS-PCR(Fig. 1A) for
samples from 80 individuals that
had previously been characterized
with 3 established methods [re-
strictionfragment lengthpolymor-
phism (RFLP) PCR, direct DNA
sequencing, and T-ARMS-PCR]
(4) and observed no discrepancies.
Moreover, H-ARMS-PCR provides
both an additional internal control
and direct information about the
haplotype structure by generating an
amplicon that is specific for 1 of the
4 haplotypes that 2 polymorphisms
can theoretically have. In this case,
the haplotype-specific amplicon is
observed when the alleles 318C
and 49Gare on the same chromo-
some (Fig. 1A).
We further tested this ap-
proach by implementing
H-ARMS-PCR in the genotyping
of 2 polymorphisms that are 142
bp apart in the 3 untranslated re-
gion (UTR) of the CYP19A1 gene
(cytochrome P450, family 19, sub-
family A, polypeptide 1): rs10046
(CT) and rs4646 (GT).
CYP19A1 encodes aromatase, the
enzyme responsible for the final
step of estrogen biosynthesis.
CYP19A1 polymorphisms have
been associated with estrogen con-
centrations in woman and with
susceptibility to breast and pros-
tate cancers (5).
We used the PCR to analyze
these 2 CYP19A1 polymorphisms
in the 3 UTR (Fig. 1B; see legend
for PCR conditions) in 100 in-
dividuals already characterized
by RFLP PCR and/or direct DNA
sequencing (P.P. and R.N., un-
published data) and observed no
discrepancies. A haplotype-specific
amplicon is present when alleles
rs10046C and rs4646T are on the
same chromosome. This H-ARMS-
PCRis currentlybeingusedinamul-
Letters
Clinical Chemistry 54:1 (2008) 227
ticenter Italian clinical trial (GIM5)
to test the possible association of
CYP19A1 polymorphisms with the
efficacy of adjuvant therapy with an
aromatase inhibitor (letrozole) after
tamoxifen treatment in postmeno-
pausal patients with early breast
cancer.
In addition, we genotyped a
series of 40 individuals for both
CTLA4 and CYP19A1 polymor-
phisms by H-ARMS-PCR analysis
with different thermal cyclers
(iCycler by Bio-Rad, Px2 by
Hybaid, and PTC-100 by MJ Re-
search) and in different laborato-
ries, and we obtained fully concor-
dant results, demonstrating the
robustness and reproducibility of
this approach. All human samples
were collected after informed con-
sent was obtained according to in-
stitutional procedure.
We have shown that H-ARMS-
PCR is an effective and robust tech-
nique for genotyping 2 close poly-
morphisms (in a range of about
100400 bp) with only 6 primers.
With appropriate long-range Taq
DNA polymerase, H-ARMS-PCR
may work for genotyping even more
distantly separated polymorphisms,
likely withina distance of about 5kb.
In addition, by providing direct in-
formation about one defined haplo-
type, H-ARMS-PCR, may be useful
for the identification of potentially
ambiguous haplotypes in individu-
als who are double heterozygotes.
Grant/fundingSupport: This work
is supported in part by grants from
Ministero della Salute (Italy), Com-
pagnia di San Paolo (Torino, Italy),
and CARIGE (Genova, Italy). P.P. is
Fig. 1. Polymorphism genotyping by H-ARMS-PCR.
(A), H-ARMS-PCR for CTLA4 318 CT (rs5742909) and 49 AG (rs231775) polymorphisms: representative results for 6
individuals. PCR products were separated by electrophoresis on a 17.5-g/L agarose gel. Lane MW, molecular size markers; lane
1, 318 C/C and 49 A/A; lane 2, 318 C/C and 49 G/G; lane 3, 318 C/T and 49 A/G; lane 4, 318 C/C and 49 A/G;
lane 5, 318 C/T and 49 A/A; lane 6, 318 T/T and 49 A/A. Amplicon sizes are as follows: C (control amplicon), 701 bp;
318C allele, 597 bp, 318T allele, 149 bp; 49A allele, 230 bp; 49G allele, 517 bp; Hap CG [haplotype 318C- and
49G-specific amplicon (lanes 2, 3, 4)], 420 bp.
(B), H-ARMS-PCR for CYP19A1 rs10046 (CT) and rs4646 (GT) polymorphisms: representative results for 6 individuals. Lane
MW, molecular size markers; lane 1, rs10046 T/T and rs4646 G/G; lane 2, rs10046 C/C and rs4646 G/G; lane 3, rs10046 C/C
and rs4646 G/T; lane 4, rs10046 C/C and rs4646 T/T; lane 5, rs10046 C/T and rs4646 G/G; lane 6, rs10046 C/T and rs4646 G/T.
PCR reactions (see text) were with the following primers (deliberate mismatches from the GenBank sequence, no. M30804, are
in boldface italics): CYP19-Fo, 5-CAGAAGATACACGACTTGTCCTTGCACCCAG-3 (0.25 mol/L); CYP19-Ro, 5-CCGACTATT
TCTCCCTCAAACTCTTGGC-3 (0.25 mol/L); rs10046-Fi(C), 5-CTGGAACACTAGAGAAGGCTGGTCAGTAGCC-3 (1.0 mol/L);
rs10046-Ri(T), 5-TGTGAACTACTGATGAGAAATGCTCCAGATTA-3 (1.0 mol/L); rs4646-Fi(G), 5-TATGGGTTGTCACCAAGCTAG
GTGCTACTG-3 (2.0 mol/L); rs4646-Ri(T), 5-GTTCTCTGGTGTGAACAGGAGCAGATGTCA-3 (2.0 mol/L). Cycling conditions
were 12 min at 95 C, followed by 20 cycles of 94 C for 30 s, 67 C for 30 s, and 72 C for 30 s; 15 cycles of 94 C for 30 s,
63 C for 30 s, and 72 C for 30 s; and a final cycle at 72 C for 10 min. PCR products were separated by electrophoresis on
25-g/L agarose gels (Agarose MS; Roche Diagnostics). Amplicon sizes are as follows: C (control amplicon), 342 bp; rs10046C
allele, 255 bp; rs10046T allele, 149 bp; rs4646T allele, 289 bp; rs4646G allele, 112 bp; Hap CT [haplotype rs10046C- and
rs4646T-specific amplicon (lanes 3, 4, 6)], 202 bp.
Because of the tight linkage of these polymorphisms, only 3 (combined in 6 genotypes) of the 4 possible haplotypes have been
observed for the 2 genes. The SNP nomenclature is according to NCBI at: http://www.ncbi.nlm.nih.gov/SNP/index.html.
Letters
228 Clinical Chemistry 54:1 (2008)
supported by Oncotech, Naples,
Italy.
Financial Disclosures: None de-
clared.
References
1. Ye S, Humphries S, Green F. Allele specific am-
plification by tetra-primer PCR. Nucleic Acids Res
1992;20:1152.
2. Piccioli P, Serra M, Gismondi V, Pedemonte S,
Loiacono F, Lastraioli S, et al. Multiplex tetra-
primer amplification refractory mutation sys-
tem PCR to detect 6 common germline muta-
tions of the MUTYH gene associated with
polyposis and colorectal cancer. Clin Chem
2006;52:73943.
3. Teft WA, Kirchhof MG, Madrenas J. A molecular
perspective of CTLA-4 function. Annu Rev Immu-
nol 2006;24:6597.
4. Balbi G, Ferrera F, Rizzi M, Piccioli P, Morabito
A, Cardamone L, et al. Association of 318 C/T
and 49 A/G cytotoxic T lymphocyte antigen-4
(CTLA-4) gene polymorphisms with a clinical
subset of Italian patients with systemic sclerosis.
Clinical Exp Immunol 2007;149:407.
5. Olson JE, Ingle JN, Ma CX, Pelleymounter LL,
Schaid DJ, Pankratz VS, et al. A comprehensive
examination of CYP19 variation and risk of
breast cancer using two haplotype-tagging ap-
proaches. Breast Cancer Res Treat 2007;102:
23747.
Patrizia Piccioli
1
Martina Serra
1
Simona Pedemonte
1
Giuseppe Balbi
4
Fabrizio Loiacono
1
Sonia Lastraioli
1
Lucia Gargiulo
1
Anna Morabito
2
Daniela Zuccaro
1
Lucia Del Mastro
3
Maria Pia Pistillo
2
Marco Venturini
5
Maria De Angioletti
6,7
Rosario Notaro
1,7*
1
Laboratory of Human Genetics
Medical Oncology C
2
Laboratory of Translational Research A
3
Medical Oncology A
IST, Istituto Nazionale per la
Ricerca sul Cancro
Genoa, Italy
4
Department of Oncology,
Biology and Genetics
University of Genoa
Genoa, Italy
5
Medical Oncology
Ospedale Sacro Cuore Don Calabria
Verona, Italy
6
Istituto di Genetica e Biofisica
Adriano Buzzati Traverso (IGB-CNR)
Naples, Italy
7
Laboratory of Genetics and Gene
Transfer
Core Research Laboratory Istituto
Toscano Tumori (CRL-ITT)
Florence, Italy
* Address correspondence to this author at:
Laboratory of Genetics and Gene Transfer
Core Research Laboratory Istituto
Toscano Tumori (ITT-CRL)
Viale Pieraccini 6 (Cubo)
50139 Florence, Italy
Fax 39-055-427-1280
e-mail rosario.notaro@ittumori.it

These authors contributed equally


to this work.
DOI: 10.1373/clinchem.2007.095703
Letters
Clinical Chemistry 54:1 (2008) 229