This article appeared in a journal published by Elsevier.

The attached
copy is furnished to the author for internal non-commercial research
and education use, including for instruction at the authors institution
and sharing with colleagues.
Other uses, including reproduction and distribution, or selling or
licensing copies, or posting to personal, institutional or third party
websites are prohibited.
In most cases authors are permitted to post their version of the
article (e.g. in Word or Tex form) to their personal website or
institutional repository. Authors requiring further information
regarding Elseviers archiving and manuscript policies are
encouraged to visit:
http://www.elsevier.com/copyright
Author's personal copy
Acta Tropica 125 (2013) 237245
Contents lists available at SciVerse ScienceDirect
Acta Tropica
j our nal home page: www. el sevi er . com/ l ocat e/ act at r opi ca
Survey of pyrethroids resistance in Indian isolates of Rhipicephalus (Boophilus)
microplus: Identication of C190A mutation in the domain II of the
para-sodium channel gene
Rinesh Kumar, Gaurav Nagar, Anil Kumar Sharma, Sachin Kumar, D.D. Ray, Pallab Chaudhuri,
Srikanta Ghosh

Entomology Laboratory, Parasitology Division, Indian Veterinary Research Institute, Izatnagar 243122, Uttar Pradesh, India
a r t i c l e i n f o
Article history:
Received 17 July 2012
Received in revised form3 October 2012
Accepted 14 October 2012
Available online 22 October 2012
Keywords:
Rhipicephalus (Boophilus) microplus
Deltamethrin resistance
Esterase
Mutation
Para-sodiumchannel gene
a b s t r a c t
Monitoring acaricide resistance and understanding the underlying mechanisms are critically important
in developing strategies for resistance management and tick control. Eighteen isolates of Rhipicephalus
(Boophilus) microplus collected from four agro-climatic regions of India were characterized and the resis-
tant data were correlated with bioassay results, esterase enzyme activities and with the presence/absence
of point mutation in the para-sodium channel gene. The adult immersion test was standardized to assess
the level of resistance and resistant factors (RF) in the range of 1.295.7 were detected. Out of eighteen
isolates, three were categorized as susceptible (RF < 1.4), ve isolates at level I (RF =1.5<5), eight at level
II (RF = 5.1<25), and one isolate each at level III (RF = 26<40) and level IV (RF = >41). The esterase enzyme
ratio and survival% of tick isolates was observed signicantly (p < 0.001) correlated with correlation coef-
cient (r) in - and -esterase activity. The correlation of determination (R
2
) for - and -esterase activity
indicated that 73.3% and 55.3% data points of eld isolates were very close to the correlation lines. For
detection of point mutation, three sites (mutation in domain IIS6, T2134A mutation in domain IIIS6 and
C190A mutation in domain IIS4-5 linker) of sodium channel gene were amplied and sequenced. Com-
parative sequence analysis identied a cytosine (C) to adenine (A) nucleotide substitution (CTC to ATC) at
position 190 in domain II S4-5 linker region of para-sodium channel gene in six isolates and in reference
deltamethrin resistant IVRI-IV line. The occurrence of mutation in the tick isolates having high resistance
factor suggested that target site insensitivity and enhanced esterase activity is the possible mechanism
of resistance to deltamethrin in the Indian isolates of R. (B.) microplus. These results also concluded that
the mutation site in Indian tick isolates is similar to Australian and Brazilian tick isolates while it is dif-
ferent in tick isolates from Mexico and North America. This is the rst report of occurrence of mutation
in para-sodium channel gene of deltamethrin resistant Indian isolates of R. (B.) microplus.
2012 Elsevier B.V. All rights reserved.
1. Introduction
The cattle tick, Rhipicephalus (Boophilus) microplus (Canestrini)
pose serious economic threat to cattle producers in many parts
of the world, both directly from physical effects upon infested
animals and indirectly through the diseases caused by protozoan
parasites transmitted by this tick species. The global economic
losses due to tick infestations have been roughly estimated as
14,00018,000millionUS$ annually (De CastroandNewson, 1993).
In India, the annual control cost of ticks and tick borne diseases
(TTBDs) has been estimated at 498.7millionUS$ (Minjauwand Mc
Leod, 2003). Besides, a 2030% reduction in the value of hides

Corresponding author. Tel.: +91 941 0261029; fax: +91 581 2303284.
E-mail addresses: sghoshp@yahoo.co.in, sghoshtick@gmail.com(S. Ghosh).
and skin has been determined due to tick bite marks (Biswas,
2003). Control of the tick species along withother medically impor-
tant vectors and agricultural pests is largely focused on repeated
use of chemical acaricides viz., synthetic pyrethroids (SPs) and
organophosphates (OPs). The rampant and indiscriminate use of
acaricides by livestock farmers has culminated into development
of resistance in ticks, which is considered as the main technical
problem for tick control programme in livestock (Shidrawi, 1990;
Ghosh et al., 2006). A survey based on questionnaires in a sampled
population of manufacturers and farmers reported the presence of
a wide spread acaricidal resistance in India (FAO, 2004). However,
no comprehensive study was undertaken to study the mecha-
nism of resistance to SPs operating in Indian cattle tick, R. (B.)
microplus.
Insensitive target site SP resistance mechanismhas been closely
examined in many arthropods. The sodium channels are the
0001-706X/$ see front matter 2012 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.actatropica.2012.10.006
Author's personal copy
238 R. Kumar et al. / Acta Tropica 125 (2013) 237245
primary targets of SPs, which are structural derivatives of the nat-
urally occurring pyrethrins (Narahashi, 1988). Intensive use of SPs
in arthropod control has led to a worldwide emergence of resistant
populations. Many of the resistant arthropods carry specic point
mutations in the sodium channel gene and structural alterations
in the sodium channel protein may diminish the interaction of
SPs with sodium channel, reducing the sensitivity to pyrethroids
(Dong, 2007; Soderlund, 2008). Most of the mutations in sodium
channel gene have been reported in domain II S6 transmembrane
segment and domain II S4-5 linker region. A small number of
mutations have also been found outside of domain II usually
in domain I or III. Insensitive target site resistance mechanism,
which is now quite ubiquitous among disease vectors and other
arthropod species is also reported in R. (B.) microplus. A mutation
in the sodium channel gene was found in Corrales and San Felipe
isolates of R. (B.) microplus from Mexico that were extremely
resistant to the acaricide permethrin. This mutation involved a
single substitution of an adenosine (A) for thymidine (T) at the
position 2134 (T2134A) in the sodium channel gene sequence
(GenBank accession no. AF134216), resulting in the replacement
of a phenylalanine by an isoleucine in transmembrane segment
six of domain III of the sodium channel gene (He et al., 1999).
Studies have shown that this mutation correlates with umethrin,
deltamethrin and cypermethrin resistance in Mexican tick popula-
tions (Jamroz et al., 2000; Rosario-Cruz et al., 2005). More recently,
another mutation in the domain II S4-5 linker region of the sodium
channel gene has been reported in cattle tick R. (B.) microplus from
Australia (Morgan et al., 2009) and Brazil (Nogueira Domingues
et al., 2012). The cytosine (C) to adenine (A) mutation at position
190 (C190A) in the para-sodiumchannel gene sequence results in
anamino acidsubstitutionfromleucine inthe susceptible isolate to
isoleucine in the resistant isolate. The mutation found in Australian
and Brazilian ticks has not been detected in ticks from Mexico
(Chen et al., 2009; Rosario-Cruz et al., 2009). The second and
less understood mechanism involves esterase enzyme mediated
metabolic detoxication. A number of assays have been developed
to detect elevated expression of esterase via gene amplication
(Field et al., 1988) and over-transcription (Fournier et al., 1992).
However, In India there is a paucity of information on the status
and mechanisms of development of acaricide resistance in R. (B.)
microplus, the most economically important tick infesting Indian
livestock. There is a need to closely monitor acaricide resistance
problem in India as there is diversity reported in the mechanism
of resistance to SPs in R. (B.) microplus from different regions of
the world (He et al., 1999; Chen et al., 2009). Hence, the aim of
the present study was to determine the mechanism of resistance
in eighteen eld isolates of R. (B.) microplus collected from highly
tick infested areas of India through correlation of discriminat-
ing dose (DD) bioassay results with esterase activity and the
presence/absence of mutation in the para-sodiumchannel gene.
2. Materials and methods
2.1. Reference susceptible tick line (IVRI-I)
The colony of acaricides susceptible reference IVRI-I line of R.
(B.) microplus (NBAII-IVRI-BM-1-1998) was used as the standard to
assess susceptibility/resistance status intickisolates collectedfrom
the study area. The colony is maintained in the Entomology Labora-
tory of IndianVeterinary ResearchInstitute for the last 15 years and
has not been exposed to any acaricides. The susceptibility status
of the colony was established by periodical testing against sev-
eral organo-phosphates, organo-chlorines, synthetic pyrethroids
and formamidine compounds in independent bioassays. Different
developmental stages of ticks were reared in glass tubes covered
with cotton cloths and kept in BOD incubator maintained at 28

C
with 852% RH. Agroup of 1014 days old larvae were released on
the ears of disease free cross bred calves using ear bag method and
the bags were checked regularly. After 1618 days, the engorged
females dropped in the ear bags were collected for in vitro bioas-
says. After 23 feeding cycles, calves were set free for a month.
The homogeneity amongst different generations of IVRI-I line has
been established by uniformentomological data and by analyzing
the sequences of 16s rRNA gene of the tick species (accession nos.
GU222462, GU323287, and GU323288) (Kumar et al., 2011).
2.2. Reference deltamethrin resistant tick line (IVRI-IV)
The deltamethrin resistant IVRI-IV line of R. (B.) microplus was
originally collected from cattle shed located at Danapur village of
Patna, Bihar, India. The cattle owners of the village reported low
efcacy of deltamethrin used for the control of ticks. As the col-
lected samples were not sufcient for effective AIT, adults were
reared in the laboratory at 28

C with 852% RH for oviposi-

tion and hatching of larvae. As mentioned above, larvae were
released on separate batch of calves and signicant number of
adult females was obtained. To determine the acaricide resistance
status, previously determined discriminating dose (DD) of tech-
nical grade deltamethrin (99.9%) (AccuStandard

Inc., USA) was

used in AIT and the resistance factor (RF) was determined (Sharma
et al., 2012). Initially, the ticks were selected from the treatment
of 6X (X=30ppm) concentration of deltamethrin. The adult female
that survived was allowed to lay eggs and the developed larvae
were released on calves for feeding. After completing the cycle the
engorged females of the next generation were collected and again
treated with higher concentration of deltamethrin to get the LC
50
values. The experiment was continued for several generations with
the increasing acaricide pressure. The resistance increase in subse-
quent generations was calculated by the method of Gopalan et al.
(1996) using the following formula:
Resistance fold increased =
LC50 values of the resistant ticks
LC50 values of the susceptible ticks
.
The RF of reference IVRI-IV line was calculated as 42.5.
2.3. Sampling
Two stage stratied sampling method was adopted to collect
live engorged females of R. (B.) microplus from animals and from
the cracks and crevices of organized and unorganized farms. The
areas of collection were selected from four agro-climatic regions
of India (Fig. 1) where tick infestation level is normally very high
and SPs and OP insecticides are intensively used for animal hus-
bandry and agricultural activities. The isolates (BEG, DNP, DRB,
and SUL) were collected from middle gangetic region located at
24

20

10

27

31

15

N, 82

19

50

88

17

40

E with annual tem-

perature and rainfall in the range of 440

C and 10001200mm,
respectively. The isolates (N-24P, S-24P) were collected fromareas
located at 22.56

N88.36

E receiving annual rainfall from 1250

to 2500mm with an average annual temperature in the range
from 15 to 35.5

C. The isolates (PAT, BTH, and LDH) were col-

lected fromtrans-gangetic plain region located at 29.30

32.32

N,
73.55

76.50

E with very cold winter (2

C) and hot summer

(40

C) and receiving 460960mm annual rainfall. The other iso-

lates (COR, PRT, UDP, BLW, BSW, JPR, BHT, ALW, and SKR) of
western region located at 23.30

30.11

N, 69.29

78.17

E having
very low annual rainfall of 200400mmand average temperature
of 848

C.
The female ticks were collected in separate vials, covered with
cotton cloths to allow air and moisture exchange, and were trans-
ported to the local processing centers. The samples collected froma
Author's personal copy
R. Kumar et al. / Acta Tropica 125 (2013) 237245 239
Fig. 1. Collection of tick samples fromdifferent agro-climatic regions (shaded) of India.
Source: Planning Commission of India.
particular area (district) were pooled, designated as an isolate and
washed thoroughly in water, labeled and kept at 28

C and 855%
relative humidity. The AIT was conducted at the processing cen-
ters where the engorged ticks were collected in a large numbers.
When collected ticks were fewer in number and insufcient for
conducting AIT these ticks were transportedtothe entomology lab-
oratory of Indian Veterinary Research Institute and were kept at
optimum maintenance conditions egg laying at 28

C and 855%
relative humidity. The egg masses of different engorged females
of each isolate were pooled and the pooled larvae were released
on calves for feeding. The resistance status of the isolates against
deltamethrin was determined by AIT using statistically signicant
number of ticks.
2.4. Adult immersion test
The adult immersion test was adopted as per the method of
Drummond et al. (1973) and Benavides et al. (1999) using different
discriminating dose (DD) of deltamethrin to determine the resis-
tance factor and the level of resistance. Discriminating dose (DD) of
deltamethrinwas determinedas 2LC
95
(229.6ppm=59.2ppm)
to conduct in vitro bioassays of different eldisolates (Sharma et al.,
2012). Each isolate was exposed to different discriminating doses
viz., 2x, 4x, 6x, 8x, 10x prepared in distilled water from the stock
solution of deltamethrin, where x is the calculated value of LC
95
.
Four to six replications each containing 5 ticks were treated at each
DD for 2min and kept in Petri dishes after drying on tissue paper.
Author's personal copy
240 R. Kumar et al. / Acta Tropica 125 (2013) 237245
Table 1
Primers used to amplify the targeted regions of sodiumchannel gene.
Name Primer sequence 5

-3

Region amplied Product size Ref.

D2F
D2R
ACGTTCGTTTCGTCTGCTA
GATTCGCTTGGGACAGATT
Domain II-S6 (kdr) 434bp Jamroz et al. (2000)
D3F
D3R
CTGGTTACATCATATCTAATTGCCAC
CCAGCCTTCTTCTTTTGTTCATTG
Domain III-S6 193bp Chen et al. (2009)
L2F
L2R
TACGTGTGTTCAAGCCTA
ACTTTCTTCGTAGTTCTTGC
Domain II S4-5 linker (Superkdr) 167bp Morgan et al. (2009)
After 24h, the treated ticks were transferred to 10ml tick-rearing
tubes covered with cotton cloths and were placed in incubator
maintained at 28

C and 855% relative humidity. The entomo-

logical data was recorded regularly. The LC
50
value of different
isolates was determined by applying regression equation analysis
to the probit transformed data of mortality using GraphPad Prism
version 4.0, San Diego, CA, USA. Resistance factors (RFs) for dif-
ferent isolates were worked out by the quiescent between LC
50
of
eld isolates and LC
50
of reference susceptible IVRI-I line of R. (B.)
microplus (Castro-Janer et al., 2009). As per the calculated value of
resistance factor (RF), the resistance status in eld isolates of R. (B.)
microplus was categorized as susceptible (RF 1.4), resistance level
I (RF =1.55.0), level II (RF =5.125.0), level III (RF =2640) andlevel
IV (RF 41) (Kumar Sachin et al., 2011).
2.5. Esterase assay
Esterase activities withthe substrates -and-naphthyl acetate
were determined in the ticks according to the method of
Hemingway (1998) with some modications. Twenty deep frozen
larvae were homogenized in a precooled glass pestle in 200l
of distilled water. The homogenates were spun at 1100g in
a refrigerated centrifuge at 4

C for 15min and resulting super-

natant was used for assay. Reaction mixtures contained 20l of
the homogenate in quadruplicate adjacent wells (two wells each
for -and -naphthyl acetate) of microtitre plate and 200l of -
and -naphthyl acetate solution (250l of 30mM stock in 25ml
of phosphate buffer 0.02M, pH 7.2.), respectively. The reaction
mixtures were incubated at room temperatures for 30min before
additionof 50l of fast bluesolution(0.023gfast bluesalt dissolved
in 2.25ml distilled water and 5.25ml of 5% SDS in 0.1M sodium
phosphate buffer, pH 7.2) to each well. The plates were incubated
for 5min at room temperature and absorbance was measured at
570nm in a microtitre plate reader (Tecan, Austria) operated by a
personal computer using Magellan 6 software. The resulting opti-
cal densities (ODs) were compared with standard curves of ODs for
known concentrations of the products -and -naphthyl acetate,
respectively. The esterase activities were expressed as enzyme
ratio (mean activity of enzyme in resistant isolate/mean activity
of enzyme in reference susceptible IVRI-I line).
2.6. Extraction of genomic DNA, RNA, amplication and
sequencing
Ten to fteen days old, unfed larvae emanating from reference
IVRI-I, IVRI-IV lines and eld isolates, whose resistance status was
characterized were used to isolate total RNA and genomic DNA.
The total RNA was extracted from about 100mg tick larvae using
Trizol reagent (Sigma, USA) following the manufacturers protocol.
The integrity of RNA was checked by gel electrophoresis and con-
centration was determined in Nanodrop 3300C spectrophotometer
(Thermo scientic, USA). The cDNA was synthesized from 3g of
total RNAusing the RevertAid
TM
Hminus Reverse Transcription Kit
using OligodT primer (Fermentas, Germany). The cDNA was stored
at 20

C until use. The genomic DNA was extracted from 400mg

tick larvae by phenolchloroform extraction as per the standard
technique (Sambrook et al., 2001). Genomic DNA was preserved in
200l of TE buffer.
The PCR primers to amplify the fragments of the sodiumchan-
nel gene anking the mutation sites were designed fromthe partial
sodium channel R. (B.) microplus gene sequence (Mexican strain,
GenBank accession no. AF134216). Nucleotide sequences of the
primer pairs, the product sizes and the regions amplied are indi-
cated in Table 1. Domain IIS6 was amplied by primer pair D2F and
D2R; domain IIIS6 was amplied by primer pair D3F and D3R and
S4-5 linker region in domain-II was amplied by primer pair L2F
and L2R. The lyophilized primers were resuspended in TE buffer
and the stock solution was further diluted in nuclease free water to
obtain a working solution of 10pmol/l.
First strand cDNA generated from the larvae of IVRI-I, IVRI-IV
lines and from 18 eld isolates were used as a template for PCR
amplication of knockdown resistance (kdr) region (domain IIS6)
of the sodiumchannel gene. PCR reaction was carried out in a 25l
reaction volume containing 2.5l of 10 AccuPrime PCR buffer I,
5.0l cDNA (1:5 dilution, 100ng/l); 1.0l of each primer, D2F
and D2R, 0.3l of AccuPrime Taq DNA polymerase (5IU/l) (Invi-
trogen, USA). The PCR conditions optimized as one cycle of initial
denaturation at 94

C for 2min followed by 35 cycles of 94

C for
1min, 50

C for 1min, 68

C for 1min and a nal extension at 68

C
for 10min.
Genomic DNA was isolated from larvae of IVRI-I, IVRI-IV lines
and eighteen eld isolates and was used as a template for PCR
amplication of domain IIIS6 region (encompassing the T2134A
mutation site) and domain II S4-5 (encompassing the C190A
mutation site) in the voltage-gated sodium channel gene. For
amplication of T2134A mutation site, a 25l PCR reaction was set
up using 2.5l of 10 PCR buffer; 5.0l genomic DNA (1:5 dilu-
tion, 50ng/l); 0.5l dNTP (10mM), 0.75l of each primer, D3F
andD3R, 0.3l of DreamTaqDNApolymerase (5IU/l) (Fermentas,
Germany). The PCR conditions optimized as an initial denaturation
step at 95

C for 2min, followed by 34 cycles of 95

C for 1min,
55

C for 30s and 72

C for 30s with a nal extension step at 72

C
for 10min.
The C190A mutation site was amplied by PCR using a set of
primers, L2F and L2R. A 25l PCR reaction was performed using
2.5l of 10 AccuPrime PCR buffer II, 5.0l genomic DNA (1:5
dilution, 50ng/l), 1.0l of each primer, 0.3l of AccuPrime Taq
DNA polymerase (5IU/l) (Invitrogen, USA). Thermal cycling con-
ditions were: initial denaturation of 94

C for 2min and followed

by 40 cycles each consisting of successive incubations at 94

C for
1min, 50

C for 30s, 68

C for 30s with a nal extension step at

68

Cfor 10min. All amplications were carriedout ina Veriti Ther-

mal Cycler (Applied Biosystems, USA). The positive amplication
of genes was visualized by electrophoresis of the product in ethid-
ium bromide stained 1.5% and 3% metaphor agarose gel. The PCR
products were puried using QIAquick gel extraction kit (Qiagen,
Germany).
The puried PCR product of T2134A mutation site (193bp) and
C190A mutation site (167bp) were subjected to double stranded
custom DNA sequencing. The puried PCR product of kdr region
Author's personal copy
R. Kumar et al. / Acta Tropica 125 (2013) 237245 241
Table 2
Showing slope, LC
50
values, RF, level of resistance and its relation to presence/absence of mutation in the para-sodiumchannel gene.
Tick isolates Slope SE LC
50
values (95% CL) RF against deltamethrin Level of resistance
a
Na
+
channel mutation
DNP 2.42 0.24 55.9 (51.760.4) 4.2 I ND
BEG 2.08 1.32 92.0 (83.6101.2) 6.9 II ND
DRB 2.18 1.37 46.1 (42.350.2) 3.4 I ND
SUL 1.30 0.14 467.1 (399.2546.5) 34.9 III D
N-24P 2.96 0.30 26.9 (16.344.4) 2.0 I ND
S-24P 3.55 0.73 158.0 (149.0167.5) 11.8 II D
PAT 1.62 0.93 69.2 (61.278.2) 5.2 II ND
BTH 2.351.48 102.1 (92.8112.3) 6.7 II ND
LDH 2.32 0.37 90.0 (85.794.5) 7.6 II D
COR 3.44 0.87 71.9 (67.876.2) 5.4 II ND
PRT 1.37 0.32 33.5 (28.938.9) 2.5 I ND
UDP 2.96 0.42 153.6 (143.5164.3) 11.5 II D
BLW 5.09 1.03 114.04 (109.6118.6) 8.5 II D
BSW 0.55 0.22 0.27 (0.180.39) 1.2 S ND
JPR 1.08 0.43 6.1 (5.047.37) 1.4 S ND
BHT 3.30 0.76 65.9 (53.760.3) 4.9 I ND
ALW 0.68 0.27 3.33 (2.195.06) 1.25 S ND
SKR 1.27 0.42 1282.5 (1089.41516.9) 95.7 IV D
a
S, susceptible =RF <1.4; level I =1.5<RF <5; level II =5.1<RF <25; level III =26<RF <40; level IV=RF >41; D, detected; and ND, not detected.
(434bp) was ligated with the T/A cloning vector pTZ57R/T (InsTA
Clone, MBI, Fermentas Inc., GmbHGermany) andrecombinant plas-
mids were transformed into E. coli DH
5
cells. Plasmid DNA was
puried with a plasmid purication kit (Qiagen, Germany). Insert-
positiveclones wereveriedbyrestrictionenzymedigestionbefore
sequencing. The positive clones and PCR products were outsourced
to DNA sequencing facility at University of Delhi, South Campus
for double stranded sequencing. The forward and reverse sequence
data were alignedandanalyzedusing Lasergene software (DNAStar
Inc., Madison, USA) andBTI software (Gene Tool Lite, USA) andcom-
pared with homologues in GenBank using BLAST (NCBI). Sequence
information of at least ve PCR products/clones from each of the
eld isolate was analyzed.
3. Results
The data on slope, LC
50
, RF values and the level of resistance in
the eld isolates are shown in Table 2. Five isolates viz., DNP, DRB,
N-24, PRT and BHT were detected as resistant at level I with RF ran-
ging from2.0to4.9. Resistance level II was detectedineight isolates
with 5.211.8 RF values while two isolates, SUL and SKR collected
frommiddle gangetic plain region and western dry region, respec-
tively, were detected as highly resistant and categorized under
level III; RF =34.9 and level IV; RF =95.7, respectively. The farm-
ers/farm owners reported frequent applications of higher doses
of deltamethrin due to very low efcacy of the most aggressively
marketed product.
The - and -esterase enzyme activity in terms of enzyme ratio
in collected eld isolates of R. (B.) microplus is summarized in
Table 3. The correlation data of survival% and - and -esterase
enzyme activity is summarized in Table 4. The enzyme ratio and
survival% of tick isolates were observed signicantly (p<0.001)
correlated with correlation coefcient (r) in - and -esterase
activities. The correlation coefcient (r) indicates the real correla-
tion between both the variables which tend to increase or decrease
together when r exists between 0 and 1. The correlation of deter-
mination (R
2
) for - and -esterase activity indicated that 73.3%
and 55.3% data points of eld isolates were very close to the corre-
lation lines. However, the correlation was more pronounced with
-esterase than -esterase. When a minimumof 50% survival per-
centage at DD was compared, a signicant correlation between -
and -esterase activities with survival percentages was observed
(Fig. 2A and B).
The PCR amplication of domain IIS6 showed clear bands
at 434bp. The kdr mutation was not detected in any of the
Table 3
Esterase activity in Indian isolates of R. (B.) microplus collected fromdifferent places.
Tick isolates Resistance factor Survival% -Esterase ratio -Esterase ratio
IVRI-I 1.0 0.0 1.0 1.0
IVRI-IV 42.5 100 3.07 1.77
DNP 4.2 48.9 1.88 2.08
BEG 6.9 60 2.31 2.45
DRB 3.4 35 1.72 1.63
SUL 34.9 86.7 4.35 2.92
N-24P 2.0 65 1.75 1.60
S-24P 11.8 85 3.56 2.89
PAT 5.2 50 1.77 1.85
BTH 6.7 65 2.46 2.71
LDH 7.6 75 4.01 2.79
COR 5.4 56.7 1.44 1.13
PRT 2.5 33.3 1.84 1.4
UDP 11.5 90 3.21 2.46
BLW 8.5 100 3.47 2.24
BSW 0.02 10 1.2 1.03
JPR 0.45 15 1.08 1.0
BHT 4.9 50 2.33 2.13
ALW 0.25 20 1.12 1.07
SKR 95.7 100 4.06 2.9
deltamethrin resistant isolates as well as in reference deltamethrin
resistant IVRI-IV line of R. (B.) microplus. The PCR amplication of
the domain IIIS6 transmembrane segment of the sodium channel
gene from the susceptible and resistant isolates showed a clear
band at 193bp. No mutation was detected at position 2134 (T
to A) in domain IIIS6 transmembrane segment of resistant iso-
lates and also in reference IVRI-IV line (Fig. 3) despite of varying
degree of resistance status. The S4-5 linker region showed clear
band of 167bp. Sequence analysis from susceptible and resistant
eld isolates led to the identication of a cytosine (C) to adenine
(A) nucleotide substitution (CTC to ATC) at position 190 in domain
II S4-5 linker region in six isolates (BLW, LDH, S24-P, SKR, SUL,
and UDP) having high RF in the range of 7.695.7 (Fig. 4). In silico
translation of this nucleotide substitution causes an amino acid
change from leucine in the susceptible isolate to isoleucine (L64I)
Table 4
Correlation between survival% and enzyme activity in collected Indian isolates of R.
(B.) microplus.
Enzyme activity Pearsons correlation
coefcient (r) (95% CL)
p value R
2
-Esterase 0.856 (0.65820.9436) 0.0001 0.733
-Esterase 0.744 (0.43750.8956) 0.0003 0.553
Author's personal copy
242 R. Kumar et al. / Acta Tropica 125 (2013) 237245
Fig. 2. (A) Correlation between survival% and -esterase activity in different Indian
isolates of R. (B.) microplus. (B) Correlationbetweensurvival%and-esterase activity
in different Indian isolates of R. (B.) microplus.
in the resistant isolate within domain II S4-5 linker of the para-
sodiumchannel gene. Similar mutation was observed in reference
deltamethrin resistant IVRI-IV line of R. (B.) microplus.
4. Discussion
Selection for insecticide resistance in pest population is a major
consequence of using pesticides and is the principal threat to the
efcacy of SPs for the control of vectors of human and animal
diseases. Amongst the different vectors, ticks are ranked second to
mosquitoes in terms of numbers of diseases transmitted to human
and animals. Of the 899 tick species reported throughout the world
(Barker and Murrell, 2004), in India R. (B.) microplus is considered
most economically important tick species infesting livestock and
transmitting a number of diseases like babesiosis andanaplasmosis
(Ghosh et al., 2007). This tick population has immense potential for
rapidly developing resistance due to their biological and behavioral
characteristics and resistance to different active ingredients has
been reported in almost all countries where this parasite occurs
(Alonso-Diaz et al., 2006). Although in India the situation is not
very clear, recently a large scale development of resistance in R. (B.)
microplus to OP compound, diazinon (Kumar Sachin et al., 2011)
and SPs (Sharma et al., 2012) and moderate resistant in Hyalomma
anatolicum to both OP and SPs (Shyma et al., 2012) has been
reported. In the present work, discriminating dose bioassay results
with resistance factor were correlated with esterase activity and
the presence or absence of a point mutation in the sodiumchannel
gene. The resistance status to deltamethrin was established in
eighteen isolates collected from four agro-climatic regions, using
AIT, and the resistance factor (RF) was varied from 2.0 to 95.7.
Out of eighteen populations characterized, 3 populations showed
RF below 1.5 and were designated as susceptible populations.
T T C G G C T C C T T C T T C A C C T T G A A T C T A T Mexico, Susceptible
T T C G G C T C C T T C A T C A C C T T G A A T C T A T Mexico, Resistant
T T C G G C T C C T T C T T C A C C T T G A A T C T A T IVRI-I (HQ157236)
T T C G G C T C C T T C T T C A C C T T G A A T C T A T DNP
T T C G G C T C C T T C T T C A C C T T G A A T C T A T BEG
T T C G G C T C C T T C T T C A C C T T G A A T C T A T DRB
T T C G G C T C C T T C T T C A C C T T G A A T C T A T SUL (HQ157234)
T T C G G C T C C T T C T T C A C C T T G A A T C T A T LDH
T T C G G C T C C T T C T T C A C C T T G A A T C T A T S-24P
T T C G G C T C C T T C T T C A C C T T G A A T C T A T SKR (JQ693155)
T T C G G C T C C T T C T T C A C C T T G A A T C T A T UDP (JQ693156)
T T C G G C T C C T T C T T C A C C T T G A A T C T A T IVRI-IV (JQ693158)
Fig. 3. Sequence analysis of domain III S-6 region. Partial nucleotide sequence alignment of the domain III S-6 region of sodiumchannel gene in Indian and Mexican isolates
of R. (B.) microplus. Mexican resistant isolate showed T to A nucleotide change while no T to A nucleotide changes were recorded in Indian deltamethrin resistant isolates.
The position of mutation is 2134 in the reference sequence of sodiumchannel gene (accession no. AF134216).
A C C A T C G G T G C C C T C G G G A A C T T G A C C T Australian susceptible
A C C A T C G G T G C C A T C G G G A A C T T G A C C T Australian resistant
A C C A T C G G T G C C C T C G G G A A C T T G A C C T IVRI-I (HM579820)
A C C A T C G G T G C C C T C G G G A A C T T G A C C T ALW(JX262011)
A C C A T C G G T G C C C T C G G G A A C T T G A C C T BSW (JX262012)
A C C A T C G G T G C C C T C G G G A A C T T G A C C T DNP
A C C A T C G G T G C C C T C G G G A A C T T G A C C T BEG
A C C A T C G G T G C C C T C G G G A A C T T G A C C T DRB
A C C A T C G G T G C C A T C G G G A A C T T G A C C T LDH(HM579823)
A C C A T C G G T G C C A T C G G G A A C T T G A C C T SUL (HM579821)
A C C A T C G G T G C C A T C G G G A A C T T G A C C T S-24P (HM579824)
A C C A T C G G T G C C A T C G G G A A C T T G A C C T BLW(JX262013)
A C C A T C G G T G C C A T C G G G A A C T T G A C C T SKR (JQ693152)
A C C A T C G G T G C C A T C G G G A A C T T G A C C T UDP (JQ693153)
A C C A T C G G T G C C A T C G G G A A C T T G A C C T IVRI-IV(JQ693154)
Fig. 4. Sequence analysis of domain II S4-5 linker region. Partial nucleotide sequence alignment of the domain II S4-5 linker region of para-sodiumchannel gene of different
isolates of R. (B.) microplus showing C to A mutation in isolates having high RF and in deltamethrin resistant IVRI-IV line. This position is 190 in the reference sequence,
accession no. AF134216.
Author's personal copy
R. Kumar et al. / Acta Tropica 125 (2013) 237245 243
The other fteen populations were considered resistant at IIV
level according to the classication of Kumar Sachin et al. (2011).
From the data it is very clear that two isolates, SUL and SKR
having RF of 34.9 and 95.7, respectively, were collected from the
areas where SPs are probably not at all effective against the tick
populations. In both the areas use of SPs has reached at alarmingly
high level without maintaining any dose regime (Sharma et al.,
2012). Besides, six samples (Table 2) were having RF more than
6.0, a level considered enough to impair the use of deltamethrin in
the eld (Patarroyo and Costa, 1980). The isolates characterized as
susceptible were collected from the areas where OP compounds
are more frequently used than SP and thus high level of resistance
to diazinon was recorded in these areas (Kumar Sachin et al., 2011).
Esterase based resistance has been demonstrated to be one of
themechanisms for SPs andOPdetoxicationininsects andinR. (B.)
microplus. However, the specic mechanism through which resis-
tance is conferred has not been suitably elucidated (Hemingway
et al., 1993; Rosario-Cruz et al., 1997; Jamroz et al., 2000; Zhu et al.,
2004). In the present study, 73.3% and 55.3% data points for and
-esterase, respectively, of eld isolates were close to the correla-
tion point with survival percentages conrming esterase mediated
resistant mechanismis operating in R. (B.) microplus population in
India (Table 4).
The in silico analysis was performed to detect point mutations
in three specic regions of the sodium channel gene of the eld
isolated, R. (B.) microplus. One major mechanismof resistance tar-
geting the sodiumchannel gene is knownas knock downresistance
(kdr) inwhichthere is reducedtarget site sensitivityfor pyrethroids
resulting from one or more point mutations in domain IIS6 of
sodium channel gene. The most frequently encountered mutation
of kdr found in the house y include a substitution of leucine by
phenylalanine (L1014F) and a variety of this mutations (L1014S
or L1014H) are found in a range of important agricultural and
disease-transmitting arthropods including tobacco budworm(Park
and Taylor, 1997), horn y, Haematobia irritans (Guerrero et al.,
1997), diamondback moth, Plutella xylostella (Schuler et al., 1998),
peach-potato aphid, Myzus persicae (Martinez-Torres et al., 1999a),
mosquitoes, Anopheles gambiae and Culex pipiens (Martinez-Torres
et al., 1999b) and Colorado potato beetle, Leptinotarsa decemlineata
(Lee et al., 1999). Although kdr mutation is the most widely found
mutation associated with pyrethroid resistance, it is not detected
in any of the pyrethroid resistant Mexican isolates of southern cat-
tle tick, R. (B.) microplus (He et al., 1999; Jamroz et al., 2000). The
present investigation also failed to detect mutation in this region
of sodiumchannel gene (domain IIS6) in the resistant isolates of R.
(B.) microplus fromIndia (Fig. 3).
Another nucleotide substitution at position 2134 (T2134A) in
domain IIIS6 transmembrane segment of the sodiumchannel gene
was detected in San Felipe and Corrales isolates of R. (B.) microplus
in Mexico that were extremely resistant to pyrethroid permethrin
(He et al., 1999). To date this mutation in domain IIIS6 has been
detected in many tick isolates fromNorth America (Guerrero et al.,
2002; Rosario-Cruz et al., 2005; Miller et al., 2007; Chen et al.,
2009; Aguirre et al., 2010; Rodriguez-Vivas et al., 2012). Resis-
tance conferring mutations in the domain IIIS6 transmembrane
segment of the sodium channel gene have also been identied in
several pyrethroid resistant arthropods such as fruity, Dorsophila
melanogaster (Pittendrigh et al., 1997; Martin et al., 2000), two-
spotted spider mites, Tetranychus urticae (Tsagkarakou et al., 2009),
itch mites, Sarcoptes scabiei (Pasay et al., 2008) and mosquito, Aedes
aegypti (Yanola et al., 2010). The double strandedsequence analysis
fromeighteenpyrethroidresistant tickisolates andfromlaboratory
establisheddeltamethrinresistant IVRI-IVline didnot detect muta-
tions in the domain IIIS6 region of sodium channel gene of Indian
isolates of R. (B.) microplus. The absence of T2134A mutation has
also beenreported invarious pyrethroid resistant tick isolates from
Australia and Brazil (Li et al., 2007; Chen et al., 2009; Rosario-Cruz
et al., 2009; Andreotti et al., 2011).
A mutation which included substitution of adenine (A) by cyto-
sine (C) (CTC to ATC) was reported at position 190 in the domain
II S4-5 linker of the sodiumchannel gene of Parkhurst isolate of R.
(B.) microplus fromAustralia, which was resistant to all pyrethroids
including umethrin, cyhalothrin and deltamethrin (Morgan et al.,
2009). A similar mutation has been discovered in whitey, B. tabaci
(Morin et al., 2002) and head lice, Pediculus capatis (Lee et al., 2000)
in which it confers resistance to SPs. In the present investigations, a
mutation in the domain II S4-5 linker region of the sodiumchannel
gene has been detected in six populations having high resistance
factors (level IIlevel IV). This is the rst report from India detec-
ting a point mutation in the para-sodium channel gene possibly
responsible for conferring high level of resistance against SP in R.
(B.) microplus.
In the present study, a direct correlation between RF, esterase
activity and mutation (C190A) in the domain II S4-5 linker of para-
sodiumchannel gene was observed when RF is reached more than
7.6. The results gives a signicant clue to develop a monitoring and
warning system to restrict the use of SPs in area (s) where RF has
reached above the threshold level of 7.6.
The analysis of mutation in the sodium channel gene of R.
(B.) microplus from Australia, Brazil, Mexico and India leads to
the conclusion that different resistance mechanism have appar-
ently developed between these isolates of R. (B.) microplus. These
results suggest that distinct sodium channel gene mutations may
be selected in different arthropod species in response to pyrethroid
drug pressure and due to geographical isolation (He et al., 1999;
Pasay et al., 2006). Ina recent reviewGuerreroet al. (2012) reported
that Domain III mutation seems to be localized to North America,
the Morgan et al. (2009) mutation was discovered in Australia but
also reported in Brazil (Nogueira Domingues et al., 2012) while the
Jonsson et al. (2010) mutation is only reported in Australia. The
present information added new dimension to the distribution of
domain II mutation in the cattle tick, R. (B.) microplus.
5. Conclusions
In India, the R. (B.) microplus populations have developed
resistancetodeltamethrinandmechanismof development of resis-
tance has possibly been mediated by over-expression of esterase
enzymes and mutation in domain II S4-5 linker region of para-
sodiumchannel gene.
Acknowledgements
The authors are grateful to Indian Council of Agricul-
tural Research, New Delhi for funding through World Bank
funded National Agricultural Innovation Project No. NAIP/Comp-
4/C2066/2008-09. Authors are also grateful to the Veterinary
ofcers posted at different tick collection spots for their support.
References
Aguirre, M., Flores, E.A., Alvarez, G., Molina, A., Rodriguez, I., Ponce, G., 2010. A
novel amino acid substitution in the para-sodiumchannel gene in Rhipicephalus
microplus (Acari, Ixodidae) associatedwithknockdownresistance. Experimental
and Applied Acarology 52, 377382.
Alonso-Diaz, M.A., Rodriguez-Vivas, R.I., Fragoso-Sanchez, H., Rosario-Cruz, R., 2006.
Ixodicide resistance of the Boophilus microplus tick to ixodicides. Archivos de
Medicina Veterinaria 38, 105114.
Andreotti, R., Guerrero, F.D., Soares, M.A., Barros, J.C., Miller, R., Perez De Leon, A.A.,
2011. Acaricide resistance of Rhipicephalus (Boophilus) microplus inState of Mato
Grosso do Sul, Brazil. Revista Brasileira de Parasitologia Veterinria 20, 127133.
Barker, S.C., Murrell, A., 2004. Systematics and evolution of ticks with a list of valid
genus and species names. Parasitology 129, S15S36.
Benavides, O.E., Romero, N.A., Rodriguez, J.L., Silva, Z.J., 1999. Evidencia preliminar
de la aparicion de resistencia a lactonas macrociclicas en cepas de garrapata
Author's personal copy
244 R. Kumar et al. / Acta Tropica 125 (2013) 237245
Boophilus microplus en Colombia. In: Memorias IV Seminarios Internacional de
Parasitologia, Puerto Vallarta, Jalisco, Mexico, October 2022, pp. 260264.
Biswas, S., 2003. Effects of ticks on animal production system. In: Proceedings of
the National Seminar on Leather Industry in Todays Perspective, Kolkata, India,
November 1415.
Castro-Janer, E., Rifran, L., Piaggio, J., Gil, A., Miller, R.J., Schumaker, T.T.S., 2009.
In vitro tests to establish LC
50
and discriminating concentrations for pronil
against Rhipicephalus (Boophilus) microplus (Acari, Ixodidae) and their standard-
ization. Veterinary Parasitology 162, 120128.
Chen, A.C., He, H., Temeyer, K.B., Jones, S., Green, P., Barker, S.C., 2009. A survey
of Rhipicephalus microplus populations for mutation associated with pyrethroid
resistance. Journal of Economic Entomology 102, 373380.
De Castro, J.J., Newson, R.M., 1993. Host resistance in cattle tick control. Parasitology
Today 9, 1317.
Dong, K., 2007. Insect sodiumchannels and insecticide resistance. Invertebrate Neu-
roscience 7, 1730.
Drummond, R.O., Crust, S.E., Trevino, J.L., Gladney, W.J., Grahan, O.H., 1973. Boophilus
annulatus and laboratory tests of insecticides. Journal of Economic Entomology
66, 130133.
FAO, 2004. Guidelines Resistance Management and Integrated Parasite Control in
Ruminants. Module 1: Ticks: Acaricide Resistance: Diagnosis, Management and
Prevention. Food and Agriculture Organization, Animal Production and Health
Division, Rome, pp. 153.
Field, L.M., Devonshire, A.L., Forde, B.G., 1988. Molecular evidence that insecticide
resistance in peach-potato aphids (Myzus persicae Sulz,) results fromamplica-
tion of an esterase gene. Biochemical Journal 251, 309315.
Fournier, D., Bride, M., Hoffman, F., Karch, F., 1992. Acetylcholinesterase: two types
of modications confer resistance to insecticide. Journal of Biological Chemistry
15, 1427014274.
Ghosh, S., Bansal, G.C., Gupta, S.C., Ray, D., Khan, M.Q., Irshad, H., Shahiduzzaman,
M., Seitzer, U., Ahmed, J.S., 2007. Status of tick distribution in Bangladesh, India
and Pakistan. Parasitology Research 101 (Suppl. 2), S207S216.
Ghosh, S., Azhahianambi, P., de la Fuente, J., 2006. Control of ticks of ruminants, with
special emphasis on livestock farming systems in India: present and future pos-
sibilities for integrated control a review. Experimental and Applied Acarology
40, 4966.
Gopalan, N., Prakash, S., Bhattacharya, B.K., Anand, O.P., Rao, K.M., 1996. Develop-
ment of malathion resistance in Culex quinquefasciatus Say (Diptera, Culicidae).
Indian Journal of Medical Research 103, 8490.
Guerrero, F.D., Leonore, L., Martins, J.R., 2012. Acaricide resistance mechanisms in
Rhipicephalus (Boophilus) microplus. Revista Brasileira de Parasitologia Veter-
inria 21, 16.
Guerrero, F.D., Li, A.Y., Hernandez, R., 2002. Molecular diagnosis of pyrethroid resis-
tance in Mexican strains of Boophilus microplus (Acari: Ixodidae). Journal of
Medical Entomology 39, 770776.
Guerrero, F.D., Jamroz, R.C., Kammlah, D., Kunz, S.E., 1997. Toxicological and molec-
ular characterization of pyrethroid-resistant horn ies, Haematobia irritans:
identication of kdr and super-kdr point mutations. Insect Biochemistry and
Molecular Biology 27, 745755.
He, H., Chen, A.C., Davey, R.B., Ivie, G.W., George, J.E., 1999. Identication of a point
mutation in the para-type sodium channel gene from a pyrethroid-resistant
cattle tick. Biochemical and Biophysical Research Communications 261,
558561.
Hemingway, J., 1998. Techniques toDetect Insecticide Resistance Mechanisms (Field
and Laboratory Manual). Document WHO/CDS/CPC/MAL/98.6, World Health
Organization, Geneva.
Hemingway, J., Dunbar, S.J., Monro, A.G., Small, G.J., 1993. Pyrethroid resistance in
German cockroaches (Dictyoptera: Blattelidae): resistance levels and underly-
ing mechanisms. Journal of Economic Entomology 86, 16311638.
Jamroz, R.C., Guerrero, F.D., Pruett, J.H., Oehler, D.D., Miller, R.J., 2000. Molecular and
biochemical survey of acaricide resistance mechanisms in larvae from Mex-
ican strains of the southern cattle tick, Boophilus microplus. Journal of Insect
Physiology 46, 685695.
Jonsson, N.N., Cutull, C., Corley, S.W., Seddon, J.M., 2010. Identication of a muta-
tion in the para-sodiumchannel gene of the cattle tick Rhipicephalus (Boophilus)
microplus associated with resistance to umethrin but not to cypermethrin.
International Journal for Parasitology 40, 16591664.
Kumar, R., Paul, S., Kumar, S., Sharma, A.K., Gupta, S., Rawat, A.K.S., Chaudhuri, P., Ray,
D.D., Ghosh, S., 2011. Nucleotide specic changes in the hypervariable region of
16S rDNAgene as possible marker to differentiate the tick genera. IndianJournal
of Animal Sciences 81, 12041207.
Kumar, S., Paul, S., Sharma, A.K., Kumar, R., Tewari, S.S., Chaudhuri, P., Ray,
D.D., Rawat, A.K.S., Ghosh, S., 2011. Diazinon resistant status in Rhipicephalus
(Boophilus) microplus collected fromdifferent agro-climatic zones of India. Vet-
erinary Parasitology 181, 274281.
Lee, S.H., Dunn, J.B., Soderlund, J.M., Clark, D.M., 1999. Molecular analysis of kdr-like
resistance in a permethrin-resistant strain of Colorado potato beetle. Pesticide
Biochemistry and Physiology 63, 6375.
Lee, S.H., Yoon, K.S., Williamson, M.S., Goodson, S.J., Takano-Lee, M., Devonshire,
A.L., Clark, J.M., 2000. Molecular analysis of kdr-like resistance in permethrin-
resistant strains of head lice Pediculus capitis. Pesticide Biochemistry and
Physiology 66, 130143.
Li, A.Y., Chen, A.C., Miller, R.J., Davey, R.B., George, J.E., 2007. Acaricide resistance and
synergism between permethrin and amitraz against susceptible and resistant
strains of Boophilus microplus (Acari, Ixodidae). Pest Management Science 63,
882889.
Martin, R.L., Pittendrigh, B., Liu, J., Reenan, R., ffrench-Constant, R., Hanck, D.A., 2000.
Point mutations in domain III of a Drosophila neuronal Na channel confer resis-
tance to allethrin. Insect Biochemistry and Molecular Biology 30, 10511059.
Martinez-Torres, D., Foster, S.P., Field, L.M., Devonshire, A.L., Williamson, M.S.,
1999a. A sodium channel point mutation is associated with resistance to DDT
and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer)
(Hemiptera: Aphididae). Insect Molecular Biology 8, 339346.
Martinez-Torres, D., Chevillon, C., Brun-Barale, A., Berg, J.B., Pasteur,.N., Pauron, D.,
1999b. Voltage-dependent Na
+
channels in pyrethroid-resistant Culex pipiens
mosquitoes. Pesticide Science 55, 10121020.
Miller, R.J., Davey, R.B., George, J.E., 2007. First report of Permethrin resistant
Boophilus microplus (Acari: Ixodidae) collected within the United States. Journal
of Medical Entomology 44, 308315.
Minjauw, B., Mc Leod, A., 2003. Research Report, DFID Animal Health Programme.
Centre for Tropical Veterinary Medicine, University of Edinburgh, UK.
Morgan, J.A.T., Corley, S.W., Jackson, L.A., Lew-Tabor, A.E., Moolhuijzen, P.M., Jon-
sson, N.N., 2009. Identication of point mutation in the para-sodium channel
gene of the cattle Rhipicephalus (Boophilus) microplus associated with resistance
to synthetic pyrethroids acaricides. International Journal for Parasitology 39,
775779.
Morin, S., Williamson, M.S., Goodson, S.J., Brown, J.K., Tabashnik, B.E., Dennehy, T.J.,
2002. Mutations in the Bemisia tabaci para sodiumchannel gene associated with
resistance to a pyrethroid plus organophosphate mixture. Insect Biochemistry
and Molecular Biology 32, 17811789.
Narahashi, T., 1988. Chemical modulation of sodiumchannels. In: Soria, B., Cena, V.
(Eds.), Ion Channel Pharmacology. Oxford University Press, Oxford, pp. 2373.
Nogueira Domingues, L., Dos Santos Alves Figueiredo Brasil, B., Passos de Paiva
Bello, A.C., Pinto da Cunha, A., Thadeu Medeiros de Barros, A., Cerqueira
Leite, R., Silaghi, C., Pster, K., Friche Passos, L.M., 2012. Survey of pyrethroid
and organophosphate resistance in Brazilian eld populations of Rhipicephalus
(Boophilus) microplus: Detection of C190A mutation in domain II of the para-
type sodium channel gene. Veterinary Parasitology http://dx.doi.org/10.1016/
j.vetpar.2012.04.031
Park, Y., Taylor, M.F.J., 1997. A novel mutation L1029H in sodium channel gene
hscp associated with pyrethroid resistance for Heliothis virescens (Lepidoptera,
Noctuidae). Insect Biochemistry and Molecular Biology 27, 913.
Pasay, C., Arlian, A., Morgam, M., Moher-Vyszenski, D., Rose, A., Holt, D., Walton, S.,
McCarthy, J., 2008. High-resolution melt analysis for the detection of a mutation
associated with permethrin resistance in a population of scabies mites. Medical
and Veterinary Entomology 22, 8288.
Pasay, C., Walton, S., Fischer, K., Holt, D., McCarthy, J., 2006. PCR-based assay to
survey for knockdown resistance to pyrethroid acaricides in human scabies
mites (Sarcoptes scabiei var hominis). American Journal of Tropical Medicine and
Hygiene 74, 649657.
Patarroyo, J.H., Costa, J.O., 1980. Susceptibility of Brazilian samples of Boophilus
microplus to organophosphorus acaricides. Tropical Animal Health and Produc-
tion 12, 610.
Pittendrigh, B., Reenan, R., Ffrench-Constant, R.R., Ganetzky, B., 1997. Point muta-
tions in the Drosophila para sodium channel gene associated with resistance
to DDT and pyrethroid insecticides. Molecular and General Genetics 256,
602610.
Rodriguez-Vivas, R.I., Hodgkinson, J.E., Rosado-Aguilar, J.A., Villegas-Perez, S.L.,
Trees, A.J., 2012. The prevalence of pyrethroid resistance phenotype and geno-
type in Rhipicephalus (Boophilus) microplus in Yucatan, Mexico. Veterinary
Parasitology 184, 221229.
Rosario-Cruz, R., Almazan, C., Miller, R.J., Dominguez-Gracia, D.I., Hernandez-Ortiz,
R., De la Fuente, J., 2009. Genetic basis and impact of tick acaricide resistance.
Frontiers in Bioscience 14, 26572665.
Rosario-Cruz, R., Guerrero, F.D., Miller, R.J., Rodriguez-Vivas, R.I., Dominguez-Garcia,
D.I., Cornel, A.J., Hernandez-Ortiz, R., George, J.E., 2005. Roles played by esterase
activity and by a sodium channel mutation involved in pyrethroid resistance
in populations of Boophilus microplus (Acari: Ixodidae) collected fromYucatan,
Mexico. Journal of Medical Entomology 42, 10201025.
Rosario-Cruz, R., Miranda, M.E., Garcia, V.Z., Ortiz, E.M., 1997. Detection of esterase
activity in susceptible and resistant Boophilus microplus tick strains. Bulletin of
Entomological Research 87, 197202.
Sambrook, J., Russell, D.W., Irwin, N., Janseen, K.A., 2001. Molecular cloning-A labo-
ratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NewYork, pp. 6.16.62.
Schuler, T.H., Martinez-Torres, D., Thompson, A.J., Devonshire, A.L., Duce, I.R.,
Williamson, M.S., 1998. Toxicological, electrophysiological and molecular char-
acterization of knockdown resistance to pyrethroid insecticides in the diamond
black moth, Plutella xylostella (L.). Pesticide Biochemistry and Physiology 59,
169182.
Sharma, A.K., Kumar, R., Kumar, S., Nagar, G., Singh, N.K., Rawat, S.S.,
Dhakadd, M.L., Rawat, A.K.S., Ray, D.D., Ghosh, S., 2012. Deltamethrin
and cypermethrin resistance status of Rhipicephalus (Boophilus) microplus
collected from six agro-climatic regions of India. Veterinary Parasitology
http://dx.doi.org/10.1016/j.vetpar.2012.03.050
Shidrawi, G.R., 1990. A WHO global programme for monitoring vector resistance to
pesticide. Bulletin of the World Health Organization 68, 403408.
Shyma, K.P., Kumar, S., Sharma, A.K., Ray, D.D., Ghosh, S., 2012. Acaricide resistance
status in Indian isolates of Hyalomma anatolicum. Experimental and Applied
Acarology, http://dx.doi.org/10.1007/s10493-012-9592-3.
Soderlund, D.M., 2008. Pyrethroids, knockdown resistance and sodium channels.
Pest Management Science 64, 610616.
Author's personal copy
R. Kumar et al. / Acta Tropica 125 (2013) 237245 245
Tsagkarakou, A., VanLeeuwen, T., Khajehali, J., Ilias, A., Grispou, M., Williamson, M.S.,
Tirry, L., Vontas, J., 2009. Identicationof pyrethroidresistance associatedmuta-
tions in the para sodium channel of the two-spotted spider mite Tetranychus
urticae (Acari, Trtranychidae). Insect Molecular Biology 18, 583593.
Yanola, J., Somboon, P., Walton, C., Nachaiwieng, W., Prapanthadara, L., 2010. A
novel F1552/C1552 point mutation in the Aedes aegypti voltage-gated sodium
channel gene associatedwithpermethrinresistance. Pesticide Biochemistry and
Physiology 96, 127131.
Zhu, Y.C., Snodgrass, G.L., Chen, M.S., 2004. Enhanced esterase gene expres-
sion and activity in a malathion-resistant strain of the tarnished plant
bug, Lygus lineolaris. Insect Biochemistry and Molecular Biology 34,
11751186.