Vous êtes sur la page 1sur 148

Understanding Maternal Sensitivity: Early Adversity, Arginine

Vasopressin 1a Receptor Gene and Gene-Environment Interplay


by
Rossana Bisceglia
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy
Department of Human Development and Applied Psychology
University of Toronto
Copyright by Rossana Bisceglia 2011
ii
Understanding Maternal Sensitivity: Early Adversity, Arginine
Vasopressin 1a Receptor Gene and Gene-Environment Interplay
Rossana Bisceglia
Doctor of Philosophy
Department of Human Development and Applied Psychology
University of Toronto
2011
Abstract
The purpose of these studies was to examine mediation and moderation processes for the
influence of early adversity and current stressful circumstances on maternal sensitivity.
Evidence of mediation was found in Study 1 where maternal depression and mothers negative
appraisal of their infant mediated the influence of early adversity and low family income on
maternal sensitivity. Study 1 also examined the influence of the neighborhood. A moderate-
mediation model was tested where the mediating influence afore-stated was hypothesized to vary
across levels of neighborhood quality. Partial evidence of moderation was found. In the context
of a high quality neighborhood, mothers early adversity was not associated with maternal
depression. Across levels of neighborhood quality, complex relationships emerged between the
variables low family income, maternal depression and mothers appraisal of infant temperament.
In a context of low neighborhood quality, there was no evidence of a direct association between
low family income and maternal sensitivity, rather, low family income operated indirectly
through maternal depression. In a context of high neighborhood quality, there was evidence for a
direct and indirect association between low family income and maternal sensitivity. Study 2
examined associations between variation in the Arginine Vasopressin 1a receptor gene
iii
(AVPR1a) and maternal sensitivity, and whether variation in this gene moderated the influence of
mothers early adversity on sensitivity. Mothers homozygous for the long alleles of the RS3
microsatellite were significantly less sensitive than mothers heterozygous for the long alleles and
those homozygous for the short alleles. Homozygosity for the RS3 long alleles moderated the
influence of mothers early adversity on their sensitivity; the influence of early adversity on
maternal sensitivity was most pronounced for mothers with the RS3 long/long genotype. These
results suggest that variation in the AVPR1a gene may be important not only for human maternal
behavior, but also for stress reactivity.
iv
Acknowledgments
I am indebted to a number of people that helped me tremendously in the completion of this
project. I have been most fortunate to work with Dr. Jenny Jenkins. Jenny, during the last 6
years you have been so much more than an academic advisor. You were a supportive and
instructive mentor in times of academic difficulty, and a friend, confidant and counselor during
difficult personal times. I can honestly say that I could not have chosen a better advisor. You
influence will really be everlasting, pushing me to achieve my best and to persevere during
difficult times. Thank you for all your support, encouragement and all that you have taught me.
I was equally fortunate to have Dr. Greg Moran, Dr. Thomas OConnor and Dr. George
Tarabulsy as members of the thesis committee. Your feedback on earlier versions of this thesis
significantly improved the quality of this research. My only regret is that I did not work with
you more closely during the initial phases of my PhD. career. I know that I would have learned
tremendously from both of you. This project would also have not been possible without the
contribution of the families who participated in the Kids, Families and Places study. Thank you
for donating your invaluable time. To my lab members, Mira, Krista, Kristen, Aarti, Amelia,
Dillon, Jean-Christophe and Mark, thank you for you encouragement, support and the many
laughs that made the last 6 years fly by. I am also very indebted to Dr. Cathy Barr and her lab
members: Karen, Yu, Adrienne, Lisette, Linette, Ginger and Kathryn. Thank you for taking the
time to train me and teach me genetics! Words cant express how much I have learned from all
of you. I am most indebted to my family. My parents, Giuseppe and Anna, it is difficult to put
in words the gratitude that I feel for both of you. Your love for me is and has always been
unconditional and omnipresent; without it my achievements would not have been possible. You
have taught me lifes biggest lessons, including to persevere and work hard to achieve every
dream. To my brother, Raffaele, my sister-in-law Patricia, and my wonderful nieces Milena and
Tiana, thank you for your encouragement and all the wonderful times that we have shared. I
love being around you, the fun times together helped me to plug along with this project
especially during difficult times. My extended family and nieces and nephews Antonio, Simone,
Matteo, Marco, Francesca, Roberta and Marika, it has been great having you in my life. I enjoy
our Italian summers and getaways together. I look forward to many more wonderful moments.
To my friends, Tammy, Preena, Rubina, Daniela, Carolina, Connie and the PBS family; I feel
very fortunate to have such a great support system. To my husband and best friend Francesco,
words really cant express the gratitude I feel for you. Thank you for your unconditional support
and encouragement to complete this project and to achieve my career goals. You have sacrificed
being in Italy and with your family in order to be with me and to support me. I am well aware
that this choice has not always been an easy one for you. Your love for me sometimes amazes
me! Please know that having you by my side has made a tremendous difference in my happiness
and strength. Thank you. To my wonderful daughter Giada, I am so grateful for having you in
my life. Motherhood has really been the most amazing experience. Watching you grow has
given me countless moments of joy. My love for you is greater than the universe. You have
taught me so much in the last 10-months and I know that this is only the beginning of many more
life lessons. You have been the most important teacher on maternal behavior and so I dedicate
this thesis to you. Always know that mamma loves you.
v
Table of Contents
Abstract ........................................................................................................................................... ii
Acknowledgments .......................................................................................................................... iv
List of Tables ................................................................................................................................ viii
List of Figures ................................................................................................................................. x
List of Figures ................................................................................................................................. x
List of Appendices ......................................................................................................................... xi
General introduction ........................................................................................................................ 1
Study 1: Examining Associations Between Mothers' Early Adversity, Depression and Sensitivity
Across Levels of Neighborhood Quality ......................................................................................... 6
Introduction ................................................................................................................................. 6
Method ...................................................................................................................................... 18
Measures.................................................................................................................................... 20
Dependent variable. ............................................................................................................... 20
Control variables. .................................................................................................................. 20
Independent variables. ........................................................................................................... 21
Analysis ..................................................................................................................................... 25
Missing Data. ........................................................................................................................ 25
Measurement model for maternal sensitivity. ....................................................................... 26
Measurement model for maternal depression. ...................................................................... 27
Mediation analyses. ............................................................................................................... 28
Model identification. ............................................................................................................. 28
Adequacy of model fit. .......................................................................................................... 29
Moderated mediation analyses. ............................................................................................. 32
vi
Univariate and multivariate normality. ................................................................................. 32
Results ....................................................................................................................................... 33
Descriptive statistics and correlations. .................................................................................. 33
Exploratory factor analysis.................................................................................................... 37
Confirmatory factor analysis. ................................................................................................ 38
Measurement model of maternal depression. ........................................................................ 44
Mediation analysis................................................................................................................. 47
Moderated mediation............................................................................................................. 58
Discussion ................................................................................................................................. 64
The role of early adversity. ................................................................................................... 64
Moderated-mediation: the role of neighborhood quality. ..................................................... 68
Implications ........................................................................................................................... 72
Study 2: Maternal Sensitivity, Early Adversity and the Arginine Vasopressin 1a Receptor Gene
(AVPR1A) ...................................................................................................................................... 73
Introduction ............................................................................................................................... 73
Relationship between AVPR1A and maternal behavior. ...................................................... 75
AVPR1A and stress regulation. ............................................................................................ 78
Method ...................................................................................................................................... 80
Procedures. ............................................................................................................................ 81
Measures................................................................................................................................ 82
Analysis ..................................................................................................................................... 90
Missing Data. ........................................................................................................................ 90
Hierarchical regression analysis. ........................................................................................... 90
vii
Results ....................................................................................................................................... 91
Normality. ............................................................................................................................. 91
Marker: RS3 microsatellite. .................................................................................................. 91
Descriptive statistics. ......................................................................................................... 91
Hierarchical regression analyses. ...................................................................................... 95
Marker: rs1042615. .............................................................................................................. 99
Descriptive statistics. ......................................................................................................... 99
Hierarchical regression analyses. .................................................................................... 100
Marker: rs7298346. ............................................................................................................ 103
Descriptive statistics. ....................................................................................................... 103
Discussion ............................................................................................................................... 105
General discussion....................................................................................................................... 109
References ................................................................................................................................... 119
Appendix A ................................................................................................................................. 136
Appendix B ................................................................................................................................. 137

viii
List of Tables
Table 1. Means, standard deviation, range of values, skewness and kurtosis across variables. . 34
Table 2. Frequencies of cumulative early adversity score. ......................................................... 35
Table 3. Bivariate correlations. ................................................................................................... 36
Table 4. Results of exploratory factor analysis. .......................................................................... 37
Table 5. Principal Component Loadings of the Five .................................................................. 38
Table 6. Results of confirmatory factor analysis (N=351). ......................................................... 41
Table 7. Parameter estimates of final measurement model (Model 3) for maternal sensitivity. 42
Table 8. Descriptive statistics and psychometric properties of the depression parcels............... 45
Table 9. Goodness-of-fit indices for the depression measurement model. ................................. 46
Table 10. Parameter estimates of the final depression measurement model. ................................ 47
Table 11. Goodness-of-fit indices for the final mediation model. ................................................ 54
Table 12. Parameter estimates of the final mediation model. ....................................................... 55
Table 13. Confidence intervals for the standardized indirect and direct effects of income on
sensitivity and for the standardized indirect effect of early adversity on sensitivity. . 58
Table 14. Goodness-of-fit indices for the moderated mediation models. ..................................... 61
Table 15. Parameter estimates across levels of neighborhood quality. ......................................... 63
Table 16. Primer and probe sequences and annealing temperatures. ............................................ 85
Table 17. Breakdown of available and missing data. .................................................................... 90
Table 18. RS3 allele frequency. .................................................................................................... 93
Table 19. RS3 genotype frequency across ethnicity. .................................................................... 94
ix
Table 20. Correlations among study variables and summary of hierarchical regression analysis
examining the moderation of RS3 length reference category is short/long and
long/long genotypes. ................................................................................................... 97
Table 21. Correlations between time 1 and time 2 maternal behavior measures. ....................... 137
x
List of Figures
Figure 1. Theoretical model of maternal sensitivity. ................................................................... 40
Figure 2. Final measurement model of maternal sensitivity. ....................................................... 43
Figure 3. Theoretical model for maternal depression. ................................................................. 46
Figure 4. Hypothesized model for the mediating effect of mothers depression and appraisal of
infant negative temperament on the association between maternal sensitivity and mothers early
adversity and income. .................................................................................................................... 50
Figure 5. Final model for the mediating effect of mothers depression and appraisal of infant
negative temperament on the association between maternal sensitivity and mothers early
adversity and income. .................................................................................................................... 57
Figure 6. Neighborhood quality moderates the association between maternal sensitivity, early
adversity and income. .................................................................................................................... 62
Figure 7. Location of the RS3 microsatellite, rs7298346 and rs1042615 on the AVPR1A gene. 77
Figure 8. RS3 length moderates the association between early adversity and sensitivity. .......... 98

xi
List of Appendices


Appendix A ................................................................................................................................. 136
Appendix B ................................................................................................................................. 137
1
General introduction

Over the last several decades, parenting research has gathered a rich body of data on the
biopsychosocial influences of maternal behavior. Pryce (1995) integrated these various research
findings into a theoretical model in which it is proposed that optimal maternal behavior is
associated with the following factors: (a) the mothers genotype and (b) hormonal fluctuations,
(c) the mothers developmental history, and the experience of (d) low stress and good social
support during and post pregnancy. The present studies examine the relationship between
maternal behavior and three of the four factors identified in Pryces model of mothering:
mothers (a) genotype, and (b) developmental history of adversity (early adversity), and (c) the
experience of stress post pregnancy.
The maternal behavior of interest in the present studies is maternal sensitivity which
refers to mothers ability to accurately perceive infants signals and to respond to them promptly
and appropriately (Ainsworth, Blehar, Waters, & Wall, 1978). This construct is one of the few
measures of mother-child interaction in the infancy period that predicts child functioning over
time (Cassidy & Shaver, 1999) across domains of well-being including attachment security
(DeWolff, et al., 1997), stress regulation (Bowlby, 1970, 1989; Cassidy & Shaver, 1999) and
internalizing and externalizing problems in childhood (Brennan, Le Brocque, & Hammen, 2003;
Dallaire, et al., 2006).
An important determining factor for maternal sensitivity is mothers developmental
history; several lines of research provide evidence for this assertion. Maltreatment research
provides the most direct evidence showing associations between the experience of maltreatment
in ones childhood and abusive and insensitive parenting of ones own children (e.g. see Caliso
& Milner, 1992; Egeland, Jacobvitz, & Papatola, 1987; Hunter & Kilstrom, 1979; Bailey, Moran,
2
& Pederson, 2007; Gonzalez, Jenkins, Steiner, & Fleming, 2009; Jacobvitz, Leon, & Hazen,
2006).
Attachment research provides additional but somewhat less direct evidence. This
literature shows concordance of attachment status in mothers, fathers and their children (Fonagy,
Gyrgy, Jurist, & Target, 2002; Fonagy, et al., 1995; Slade, Grienenberger, Bernbach, Levy, &
Locker, 2005). The concordance in attachment status suggests that experiences in ones
childhood influence the development of the attachment system, including representations of self
and others, which in turn compromises the quality of the child-parent relationship (Fonagy, et al.,
2002; Slade, et al., 2005).
Empirical findings indicate a complex relationship between early adversity and
subsequent parenting. For example, the majority of parents with abusive backgrounds do not go
on to abuse their own children. The discontinuity rate of abuse is as high as 70% (Kaufman &
Zigler, 1987). Likewise, the intergenerational continuity of positive and negative parenting is
modest to moderate at best, with correlation estimates ranging from .21 to .23 for negative
parenting (Bailey, et al., 2009; Neppl, Conger, Scaramella, & Ontai, 2009) and correlation
estimates in the range of .17 to .43 for positive parenting (Bailey, et al., 2009; Kerr et al., 2009;
Kovan et al., 2009; Neppl, et al., 2009; Shaffer et al., 2009). It is noteworthy that several
methodological factors influence the degree of intergenerational continuity in parenting. Some of
these factors include the psychometric properties of the parenting measures used to assess
parenting across the generations, the use of observational measures which yield stronger
associations than rating scales, the length of the observational segment with short duration (e.g. 5
minutes) compromising the ecological validity of the assessment, and the cross-sectional design
(Van Ijzendoorn, 1992). Recent reports, afore summarized, have taken care to address most of
3
these methodological issues, by for instance using prospective longitudinal designs and
observational measures of parenting across the two generations (e.g. see Kovan et al., 2009).
Nonetheless the degree of intergenerational continuity remains in the modest range, as
aforementioned. Thee modest associations indicate that while there is evidence for
intergenerational continuity in parenting practices, there is also evidence for weak or a lack of
continuity (Conger, Besky, & Capaldi, 2009). This raises several questions with regards to the
influence of early experience in shaping subsequent parenting. Two central questions that arise
from these findings are: (1) what are the processes that account for the continuity of early
experience to future behavior (the question of mediation) and (2) what are the factors that
strengthen or weaken the association between early experience and subsequent behavior (the
question of moderation; Conger, Besky, & Capaldi, 2009).
Studies have adequately documented mediation processes with respect to continuity
between early experience and subsequent parenting behavior. These studies have shown that, in
general, aspects of individuals subsequent functioning mediate the association between
parenting experienced in ones childhood and subsequent parenting of ones child. Recent
findings on the intergenerational continuity of parenting illustrate this process. Shaffer, Burt,
Obradovc, Herbers, and Masten (2009) examined the intergenerational transmission of parenting
quality (includes assessments of hostility, warmth, quality of the parent-child relationship, and
ratings of consistent discipline) in a normative sample of 10-year old children and their parents.
Children were reassessed 20-years later once they became parents themselves. The authors
found that the association between parenting quality of the 1
st
generation (G1) and 2
nd
generation
(G2) was mediated by the social competence demonstrated by G2 parents in young adulthood
(approximately30 years of age). Likewise, Neppl et al., (2009) first assessed G1 parenting
4
during G2s adolescence and subsequently assessed the adolescent G1 children during early
adulthood (approximately 30 years of age) for adult delinquent behavior (includes substance use,
crime against property and people, and careless driving). The authors found that G2 adult
delinquent behavior mediated the association between G1 harsh parenting and the harsh
parenting G2 provided to their own children (G3). G2 adult delinquent behavior was a significant
mediator after accounting for G2 adolescent externalizing behavior.
It is noteworthy that although the afore-stated studies examined different aspects of
parental functioning ( e.g. social competence, adult delinquency and educational attainment) the
mediating influence of adult parental functioning remained consistent (Conger et al., 2009). This
implies that parental functioning, however defined, is an important mediator for the influence of
early experience on subsequent parenting.
With respect to maternal sensitivity, despite the demonstrated importance of this
construct for child development, and the shown associations between early adversity and
maternal sensitivity, research has not identified the processes that mediate the association
between early adversity and subsequent maternal sensitivity. Furthermore, despite the accrued
knowledge regarding mediation processes involved in intergenerational continuity of parenting
practices, less is known about the factors that moderate the association between early experience
and subsequent parenting (Conger, Besky, & Capaldi, 2009), including maternal sensitivity.
The focus of study 1 is to examine a mediation model for the relationship between
mothers early adversity and mothers functioning post pregnancy. The study focused on two
aspects of maternal functioning that are consequential to maternal behavior: maternal depression
and low family income. Maternal depression (Brown & Harris, 1993; Murray & Cooper, 1997;
Nichd, 1999; Rutter & Maughan, 1997) and economic stress by way of low family income
5
(Kessler & Cleary, 1980; McLeod & Kessler, 1990; McLoyd, 1990) are two factors that show
relations with both early adversity and compromised parenting. For reasons detailed in the
following pages, it is proposed that maternal depression mediates the influence of early adversity
and low family income on maternal sensitivity.
Moderation processes are examined in study 1 and study 2. Ecological systems theory
proposes that characteristics of the wider ecology differentially increase individuals
vulnerability to the processes that shape individual development such as parenting
(Brofenbrenner, 1979). Moderated mediation models allow for the examination of these kinds of
processes; in these models the influence of a variable on an outcome is contingent on levels of a
moderator variable (Baron & Kenny, 1986). A second aim of study 1 is to examine whether, for
reasons detailed in the following pages, the proposed mediating influence of maternal depression
is contingent on the quality of the neighborhood in which families reside.
The mothers genotype is an additional factor proposed to moderate mothers response to
early adversity (Serbin & Karp, 2004). The Arginine Vasopressin 1a Receptor gene (AVPR1A)
is a gene that has been linked with animal maternal behavior (e.g. see Hammock, Lim, Nair, &
Young, 2005), organization of social behavior (Kim, et al., 2002) and proposed as a determining
factor for stress reactivity (Ebstein, et al., 2009). The focus of study 2 is to examine whether
maternal sensitivity relates to variation in the AVPR1A gene and whether variation in this gene
moderates mothers response to early adversity.

6
Study 1: Examining Associations Between Mothers' Early Adversity,
Depression and Sensitivity Across Levels of Neighborhood Quality
Introduction

Life course theories suggest that the effects of early adversity on future functioning are
mediated by subsequent positive and negative experiences (OConnor, 2006). Two factors
linked with both mothers early adversity and parenting quality are parental low income (Kessler
& Cleary, 1980; McLeod & Kessler, 1990; McLoyd, 1990) and the experience of depression
(Brown & Harris, 1993; Murray & Cooper, 1997; Nichd, 1999; Rutter & Maughan, 1997).
Depression is characterized as a heterogeneous disorder with individuals varying markedly in
their symptom presentation (Kendler et al., 1999). Thought distortions are one component of
depression that have been hypothesized to account for depressed mothers reduced responsivity to
their child (Mayberry & Affonso, 1993; Stein et al., 2010; Teti & Gelfand, 1997). The proposed
conceptual model (see Figure 4) examines the mediating influence of maternal depression and
mothers appraisals of their infant.
Early adversity and maternal depression.
The experience of early adversity increases the risk of adult mental health problems,
particularly maternal depression (Brown & Harris, 1993; Rutter & Maughan, 1997). Several
reports have shown that maternal depression is an important mediator for the effects of early
adversity on parenting. Bifulco et al. (2000) found that maternal chronic depression accounted
for the continuity of abusive and neglectful parenting of mothers own children. Likewise,
Roberts et al., (2004) showed that maternal history of abuse was associated with subsequent
problems in mothers mental health, parenting behavior and family instability.
7
Although previous reports have documented the mediating influence of maternal
depression on the association between early adversity and abusive, neglectful parenting (Bifulco
et al., 2000) and quality of the parent-child relationship (Roberts et al., 2004) studies have not
examined whether maternal depression mediates the association between early adversity and
maternal sensitivity. It is valuable to examine this process with respect to maternal sensitivity
since previous reports have shown that factors that relate to one dimension of parenting can
operate differentially with other dimensions of parenting. For instance, Kendler, Sham and
MacLean (1997) examined the determinants of parental warmth, protectiveness and
authoritarianism as measured by the Parental Bonding Instrument (PBI; Parker et al., 1979) and
found different predictors for the three parenting behaviors. For example, parental warmth was
best predicted by child temperament, marital quality, parental personality and psychopathology.
Parental education and religious ideology best predicted authoritarianism and protectiveness.
Likewise, in an examination of maternal scaffolding behavior, Hoffman (2006) reported
evidence that differences in the affective presentation of depression in mothers related
differentially to separate components of scaffolding behavior. Two types of scaffolding behavior
were examined; emotional scaffolding (mothers ability to make a task a positive experience for
the child so the child can derive a high levels of self-efficacy), and technical scaffolding
(mothers ability to structure a task so that it is within the childs ability). As well, two
presentations of depression were examined: an intrusive/hostile presentation (defined as
irritability, insomnia and psychomotor agitation) and a withdrawn/disengaged symptomatology
(characterized by affective dulling, psychomotor retardation and excessive sleep). Mothers who
showed predominantly an intrusive/hostile presentation of depression were most ineffective at
providing emotional scaffolding, while mothers whose presentation was predominantly a
8
withdrawn/detached one were mainly ineffective at providing technical scaffolding. Hence,
variation in the manifestation of mothers depression related differentially to different
components of scaffolding behavior. Hence, different dimensions of parenting behavior show
separate determinants.
Last, recent intergenerational research also indicates that the mediating mechanisms that
account for the intergenerational continuity in parenting practices are likely different depending
on the type of parenting behavior under study (Conger, Belsky, & Capaldi, 2009). For instance,
in the study aforementioned by Neppl et al., (2009) the authors showed that the mediating
mechanisms for intergenerational continuity differed for negative and positive parenting.
Specifically, G2 parental academic achievement mediated the association between G1 and G2
positive parenting, while G2 adult delinquent behavior mediated the association between G1 and
G2 negative parenting.
Given the afore-stated associations between early adversity and adult depression, and
since mothers depression can influence the way mothers view their children (as discussed
below), it was reasoned that the influence of early adversity on maternal sensitivity would be
mediated by maternal depression (see Fig. 4).
Maternal depression, mothers appraisal of infant temperament and maternal sensitivity.
There is evidence that mothers representations of their infant and/or the mother-infant
relationship influence parenting behavior including sensitivity. For example, maternal sensitivity
is associated with mothers representations of early attachment representations (Crowell &
Feldman, 1988; Haft & Slade, 1989; Pederson, Gleason, Moran & Bento, 1998; Slade et al.,
1999). Mothers representations are also related to maternal behavior during the Still Face
procedure (Rosenblum, McDonough, Muzik, Miller & Sameroff, 2002). During this procedure
9
mothers and their infant engage in three 2-min interaction segments in the following order: (1)
mothers and infants engage in free play while the child is in seated in a high chair (Highchair
segment), (2) Still Face segment during which the mother holds a still face while maintaining eye
contact with the infant but showing no responsivity, and (3) the Reengagement episode during
which the mother reestablishes usual responsive behavior and availability to her infant. The goal
of the mothers behavior during Reengagement is to facilitate for the infant the process of repair
from the earlier stressful segment in order to reestablish synchrony in the mother-infant dyad.
(Tronick, Als, Adamson, Wise, and Brazelton, 1978).
Rosenblum, McDonough, Mizik, Miller et al., (2002) found associations between
maternal representations of their child and mothers behavior during the Reengagement segment.
The authors examined three categories of maternal representations as measured by the Working
Model of the Child Interview (WMCI; Zeanah & Benoit, 1995). Mothers with balanced
representations of their infant (which included mothers warm, accepting and detailed accounts
of their infants and their infants needs) showed more positive affect in the Reengagement
segment than mothers with disengaged representations (characterized by mothers aloof, hostile,
rejecting and/or idealized but unsubstantiated accounts of their infant and of the mother-infant
relationship). Mothers with distorted representations (characterized by incoherent, bizarre, and
contradictory accounts of their infant and a mother-child relationship) showed more rejecting
behavior in the Reengagement segment than mothers with balanced or disengaged
representations. It is noteworthy that these associations were evident after having accounted for
the infants distress behavior during the Still Face procedure, therefore the observed association
between maternal representations and maternal behavior during the Reengagement segment are
not due to differences in the infants distress behavior.
10
In addition to mothers representations of their infant, most studies using the Still Face
procedure also document significant associations between maternal depression and mothers
behavior (Field et al., 2007; Garrity-Rokous, 1999; Rosenblum et al., 2002; Stanley et al., 2004;
Weinberg et al., 2006). For example, Rosenblum et al., (2002) found that depressed mothers
were significantly less involved with their infant during the Reengagement segment than non-
depressed mothers. The authors also reported associations between maternal depression and
mothers mental representations of their infant. Mothers with distorted representations reported
higher levels of depression than mothers with balanced representations. These findings are
consistent with other research showing that thought distortions are an important component of
maternal depression (Mayberry & Affonso, 1993; Teti & Gelfand, 1997). These thought
distortions have been suggested to account for depressed mothers negative appraisals of
childrens behavior and temperament (Mayberry & Affonso, 1993; Teti & Gelfand, 1997).
Mothers with depression have been noted to make more critical and negative remarks of their
children (Gordon et al., 1989; Nelson, et al., 2003) and to experience their infants as more
temperamentally difficult (Edhborg, et al., 2000) in relation to mothers with no depression. Two
lines of thought have been proposed for these associations with empirical support available for
both.
One explanation attributes mothers negative appraisals of the child to the thought
distortions associated with the depression (Mayberry & Affonso, 1993; Teti & Gelfand, 1997).
Field, Morrow and Adelstein (1993) provide evidence for this latter view showing that depressed
mothers rate their infants behavior more negatively than observers. Recently, Stein and
colleagues (2010) found that mothers with postnatal depression showed a systematic bias in
interpreting infant facial expressions as more negative. The authors concluded that this
11
systematic bias might explain some of the challenges that depressed mothers face in responding
to their infants signals.
The second explanation is that children of depressed mothers are indeed more
temperamentally difficult than children of non-depressed mothers (Fox & Gelfand, 1994;
Whiffen & Gotlib, 1989; Field, Sandberg, Garcia, Vega-Lahr, Goldstein & Guy, 1985). Cutrona
and Troutman (1986) provide the strongest evidence for this view point, showing associations
between maternal depression and infant temperament on both observers and maternal reports of
infant temperament.
Distinguishing between these two perspectives is beyond the scope of the present study,
rather the afore-stated findings inform the studys conceptual model (see Fig. 4). Given the
aforementioned associations between maternal behavior and mothers representations of their
infant, and the association between maternal depression and mothers representations of their
infant, it was hypothesized that the influence of depression on sensitivity would be mediated by
mothers appraisals of their infants temperament.
An alternate pathway was also included in the model to test whether depression is
directly associated with maternal sensitivity rather than operating through mothers appraisal of
infant temperament.
Early adversity and mothers appraisal of infant temperament.
Recent studies indicate that early adversity, such as abuse, increases the risk of
developing a negative inferential style (Gibb et al., 2001; Gibb, Alloy, Abramson, & Marx, 2003;
Kankin et al., 2001). Also, Malone, Levendosky, Dayton and Bogat (2010) reported associations
between mothers experience of childhood physical abuse and mothers prenatal distorted
representations (characterized by incoherent, bizarre, and contradictory accounts of their infant
12
and a mother-child relationship and unrealistic expectations of the child) as measured by the
WMCI. Therefore, the model includes an alternate pathway depicting the direct association
between early adversity and mothers negative appraisal of their infant.
Income and maternal sensitivity.
Parents differ in their values regarding parenting practices, and there is evidence that
some of these differences are related to parental socio-economic status. For example, low income
mothers hold more authoritarian beliefs regarding parenting than higher income mothers
(Martini, Root & Jenkins, 2004; Dodge, Petit, & Bates, 1994) these beliefs have in turn been
associated with reduced responsivity (Maccoby & Martin, 1983). Consistent with these findings,
in addition to the indirect influence of income on sensitivity, a direct pathway was also included
in the model to test the possible direct association between income and maternal sensitivity.
Income and maternal depression.
Low parental income is a widely recognized risk for both maternal functioning and
parenting (Hoff, Laursen, & Tardif, 2002; Hoffman, 2003; McLoyd, 1990; Tonge, James, &
Hillam, 1975). Low income parents are more likely than their middle income counterparts to use
authoritarian and punitive parenting styles and less likely to be responsive to their childrens
needs (McLoyd, 1990). Low income results in economic pressures in the family which increase
the risk of parental emotional distress (e.g. depression, anxiety etc.) which in turn compromises
the quality of parenting (Conger & Conger 2002, Conger & Elder 1994, Conger et al. 2002). For
these reasons, low family income is used in this study as a proxy for maternal stress. Hence, the
conceptual model includes a direct association between income and maternal depression.
Furthermore, since low income parents show an increased prevalence of negative life events
13
(Kessler & Cleary, 1980; McLeod & Kessler, 1990) the model includes a covariance between
early adversity and low income (see Fig. 4).
Moderated mediation: the role of the neighborhood.
Individual differences and contextual factors have been shown to modify or even change
the processes that explain how a risk factor relates to individuals well-being (e.g. see Muller,
Judd, & Yzerbyt, 2005; Edwards & Lambert, 2007). These models are referred to as moderated
mediation models (Baron & Kenny, 1986; Dearing, & Hamilton, 2006) in which the mediating
effect of a variable varies across levels of a moderator variable (Baron & Kenny, 1986).
Consistent with these models, Belsky (1984) posits that parenting is a buffered system. He
suggests that aspects of the individuals context may offer supports that will act in a
compensatory way to repair the negative effects of the early experience. Likewise,
Bronfenbrenners ecological systems theory (Brofenbrenner, 1979) proposes that individuals are
embedded within multiple layers of influence at varying levels of proximity to the person.
Characteristics of the wider ecology result in individuals being differentially vulnerable to the
processes that shape individual development.
A contextual variable that has been linked to parenting and family functioning is the
quality of the neighborhood in which families reside. Follow-up data from the Moving
Opportunities Program (MTO) provide the strongest evidence for the causal effects of
neighborhood quality on parenting and family functioning. This program was an experimental
intervention where families were offered the opportunity to relocate to better quality
neighborhoods and were randomly assigned to three groups with different services and supports.
Participants in the experimental group were provided with a housing voucher to assist them in
relocating to a better quality neighborhood, along with special mobility counseling and the
14
requirement to relocate to a low-poverty neighborhood. Participants in the Section 8 group also
received the voucher but they could move to any neighborhood of their choice and were also
provided only regular housing assistance. The baseline group did not receive a voucher but
could continue to reside in assisted or public housing. The three year follow-up data show that
mothers who had relocated out of public housing reported less depression, less harsh parenting
and provided their children more structure (Leventhal & Brooks-Gunn, 2001). These findings are
consistent with other evaluations of the program which report that the experimental group
shower greater gains from residing in a low-poverty neighborhood than a high-poverty
neighborhood relative to the Section 8 movers and the baseline group across a range of outcomes
including education, health, employment, housing, and changes in criminal/behavioral problems
(Briggs, 2005; Johnson et al. 2002; Goering, 2005; Orr et al. 2003). It is noteworthy however
that the magnitude of the gains were marginal for several domains of well-being (Clark, 2008)
like employment and school achievement (Kingsley & Pettit, 2008) but the gains were positive
and noteworthy in other areas (e.g., safety, mental and physical health, and the neighborhood
environment; Kingsley & Pettit, 2008). However reports also indicate that over the long-term
many of experimental families re-located to neighborhoods that were very similar to their
original high-poverty neighborhood (Clark, 2005). For some families these moves reversed the
positive effects of the intervention (Kingsley & Pettit, 2008). Reports have not extensively
examined why experimental families chose to return to lower quality neighborhoods but intricate
processes are likely at play (Kingsley & Pettit, 2008) including re-accessing their social networks
and families that remained in their previous neighborhood (Popkin, 2008). Although it may be
concluded that the program was successful for individual families (Clark, 2008) with moderation
processes explaining why some families benefited over the long-term while others did not (e.g.
15
child gender; Leventhal & Brooks-Gunn, 2005), the efficacy of the program as a whole remains
questionable (Clark, 2008). It has been proposed that augmenting the voucher program with
counseling and other follow-up supports may result in sustained benefits over time (Clark, 2008;
Kingsley & Pettit, 2008). Further, the identification of selection factors that influence families
relocation patterns is also vital to the evaluation and modification of the program (Clark, 2008).
Other research has shown the importance of the neighborhood for individuals well-being.
For example, the quality of the neighborhood has been shown to moderate the effects of
individuals characteristics, with good quality neighborhood augmenting individuals positive
characteristics and poor quality neighborhood exacerbating negative characteristics (Cutrona, et
al., 2000). The final objective of the present study was to examine whether the hypothesized
mediating influence of maternal depression and negative appraisal of infant temperament were
contingent on aspects of the ecology. It was hypothesized that in a low quality neighborhood the
influence of early adversity and low income on maternal sensitivity would be exacerbated, while
a high quality neighborhood would buffer mothers from the influence of early adversity and low
income.
The conceptual model.
Figure 4 displays the conceptual model. The construct mothers early adversity is
operationalized as a cumulative risk score of various unfavorable conditions mothers
experienced during childhood. Studies that to-date have examined the impact of early adversity
on maternal sensitivity have defined adversity in a way that may be overly narrow for several
reasons. First, most studies have focused on mothers experience of abuse and trauma; less is
known about the influence of non-abusive aspects of mothers early experience. Findings from
life course research indicate clear links between more normative negative experiences (i.e. being
16
raised in low socio-economic context) and adult functioning across domains of well-being (e.g.
see Dong et al., 1994). Second, single risk factors do not represent individuals experiences
adequately as risks cluster together. Dong et al. (2004) demonstrated a high level of
interrelatedness among adverse childhood experiences (i.e. abuse, poverty, and parental mental
health and alcohol problems). Exposure to one risk such as parental alcohol abuse is associated
with an increased likelihood of exposure to other adverse events. Based on these findings it has
been suggested that studies interested in the effects of early adversity on subsequent functioning
include measures of multiple adverse events as opposed to focusing on single experiences (Dong
et al., 2004). This recommendation is consistent with studies examining the impact of
cumulative risks on mental health. The number of risks, rather than the nature of a specific risk,
is negatively associated with well-being including parenting (Dong, et al., 2004; Masten, 2006;
Rutter, 1979; Sameroff, 2000).
The risk factors composing the cumulative early adversity score include experiences that
have been shown to be associated with reduced adult well-being including having been raised by
a mother with low education and/or who was a teen at the time of the first child, having
experienced multiple parental transitions, having experienced physical and sexual abuse, having
witnessed physical and/or verbal abuse, having been raised by parents who had problems with
substance abuse (i.e. drugs and alcohol) and mental health (Dong, et al., 2004).
The moderating role of neighborhood quality was examined by testing the conceptual
model across two levels of neighborhood quality. Since the associations between neighborhood
quality and parental functioning are generally stronger for measures of neighborhood social
disorder (i.e. chaos, crime rates) than measures of neighborhood cohesion (i.e. sense of a
common interest in the neighborhood; Cutrona et al., 2000; Hill et al., 2002; OBrien,
17
Hassinger, & Dershem, 1994; Ross, 2000) the quality of neighborhood was measured using
objective assessments of disorder and Census tract data on the percentage of families living in
poverty.
Last, several variables were entered as covariates. Mothers place of birth was treated as a
covariate given the evidence of cultural differences in mothers interaction with their children.
For instance, European American mothers tend to follow their childrens lead and interests
during play interactions; this is consistent with Western goals of fostering their childrens
autonomy (Harkness, Super, & Keefer, 1992). In contrast, Japanese and Latino mothers have
been observed to direct the interactions; this is consistent with child-rearing goals of fostering
interindependence in the mother-child dyad (DeVos, 1993) and to foster obedience in the child
(Bornstein, Tamis-LeMonda, & Haynes, 1999). To account for the possible effect of cultural
differences on maternal sensitivity, mothers were classified into two groups of place of birth,
depending on whether they were born in Canada or elsewhere. A second covariate included is
mothers education given its association with maternal sensitivity (Albright & Tamis-LeMonda,
2002; Hammen, 2002). The number of children in the family was also treated as a covariate
given the evidence that this factor is associated with differential parenting (Jenkins, Rasbash, &
O'Connor, 2003), hence hindering the quality of parenting directed to each child in the family.
Last, since lower maternal sensitivity has been associated with prenatal difficulties and child
health (Hofheimer, Lewis, & Porges, 1996; van Bakel & Riksen-Walreven, 2002) prenatal
problems and low child weight were entered as covariates.
Hypotheses.
1. The effects of early adversity and income on sensitivity will be mediated by maternal
depression and negative appraisal of infant temperament.
18

2. The influence of early adversity and income will be moderated by the quality of the
neighborhood in which families reside. A low quality neighborhood will exacerbate
the influence of early adversity and low income on maternal sensitivity, while a high
quality neighborhood will buffer mothers from the influence of low income and early
adversity.
Alternate pathways: the following pathways were included in the model to account for alternate
and possible relationships among the variables:
1. Direct association between depression and maternal sensitivity.
2. Direct association between income and maternal sensitivity.
3. Direct association between early adversity and mothers negative appraisal of infant
temperament.
Method
Sample.
The sample consisted of 501 families drawn from the intensive sample of the Kids,
Families and Places Study which is an ongoing prospective study of newborns, older siblings and
their families in Toronto and Hamilton area. A total of 668 families with a newborn and an older
sibling were enlisted through the Public Health Units. Families were enlisted in the study if the
newborn weighed 1500 gm or more, the mother spoke enough English to engage in a
conversation, and the family had at least one other child under 16-years of age. A sub-sample of
501 families was enlisted if they had a newborn and at least one child under the age of 4-years
old (sibling). Families from the sub-sample are being visited for 4 years. The 501 families were
19
asked to provide additional data, such as DNA, in order to allow for the investigation of broader
questions. Data for the present study was drawn from the completed time 1 data collection.
All of the participants were English speaking. Mothers age ranged from 18 to 48 years
(M = 35.7, SD = 4.9) and infants age ranged from 2 to 8 months (M = 2 months, SD = 1 month).
The sample was representative of the Toronto area with respect to race. Mothers were primarily
Caucasian (57%), while 15% were South Asian, 12% were Southeast Asian, and 9% of mothers
endorsed Black as their race. Likewise, 2006 Census data indicate that 13.5% of the Toronto
population was South Asian, 14% were South East Asian, 7% were Black while 57% were
Caucasian (Statistics Canada, 2007). The sample was higher in education and income than the
Toronto population. For example, the sample median family income was approximately $65
000.00 to $75 000.00 while in 2006 the Toronto median income was $45 350.00 (Statistics
Canada, 2007).
Procedures.
Trained interviewers visited each familys residence for approximately two hours.
During the visit, mothers completed various standardized questionnaires, including
questionnaires that assessed their childhood experience and psychosocial functioning of their
parents. Mothers were videotaped interacting with their infant for 15 minutes. The interaction
consisted of three, 5-minute segments, first, interacting without toys, next using a toy and last,
while completing a questionnaire.
20
Measures
Dependent variable.
Maternal Sensitivity. Maternal sensitivity was assessed using the Maternal Behavior Q-
Sort-25-item short version (MBQS; Pederson & Moran, 1995) and four Ainsworth scales
(Ainsworth, 1969). Six-trained coders viewed the video tapes and rated mothers on the four
Ainsworth scales. The MBQS-25-item is a validated tool that assesses the quality of a mothers
naturalistic interaction with her child (Tarabulsy et al., 2009). It is a reliable measure (r = .94)
that relates to measures of sensitivity using the full MBQS at 6-months of age (r = .35) and
relates to childrens cognitive development at 10 and 15 months (r =.48), and attachment security
at 15-months of age (r = .34). Coders carried out the MBQS 25-item sort by placing the items
into five piles: from most characteristic of the mother to least characteristic of the mother. The
final sensitivity score is a correlation score that represents the extent to which the individual
mother is similar to the prototypical sensitive mother. The scores range from -1 indicating low
sensitivity to a value of 1 indicating high sensitivity. Inter-rater reliability was assessed by
double coding 15% of the video tapes, with every coder double coding with at least 2 other
coders. On the MBQS inter-rater reliability ranged between = .63 to = .96 with an average
reliability of = .82. On the Ainsworth scales, the average inter-rater reliability for each scale
ranged from =.84 to =.87.
Control variables.
Canadian born status (mothers place of birth). Mothers reported on their country of
birth. A dichotomous variable was constructed by assigning mothers born in Canada a value of 0
and those born elsewhere a value of 1.
21
Maternal Education. Mothers were asked a series of questions about their educational
attainment. These questions were recoded into one scale representing years of education
completed, with higher scores indicating greater years of education.
Number of children in the home. Mothers reported on the number of children living in
the home that were 18-years of age or less. A dichotomous variable was constructed by assigning
mothers with three or more children a value of 1 and mothers with less than three children a
value of 0.
Prenatal difficulties and child weight. Mothers reported on the infant weight at birth, in
kilos and grams. Mothers also reported on the presence of prenatal difficulties (i.e. pregnancy
diabetes, high blood pressure, thyroid problems, concerns over loss of fetal movements, injury to
abdomen and other physical concerns during pregnancy; Statistics Canada,1994-95). Response
options ranged from 0 (No) to 1 (Yes). Responses across the six questions were averaged;
higher values indicate greater number of prenatal difficulties.
Independent variables.
Family income. Mothers provided a best estimate of their family income by answering
the following question from the Ontario Child Health Study (Boyle, Offord, Racine, Sanford, et
al., 1993): What is your best estimate of your total household income from all source(s)s in the
last tax year, that is, the total income of all household members, before taxes and deductions?
Response options ranged from 1 to 16 with intermediate values indicating an increase in income
by $5000, for example, a value of 1 equals No income, a value of 2 indicates an income Less
than $5000, 3 indicates an income between $5000 to $9,999 and so forth with a maximum
value of 16 indicating an income of $105,000 or more. Higher values indicate greater income.
22
Cumulative Early Adversity. A cumulative indicator was created by summing mothers
scores on the following 5 risk variables. The maximum score of cumulative early adversity was
10.
1. Mothers mother had less than grade 8 education. Mothers reported on the level of
educational attainment of their own mother by responding to a series of questions. These
questions were recoded into one scale representing years of education completed.
Mothers were assigned a value of 1 if their mothers education score was less than 8
years, and a value of 0 if the education score was equal to or greater than 8 years.
2. Mothers mother was a teenager at time of first child. Mothers reported on the age of
their mother when the first child was born. Mothers were assigned a value of 1 if their
mother was under the age of 20, and a value of 0 if their mother was older than 20-years
of age.
3. Having been raised by one or both parents who suffered from mental illness, drug and/or
alcohol abuse (source: Ontario Child Health Study; Boyle, Offord, Racine, Sanford, et al.,
1993). Mothers reported on the presence of mental health disturbance and drug and/or
alcohol abuse in their mother and father. Mental health disturbance and drug/alcohol
abuse were scored separately. This resulted in six dichotomous codes representing
disturbance of mental illness in mother, father or both parents (3 dichotomous codes) an
disturbance of drug/alcohol in mother, father or both parents (3 dichotomous codes).
Mothers were assigned a value of 0 if neither parent suffered from mental illness or drug
and/or alcohol abuse, a value of 1 if either mother or father had mental illness or drug
and/or alcohol problems, and a value of 2 if both parents had mental illness or drug
and/or alcohol abuse. The possible scores ranged from 0 to 4 with 4 representing that
23
both parents had a mental illness (value of 2 on mental illess dichotomous code) and
drug/alcohol problem (value of 2 on the drug/alcohol problem dichotomous code).
4. Having experienced physical and/or sexual abuse. Mothers reported on whether they
were ever sexually and/or physically abused during childhood, and the frequency of the
abuse. Questions were drawn from Walsh, MacMillan, Trocme, Jamieson, & Boyle,
(2008) (e.g. How many times before age 16 did an adult caregiver (1) slap you on the
face, head or ears or hit you with a hard object, such as a belt, stick, or wooden spoon?
(2) Push, grab, shove or throw something at you to hurt you? (3) Kick, bite, punch,
choke, burn you, or physically attack you in some way? For sexual abuse: Before age 16,
were you ever sexually assaulted or raped? How many times did this happen?) Mothers
were given a value of 1 if they ever experienced physical abuse and/or sexual abuse and a
value of 0 for no experience of physical and/or sexual abuse. The possible score ranged
from 0 to 2.
5. Having witnessed verbal and/or physical abuse. Mothers reported on whether they ever
witnessed verbal and/or physical abuse by answering the following two questions drawn
from the Ontario Child Health Study (Boyle, Offord, Racine, Sanford, et al., 1993): (1)
Before age 16, how many times did you see or hear any one of your parents/caregivers
who raised you say hurtful or mean things to each other or to another adult in her home?
(2) How many times did you see or hear any one of your parents/caregivers hit each
other or another adult in your home? Mothers were assigned a value of 0 if they reported
never witnessing verbal and/or physical abuse, and a value of 1 if mothers witnessed
verbal and/or physical abuse. Possible scores range from 0 to 2.

24
Mediators.
Maternal depression. Mothers completed the Center for Epidemiological Studies
Depression Scale (Radloff, 1977). Mothers answered 20 questions (e.g. item 3: I felt that I could
not shake off the blues even with help from my family or friends) with response options that
range from 0 indicating no depression to 3 indicating high levels of depression. The scores
were summed to create a final depression score with a range from 0 to 60. Higher scores indicate
greater depression. The internal consistency of the scale was = .84.
Appraisal of infant temperament. Mothers reported on infant temperament by answering
five questions (i.e. difficulty to soothe, how changeable is mood, overall amount of attention
needed, how easily upset, and average number of times per day the infant is fussy/irritable). The
items were drawn from the Fussy Difficult subscale of the Infant Characteristics Questionnaire
(Bates, Freeland, & Lounsbury, 1979). Response options on all items ranged from 1 to 7 with
higher values indicating difficult temperament (e.g. more difficult to soothe, needs a lot of
attention etc.) Scores on the five items were averaged. The internal consistency of the scale was
= .67.
Moderators.
Neighborhood quality. Assessment of the neighborhood quality consisted of two
measures. Coders assessed the neighborhood in which families resided by answering seven
questions drawn from the Neighborhood Cluster Observation Schedule (McGuire, 1997). Items
on this questionnaire measure the general condition and cleanliness of the neighborhood, volume
of traffic, evidence of loitering and observers safety perceptions. Inter-rater reliability ranged
from .92 to 1.0. The second measure consisted of mean standardized score derived from CT
assessments of neighborhood poverty. This measure was obtained from Census of Canada Data
25
(2006). Family postal codes were used to identify the Census of Canada (2006) Census Tract
(CT) in which each family lived. Using a comprehensive list of CTs for the sample it was then
possible to extract Census of Canada Data using the Beyond 20/20 web data software
(www.beyond2020.com). A factor score was computed by entering these two measures of
neighborhood into a factor analysis; the two measures loaded on a single factor explaining 79.8%
of the variance in neighborhood quality, with an eigenvalue of 1.6.
Analysis
Missing Data.
Missing data from the Kids, Families and Places wave 1 data were imputed using
Multiple Imputation (Rubin, 1996). As described by Rubin (1996), the first step of multiple
imputation involves identifying all of the missing observations within a data set and then
generating a set of plausible values that can be used to replace the missing observations. This
step is then repeated multiple times to generate several complete data sets resulting in a more
accurate approximation of the parameter estimates and standard errors by accounting for
uncertainty regarding the accuracy of a single imputation (for a more detailed description of
these procedures see Allison, 2002; Horton & Kleinman, 2007; Horton & Lipsitz, 2001). This
resulted in five datasets with the imputed values. All analyses were conducted across the five
datasets and results were averaged. Structural Equation Modeling (SEM) regression coefficients
and estimates of indirect and direct effects were averaged across the five datasets using Rubins
(1987) formula.
As shown in Appendix A, the percentage of missing data ranged from 0.2% to 24%; for
all variables there were no differences in the mean and standard deviations between the imputed
and original data. For 24% (N = 120) of mothers observed maternal sensitivity was missing
26
therefore for these families maternal behavior was imputed as described above. Relative to
families for whom maternal behavior was observed, those that were missing observed maternal
sensitivity did not differ on family income (F
(1, 470)
= .57, p > .05), mothers education (F
(1, 498)
=
1.16, p > .05), mothers depression (F
(1, 491)
= .77, p > .05), mothers age (F
(1, 497)
= .02, p > .05)
or experience of early adversity (F
(1, 499)
= .12, p > .05).
Measurement model for maternal sensitivity.
Factor Analyses.
A series of factor analyses were conducted to examine the best measurement model for maternal
sensitivity. Given the large sample size, it was possible to conduct both exploratory and
confirmatory factor analyses. The dataset was split into two data files via random selection of
cases. One portion of these data (N=200) was used for the exploratory factor analysis; the goal
of this analyses was to examine whether the MBQS and the four Ainsworth scales assess one or
multiple dimensions of maternal behavior. Exploratory factor analysis with principal component
extraction method with varimax rotation was conducted using SPSS v. 15.
The other portion of the data (N=301) was used for the confirmatory factor analysis. The
goal of this analysis was to assess the fit of the measurement model identified by the exploratory
factor analysis. A larger sample size was allocated for the confirmatory factor analyses given the
more complex model fitting. Confirmatory factor analysis was conducted using AMOS v. 17
with maximum likelihood estimation. Model identification and model fit were assessed using
criteria described in the subsequent section titled Model Identification and Adequacy of
Model Fit.
27

Measurement model for maternal depression.
Since maternal depression was assessed using only one scale, the CES-D (Radloff, 1977),
the following options were available to form a latent variable for depression. The first option
includes entering the 20 items as indicators of the latent variable. This method however is
problematic since single items are less reliable than composite scores (Kishton & Widaman,
1994) and entering 20 items in the SEM model would substantially increase the number of
parameters the model must estimate thereby possibly resulting in convergence problems
(Coffman & MacCallum, 2005).
The second option involves entering the sum of the 20 items as a single indicator of the
latent variable. Identification rules of single indicator latent variables require that the indicators
unique variance is set to a pre-determined value. This value may be determined using a reliability
correction (Coffman & MacCallum, 2005). However, the reliability correction ignores one
source of the indicators unique variance. Unique variance includes (1) systematic or unique
variability that arises from factors that affect only a specific measured variable such as a poor
quality item, and (2) unsystematic variance due to random measurement error or unreliability
(Coffman & MacCallum, 2005). Since the reliability correction uses the scales reliability (i.e.
Cronbach alpha) to calculate a predetermined value for the indicators variance, it only captures
unsystematic variance while ignoring systematic variance. These limitations are addressed by
the third option referred to as partial disaggregation method which involves combining and
summing a subset of items of the scale into groupings referred to as parcels (e.g. Bandalos &
Finney, 2001). The parcels are then entered in the SEM model as indicators of the latent
variable. This latter methodology allows for the estimation and correction of both systematic
28
and unsystematic variance. As well, parcels are more reliable than single items (Coffman &
MacCallum, 2005).
The identification and adequacy of the depression measurement model was assessed
using criteria described below under Model Identification and Adequacy of Model Fit.
Mediation analyses.
The extent to which mothers depression and appraisal of infant temperament mediate the
association between mothers cumulative early adversity, income and maternal sensitivity was
assessed using SEM in AMOS v. 17.0. A three step strategy was implemented to examine the
mediating effect of mothers depression and appraisal of infant temperament. First, adequacy in
model fit was assessed using the various indices described in the section titled Adequacy of
Model Fit. Second, the statistical significance of the indirect pathways was examined in the
final model demonstrating the best fit. Third, the significance level of the indirect effect was
examined using confidence intervals; this method is an alternative to the Sobel test and shares
similar properties to a bootstrap approach (Arbuckle, 2008). The confidence intervals are
estimated using Bayesian estimation which uses Markov Chain Monte Carlo (MCMC)
techniques to draw random values of the models parameters across numerous data samples
(Arbuckle, 2008). Convergence of the MCMC algorithm is achieved once stable parameters
have been detected across the numerous samples.
Model identification.
A precondition of testing SEM is that the model must be identified for it to be testable
and interpretable. Model identification is important given that the models attempt to estimate
parameters for unobserved variables (latent constructs) for which no direct data are available
(Byrne, 2001). Hence, model identification concerns the issue of whether it is feasible to
29
estimate parameter values for the unknown parameters from a models covariance matrix and
whether there is a unique solution to the model (Byrne, 2001).
A multi-stage strategy was implemented for model identification. The scaling rule for
latent variables (Byrne, 2010/2001) is the first rule applied; this criterion requires that every
latent variable have a fixed unit of measurement (i.e. a fixed regression coefficient, factor
variance or error term variance). The second rule applied is the t-rule (Byrne, 2001) which
indicates the extent to which there is an adequate number of data points for the number of
parameters to be estimated. The t value should be less than or equal to the number of
unknown parameters.
Adequacy of model fit.
The fit of the models was assessed using criteria for (a) the adequacy of parameter
estimates and (b) the model as a whole. Adequate estimated parameters are those that show the
parameter sign and size that is consistent with underlying theory (Byrne, 2001). It is
recommended that parameter estimates, except for error variances, that are not statistically
significant should be deleted from the model (Byrne, 2001).
Adequacy of the model as a whole was assessed using the following criteria.
(1) A non-significant chi-square value (2): this confirms the null hypothesis that the model
specification is valid and fits the data well. Since the chi square is sensitive to sample size,
very trivial departures in fit produce large chi square values in large samples (Byrne, 2001).
Hence, non-significant chi square values have proven unlikely in large samples (Byrne,
2001). Given this limitation, it is recommended that additional fit measures are used in
conjunction with the chi square, requiring that the standards of fit be met for all other indices.
30
(2) Comparative Fit Index (CFI; Bentler, 1990); this measure compares the hypothesized model
to a model that assumes no relationship among the variables (i.e. independence model;
Byrne, 2001). This measure is considered an index of choice as it takes into account sample
size. Values range from zero to one with values equal to or greater than .95 indicating good
fit (Hu & Bentler, 1999).
(3) Bentler-Bonett Non-Normed Fit Index (NNFI; Bentler, 1980); this index compares the
hypothesized model to an independence model. This measure is insensitive to sample size
but penalizes for model complexity; hence, models with more degrees of freedom will
produce higher fit values. Values range from zero to one with good fitting models showing
values of .95 or larger (Hu & Bentler, 1999).
(4) Relative Non-Centrality Index (RNI; McDonald & Marsh, 1990) is a measure of discrepancy
in fit that has been recommended based on results from multiple simulation studies. Similar
to the NNFI and the CFI, it compares the hypothesized model to an independence model
where the relationship among variables is assumed to be zero. The desirable characteristic of
the RNI is a lower standard error and independence of sample size; however, it does not
adjust for model complexity. Like the NNFI and CFI, RNI values range from zero to one
with good fitting models showing values of .95 or larger (Byrne, 2010/2001).
(5) Root Mean Square Error of Approximation (RMSEA; Steiger & Lind, 1980) is an index of
absolute fit which takes into account both sample size and model complexity. This measure
is regarded as one of the most informative measures in covariance structure modeling (Byrne,
2001). The RMSEA assess the extent to which the estimated parameters would fit the
population covariance matrix if it were available (Byrne, 2001). Browne and Cudeck (1993)
suggest that RMSEA value less than .05 indicate good fit and values as high as .08 indicate
31
reasonable fit, and the associated p value for the hypothesis of closeness-of-fit > .50 (that is
the RMSEA is good at <.05; Joreskog & Sorbom, 1996a).
(6) Bayesian Information Criterion (BIC; Raftery, 1993; Schwarz, 1978) examines the extent to
which parameter estimates will cross-validate in future samples, imposing penalties for
model complexity (Byrne, 2001). The BIC is used in model comparison of two or more
models with smaller values indicating better fit (Byrne, 2001). Furthermore, it is possible to
calculate the change in BIC across models. Raftery (1995) suggests that change in BIC
values of 6-10 and >10 provide strong and very strong evidence, respectively, that a model
should be rejected for alternate models. A change in the BIC of 6 to 10 function analogs to a
.05 and .01 level of significance, respectively. Specifically, when the probability of a model
given the data exceeds .95 but is not greater than .99, the change in BIC will be in the range
of 6 to 10. While change in the BIC greater than 10 indicate that the probability of a model
exceeds .99 (Arbuckle, 2008).
(7) Modification Indices (MI). Adequacy of model fit was also assessed using MI values, which
indicate the expected drop in the chi square if a fixed parameter is freely estimated in a
subsequent run. Parameters should be freed one at a time in subsequent runs, with the largest
and most interpretable modification index freed first; this test is referred to as the Lagrange
Multiplier Test (LM Test; Byrne, 2001). A significant change in the chi square is used as an
index of the significance of the change in model fit per freed parameters. However, given the
limitations of the
2
with respect to sample size, this test is supplemented by the change in
BIC (as described previously).
32
Moderated mediation analyses.
The final mediation model was re-estimated across levels of neighborhood quality. The
purpose of these analyses was to examine whether the significance of the mediating pathways
was contingent on levels of neighborhood quality.
These analyses were conducted by first allowing the indirect pathways of early adversity
and income to vary across levels of the moderator variables (i.e. poor versus good
neighborhood); the fit of the unconstrained model was then compared to that of a subsequent
model where the mediating pathways were set invariant across the two groups. Group equality
was assessed by examining the change in the chi-square (Byrne, 2010). Evidence that the
mediating effect is not equivalent across groups is claimed if the change in the chi-square value
is statistically significant (Byrne, 2010). A significant change in the chi-square allows for the
rejection of the null hypothesis that the groups are equivalent on the constrained parameters.
Univariate and multivariate normality.
A critical data requirement of SEM analyses is that the data are multivariate normal with
multivariate kurtosis being particularly important (Byrne, 2010). Since the presence of
univariate nonnormality precludes the possibility of multivariate normality (Byrne, 2010)
univariate nonnormality was first assessed in SPSS and subsequently in AMOS. In SPSS
variables with skewness and kurtosis values of greater than 1 are considered as having a
nonnormal distribution. In AMOS, the rescaled standardized kurtosis index (
2
) (i.e. maximum
recommended value of 7) indicates departure from normality (West et al., 1995). Multivariate
normality was assessed in AMOS. Bentler (2005) recommends that values of Mardias
normalized estimate of multivariate kurtosis greater than 5.00 are indicative of data that are
nonnormally distributed.
33
Results
Descriptive statistics and correlations.
Table 1 presents descriptive statistics for the cumulative early adversity risk variable,
mothers depression score, the five measures of maternal behavior, and covariates of maternal
sensitivity. As shown in Table 1, five variables demonstrated skewness and kurtosis values
greater than 1: cumulative early adversity risk, number of children in the home, mothers
age, single parent and prenatal problems. With respect to the variable cumulative early
adversity, since fewer than 3% of the sample endorsed 7 or more early risks, the variable was
recoded so that risk levels 6 through 10 were recoded to 5 or more risks (see Table 2). The
variables number of children in the home was transformed into a dichotomous variable with
values of 1 representing families with three or more children and 0 families with two children;
74% of mothers reported having less than 3 children, while 26% reported having 3 children or
more. A square root transformation was used for the variables mothers age and prenatal
problems; this transformation successfully corrected both skewness and kurtosis for the variable
mothers age but not prenatal problems therefore this latter variable was entered in AMOS in
its original form. It was not possible to transform the variable single parent as it is a
dichotomous variable.
In AMOS, examination of the rescaled standardized kurtosis index (
2
) of all variables
indicated that this value was below the maximum value of 7, therefore suggesting that the data
were univariate normal (data not shown). Across the five imputations, the Mardias normalized
estimate was less than 5 indicating that the data were multivariate normal.
Table 3 presents the bivariate correlations among the five measures of maternal behavior,
mothers cumulative early adversity, mothers depression and covariates of maternal sensitivity.
Consistent with existing theory and empirical findings, significant covariates of maternal
34
sensitivity include infant temperament, three or more children in the home, family income, infant
weight, being Canadian born, mothers education and being a single parent.

Table 1. Means, standard deviation, range of values, skewness and kurtosis across variables.
N Min. Max. Mean SD Skewness Kurtosis
Cumulative early adversity risk 501 1 9 2.21 1.59 1.84 3.71
Cumulative early adversity risk (recoded) 501 1 5 2.09 1.28 1.01 -0.11
MBQS 501 -.92 1 0.27 0.49 -0.53 -0.63
Ainsworth acceptance 501 1 9 6.29 1.74 -0.47 -0.13
Ainsworth accessibility 501 1 9 5.82 2.01 -0.37 -0.62
Ainsworth cooperation 501 1 9 5.59 1.90 -0.27 -0.66
Ainsworth sensitivity 501 1 9 5.42 1.98 -0.19 -0.78
Infant temperament 501 1 6 3.05 0.97 0.32 -0.08
No. of children in the home 501 2 10 2.37 0.82 4.35 30.72
Family income 501 2 16 11.8 4.07 -0.60 -0.74
Infant weight (kilos and grams) 501 1.6 6.12 3.4 0.51 -0.13 -1.99
Mothers education 501 8 22 15.27 2.67 0.02 -0.32
Mothers age 501 18 48 32.71 4.90 -0.30 0.02
Mothers age (transformed) 501 4.24 6.93 5.70 0.44 -0.53 0.25
Prenatal problems 501 0 .67 0.08 0.11 1.5 2.4
Prenatal problems (transformed) 501 0 .82 0.17 0.22 0.69 -1.18
Neighborhood quality 501 -1.57 3.69 0 1 0.83 0.38

35


Table 2. Frequencies of cumulative early adversity score.

Score N Percent
Cumulative
Percent
1.00 221 44.1 44.1
2.00 137 27.3 71.5
3.00 58 11.6 83.0
4.00 44 8.8 91.8
5.00 + 41 8.2 100.0


3
6
T
a
b
l
e

3
.


B
i
v
a
r
i
a
t
e

c
o
r
r
e
l
a
t
i
o
n
s
.


1

2

3

4

5

6

7

8

9

1
0

1
1

1
2

1
3

1
4

1
5

1
6

1
.



C
u
m
u
l
a
t
i
v
e

e
a
r
l
y

a
d
v
e
r
s
i
t
y


















2
.



M
a
t
e
r
n
a
l

d
e
p
r
e
s
s
i
o
n




.
2
1
b

-
















3
.



M
B
Q
S

-
.
0
5

-
.
1
6

a

-















4
.



A
i
n
s
w
o
r
t
h

a
c
c
e
p
t
a
n
c
e


-
.
0
6

-
.
1
1
a

.
7
7

c

-














5
.



A
i
n
s
w
o
r
t
h

a
c
c
e
s
s
i
b
i
l
i
t
y

.
0
0

-
.
1
0

a

.
7
9
c

.
7
7

c

-













6
.



A
i
n
s
w
o
r
t
h

c
o
o
p
e
r
a
t
i
o
n



.
0
0

-
.
0
5

.
7
5
c

.
7
6

c

.
6
8

c

-












7
.



A
i
n
s
w
o
r
t
h

s
e
n
s
i
t
i
v
i
t
y


-
.
0
8

-
.
1
2

a

.
8
8
c

.
8
4

c

.
8
6

c

.
8
2

c

-











8
.



A
p
p
r
a
i
s
a
l

o
f

i
n
f
a
n
t

t
e
m
p
e
r
a
m
e
n
t

.
0
5

.
1
7

c

-
.
0
8

-
.
1
3

a

-
.
1
1
b

-
.
0
4

-
.
1
3

b

-










9
.



T
h
r
e
e

c
h
i
l
d
r
e
n

o
r

m
o
r
e

.
0
8

.
1
0

a

-
.
0
8

-
.
1
0

a

-
.
0
3

-
.
1
2

a

-
.
0
7

.
0
2

-









1
0
.

F
a
m
i
l
y

i
n
c
o
m
e

-
.
1
7
c

-
.
3
3

c

.
2
4

c

.
2
5

c

.
2
4

c

.
2
6

c

.
2
7

c

-
.
0
4

-
.
0
8

-








1
1
.

I
n
f
a
n
t

w
e
i
g
h
t

-
.
0
2

-
.
0
5

.
0
9
*

-
.
0
2

.
0
5

a

.
0
9

.
1
1

a

.
0
0

.
0
1

.
1
6

c

-







1
2
.

C
a
n
a
d
i
a
n

b
o
r
n

s
t
a
t
u
s


.
1
3
b

-
.
1
7

c

.
1
9

c

.
1
6
b

.
2
3

c

.
2
0

c

.
2
2

c

-
.
0
0

.
0
5

.
3
3

c

.
1
3

b

-






1
3
.

M
o
t
h
e
r
s
'

y
e
a
r

o
f

e
d
u
c
a
t
i
o
n

-
.
2
1
b

-
.
2
5

c

.
2
0

c

.
2
7

b

.
1
9

c

.
2
8

c

.
2
2

c

-
.
0
5

-
.
1
3

b

.
5
1

c

.
1
0

a

.
1
4

b

-





1
4
.

M
o
t
h
e
r
s
'

a
g
e

-
.
0
9
a

-
.
2
0

c

-
.
0
1

.
0
2

.
0
0

.
0
4

.
0
0

-
.
0
4

.
1
3

b

.
4
7

c

.
0
7

.
0
7

.
3
8

c

-




1
5
.

S
i
n
g
l
e

m
o
t
h
e
r


.
2
2
b

.
1
8

c

-
.
0
8

-
.
0
8

-
.
1
3

b

-
.
1
2

a

-
.
1
1

a

.
0
5

.
0
5

-
.
4
4

c

-
.
1
0

a

-
.
0
7


-
.
2
2

c

-
.
2
7

c

-



1
6
.

P
r
e
n
a
t
a
l

p
r
o
b
l
e
m
s

.
1
4
b

.
1
1
a

-
.
0
0

-
.
0
0

.
0
6

-
.
0
1

-
.
0
1

.
0
4

.
0
9

a

-
.
0
9

.
0
5

.
0
9
*

-
.
0
8

-
.
0
1

.
0
4

-


1
7
.

N
e
i
g
h
b
o
r
h
o
o
d

q
u
a
l
i
t
y

.
1
9
c

.
2
7

c

-
.
2
3

c

-
.
2
6

c

-
.
2
4

c

-
.
2
4

c

-
.
2
4

c

.
0
4

.
1
2

a

-
.
5
7

c

-
.
1
2
b

-
.
2
0

c

-
.
4
0

c

-
.
3
4

c

.
3
6

c

.
0
8

-

a

p

<

.
0
5
;

b

p

<

.
0
0
1

c

p

<

.
0
0
0
1

*

p

=
.
0
5
.
37
Exploratory factor analysis.
The goal of exploratory factor analysis was to examine whether the MBQS and the
Ainsworth scales loaded on a single construct or multiple dimensions of maternal behavior.
Examination of the scree plot and eigenvalues (greater than 1) indicated that the five measures of
maternal behavior loaded on a single factor. As shown in Table 4, this factor had an eigenvalue
of 4.1 and explained 82.5% of the variance. The component loadings (Table 5) also indicated
that these five measures of maternal behavior assess a single underlying construct. The loadings
ranged from .85 to .97 with an average loading of .91.

Table 4. Results of exploratory factor analysis.

Factors Eigenvalues % of Variance

Cumulative %

1 4.1 82.5 82.5
2 0.4 7.5 90.0
3 0.2 4.8 94.8
4 0.2 3.6 98.5
5 0.1 1.5 100.0


38

Table 5. Principal Component Loadings of the Five
Measures of Maternal Behavior.
MEASURES FACTOR 1
MBQS 0.92
AISNWORTH ACCEPTANCE 0.90
AINSWORTH ACCESSABILITY 0.90
AINSWORTH COOPERATION 0.85
AINSWORTH SENSITIVITY 0.97

Confirmatory factor analysis.
A series of confirmatory factor analyses were conducted to confirm that the measurement
model identified in the exploratory factor analysis fit the data well. Figure 1 displays the
theoretical model. Maternal sensitivity is a latent (unobserved) construct that is assessed by the
following observed indicators: MBQS and the four Ainsworth scales. Associated with each
observed indicator is an error term (E1 to E5) which represents measurement error associated
with the indicators adequacy in measuring the latent factor (maternal sensitivity).
Consistent with the scaling rule for model identification (Byrne, 2001), the regression
coefficient of at least one indicator should be fixed. As shown in Figure 1, the regression
coefficient of the Ainsworth Cooperation indicator was fixed to 1. Further, model identification
required that all error terms (E1 to E5) have a fixed unit of measurement. The regression
weights for these parameters were set to 1. These constraints resulted in 10 unknown
parameters: 4 regression coefficients of the unfixed indicator variables, 6 variances (E1 to E5
and variance term for the latent variable). The number of available data points is 15 (calculated
as p(p+1)/2 where p is the number of observed variables). Since the number of estimated
39
parameters (10) is less than the number of available parameters (15), the t-rule is met
indicating an identified model.
As shown in Table 6, the theoretical model demonstrated good fit according to the TLI of
.97, and CFI and RNI of .99. However, the RMSEA value in the range of .12 is clearly above
the cut off value of < .05 and associate p value less than the criteria p >.50. Misfit is also
indicated by the significant chi-square (
2
(5)
= 27.36).
Inspection of the modification indices (MI) suggested that the specification of covariance
between errors E3 and E4 and E3 and E5 would improve the fit of the model. The covariance
between E3 and E4 is theoretically relevant representing the non-independent relationship
between mothers cooperative/non-interfering behavior and their accessibility to their infant.
Specifically, the Ainsworths cooperation scale describes some mothers as highly interfering and
non-cooperative with their infants wishes and signals, but highly accessible showing clear
awareness of their infant at all times (Ainsworth, 1969). The central issue of the accessibility
scale is mothers awareness of their infants wishes and needs; this scale does not take into
account the quality of mothers responses to the infant. Hence, it is possible for a mother to
show high awareness of their infant but respond non-cooperatively to the babys cues.
Likewise, the covariance between E3 and E5 is consistent with Ainsworths observation
that some mothers show rejection or non-acceptance of their infant through their constant non-
cooperative behavior. Highly rejecting mothers are described as constantly opposing their
infants wishes, joining battle with the baby whenever the mothers authority is challenged and
frequently display retaliatory behavior against the baby. The dynamic that exists between the
mother and child is one characterized by chronic irritability and impatience on the part of the
mother (Ainsworth, 1969).
40
As shown in Table 6, specification of these covariance terms in the final model
significantly improved the fit of the model. The change in the chi-square is significant (range of

2
(2)
= 24.92, p <.001). All fit indices are in the recommended range: (1) a non-significant
2
(
2
(3)
= 2.44, p >.05), (2) CFI, TLI and RNI values of 1, and (3) drop in the BIC greater than 10
indicating that the change in the BIC is significant at the .01 level (Raftery, 1995). Table 7
displays the regression, variance and covariance estimates of the final model. All regression
coefficients are significant, and show parameters size and sign consistent with theories on
maternal sensitivity.

Figure 1. Theoretical model of maternal sensitivity.



4
1
T
a
b
l
e

6
.



R
e
s
u
l
t
s

o
f

c
o
n
f
i
r
m
a
t
o
r
y

f
a
c
t
o
r

a
n
a
l
y
s
i
s

(
N
=
3
5
1
)
.


M
o
d
e
l

2

D
F

P

C
F
I

T
L
I

R
M
S
E
A


R
M
S
E
A

P
*

R
N
I

B
I
C

B
I
C

D
F

P

T
h
e
o
r
e
t
i
c
a
l

m
o
d
e
l

2
7
.
3
6

5

<

.
0
0
1

.
9
9

.
9
7

0
.
1
2

.
0
1

.
9
9

8
1
.
5
3

-

-

-

-

F
i
n
a
l

m
o
d
e
l

2
.
4
4

3

>
.
0
5

1

1

0
.
0
1

.
8
3

1

7
0
.
9
2

1
0
.
6
0

2
4
.
9
2

2

<
.
0
0
1

*

T
h
i
s

s
t
a
t
i
s
t
i
c

t
e
s
t
s

t
h
e

h
y
p
o
t
h
e
s
i
s

o
f

c
l
o
s
e
n
e
s
s
-
o
f
-
f
i
t

w
i
t
h

p

v
a
l
u
e
s

>

.
5
0

s
u
g
g
e
s
t
i
n
g

t
h
a
t

t
h
e

R
M
S
E
A

v
a
l
u
e

i
s

g
o
o
d

a
t

t
h
e

<

.
0
5

l
e
v
e
l

(
J
o
r
e
s
k
o
g

&

S
o
r
b
o
m
,

1
9
9
6
a
)
.
42

Table 7. Parameter estimates of final measurement model (Model 3) for maternal sensitivity.

b SE P
Ainsworth sensitivity Sensitivity
1.17 .05 <.001 .97
MBQS Sensitivity
0.26 .01 <.001 .90
Ainsworth cooperation Sensitivity
1.00 - - .85
Ainsworth accessibility Sensitivity
1.09 .06 <.001 .88
Ainsworth acceptability Sensitivity
0.93 .04 <.001 .86
Covariances
Covariance E3 E4
-.27 .07 <.05
Covariance E3 E5
.13 .07 <.05
Variances
Sensitivity 2.7 .30 <.001
E1 0.2 .05 <.001
E2 0.0 .00 <.001
E3 1.1 .11 <.001
E4 0.9 .09 <.001
E5 0.8 .08 <.001
43
Figure 2. Final measurement model of maternal sensitivity.

Note: standardized estimates shown.
44
Measurement model of maternal depression.
A partial disaggregated model was estimated for maternal depression. This methodology
requires that the scale is unidimensional (Williams & Boyle, 2008) thus an exploratory factor
analysis was first conducted on the entire sample (N=501) to examine this assumption. Results
of the exploratory factor analysis indicated that the CES-D scale is indeed unidimensional (data
not shown). The 20 CES-D items were then grouped into parcels based on a correlation matrix
with the most correlated items grouped together. Table 8 displays the descriptive statistics and
psychometric properties of the parcels. Since the parcels demonstrated both skewness and
kurtosis, they were transformed into their square root. This transformation was successful in
correcting the skewness and kurtosis.
Figure 3 displays the measurement model for maternal depression. Model identification
required that all error terms (E1 to E3) have a fixed unit of measurement as well the regression
coefficients of parcel 1 and parcel 3 were set to 1. These constraints resulted in 5 unknown
parameters: 1 regression coefficient of the unfixed parcel 3, 4 variances (E1 to E3 and variance
term for the latent variable). The number of available data points is 6 (calculated as p(p+1)/2
where p is the number of observed variables). Since the number of estimated parameters (5) is
less than the number of available parameters (6), the t-rule is met indicating an identified
model.
As shown in Table 9, the theoretical model demonstrated good fit. All fit indices are in
the recommended range: (1) a non-significant chi-square (
2
(1)
= 1.03, p >.05), (2) CFI, TLI and
RNI values of .99, .99 and 1 respectively, and (3) the RMSEA value less than the .05 criteria and
associated p > .50. Table 10 displays the regression and variance estimates of the final model.
45
Table 8. Descriptive statistics and psychometric properties of the depression parcels.
N Min. Max. Mean SD Skewness Kurtosis Cronbach
alpha
Parcel 1
(No. of items = 11)
501 0 2.0 0.44 .36 1.1 1.3 .70
Parcel 1 square root
transformation
501 0 1.4 0.59 .30 -0.2 -0.3 -
Parcel 2
(No. of items = 4)
501 0 2.5 0.37 .5 1.6 2.2 .75
Parcel 2 square root
transformation
501 0 1.6 0.42 .44 0.5 -1.0 -
Parcel 3
(No. of items = 5)
501 0 2.6 0.62 .6 1.2 1.6 .67
Parcel 3 square root
transformation
501 0 1.6 .69 .37 -0.3 -0.2 -

46

Figure 3. Theoretical model for maternal depression.

Depression
Parcel 1
E1
1
1
Parcel 2
E2
1
Parcel 3
E3
1
1


Table 9. Goodness-of-fit indices for the depression measurement model.


2
df P CFI TLI RMSEA RMSEA P RNI

Theoretical model

1.03

1

0.32

0.99

0.99

0.01

0.56

1


47

Table 10. Parameter estimates of the final depression measurement model.

b SE p
Parcel 1 Depression
1 - - .75
Parcel 2 Depression
1.55 0.12 <.001 .80
Parcel 3 Depression
1 - - .60
Variances
Depression 0.05 .00 <.001
E1 0.04 .00 <.001
E2 0.07 .01 <.001
E3 0.09 .00 <.001

Mediation analysis.
Figure 4 displays the hypothesized model for the mediating role of mothers depression
and appraisal of infant temperament on the association between maternal sensitivity and
mothers early adversity and income. The model consists of three latent variables: Maternal
depression, Mothers appraisal of infant temperament and Maternal sensitivity. The
measurement models of maternal depression and maternal sensitivity are not discussed
further as these were described in detail in the respective sections. With regards to the latent
variable Mothers appraisal of infant temperament, three options were available for the
specification of this latent construct; these are discussed in detail under section Measurement
model for maternal depression. The second option was used for the specification of this
construct. Since mothers appraisal of infant temperament was assessed using a five-item scale
48
the latent variable was specified with a sole indicator which consisted of the mean of the five-
items. The variance of the latent construct was specified to a pre-determined value of 0.16
calculate using a reliability correction (calculated as (1-.67<Cronbach alpha of
scale>*.48<variance of scale>) (see Fig 4). Additionally, identification of this latent construct
required that the regression coefficient of the indicator be set to unity.
Last, a residual term (R1-R3) is associated with each latent factor; this represents error in
the prediction of the construct from the respective predictors (e.g. R1 represents error in the
prediction of Depression from the construct Early adversity and income).
The cumulative score of mothers early adversity was entered as an observed variable.
Likewise for mothers income, this construct was specified as an observed variable given that it
was assessed by a single question.
Based on existing theory, the following variables were entered as covariates of maternal
sensitivity: experience of prenatal difficulties, mothers education, mothers Canadian born
status, infant weight, number of children in the home, and single parent status. These control
variables were entered as observed measures with no measurement error. Only Canadian born
status and mothers education were found to relate to sensitivity therefore only these covariates
were retained in the model. A default of AMOS is to specify correlations among all observed
variables, hence the following covariances were specified: mothers education and the following:
Canadian born status income and early adversity, and two covariance terms between
Canadian born status and income and Canadian born status and early adversity.
The first step of the analysis was to achieve adequacy in model fit. As shown in Table
11, the theoretical model fit well as per the CFI, TLI and RNI values of .95 to .97. However, the
RMSEA values over .05 and the significant chi-square suggest misfit. Examination of the
49
parameter estimates indicated that the following pathways were not statistically significant and
therefore should be removed from the model. The non-significant pathway between Early
adversity Maternal sensitivity partially supports hypothesis 1 indicating that early adversity
does not directly influence maternal sensitivity but rather that the relationship is a mediated
association. The non-significant pathway between Depression Maternal sensitivity also
partially supports hypothesis 1 indicating that the association between depression and maternal
sensitivity is accounted for by mothers perceptions of their infants temperament. The non-
significant pathway of Early adversity Mothers appraisal of infant temperament suggests
that early adversity does not directly influence mothers perceptions of their infant as suggested
by alternate perspectives for the effects of early adversity on thought distortions (Gibb et al.,
2001; Gibb, Alloy, Abramson, & Marx, 2003; Kankin et al., 2001). Rather, as specified in
hypothesis 1, early adversity increases the risk of maternal depression which is in turn related to
mothers appraisal of infant temperament.






5
0
F
i
g
u
r
e

4
.


H
y
p
o
t
h
e
s
i
z
e
d

m
o
d
e
l

f
o
r

t
h
e

m
e
d
i
a
t
i
n
g

e
f
f
e
c
t

o
f

m
o
t
h
e
r
s


d
e
p
r
e
s
s
i
o
n

a
n
d

a
p
p
r
a
i
s
a
l

o
f

i
n
f
a
n
t

n
e
g
a
t
i
v
e

t
e
m
p
e
r
a
m
e
n
t

o
n

t
h
e

a
s
s
o
c
i
a
t
i
o
n

b
e
t
w
e
e
n

m
a
t
e
r
n
a
l

s
e
n
s
i
t
i
v
i
t
y

a
n
d

m
o
t
h
e
r
s


e
a
r
l
y

a
d
v
e
r
s
i
t
y

a
n
d

i
n
c
o
m
e
.


51
Examination of the modification indices of the re-estimated model indicated that the
specification of four covariances would improve the fit of the model. It is noteworthy that the
only covariances specified were those justifiable based on shared measurement (i.e. where
mother reported on multiple measures). The covariances were specified one at a time and the
respective model re-estimated, the covariance included the following: (1) covariance among the
observed variable mothers education and the variance of depression parcel 1 (D1), (2)
covariance among the variance of depression parcel 3 (D3) and mothers income and
Canadian born status, and last (3) the covariance among the observed variable Canadian born
status and the residual term for the depression latent variable (RD1).
Specification of these covariances improved the fit of the final model, across the five
datasets, as shown in Table 11. The following fit indices are in the recommended range: (1) CFI,
TLI and RNI values of .95 to .97, (2) the RMSEA value equal to or less than the .05 criteria and
associated p > .50. The change in the BIC statistic clearly greater than 10 indicates that the
change in fit from the theoretical to the final model is significant at the .01 level (Raftery, 1995).
However, the chi-square remained significant (
2
(52)
= 99.64, p <.001). However, the chi-square
is sensitive to sample size and very trivial departures in fit produce large chi-squares in large
samples (Byrne, 2001). Further, the change in the chi-square (
2
(1)
= 67.50, p <.001) is
significant indicating that the final model is superior in fit than the theoretical model. Hence,
given the limitation of the chi-square due to the large sample size and that the other indices
suggest adequate fit, the final model is retained over the theoretical model.
Table 12 displays the parameter estimates for the final model. Evidence for hypothesis 1
and 2 was found. The model supports the two hypothesized indirect relationships for early
adversity (hypothesis 1) and low income (hypothesis 1). Mothers cumulative early adversity
52
and income are significantly related to mothers depression ( = .1, p < .001 and = -.40, p <
.0001 respectively) which is in turn positively related to mothers negative appraisal of the infant
temperament ( = .19, p < .0001) which is in turn negatively related to mothers sensitive
behavior toward their infant ( = -.11, p < .001). These indirect relationships are observed after
having controlled for significant covariates of maternal sensitivity including mothers education
( = .14, p < .05), and Canadian born status ( = .16, p < .01).
The second step of the analysis involved estimating confidence intervals to assess the
significance of the observed indirect effects. As shown in Table 13, the total indirect effect of
early adversity on sensitivity is -.003 (computed as multiplying the standardized parameter
estimates of early adversity on depression and that of depression on appraisal of temperament
and that of temperament appraisal on sensitivity (.13* .19 * -.11 = -.003). This effect is within
the estimated 95% lower and upper boundary indicating significance level of .05. Likewise, the
indirect effect of low income on maternal sensitivity is .008 (computed as multiplying the
standardized parameter estimates of low income on depression, depression on mothers negative
appraisal of infant temperament and the estimate of appraisal on sensitivity (-.40*.19*-.11=.008).
This effect is within the estimated 95% lower and upper boundary, indicating significance level
of .05. These significant indirect effects support hypothesis 1.
As specified in hypothesis 1, a direct association between income and sensitivity was also
found ( = .15, p < .01) even after accounting for incomes indirect effect on sensitivity and the
influence of mothers education. The total standardized effect (mediated and unmediated effect)
of mothers income on sensitivity is .16 (calculated as the sum of the direct effect and indirect
effect (.15 +.008=.16)). Low income also showed a direct relationship to maternal sensitivity

53
Figure 5 displays the final model, for simplicity the only coefficients displayed are those
that relate directly to the indirect and direct effects discussed above; all other coefficients (i.e.
variance and covariance terms) are displayed Table 12.



5
4
T
a
b
l
e

1
1
.



G
o
o
d
n
e
s
s
-
o
f
-
f
i
t

i
n
d
i
c
e
s

f
o
r

t
h
e

f
i
n
a
l

m
e
d
i
a
t
i
o
n

m
o
d
e
l
.


2

D
F

P

C
F
I

T
L
I

R
M
S
E
A

R
M
S
E
A

R
N
I

B
I
C

B
I
C

D
F

P

P

T
h
e
o
r
e
t
i
c
a
l

m
o
d
e
l

1
6
5
.
8

5
3

0

.
9
7

.
9
5

0
.
0
7

.
0
1
8

.
9
7

4
0
2
.
0
1





F
i
n
a
l

m
o
d
e
l

9
9
.
6
4

5
2

0

.
9
9

.
9
8

0
.
0
4

.
7
9

.
9
8
6

3
4
2
.
1
1

6
0

6
7
.
5
0

1

<
.
0
5


55
Table 12. Parameter estimates of the final mediation model.

b SE
Depression Early adversity
0.03 0.01 0.13
Depression Income
-0.02 0.003 -0.40
Appraisal of infant temperament Depression
0.75 0.19 0.19
Sensitivity Income
0.06 0.02 0.15
Sensitivity Appraisal of infant temperament
-0.17 0.07 -0.11
Sensitivity Canadian born status
0.51 0.15 0.16
Sensitivity Mothers education
0.08 0.03 0.14

Covariances

Income Early adversity
-0.88 0.23
Early adversity

Mothers education
-0.71 0.15
Income

Mothers education
5.18 0.52
Canadian born status

Mothers education
0.15 0.06
Income

Canadian born status
0.65 0.09
Early adversity

Mother education
0.08 0.03
Variances
Income 16.28 1.02
RT1 0.74 0.06
Early adversity 1.63 0.10
Canadian born status 0.25 0.02
Mothers education 7.03 0.44

56
Table 12. Parameter estimates of the final mediation model, continued.
b SE
Variances
Rd1 0.05 0.01
T1 0.16 0.00
R1 2.20 0.20
a
p <.05
b
p <.01
c
p <.001

5
7
F
i
g
u
r
e

5
.


F
i
n
a
l

m
o
d
e
l

f
o
r

t
h
e

m
e
d
i
a
t
i
n
g

e
f
f
e
c
t

o
f

m
o
t
h
e
r
s


d
e
p
r
e
s
s
i
o
n

a
n
d

a
p
p
r
a
i
s
a
l

o
f

i
n
f
a
n
t

n
e
g
a
t
i
v
e

t
e
m
p
e
r
a
m
e
n
t

o
n

t
h
e

a
s
s
o
c
i
a
t
i
o
n

b
e
t
w
e
e
n

m
a
t
e
r
n
a
l

s
e
n
s
i
t
i
v
i
t
y

a
n
d

m
o
t
h
e
r
s


e
a
r
l
y

a
d
v
e
r
s
i
t
y

a
n
d

i
n
c
o
m
e
.



N
o
t
e
:

N
u
m
b
e
r
s

r
e
p
r
e
s
e
n
t

s
t
a
t
i
s
t
i
c
a
l
l
y

s
i
g
n
i
f
i
c
a
n
t

s
t
a
n
d
a
r
d
i
z
e
d

c
o
e
f
f
i
c
i
e
n
t
s
.

58
Table 13. Confidence intervals for the standardized indirect and direct effects of income on
sensitivity and for the standardized indirect effect of early adversity on sensitivity.

Parameter
estimate
95% lower
boundary
95% upper
boundary
Income standardized indirect effect .02 .001 .02
Income standardized total effect .16 .06 .26
Early adversity standardized indirect
effect
-.003 -.007 -.0002

Moderated mediation.
Neighborhood quality.
The model was first estimated across low versus high neighborhood conditions (relative
to the sample median) allowing the parameters of the indirect effect of early adversity and of
income to vary across the two groups. As shown in Table 14 (see Variant Model), this model
demonstrated adequate fit indices. Constraining the indirect pathways to be equal across the two
groups (see Invariant Model) resulted in a statistically significant change in the chi-square (
2
(5)

= 17.93, p <.01). Figure 6 and table 15 display the parameter estimates across levels of
neighborhood quality. The statistically significant change in the chi-square indicates that the two
groups are not equivalent on the constrained parameters. This partially supports hypothesis 2 that
the neighborhood quality would moderate the influence of early adversity and income on
sensitivity. It was further hypothesized that in low quality neighborhood the influence of early
adversity and low income would be exacerbated, while a high quality neighborhood would buffer
mothers from the influence of low income and early adversity. These hypotheses were
59
confirmed only for the association between income and sensitivity and early adversity and
depression.
In a context of poor neighborhood quality larger parameter estimates were found for the
following two pathways income sensitivity (= .16, p < .05 for low and = -.07, p >.05
for good quality), and early adversity depression (= .28, p < .05 for low and = .01, p >
.05 for good quality). This provides partial support for hypothesis 2 suggesting that low
neighborhood quality exacerbated the influence of income on maternal sensitivity and early
adversity on maternal depression. Conversely, in the context of good quality neighborhood, the
association between income and maternal sensitivity, and early adversity and depression was
reduced as indicated by the smaller magnitude of the respective parameters. This suggests that
living in a high quality neighborhood buffered mothers from the influence of early adversity on
maternal depression and income on maternal sensitivity.
Contrary to hypothesis 2, the neighborhood quality did not exacerbate the influence of
depression on mothers appraisal of infant temperament and the influence of mothers appraisals
on their maternal sensitivity. This is shown by the small change in parameter size across
neighborhood quality for the pathways depression mother appraisal of infant temperament
(= .17, p < .05 for low neighborhood quality and = .25, p < .05 for high neighborhood
quality) and the pathway mother appraisal of infant temperament sensitivity ( = -.11, p >
.05 for low neighborhood quality and = -.13, p < .05 for high neighborhood quality).
Contrary to hypothesis 2, a stronger association between income and depression was
found in the context of high neighborhood quality (= -.40, p < .05) rather than the hypothesized
effect of low neighborhood quality (= -.23, p < .05). As well, in high quality neighborhood
there is no evidence for a direct association between income and maternal sensitivity ( = -.07, p
60
> .05 for high neighborhood quality, ( = .16, p < .05 for low neighborhood quality). This
suggests that in high quality neighborhood the influence of income on maternal sensitivity is
completely mediated by mothers depression and appraisal of infant temperament, while in low
quality neighborhood there is evidence for both a direct and indirect association between income
and maternal sensitivity.
Last, the average level of maternal sensitivity across neighborhood quality was examined.
In low neighborhood quality the average level of sensitivity was -.27 (N=251) while in high
quality neighborhood the mean level of sensitivity was = .88 (N =250). This difference was
statistically significant (
2
(1, N=501)
= 24.43, p <.0001).



6
1
T
a
b
l
e

1
4
.


G
o
o
d
n
e
s
s
-
o
f
-
f
i
t

i
n
d
i
c
e
s

f
o
r

t
h
e

m
o
d
e
r
a
t
e
d

m
e
d
i
a
t
i
o
n

m
o
d
e
l
s
.




2

D
F

P

C
F
I

T
L
I

R
M
S
E
A

R
M
S
E
A

P

2
*

D
F
*

P

C
r
i
t
i
c
a
l

2

N
e
i
g
h
b
o
r
h
o
o
d

q
u
a
l
i
t
y












V
a
r
i
a
n
t

m
o
d
e
l

1
5
9
.
4
5

1
0
4

<
.
0
1

.
9
8

0
.
9
7
6

0
.
0
3

.
9
9





I
n
v
a
r
i
a
n
t

m
o
d
e
l


1
7
7
.
3
8

1
0
9

<
.
0
0
0
1

.
9
8




-
1
7
.
9
3

5

0
.
0
0
4

1
8
.
3
5

62
Figure 6. Neighborhood quality moderates the association between maternal sensitivity, early
adversity and income.

a. Poor neighborhood quality



b. Good neighborhood quality.

* p <.05

6
3
T
a
b
l
e

1
5
.



P
a
r
a
m
e
t
e
r

e
s
t
i
m
a
t
e
s

a
c
r
o
s
s

l
e
v
e
l
s

o
f

n
e
i
g
h
b
o
r
h
o
o
d

q
u
a
l
i
t
y
.







P
o
o
r

q
u
a
l
i
t
y

n
e
i
g
h
b
o
r
h
o
o
d

G
o
o
d

q
u
a
l
i
t
y

n
e
i
g
h
b
o
r
h
o
o
d




b

S
E


b

S
E


D
e
p
r
e
s
s
i
o
n


E
a
r
l
y

a
d
v
e
r
s
i
t
y

0
.
0
4
*

0
.
0
1

0
.
2
8

0
.
0
0
3

0
.
0
1

0
.
0
1

D
e
p
r
e
s
s
i
o
n


I
n
c
o
m
e

-
0
.
0
1
*

0
.
0
0
4

-
0
.
2
3

-
0
.
0
4
*

0
.
0
0
6

-
0
.
4
0

I
n
f
a
n
t

t
e
m
p
e
r
a
m
e
n
t


D
e
p
r
e
s
s
i
o
n

0
.
7
1
*

0
.
2
9

0
.
1
7

0
.
9
9
*

0
.
2
7

0
.
2
5

S
e
n
s
i
t
i
v
i
t
y


I
n
c
o
m
e

0
.
0
7
*

0
.
0
3

0
.
1
6

-
0
.
0
3

0
.
0
4

-
0
.
0
7

S
e
n
s
i
t
i
v
i
t
y


I
n
f
a
n
t

t
e
m
p
e
r
a
m
e
n
t

-
0
.
2
0

0
.
1
1

-
0
.
1
1

-
0
.
1
8
*

0
.
0
9

-
0
.
1
3

*

p

<

.
0
5
64
Discussion
The role of early adversity.
Mothers depression and mothers appraisals of infant temperament were found to
mediate the influence of mothers cumulative early adversity on maternal sensitivity. These
findings are consistent with life course theories which suggest that developmental history
influences subsequent parenting through aspects of parental functioning including parental
mental health (Belsky & Jaffee, 2006). The positive association found between early adversity
and maternal depression is consistent with research on the effects of early negative life events on
adult mental health (Brown & Harris, 1993; Rutter & Maughan, 1997). This research generally
shows that early adversity by ways of parental indifference, physical or sexual abuse (Brown &
Harris, 1993; Brown & Moran, 1994), and low quality parenting (Parker, 1981) is a risk factor
for adult depression including postpartum depression (Matthey et al., 2000; McLaren, Kuh,
Hardy, & Mishra, 2007).
Depression was found to relate to mothers negative appraisal of the infant, which in turn
completely accounted for the effects of the depression on mothers sensitivity. This finding is in
line with previous reports that have show that mothers with depression experience their infants as
more difficult (Edhborg, Selmyr, Lunsh, & Widstrom, 2000) and make more unfavorable
remarks of their children (Gordon, Burge, Hammen, Adrian, Jaeniecke, & Hiroto, D., 1989;
Nelson, Hammen, & Brennan, 2003). Although studies have examined the relationship between
maternal depression and the quality of the mother-child relationship (Murray & Cooper, 1997;
Nichd, 1999), and the significance of maternal depression with respect to mothers appraisal of
the child (Edhborg, et al., 2000; Gordon et al., 1989; Nelson, et al., 2003), to the best knowledge
65
of the author the present study is the first to show that mothers negative appraisals can account
for the effects of maternal depression on parenting quality.
Studies that have examined the associations between maternal depression and sensitivity
have documented inconsistent findings with some studies showing negative associations (Murray
& Cooper, 1997; Nichd, 1999) while others report no relationships (Pederson et al, 1990).
Findings from the present study add to this body of work demonstrating that the relationship
between mothers depression and their sensitivity is complex. Mothers perceptions of the child
serve as an important mechanism through which depression can influence the quality of early
mother-child interaction.
There is controversy as to whether depressed mothers provide biased or accurate
appraisals of the infant (e.g. see Cutrona & Troutman, 1986; Stein, Arteche, Lehtonen, Craske,
Harvey, Counsell, & Murray, 2010). The validity of mothers appraisals of infant temperament
was not assessed as there were no observers ratings of infant behavior. Therefore, it is possible
that the infants behavior was indeed difficult and that mothers provided valid assessments. This
would also be consistent with a genetic transmission of mental health problems from mother to
child. It is also possible that the association between mothers depression and mothers
appraisal of infant temperament represent a bidirectional relationship. For example, it may be
that the infants difficult behavior is a learned response from interacting with a non-contingent
depressed mother. The infant behavior may in turn feed-back to the mother who, due to the
demands of the depression, responds to the heightened infants bids with additional withdrawal.
Although the present study does not clarify the direction of causality between mothers
depression and their appraisal of the infant temperament, it is proposed that irrespective of their
validity and cause, mothers perceptions of their infant are nonetheless consequential to
66
sensitivity. The valence of parental beliefs on parenting is exemplified by research on parenting
self-efficacy. Parenting self-efficacy refers to parental beliefs and judgments about ones
competence in the parental role (Bandura, 1997). This construct has been regarded as a major
determinant of competent parenting (Jones & Prinz 2005). For example, parents who judge
themselves higher on parenting self-efficacy demonstrate more authoritative and consistent
parenting than parents with lower parenting self-efficacy (e.g. see Ardelt & Eccles, 2001). This
study extends this line of research by showing that mothers judgments of the infant explain
variance in maternal sensitivity. This implies that interventions aiming at improving mothers
sensitivity should be mindful of mothers perceptions of their infant, especially when maternal
depression is present.
The demonstrated mechanisms for the effects of early adversity on maternal sensitivity
are also consistent with attachment theory. This theory posits that parental attachment styles and
parental childhood experiences of having established and maintained healthy attachments are
influential for parental mental health (Bowlby, 1969, 1988; Marks & Ashleman, 2002). For
instance, Bifulco et al., (2004) reported an incremental increase in the risk of depression in
postpartum women as a function of insecure attachment style (marked, mild, none) with marked
insecurity showing the highest level of depression. Likewise, McMahon, Barnett, Kowalenko
and Tennant (2005) showed that, among new mothers, the effects of early adversity (i.e. low
maternal care) on 12 months postpartum depression were mediated by the mothers insecure
attachment.
Critical to attachment theory are the parents representations of early relationships which
are posited to shape mothers perceptions of themselves and others, including their children
(Bowlby, 1969). These representations, referred to as internal working models of attachment,
67
are cognitive-representational structures that shape what one can remember, feel or think about
early attachment and future attachment relationships (Slade & Cohen, 1996). Parental internal
working models shape the parental responses to the childs affect and attachment behaviors
(Slade & Cohen, 1996) which in turn influences the childs attachment to his or her parents
(Benoit & Parker, 1994; Fonagy, Steel, & Steele, 1991).
Mothers who are insecure with respect to their attachment representations rely on internal
working models that lack, distort or defensively exclude memory and affect of early relationships
(Slade & Cohen, 1996). Insecure mothers are either unable to see their own infants clearly, deny
or are overwhelmed by them, thereby directly influencing the infants own insecure attachment
(Slade & Cohen, 1996). From this perspective, maternal insensitivity to infants signals
originates from interaction patterns that allowed the mother to preserve felt security in her own
childhood relationships (Slade & Cohen, 1996). Felt security refers to the perception of the
sensitive availability of the attachment figure (West, Spreng, Rose, & Adam, 1999). Main and
Goldwyn (1995) argued that infant attachment behaviors such as crying, or approaching, may
threaten the parents felt security by interfering with the maintenance of an attachment state that
is comfortable for the parent (i.e. dismissing or preoccupied). Hence, insensitive responding to
infants signals allows the parent to protect themselves from experiences that may make them
feel vulnerable and unsafe, and to continue thinking about and experiencing relationships in a
manner that is most comfortable for them (Slade & Cohen, 1996).
The role of income.
With respect to mothers economic circumstances, family income was found to relate
directly to sensitivity, as well as indirectly through mothers depression and negative appraisal of
the infant. The direct association is consistent with findings showing that low income mothers
68
hold more authoritarian beliefs regarding parenting than higher income mothers (Martini, Root &
Jenkins, 2004; Dodge, Petit, & Bates, 1994) these beliefs have in turn been associated with
reduced responsivity (Maccoby & Martin, 1983). The indirect pathway is consistent with Conger
and colleagues (1994) family stress model which posits that familial socio-economic
circumstances influence child development through the negative influence on parental mental
health which subsequently compromises parenting quality. This proposed process has received
empirical support (see Conger, Patterson, & Ge, 1995; Conger et al., 1994). The present
findings suggest that the family stress model could be extended to include parental cognitions
about their children as a further proximal influence for the association between familial socio-
economic influences, parental mental health and parenting.
Moderated-mediation: the role of neighborhood quality.
The significance of early adversity and economic circumstances for mothers functioning
and sensitivity is further informed by the results of the moderated-mediation analyses. In low
quality neighborhoods, characterized by crime, poverty and disorder, early adversity was
associated with mothers depression; these findings are consistent with a cumulative risk model
(Rutter & Pickles, 1991) which posits that it is the accumulation of unfavorable conditions that
matters for ones functioning. In addition to coping with an adverse history, mothers that reside
in low quality neighborhoods are exposed to additional risk factors including poverty, violence,
feeling unsafe and limited access to resources. Furthermore, parents from disadvantaged
neighborhoods are more likely to have fewer social ties and to be isolated from formal and
informal networks (Coleman, 1988; Sampson & Groves, 1989; Ross, 2000). This isolation is
associated with compromised parenting, reduced child well-being (Coleman, 1994; Coleman &
Hoffer, 1987) and encourages an individualistic pattern of parenting where the adherence to
69
social norms, values and behaviors is diminished (Sampson, 1992; Sampson & Groves, 1989).
From an attachment perspective the combination of lack of supports and increased exposure to
risk factors evident in a context of low quality neighborhood, is particularly meaningful for
mothers with adverse histories. For mothers with adverse histories, low quality neighborhoods
may elicit a heightened level of fear which is likely to activate the attachment system (Bowlby,
1973). Mothers may use maladaptive coping strategies or may lack coping strategies altogether.
Hence, mothers with an adverse background may be especially vulnerable to the effect of a low
quality neighborhood and in addition lack the coping mechanisms to face the difficulties
presented by the neighborhood. The activation of the attachment system and inability to cope
may increase the risk of depression thereby facilitating the influence of early adversity on
sensitivity.
In contrast, in high quality neighborhoods, early adversity was not found to relate to
mothers depression. This suggests that characteristics of high quality neighborhoods may have
buffered mothers from the effect of early adversity. This is consistent with Belsky (1984)s
process model of parenting in which it is posited that parenting is a buffered system and that
aspects of the ecology may offer supports that will act in a compensatory way to repair the
negative effects of the early experience. Characteristics found among higher quality
neighborhoods that may assist mothers in compensating for a difficult history include greater
social ties, reduced alienation (Coleman, 1994; Coleman & Hoffer,1987) and overall lower level
of ecological stress (i.e. higher sense of safety) (e.g. see Caspi, Bolger, & Eckenrode, 1987).
Chronic exposure to ecological risks is troublesome for mothers. For instance, Caspi et al.,
(1987) found that relative to women living in safe neighborhoods, for those in unsafe
neighborhoods the effect of daily stress on depression lingered for longer period of time. Among
70
neighborhoods characterized by greater social ties and reduced isolation parenting becomes a
shared responsibility among the residents where there is a consensus on the adherence of shared
practices and norms (Steinberg, Darling, & Fletcher, 1995). For instance, child monitoring and
supervision is shared among neighbors (Coleman, 1994; Coleman, & Hoffer, 1987). This shared
responsibility and communal beliefs about parenting may assist mothers in overcoming their
adverse history by instilling in them feelings of support and providing them alternative ways of
viewing the world, themselves and their children and the task of parenting.
With respect to low family income, a stronger association between income and
depression was found in the context of high neighborhood quality rather than the hypothesized
effect of low neighborhood quality. As well, in high quality neighborhood there is no evidence
for a direct association between income and maternal sensitivity. This suggests that in high
quality neighborhood the influence of income on maternal sensitivity is completely mediated by
mothers depression and appraisal of infant temperament, while in low quality neighborhood
there is evidence for both a direct and indirect association between income and maternal
sensitivity. Mothers demographic data were examined in detail to better interpret these
findings. 42% of mothers from high quality neighborhoods reported working outside of the
home, relative to 19% of mothers from low quality neighborhoods. Residing in a higher quality
neighborhood may increase the families financial burden resulting in mothers needing to be
employed outside of the home. The increased financial demands and commitments outside of
the home may increase mothers risk of depression in turn accounting completely for the
influence of income on maternal sensitivity.
In low neighborhood quality, the direct association between income and sensitivity, after
accounting for incomes indirect effect, may represent left-over variance not accounted for by the
71
influence of income on maternal depression. This variance may be explained by low income
mothers beliefs and values regarding parenting. For example, low income mothers have been
shown to hold more authoritarian beliefs regarding parenting than higher income mothers
(Martini, Root & Jenkins, 2004; Dodge, Petit, & Bates, 1994). These beliefs in turn reduce
maternal responsivity (Maccoby & Martin, 1983).
Several limitations of the study are noteworthy. First, the findings illustrate only
correlational processes not causal, as the data were cross-sectional. Second, mothers provided
retrospective reports on their experiences of early adversity. Although retrospective accounts
may be biased due to recall limitations, the present measure of early adversity includes recall of
concrete events only in order to lessen bias. Recall of concrete experiences in childhood, such as
the experience of physical abuse, are remembered with less bias than recall of subjective
experiences such as reports of relationship quality (Prescott, Bank, & Reid, 2000). The exclusion
of families with infants born weighing less than 1500 gm may have favored the participation of
families from a higher socio-economic standing as birth weight is correlated with family socio-
economic status (SES; Crooks, 1995); this may limit the generalizability of the studys findings
to families of lower SES. Last, findings of moderated-mediation may represent selection
processes whereby mothers difficult childhood, depression and low family economic standing
may have constrained mothers to reside in poor quality neighborhoods while mothers with less
adverse histories and better economic circumstances supported their selection of a higher quality
neighborhood. It is noteworthy that neighborhood characteristics have been shown to influence
parental functioning even after accounting for the influence of selection factors (i.e. individual
characteristics such as depression; Ross, 2000). Strengths of the study include observed, multi-
method (Q-Sort and rating scales) measurement of maternal behavior and the neighborhood
72
(observations and census tract data), and the use of latent variables with multiple indicators in
Structural Equation Modeling which account for systematic and unsystematic measurement error
(Coffman & MacCallum, 2005).
Implications
The direct association between family income and sensitivity suggest that it is not enough
to consider the stress impact of low family income on parenting quality. Socioeconomic related
differences in parental beliefs, values and attitudes regarding childrearing may also explain
additional variance in maternal sensitivity; hence these factors should be considered when
aiming to improve parenting quality. Results from the moderated mediation analyses indicate
that neighborhood quality can buffer mothers from the effects of early adversity. The measure of
neighborhood employed in the present study examined objective aspects of the neighborhood
including evidence of loitering, crime, poverty and disorder. This suggests that maternal
sensitivity is also influence by factors that are distal to the mother and that interact with more
proximal influences (e.g. developmental history). Programs geared at creating safe communities
may assist mothers, especially those with a difficult background, in providing sensitive care to
their children. The finding that maternal depression operated completely through mothers
appraisal of infant temperament suggests that treatment programs should be mindful of mothers
cognitions about their child.


73
Study 2: Maternal Sensitivity, Early Adversity and the Arginine
Vasopressin 1a Receptor Gene (AVPR1A)
Introduction

Although much is known about the genetic underpinnings of animal parenting behavior
(e.g. see Perrigo, Belvin, Quindry, & Kadir, 1993) much less is known about the genetics of
human maternal behavior. The few existent studies suggest that genetics are indeed an important
source of influence. For instance, Spinath and O'Connor (2003) using a sample of 300 twin pairs
concordant for having children, found evidence of moderate genetic influence for over-
protectiveness, supportive/indulgent, and authoritarian parenting. Likewise, Losoya, Callor,
Rowe, and Goldsmith (1997) reported evidence of moderate genetic influence on
positive/supportive parenting. Furthermore, Kendler (1996) and Perusse, Neale, Heath, and
Eaves (1994) found that monozygotic twins parent more similarly than dizygotic twins, with
heritability estimates of approximately 38% for the provision of maternal warmth (Kendler,
1996).
There are discrepant findings however with regards to which dimensions of parenting are
influenced by genetics. For instance, Spinath and OConnor (2003) found that rejecting
parenting was attributable only to environmental factors. Likewise, Kendler (1996) found that
protective and authoritarian parenting was attributable only to environmental influence. In
contrast however, Perusse, Neale, Heath and Eaves (1994) found evidence of genetic influence
on all dimensions of parenting as measured by a shortened version of the Parental Bonding
Instrument (Parker, 1989) which assesses retrospective recall of how one was parented. Some of
74
these discrepancies are associated with differences in the methodology and informants employed
across studies (see Kendler, 1996).
To-date, no behavioral genetic studies have examined the influence of genetics on
maternal sensitivity. However, two molecular genetic studies have examined relations between
four genes and maternal sensitivity. In the first study, van Ijzendoorn, Bakermans-Kranenburg
and Mesman (2008) examined the association between maternal sensitivity and two dopamine-
related genes (Dopamine D4 Receptor (DRD4) and Catechol-O-Methyltransferase (COMT). No
association was found between maternal sensitivity and any of the COMT and DRD4 genotypes.
However, the authors found that mothers genotype moderated the effect of experience of stress
(daily hassles) on maternal sensitivity. The experience of daily hassles was associated with
lower maternal sensitivity in mothers with the combination of alleles COMT-val and DRD4-7R.
This combination of genes is hypothesized to lead to less efficient dopaminergic system
functioning. The highest level of maternal sensitivity was found among mothers with the same
combination of alleles but who experienced low levels of daily hassles. Thus the combination of
genes COMT-val and DRD4-7R increased mothers reactivity to both high and low stress
conditions. No association was found between daily hassles and sensitivity in mothers carriers
of different allele combinations.
In the second study, Bakermans-Kranenburg and van Ijzendoorn (2008) examined the
association between maternal sensitivity and the serotonin transporter (5-HTT) and oxytocin
receptor (OXTR) genes in a sample of 159 mother-child dyads. Lower sensitivity was observed
in mothers who were homozygous for the 5-HTT short alleles and for the OXTR G allele, versus
mothers with other genotypes. The short/short 5-HTT and the homozygous G/G OXTR
75
genotypes are hypothesized to correlate with less efficient serotonergic and oxytocin system
functioning (Bakermans-Kranenburg & van Ijzendoorn, 2008).
An additional gene that has been found to relate to parenting in animal research is the
Arginine Vasopressin 1a receptor gene (AVPR1A). Animal research provides strong evidence
that this gene is involved in parenting, as discuss below, yet to-date no study has examined its
possible association with human maternal behavior.
Relationship between AVPR1A and maternal behavior.
The neuropeptide arginine vasopressin (AVP) plays a role in social behavior (Kim, et al.,
2002) including maternal behavior (e.g. see Neumann, 2003). This peptide is largely synthesized
in the paraventricular and supraoptic nucleus of the hypothalamus (Wang, Liu, Young, & Insel,
2000) and acts through 3 distinct receptors (V1a, V1b and receptor 2) but with predominant
activity through the V1a receptors (Kim, et al., 2002; Young, 1999). Several lines of research
indicate that the vasopressin system contributes to maternal behavior. The vasopressin system is
activated around parturition and in lactation (for a review see Neumann, 2003). Central
administration of vasopressin induces maternal behavior in rats while vasopressin antagonist
suppresses the behavior (Pedersen, Caldwell, Walker, Ayers, & Mason, 1994). Recently Bosch
& Neumann (2008) found that these effects of central administration of vasopressin are mediated
by the V1a receptors and not due to the action of the closely related oxytocin receptors, as
previously suggested (Pedersen, et al., 1994).
The strongest evidence for the relationship between the vasopressin system and maternal
behavior comes from comparative studies of two arvicoline rodents: the prairie and montane
voles. These rodents differ in their organization of social behavior. The prairie vole is
monogamous, biparental and highly social, while the montane voles are promiscuous, minimally
76
social and solely maternal. The behavioral effects of central administration of vasopressin differ
significantly between the two types of voles, such that vasopressin administration stimulates
affiliative behavior in the prairie but not in the montane voles (Kendler & Greenspan, 2006).
Also, the distribution of the V1a receptors between the montane and prairie voles is almost non-
overlapping with the prairie vole showing higher density of receptors in reward pathways than
the montane voles (Insel, Wang, & Ferris, 1994). The dissimilarity in the V1a receptor binding
patterns is primarily due to differences in gene expression (Insel, et al., 1994). Despite these
differences, the AVPR1A receptor genes of the two voles are almost identical but with one
notable difference: the AVPR1A receptor gene of the monogamous, biparental prairie voles
shows an additional segment of DNA (microsatellite) in the promoter region of the gene (region
where transcription occurs); this additional segment has been shown to regulate gene expression
(Hammock, Lim, Nair, & Young, 2005).
Although humans do not have repeated sequences of DNA that are homologous to those
of the prairie voles other variants have been identified in humans in similar area of the gene as
the prairie voles. These markers include rs1042615, rs7298346 and RS3 and will be the focus of
the present study. Figure 7 displays the location of these variants on the AVPR1A gene. To the
best knowledge of the research has not yet examined whether human social behavior relates to
variants rs1042615 and rs7298346. rs7298346 is located upstream of the transcription start site,
while rs1042615 is located in exon 1. A few studies have shown relations between the
microsatellite RS3 and human social behaviors. The RS3 is a complex repeat of (CT)
4
-TT-
(CT)
8
-(GT)
n
325bp (base pairs) upstream of the transcription site with 16 different alleles in the
population. Walum et al., (2008) found that homozygosity for the RS3 allele 334 was found to
double the risk of marital crisis (as reported by spouse), threat of divorce and lower scores on
77
mens self-report of partner bonding compared those who carried no 334 allele. Likewise, there
is strong evidence of overtransmission in autism of the 334 and 340 alleles (Kim, et al., 2002).
Autism is also associated with variation in RS1 and RS3 microsatellite (Yirmia, Rosenberg,
Levi, Salomon, et al., 2006). These findings suggest that the associations between the AVPR1A
gene and animals social behaviors may generalize to humans with the RS3 alleles 334 and 340
conferring risk with respect to social behaviors. Given these findings it was hypothesized that
alleles 334 and 340 would relate to lower maternal sensitivity. Longer repeats (including alleles
334 and 340) of the RS3 microsatellite have also been shown to relate to overactivation of the
amygdala in response to fearful/angry face stimuli (Meyer-Lindenberg, et al., 2008). This further
supports the suggestion that variation in AVPR1A gene may relate to the organization of social
behaviors in humans. Hence, the association between maternal sensitivity and RS3 length was
also examined. It is noteworthy that Knafo et al. (2008) found that short alleles (308-325 bp)
conferred risk to altruistic behavior rather than long alleles (327 to 342 bp) but this latter study
has not been replicated.

Figure 7. Location of the RS3 microsatellite, rs7298346 and rs1042615 on the AVPR1A gene.



The variant rs1042615 was selected for study as the polymorphism tags for (or is
representative of) all other haplotypes on the gene. Haplotypes are combination of alleles at
particular locations on a chromosome that are transmitted together. Since the AVPR1A is a
highly conserved gene with most of its content showing high linkage disequilibrium (non-
78
random recombination of alleles and subsequent biased transmission of the combinations;
International Hapmap Project: Annotate Phased Haplotype Display), the inclusion of this variant
in the study increases confidence that most of the polymorphic content of the gene will be
accounted for. To the best knowledge of the author, research has not examined whether this
polymorphism relates to human social behavior. Given the lack of published empirical work on
this variant, no a priori hypotheses were specified with regards to which alleles and genotypes
might relate to maternal sensitivity.
Hence, the studys first objective was to examine whether maternal sensitivity is related
to variants of the AVPR1A gene. Furthermore, given several lines of evidence which suggest that
the AVPR1A gene might also relate to differential reactivity to environmental stress, the second
objective of the proposed study was to examine whether mothers AVPR1A genotype moderates
the effect of early adversity on mothers sensitivity.
AVPR1A and stress regulation.
Several lines of research suggest that variation in the AVPR1A gene may be associated
with individuals regulation of emotion and response to stress. Vasopressin and corticotrophin-
releasing hormone (CRH) are the primary hormones involved in the activation of the
hypothalamic-pituitary adrenal (HPA) axis, the neuroendocrine system mainly involved in stress
and emotion regulation. Dysregulation of the HPA axis has been associated with mood disorders
(Spencer & Hutchison, 1999). Likewise, variations in AVPR1A expression levels in the brain are
related to anxiety in mice (Murgatroyd, et al., 2004) and the prairie vole (Hammock, et al.,
2005). Positive correlations have been reported between variation in the AVPR1A gene and
AVPR1A gene expression in several areas of the hypothalamus and other areas of the limbic
system (Bosch & Neumann, 2008). Variation in the AVPR1A is also related to overactivation of
79
the amygdala in response to fearful face stimuli (Meyer-Lindenberg, et al., 2008). Given
vasopressins role in the activation of the HPA axis and that this peptide predominantly acts
through the V1a and receptors in the brain (Kim, et al., 2002) which are located throughout the
limbic system (Ebstein, et al., 2009) it has been suggested that variations in the AVPR1A gene
might relate to individuals stress reactivity (Ebstein, et al., 2009).
Hence, the second objective of the present study was to examine whether mothers
AVPR1A genotype moderates the relationship between mothers early adversity and maternal
sensitivity. Herein, the construct mothers early adversity is operationalized as a cumulative risk
score of various unfavorable conditions mothers experienced during childhood. A cumulative
score was used given evidence that single risk factors do not represent individuals experiences
adequately as risks cluster together. For example, Dong et al. (2004) demonstrated a high level of
interrelatedness among adverse childhood experiences (i.e. abuse, poverty, and parental mental
health and alcohol problems). Exposure to one risk such as parental alcohol abuse is associated
with an increased likelihood of exposure to other adverse events. Based on these findings it is
has been suggested that studies interested in the effects of early adversity on subsequent
functioning include measures of multiple adverse events as opposed to focusing on single
experiences (Dong, et al., 2004). This recommendation is consistent with studies examining the
impact of cumulative risks on mental health. The number of risks, rather than the nature of a
specific risk, is negatively associated with well-being including parenting (Dong, et al., 2004;
Masten, 2006; Rutter, 1979; Sameroff, 2000).
The risk factors included in the cumulative early adversity score have all been shown to
be associated with adult well-being; these include having been raised by a mother with low
education, who was a teen at the time of the first child, having experienced multiple parental
80
transitions, having experienced physical and sexual abuse, having witnessed physical and/or
verbal abuse, having been raised by parents who had problems with substance abuse (i.e. drugs
and alcohol) and mental health (e.g. see Dong, et al., 2004).
Since the present study is the first to examine the possible association between AVPR1A
gene and stress reactivity, no a priori hypotheses were specified on which AVPR1A genotypes
might moderate mothers response to early adversity. However, moderation was examined only
with regards to AVPR1A variants that showed relations to sensitivity. Analyses were performed
by covarying the influence of correlates of maternal sensitivity including maternal depression
(NICHD, 1999) and marital conflict (Grych, 2002).
Since allele frequencies differ across ethnicity (personal communication, Dr. Barr, 2009),
these frequencies were first examined. Ethnic groups that showed differences in allele
frequencies were omitted from the analyses to reduce the probability of confounding possible
genetic effects from cultural differences in parenting practices.
Method

The sample was drawn from wave two of the full sample of the Kids, Families and Places
Study which is an ongoing prospective study of newborns, older siblings and their families in
Toronto and Hamilton area. A total of 668 families with a newborn and an older sibling were
enlisted through the Public Health Units at wave one. Families were enlisted in the study if the
newborn was full term, the mother spoke enough English to engage in a conversation, and the
family had at least one other child under 16-years of age. A sub-sample of 501 families was
enlisted if they had a newborn and at least one child under the age of 4-years old (sibling). The
501 families were more intensively investigated including observations in the home of parents
81
and children, direct testing of children and DNA to allow for the investigation of broader
questions.
Of the 501 families, 397 participated in wave two of the study, of these 347 provided
cheek swabs for DNA extraction. Eight families subsequently dropped out of the study reducing
the sample to 339. For two families, the genetic material could not be matched to their
identifying information further reducing the available genetic sample to 337.
All of the participants were English speaking. The sample was representative of the
Toronto population with respect to race. Mothers were primarily Caucasian (66%), while 12%
were South Asian, 11% were Southeast Asian, and 5% of mothers endorsed Black as their race.
Likewise, Census data indicate that 57% of the population in 2006 was Caucasian, 13.5% were
South Asian, 14% were South East Asian, and 7% were Black (Statistics Canada, 2007). The
sample was higher in education and family income. For example, the sample median family
income was $85 000.00 to $95 000.00 while the Census 2006 data for Toronto indicated a
median income of $45 350.00.
Procedures.
Trained interviewers visited each familys residence for approximately two hours.
During the visit, mothers completed various standardized questionnaires, including
questionnaires that assessed their childhood experience and psychosocial functioning of their
parents. Mothers were videotaped interacting individually with their 18 month old child and at
least one of the infants sibling; mothers interacted individually with their children for 15
minutes. The interaction was divided in three segments, the first five minutes mothers and child
interacted without the use of a toy, then mothers engaged their child with a challenging task
which consisted of the child drawing a pattern from a spiral book. The last five-minute segment
82
involved mothers first reading a story to their child and then asking their child to give a brief
summary of the story.
Measures.
Genotyping. The markers rs10422615 and rs7298346 were found by searching for
confirmed polymorphisms in public databases (ABI database and the NCBI SNP database
(http://www.ncbi.nlm.nih.gov/SNP) and for pre-designed assays from Applied Biosystems (ABI,
Foster City, CA, USA, Assay-on-Demand by Applied Biosystems

). These markers were


genotyped with the ABI 7900-HT Sequence Detection System

(Applied Biosystems) using the


TaqMan 5 nuclease assay for allelic discrimination. Reference sequences for Assays-on-
Demand by Applied Biosystems

are shown in Table 16. The PCR reactions (10 l volume)


contained 30 ng of genomic DNA, 10 mol of TaqMan

Universal PCR Master Mix (Applied


Biosystems), and 0.25 l of allelic discrimination mix (Applied Biosystems) containing 36 M
of each primer and 8 M of each probe. The thermal cycling conditions were 50C for 2 min,
95C for 10 min, followed by 40 cycles of 94C for 15 sec and the annealing temperature of
60C for 1 min. Each 96 well plate contained two negative controls. Plates were then read on
the ABI 7900HT Sequence Detection System (SDS) using the allelic discrimination end-point
analysis mode of SDS software package version 2.0 (Applied Biosystems).
For the marker rs10422615, mothers homozygous for the A allele were assigned a value
of 1 on the respective genotype variable (A/A), while mothers heterozygous for allele A were
given a value of 2 (A/G) and those homozygous for the G allele were given a value of 3 (G/G).
Similar procedures were implemented for the marker rs7298346. Dichotomous codes to
represent each genotype were also created for use in the hierarchical regression. A total of six
83
codes were constructed, three for each marker. On each code, mothers were assigned a value of
1 or 0 depending on their genotype (i.e. value 1 if genotype was AA and 0 for A/G and G/G etc).
The RS3 microsatellite was amplified with primers: CCTGTAGAGATGTAAGTGCT
(forward) and TCTGGAAGAGACTTAGATGG (reverse) and genotyped using the Applied
Biosystems AB3730 DNA Analyzer. The alleles are separated within the AB3730 capillaries
based on allele length, and detected by the fluorescent label. The allele length is then delineated
by comparison with standards of known length. Genotyping results were analyzed using the
GeneMapper software (Applied Biosystems).
Similar to Knafo and colleagues (2008), mothers were categorized into three groups
based on whether they had one or two copies of the long alleles (328-346 bp) or two copies of
the short alleles (310-326 bp). Knafo et al., (2008) examined the association between RS3 length
and post-mortem hippocampal mRNA levels. The authors found an association between RS3
length and hippocampal mRNA levels, with long alleles being associated with higher AVPR1A
hippocampal mRNA levels. This suggests that long RS3 variants relate to gene expression.
Mothers homozygous for the short alleles were categorized as short/short by assigning them a
value of 1, while mothers heterozygous for the long alleles were given a value of 2 for short/long
and a value of 3 was assigned to mothers with two copies of the long alleles (long/long). Three
dichotomous codes were also created for use in the hierarchical regression. For each code,
mothers were assigned a value of 1 or 0 depending on their genotype (i.e. value of 1 for
long/long genotype and value 0 for long/short and short/short, etc). None of the markers
genotyped deviated from the Hardy-Weinberg equilibrium.
Ethnicity. Mothers reported on their ethnicity by answering the following question
derived from Statistics Canada How would you describe your race or colour? Dichotomous
84
variables were constructed by assigning mothers from the following ethnic backgrounds a value
of 0 or 1 depending on their ethnic origin: European (includes White), South Asian (includes
East Indian, Pakistani, Punjabi and Sri Lanken) Black (includes e.g. African, Haitian, Jamaican,
Somali) and East and South Asian (Chinese, Filipino, Indonesian, Viatnemese, Japanese, and
Korean). This variable was drawn from wave one data.

8
5
T
a
b
l
e

1
6
.


P
r
i
m
e
r

a
n
d

p
r
o
b
e

s
e
q
u
e
n
c
e
s

a
n
d

a
n
n
e
a
l
i
n
g

t
e
m
p
e
r
a
t
u
r
e
s
.

M
a
r
k
e
r

D
N
A

V
a
r
i
a
n
t

F
l
a
n
k
i
n
g

S
e
q
u
e
n
c
e

A
n
n
e
a
l
i
n
g

T
e
m
p
.

r
s
1
0
4
2
6
1
5

(
C
_
_
_
8
9
1
6
7
3
3
_
2
0
)

A
G

T
G
A
C
T
A
C
C
A
G
C
A
T
G
T
A
G
G
C
C
G
A
C
G
C
[
A
/
G
]
A
A
C
A
T
G
C
C
G
A
A
C
A
C
C
T
G
C
A
G
G
T
G
C
T

6
0

C


r
s
7
2
9
8
3
4
6

(
C
_
_
2
9
3
0
3
4
5
5
_
1
0
)

A
G

A
T
T
T
G
T
C
T
C
T
T
A
T
C
T
A
C
C
T
A
T
G
A
C
C
[
A
/
T
]
G
A
A
A
C
C
T
C
C
C
G
C
T
T
C
G
A
G
T
T
G
T
C
C
C

6
0

C


86
Cumulative Early Adversity: Variables consisting of the cumulative early adversity index
were drawn from the completed wave one data. Wave 1 data from the Kids, Families and Places
study were imputed using the PROC MI statement in SAS. Missing data on these variables were
imputed using multiple imputation. As described by Rubin (1996), the first step of multiple
imputation involves identifying all of the missing observations within a data set and then
generating a set of plausible values that can be used to replace the missing observations. This
step is then repeated multiple times to generate several complete data sets resulting in a more
accurate approximation of the parameter estimates and standard errors by accounting for
uncertainty regarding the accuracy of a single imputation (for a more detailed description of
these procedures see Allison, 2002; Horton & Kleinman, 2007; Horton & Lipsitz, 2001). This
resulted in five datasets with the imputed values. Variable comprising the cumulative early
adversity score were averaged across the five imputed data sets.
A cumulative indicator was created by summing mothers scores on the following risk
factors . Mothers were assigned a value of 1 on each variable if they experienced the respective
risk or 0 for no experience. Detailed description of the measures is provided in study 1.
1. Mothers mother had less than grade 8 education. Mothers reported on the level of
educational attainment of their own mother by answering six questions drawn from the
Ontario Child Health Study (Boyle, Offord, Racine, Sanford, et al., 1993).
2. Mothers mother was a teenager at time of first child. Mothers reported on the age of
their mother when the first child was born (source: Ontario Child Health Study; Boyle,
Offord, Racine, Sanford, et al., 1993). A code was created by assigning mothers a value
of 1 if their mother was under the age of 20, and a value of 0 if their mother was older
than 20-years of age.

87

3. Having been raised by one or both parents who suffered from mental illness, drug and/or
alcohol abuse (source: Ontario Child Health Study; Boyle, Offord, Racine, Sanford, et al.,
1993). Mothers reported on the presence of mental health disturbance and drug
and/alcohol abuse in their mother and father. As described in study 1, the possible scores
ranged from 0 to 6.
4. Having experienced physical and/or sexual abuse. Mothers reported on whether they
were ever sexually and/or physically abused during childhood. The possible score ranged
from 0 to 2 with 0 representing no experience of abuse, 1 representing either physical or
sexual abuse, and 2 indicating the experience of both physical and sexual abuse.
5. Having witnessed verbal and/or physical abuse. Mothers reported on whether they ever
witnessed verbal and/or physical abuse by answering two questions drawn from the
Ontario Child Health Study (Boyle, Offord, Racine, Sanford, et al., 1993):. Mothers were
assigned a value of 0 if they reported never witnessing verbal and/or physical abuse,
while a value of 1 was assigned to mothers with history of witnessing verbal and/or
physical abuse. Possible scores range from 0 to 2.

As described in study 1, since fewer than 3% of the sample endorsed 7 or more early
adversity risks, the variable was recoded so that risk levels 6 through 9 were recoded to 5 or
more risks.
Marital conflict. At wave two, mothers reported on the frequency and severity of
marital conflict with their spouse by answering two questions assessing minor and major
disagreements, drawn from Kerig (1996). As suggested by Kerig (1996) answers to the

88
question assessing major disagreements were weighted by multiplying the answer by a value
of two. The scores were then summed to create a total marital conflict frequency score;
higher numbers indicate greater frequency and severity of marital conflict.
Maternal depression. At wave two, mothers completed the Center for Epidemiological
Studies Depression Scale (Radloff, 1977). Mothers answered 20 questions (e.g. item 3: I felt
that I could not shake off the blues even with help from my family or friends) with response
options that range from 0 indicating no depression to 3 indicating high levels of depression.
The scores were summed to create a final depression score with a range from 0 to 60. Higher
scores indicate greater depression.
*Maternal Sensitivity. Maternal sensitivity was assessed from the 15-mimute videotaped
mother-child interaction using the Coding of Attachment-Related Parenting (CARP; Matias,
Scott & OConnor, 2006) and the Parent-Child Interaction System (PARCHISY; Deater-
Deckard, Pylas, & Petrill, 1997). The CARP is a global measure of parent-child interaction
quality that was derived from attachment theory and related assessments in young school-aged
children (Kochanska, 1997; Kochanska & Murray, 2000; Solomon & George, 1999; Thompson
& Raikes, 2003). Level and intensity were considered in deriving a score on a 7-point Likert
scale (1 = No evidence; 7 = Pervasive/extreme evidence). The system is based on attachment-
based interaction measures in infancy and young children (Ainsworth, Blehar, Waters, & Wall,
1978). Sensitive Responding measures the degree to which the parent displays awareness of the
child's needs and shows sensitivity to his/her signals, expresses warmth/support, supports the
child's autonomy, and demonstrates an ability to see things from the child's point of view.
Mutuality is a dyadic code and is compatible with the "goal-corrected partnership" notion in
attachment in toddlers and preschool- and school-aged children (Bowlby, 1982;

89
Kochanska, 1997; Kochanska & Murray, 2000). The scales demonstrated good stability over a
one-year period, with correlation estimates of .66 and .48 for Sensitivity and Mutuality,
respectively (Matias, 2006). Scores on the sensitive responding and mutuality scales have been
found to predict children's attachment narrative style as rated from a standard story stem
assessment and peer ratings of the child acceptance (Matias et al., submitted).
The PARCHISY is a global behavioural rating system that has been used widely to
examine naturalistic behaviours in a variety of populations (Brophy & Dunn, 2002; Corapci,
Radan, & Lozoff, 2006; Hughes & Ensor, 2005; Marks et al., 2006). The PARCHISY consists
of seven scales of parent behavior (positive and negative control, positive and negative affect,
responsiveness, on task behavior, and verbalisations) and seven categories of child behavior
(positive and negative affect, responsiveness, on task behavior, activity, noncompliance, and
verbalisations). For the purpose of this study only the positive control (use of praise,
explanations and open ended questions) scale was used. Assessments of mothers positive
control are associated with observed child difficult behavior (Deater-Deckard, 2000), concurrent
and future externalizing problems (Saltsman, 2008, Hughes & Ensor, 2007), and childrens
verbal ability and theory of mind (Hughes & Ensor, 2007).
For each five-minute task, coders provided ratings on a 7-point scale, with a score of one
indicating an absence of the constructs of interest (mutuality, sensitivity and positive control),
and a seven indicating an extreme amount of the constructs of interest. An expert coded 10% of
all coded data to ensure interrater reliability. When two coders were reliable with the expert,
10% of their data was compared to each other rather than to the expert. Reliability was checked
approximately every 10 families coded; discrepancies were resolved through discussion with the
ultimate decision made by the expert. For the 18-month old child, across the CARP and

90
PARCHISY scales, interrater reliability ranged from .75 to .96 with an average rating of .89; for
the older siblings interrater reliability ranged from .84 to .95 with an average rating of .89. First,
separate mean scores were computed across the three tasks on mutuality, sensitivity, and positive
control for each child. These scores were than averaged to create a final sensitivity score per
child. A family average was computed by taking the mean of the childrens total sensitivity
score.
Analysis
Missing Data.
Table 17 displays the frequency of missing data across the genetic markers and study
variables. The analyses were performed only on the families for whom genotypes were
available.
Table 17. Breakdown of available and missing data.

Variable Available N Maternal
depression
Marital
conflict
Early
adversity
Maternal
sensitivity
RS3 264 (22%) 260 (1.5%) 249 (6%) 264 (0%) 264 (0%)
rs1042615 320 (5%) 315 (4%) 301 (6%) 320 (0%) 320 (0%)
rs7298346 319 (5%) 314 (1.6%) 302 (5%) 319 (0%) 319 (0%)
Note: percentage of missing cases is indicated in brackets.

Hierarchical regression analysis.
Data were entered into separate hierarchical regressions to examine the associations
between maternal sensitivity and variation in the RS3 microsatellite and the markers rs1042625
and rs7298346. Hierarchical regression was used to (1) examine the amount of variance in

91
maternal sensitivity explained by genotype above and beyond the influence of covariates of
sensitivity (including maternal depression and marital conflict) and the experience of early
adversity, and (2) to examine the amount of variance explained by the interaction of genotype by
early adversity, after accounting for the main effects of covariates, early adversity and genotype.
In the first step of the regressions, the dichotomous codes for mothers genotypes were
entered. In the second step, covariates were entered to examine whether these explained
variance in sensitivity above and beyond mothers genotype. For genotypes showing
associations to sensitivity moderation was examined. First an interaction term was computed by
multiplying the variable early adversity with the respective dichotomous code representing the
genotype. This interaction term was entered in the last block of the regression.
Results
Normality.
The descriptive statistics of all study variables were examined for evidence of normality.
The distribution of the variable maternal depression showed skewness and kurtosis as indicated
by values greater than 1 on the respective statistics. The variable was transformed into its square
root. Since the results of the analysis were similar using the original versus the transformed
variable, the reported results are based on the original variable.
Marker: RS3 microsatellite.
Descriptive statistics.
In total 17 alleles were detected which is consistent with prior research (e.g. see Kim et
al., 2002). Table 18 displays the frequency of the detected alleles. Comparing the allele
frequencies in the present study with those from Kim et al., (2002) and comparing the length of
the primers used herein and in Kim et al., (2002) study it was determined that alleles 328 and 334

92
herein represent Kim et al., (2002) alleles 334 and 340, respectively. Given the low frequencies
of alleles 328 and 334, it was not possible to conduct the analyses at the allele level as the
infrequency would result in low statistical power. The low frequencies of the alleles would have
been further reduced by splitting the data set across ethnic groups. Analyses were performed at
the genotype level based on short versus long allele length; the long versus short category was
based on Knafo et al., (2008).
Table 19 displays the frequency of the RS3 genotypes across ethnicity. Mothers from
European background show the genotype long/long less frequently (34% for Europeans) than
South Asians (45%), Blacks (53%) and East/South Asian mothers (42%). As well, the
short/short genotype is observed less frequently in the South Asian and Black groups (6% and
7% respectively) than European (16%) and East/South Asian (16%). Given these differences,
the analyses were performed only on the European sample to avoid confounding possible genetic
effects with cultural differences in parenting practices.

93

Table 18. RS3 allele frequency.

Allele N Freq
310 8 0.015
316 2 0.004
318 1 0.002
320 2 0.004
322 34 0.064
324 51 0.096
326 110 0.206
328 118 0.221
330 73 0.137
332 65 0.122
334 18 0.034
336 3 0.006
338 24 0.045
340 17 0.032
342 5 0.009
344 2 0.004
346 1 0.002
Total 100




94

Table 19. RS3 genotype frequency across ethnicity.

Ethnicity Genotype Frequency Percent
1.00 European 1.00 short/short 27 16
2.00 short/long 87 50
3.00 long/long 58 34
Total 172 100.0
2.00 South Asian 1.00 short/short 2 6
2.00 short/long 17 49
3.00 long/long 15 45
Total 34 100.0
3.00 Black 1.00 short/short 1 7
2.00 short/long 6 40
3.00 long/long 8 53
Total 15 100.0
4.00 East/South Asian 1.00 short/short 5 16
2.00 short/long 13 42
3.00 long/long 13 42
Total 31 100.0
Grand total N 262*
*Note: Grand total does not equal 264 as 2 mothers identified themselves as
belonging to multiple ethnic groups.

95
Hierarchical regression analyses.
In relation to mothers homozygous for the short allele (S/S), mothers homozygous for the
long alleles (L/L) were significantly less sensitive (= -.31, p < .01, F(2, 162) = 5.08, p <.01).
No differences were found between mothers heterozygous for the long alleles (S/L) and those
homozygous for the short (S/S) alleles ( = -.10, p > .05). The long/long genotype explained
6% of the variance in sensitivity (R
2
= .06, adjusted R
2
= .05 ). The main effect of the long/long
genotype remained significant ( = -.32, p< .01) after accounting for theoretical covariates of
sensitivity including mothers depression, marital conflict and mothers early adversity. These
covariates were not significantly associated with sensitivity and did not explain additional
variance in sensitivity (R
2
change = .02, (F
change
(2, 160)=1.70, p >.05 for marital conflict and
depression, and for early adversity R
2
change = .004, (F
change
(1, 159)=0.69, p >.05) . Mothers
homozygous for the long alleles (L/L) were also significantly less sensitive than mothers
heterozygous for the long alleles (S/L), ( =-.21, p < .05, F(2, 162) = 5.08, p <.05).
Next, the moderating influence of the long/long genotype on the association between
early adversity and sensitivity was examined. Since mothers homozygous for the long alleles
were found to differ from mothers with the genotype long/short and those with the short/short,
the analysis was performed by entering only the code for the long/long genotype; hence, the
reference category is the short/long and short/short genotypes. As shown in Table 20, the
interaction term was significant and explained an additional 3% of the variance (R
2
change =
.025, (F
change
(1, 160)=4.39, p < .05). As shown in Fig. 8, in the context of low early adversity (-1
SD), mothers genotype is not related to lower sensitivity. However, in the context of high early
adversity (+1 SD) mothers homozygous for the long alleles (L/L) were less sensitive than those
with the genotype short/short and short/long. The effect size of the interaction is small

96
(calculated as f
2
= R
2

(final model)
- R
2

(model 1)
/ 1 - R
2

(final model)
= .102-.055 /1-.102 =.05) as
indicated by Cohens (1988) criteria of effect size of .02 and less than .15 indicating a small
effect.


9
7
T
a
b
l
e

2
0
.


C
o
r
r
e
l
a
t
i
o
n
s

a
m
o
n
g

s
t
u
d
y

v
a
r
i
a
b
l
e
s

a
n
d

s
u
m
m
a
r
y

o
f

h
i
e
r
a
r
c
h
i
c
a
l

r
e
g
r
e
s
s
i
o
n

a
n
a
l
y
s
i
s

e
x
a
m
i
n
i
n
g

t
h
e

m
o
d
e
r
a
t
i
o
n

o
f

R
S
3

l
e
n
g
t
h


r
e
f
e
r
e
n
c
e

c
a
t
e
g
o
r
y

i
s

s
h
o
r
t
/
l
o
n
g

a
n
d

l
o
n
g
/
l
o
n
g

g
e
n
o
t
y
p
e
s
.

V
a
r
i
a
b
l
e
s

M
a
t
e
r
n
a
l


s
e
n
s
i
t
i
v
i
t
y

(
D
V
)

R
S
3
L
L

M
a
t
e
r
n
a
l


d
e
p
r
e
s
s
i
o
n

M
a
r
i
t
a
l


c
o
n
f
l
i
c
t

E
a
r
l
y

a
d
v
e
r
s
i
t
y

b

S
E
b


s
r
2

(
i
n
c
r
e
m
e
n
t
a
l
)

R
S
3
L
L

-
.
2
4
b

-

-

-

-

-
.
3
1

.
1
0

-
.
2
3

.
0
5
5

M
a
t
e
r
n
a
l

d
e
p
r
e
s
s
i
o
n

-
.
1
2

.
1
5
*

-

-

-

-
.
0
0

.
0
1

-
.
0
3

-

M
a
r
i
t
a
l

c
o
n
f
l
i
c
t

-
.
1
3

-
.
0
3

.
2
5
b

-

-

-
.
0
7

.
0
5

-
.
1
2

.
0
1
8

E
a
r
l
y


a
d
v
e
r
s
i
t
y

-
.
1
5
a

.
0
4

.
3
6
c

.
2
5
b

-

-
.
0
4

.
0
4

-
.
0
7

.
0
0
4

E
a
r
l
y

a
d
v
e
r
s
i
t
y

X

R
S
3
L
L

-

-

-

-

-

-
.
1
7

.
0
8

-
.
3
3

.
0
2
5

M
e
a
n
s

4
.
0

-

7
.
3

2
.
6

2
.
1





S
t
a
n
d
a
r
d

d
e
v
i
a
t
i
o
n
s

.
6
3

-

6
.
3

1
.
0
4

1
.
3






R
2

=

.
1
0

a

A
d
j
u
s
t
e
d

R
2

=
.
0
7



R

=

.
3
2

a

a

p

<

.
0
5

b

p
<
.
0
1

c

p
<
.
0
0
0
1

*

p

=

.
0
6



98
Figure 8. RS3 length moderates the association between early adversity and sensitivity.













* p < .05
1
1.5
2
2.5
3
3.5
4
4.5
5
M
a
t
e
r
n
a
l

s
e
n
s
i
t
i
v
i
t
y
LL
SS/SL
LL 3.8 3.38
SS/SL 4.07 4
Low High
*
Early adversity

99
Marker: rs1042615.
Descriptive statistics.
Table 22 displays the frequency of the rs10422615 genotypes. As shown in Table 23,
notable differences in genotype frequencies are observed across ethnic groups. For example, the
genotype G/G is observed less frequently among East and South Asians (15%) relative to
Europeans (33%), South Asians (47%) and Blacks (77%). Given these differences, the analyses
were performed only on the European group to avoid confounding possible genetic effects from
cultural differences in parenting practices across the groups.

Table 22. Frequency of genotypes detected on rs10422615 marker.
Genotype N %
A/A 55 17
A/G 150 47
G/G 115 36
Total 320 100


100

Table 23. Genotype frequency of rs10422615 across ethnicity.
Ethnicity Genotype Frequency Percent
European A/A 38 18.2
A/G 102 48.8
G/G 69 33.0
Total 209 100.0
South Asian A/A 4 11.1
A/G 15 41.7
G/G 17 47.2
Total 36 100.0
Black A/G 4 23.5
G/G 13 76.5
Total 17 100.0
East/South Asian A/A 10 29.4
A/G 19 55.9
G/G 5 14.7
Total 34 100.0

Hierarchical regression analyses.
As shown in Table 24, no differences in sensitivity were found between mothers
homozygous for the G alleles (G/G) and those homozygous for the A alleles (A/A) ( = -.08, p >
.05) and mothers heterozygous for the G allele (A/G) , ( = .14, p > .05, F(2, 199)=1.61, p > .05).

101
Neither depression ( = -.08, p >.05) nor marital conflict ( = -.12, p >.05, F
change
(2,197)=2.4, p
>.05 ) were significantly associated with maternal sensitivity. Furthermore, in relation to
mothers heterozygous for the G allele (A/G), no significant differences were found between
mothers homozygous for the A allele (A/A) (= -.03, p > .05, F(2, 199)=1.61, p > .05; data not
shown in table form).


1
0
2
T
a
b
l
e

2
4
.

C
o
r
r
e
l
a
t
i
o
n
s

a
m
o
n
g

s
t
u
d
y

v
a
r
i
a
b
l
e
s

a
n
d

s
u
m
m
a
r
y

o
f

h
i
e
r
a
r
c
h
i
c
a
l

r
e
g
r
e
s
s
i
o
n

a
n
a
l
y
s
i
s

e
x
a
m
i
n
i
n
g

t
h
e

a
s
s
o
c
i
a
t
i
o
n

b
e
t
w
e
e
n

v
a
r
i
a
t
i
o
n

i
n

t
h
e

g
e
n
e

r
s
1
0
4
2
6
1
5

a
n
d

m
a
t
e
r
n
a
l

s
e
n
s
i
t
i
v
i
t
y


r
e
f
e
r
e
n
c
e

c
a
t
e
g
o
r
y

i
s

G
/
G
.

V
a
r
i
a
b
l
e
s

M
a
t
e
r
n
a
l

s
e
n
s
i
t
i
v
i
t
y

(
D
V
)

2
6
1
5
A
/
A

2
6
1
5
A
/
G

M
a
t
e
r
n
a
l

d
e
p
r
e
s
s
i
o
n

M
a
t
e
r
n
a
l

c
o
n
f
l
i
c
t

E
a
r
l
y

a
d
v
e
r
s
i
t
y

b

S
E
b


s
r
2

(
i
n
c
r
e
m
e
n
t
a
l
)

2
6
1
5
A
/
A

.
0
1






.
1
2

.
1
3

.
0
8

.
0
0
5

2
6
1
5
A
/
G

.
1
2

-
.
4
6
c





.
1
7

.
1
0

.
1
3

.
0
1

M
a
t
e
r
n
a
l

d
e
p
r
e
s
s
i
o
n

-
.
1
3

-
.
0
2

-
.
0
6




-
.
0
1

.
0
0
8

-
.
0
6

.
0
0
3

M
a
r
i
t
a
l

c
o
n
f
l
i
c
t

-
.
1
4
*

.
0
5

-
.
0
5

.
2
4
b



-
.
0
7

.
0
5

-
.
1
1

.
0
1

M
o
t
h
e
r
s


e
a
r
l
y

a
d
v
e
r
s
i
t
y

-
.
1
4
a

.
0
4

-
.
0
5

.
3
6
c

.
2
3
c


-
.
0
3

.
0
4

-
.
0
6

.
0
0
3

M
e
a
n
s

3
.
9

-

-

6
.
9

2
.
6

2
.
1





S
t
a
n
d
a
r
d

d
e
v
i
a
t
i
o
n
s

.
6
3



6
.
0
8

1
.
0
3

1
.
3





R
2

=

.
0
4

A
d
j
u
s
t
e
d

R
2

=

.
0
2

R

=

.
2
0

a

p

<

.
0
5

b

p
<
.
0
1

c

p
<
.
0
0
0
1

*

p

=

.
0
5



103
Marker: rs7298346.
Descriptive statistics.
Table 25 displays the frequency of the rs7298346 genotypes. As shown in Table 26,
notable differences in genotype frequencies are observed across ethnic groups. For example,
relative to Blacks, the genotype A/A is observed less frequently among East and South Asians
(0%), South Asians (7.5%) and Europeans (2%). The genotype T/T is observed more frequently
among Europeans (77%) and East/South Asian (74%) relative to Blacks (37.5%) and South
Asians (52.5%). Given these differences, it was not possible to conduct the analyses across the
entire sample (irrespective of ethnicity) as this may have resulted in confounding possible
genetic effects from cultural differences in parenting practices across the groups. As well, since
the genotype A/A was detected in only 2% of the European sample it was also not possible to
compare levels of maternal sensitivity as a function of genotype. No further analyses with this
variant were conducted.

Table 25. Frequency of genotypes detected on rs7298346 marker.
rs7298346
Genotype N %
A/A 11 3
A/T 79 25
T/T 229 72
Total 319 100


104

Table 26. Genotype frequency of rs7298346 across ethnicity.
Ethnicity Genotype Frequency Percent
European A/A 4 2.0
A/T 43 21.0
T/T 158 77.0
Total 205 100.0
South Asian A/A 3 7.5
A/T 16 40.0
T/T 21 52.5
Total 40 100.0
Black A/A 4 25.0
A/T 6 37.5
T/T 6 37.5
Total 14 100.0
East/South Asian A/A 0 0
A/T 9 26.0
T/T 26 74.0
Total 35 100.0


105
Discussion

Results of this study suggest that variation in the AVPR1A gene relates to maternal
sensitivity and stress reactivity. Mothers homozygous for the long alleles of the RS3
microsatellite were rated by observers as significantly less sensitive than mothers homozygous
for the short alleles and those heterozygous for the long alleles. Previous studies have
documented biased transmission in Autism of allele 334 and 340 herein defined as long alleles
based on Knafo et al., (2008). These findings suggest that variation in RS3 length may be
associated with individuals ability to read and correctly interpret social and emotional cues and
to empathize with others. Remarkable impairments in these abilities are the hallmark feature of
Autism disorders. These abilities also constitute the foundation of maternal sensitivity, in this
study defined as mothers awareness and ability to correctly interpret subtle infants signals and
the prompt contingent response to infants cues. However, the mechanisms through which
variation in RS3 length relates to Autism and maternal sensitivity are unknown. Amygdala
activation has been proposed as a neural circuit possibly mediating the associations between
variation AVPR1A and the range of human social behavior afore-stated.
In humans, the peptide arginine vasopressin (AVP) binds to receptors located in the
amygdala (Whalen, Rauch, Etcoff, McInerney, Lee, Jenike, 1998). Lesions to the amygdala are
associated with social disinhibition (Adolphs, Gosselin, Buchanan, Tranel, Schyns, & Damaiso,
2005). Aggression is related to decreased amygdala activation, while increased activation is
related to social avoidance and phobia (Stein, Goldin, Sareen, Zorilla, & Brown, 2002). Fearful
stimuli strongly activate the amygdala, and lesions to the amygdala are associated with
impairments in recognition of fearful faces and social disinhibition (Adolphs, Gosselin,

106
Buchanan, Tranel, Schyns, & Damaiso, 2005). Individuals with Autism show impairments in
amygdala function (Dalton, Nacewicz, Johnstone Schaefer, Gernsbacher, Goldsmith, et al.,
2005). In healthy persons, longer repeats of the RS3 microsatellite relate to overactivation of the
amygdala in response to fearful/angry face stimuli (Meyer-Lindenberg, et al., 2008) These latter
findings coupled with the overtransmission of alleles 334 and 340 in Autism (Kim, 2002) herein
defined as long alleles, and the associations between Autism and RS3 microsatellite (Yirmia,
Rosenberg, Levi, Salomon, Shulman, Nemanov, L. et al., 2006) provide convergent evidence
that variation in the RS3 microsatellite may represent a diathesis for the organization of social
behavior and stress reactivity in humans.
The diathesis-stress model (Clark, Beck & Brown, 1992; Phelps, Belsky, & Crnic, 1998)
posits that negative outcomes result from the activation of an underlying diathesis by an
environmental insult. In the absence of the environmental insult the diathesis is not activated
bearing no consequences to the individuals functioning. In mice, chronic stress is associated
with increased expression of the peptide arginine vasopressin (AVP) and corticotrophin-releasing
hormone (CRH) (Merali, Hayley, McIntosh, Bdard, & Anistman, 2009) with the increased
expression showing endurance over time (Merali, Hayley, McIntosh, Bdard, & Anistman,
2009). Since AVP and CRH are the primary hormones involved in the activation of the
hypothalamic-pituitary adrenal (HPA) axis, it has been suggested that the increased expression of
these hormones may result in an heightened HPA response to subsequent demands (Merali et al.,
2009). In humans, longer repeats of the RS3 microsatellite are associated with higher
hippocampal mRNA levels (Knafo et al., 2008) suggesting an heightened expression of AVP.
The significant interaction found in this study between homozygosity for the long RS3
repeats and mothers early adversity is consistent with a diathesis-stress process. The lowest

107
levels of maternal sensitivity were found among mothers who experienced high levels of early
adversity and who carried the long/long RS3 genotype, relative to mothers with the short/short
and short/long genotype. In the context of low early adversity, no differences in maternal
sensitivity were found as a function of mothers genotype. Hence, length of RS3 bears
consequence to maternal sensitivity only in the context of high early adversity. Among mothers
who experienced high early adversity and who carry the long/long genotype, maternal
insensitivity may come about as a result of heightened level of stress reactivity which may
compromise mothers ability to successfully understand and meet the infants needs. Mothers
sensitivity may be further compromised by the possible difficulties in correctly interpreting the
infants cues, as suggested by the overtransmission of alleles 334 and 340 in Autism (Kim, 2002)
and impairments in correctly interpreting facial emotion associated with amygdala functioning
(Adolphs, Gosselin, Buchanan, Tranel, Schyns, & Damaiso, 2005).
Last, the study also examined whether variations in maternal sensitivity related to the
variant rs1042615. No associations were found. A trend toward statistical significance was
noted for less sensitivity among mothers homozygous for the G allele of the marker rs1042615,
relative to mothers with the genotype A/G and A/A. Given that single genes typically explain
less than 1% of the variance in human functioning (Ebstein, 2006), perhaps the study lacked
adequate statistical power to detect such small effects. A similar limitation is noteworthy for the
interaction between early adversity and homozygosity for the long alleles on the RS3. The effect
of this interaction is small (f
2
= .05) with the associated p value just at significance level. Last,
since the analyses were performed only on Europeans participants it is unknown whether the
results generalize to other ethnic populations. Splitting the sample across ethnic groups was not
possible given the small number of participants across ethnicity.

108
Strengths of the study include maternal behavior that was observed across reliable coders.
Maternal behavior was coded from naturalistic interactions using a normative sample, increasing
generalizability of results to normative patterns of mother-child interactions.
The measure of early adversity was based on mothers retrospective reports of their experiences
of early adversity. Although retrospective accounts may be biased due to recall limitations, the
present measure includes recall of concrete events only. Recall of concrete experiences in
childhood, such as the experience of physical abuse, are remembered with less bias than recall of
subjective experiences such as reports of relationship quality (Prescott, Bank, & Reid, 2000).
Last, the inclusion of three AVPR1A markers accounted for most of the variation of this small but
highly conserved gene.
The study results suggest that interventions aimed at improving mothers sensitivity
should be mindful of mothers ability to cope with stress and daily demands of child rearing.
Higher sensitivity is indeed associated with availability of support in mothers lives. In addition
to providing supports and/or in the context where such supports are lacking, such as the case
with new immigrants, interventions should also focus on providing mothers with adequate
coping skills to reduce the possible heightened state of stress reactivity. Last, given the
associations between variation in the AVPR1A, Autism and the ability to correctly decipher
emotions from faces, interventions should also be mindful of mothers capacity to correctly
identify the infants state and ability to choose a sensitive response strategy.

109
General discussion
The purpose of the present studies was to identify the underlying mechanisms that
explain how mothers early adversity relates to subsequent maternal sensitivity. Results from
these studies indicate that both proximal and distal factors are important source of influence and
that maternal sensitivity is determined by the interplay of these multiples factors. Proximal
mechanisms include mothers depression and their appraisal of their infant behavior. These two
mechanisms accounted for the association between early adversity and maternal sensitivity.
However, this relationship was not straightforward as shown by results of the moderated
mediation analyses. Quality of the neighborhood is a distal factor that was found to moderate the
influence of early adversity on maternal depression. High quality neighborhood protected
mothers from the influence of early adversity on maternal depression while a low quality
neighborhood exacerbated this association. These findings indicate that although early adversity
increases the risk of maternal depression thereby compromising maternal sensitivity, aspects of
the ecology in which mothers reside must also be considered when assessing the influence of
early adversity on subsequent maternal functioning. The implication of these findings is that
programs geared at prevention of compromised functioning across the life course should not only
consider the individual but also the wider ecology such as the neighborhood quality.
Results from study 1 also suggest that family income is also a very important source of
influence for maternal sensitivity. Some of this influence is accounted by the increased stress
that mothers from low income families feel resulting in increased feelings of depression and
more negative appraisals of infant temperament. However, family income also exerted a direct
influence on maternal sensitivity after accounting for the above-stated stress process. This
suggests that familys financial stress does not fully account for socioeconomic status (SES)

110
related differences in parenting practices. Parental beliefs, values and attitudes regarding child
rearing may be underlying factors of the direct relationship between family income and maternal
sensitivity. These possible influences should be better represented in theories on determinants of
parenting and parenting research.
A second proximal influence includes mothers genotype. Mothers homozygous for the
long alleles on the RS3 microsatellite were found to show lower levels of sensitivity relative to
mothers carriers of the long/short and short/short genotype. In humans, longer repeats of the RS3
microsatellite relate to overactivation of the amygdala in response to fearful/angry face stimuli
(Meyer-Lindenberg, et al., 2008). Amygdala activation has been proposed as a neural circuit
possibly mediating the associations between variation AVPR1A and a range of human affiliative
behavior (Meyer-Lindenberg, et al., 2008) and stress reactivity (Ebstein, et al., 2009). Results
from the moderation analyses indicate that the long repeats of the RS3 microsatellite increase the
risk of reduced sensitivity only when mothers experienced high levels of early adversity. These
findings highlight the importance of considering experiential factors alongside biological
predispositions when explaining variability in maternal behavior.



111
References
Adolphs, R., Gosselin, F., Buchanan, T. W., Tranel, D., Schyns, P., & Damaiso, A. R. A. (2005).
A mechanism for impaired fear recognition after amygdala damage. Nature, 433, 68-72.
Ainsworth, M. S., Blehar, M. C., Waters, E., & Wall, S. (1978). Patterns of attachment: A
psychological study of the strange situation. Oxford, England: Lawrence Erlbaum.
Albright, M. B., & Tamis-LeMonda, C. S. (2002). Maternal depressive symptoms in relation to
dimensions of parenting in low-income mothers. Applied Developmental Science, 6(1),
24-34.
Ardelt, M. & Eccles, J., S. (2001). Effects of mothers parental efficacy beliefs and promoting
parenting strategies on inner-city youth. Journal of Family Issues, 22(8), 944-972.
Bailey, J. A., Hill, K, G., Oesterle, S., & Hawkins, D. J. (2009). Parenting practices and problem
behavior across three generations: Monitoring, harsh discipline, and drug use in the
intergenerational transmission of externalizing behavior. Developmental Psychology, 45
(5), 12141226.
Bailey, H. N., Moran, G., & Pederson, D. R. (2007). Childhood maltreatment, complex trauma
symptoms, and unresolved attachment in an at-risk sample of adolescent mothers.
Attachment & Human Development, 9, 139-161.
Bakermans-Kranenburg, M. J., & van Ijzendoorn, M. H. (2006). Gene-Environment Interaction
of the Dopamine D4 Receptor (DRD4) and Observed Maternal Insensitivity Predicting
Externalizing Behavior in Preschoolers. Developmental Psychobiology, 48, 406-406.
Bakermans-Kranenburg, M. J., & van Ijzendoorn, M. H. (2008). Oxytocin receptor (OXTR) and
serotonin transporter (5-HTT) genes associated with observed parenting. Social Cognitive
and Affective Neuroscience, 3, 128-134.

112
Bandura, A. (1997) Self-Efficacy: The Exercise of Control. W.H. Freeman, New York, NY,
USA.
Bandura, A. (1997). Self-efficacy: The exercise of control. NY: Freeman and Company.
Bandura, A., Barbaranelli, C., Caprara, G. V., & Pastorelli, C. (1996). Multifaceted impact of
self-efficacy beliefs on academic functioning. Child Development, 67, 1206-1222.
Baron, R. M., & Kenny, D. A. (1986). The moderatormediator variable distinction in social
psychological research: Conceptual, strategic, and statistical considerations. Journal of
Personality and Social Psychology,, 5, 1173-1182.
Bates, J. E., Freeland, C. A., & Lounsbury, M. L. (1979). Measurement of infant difficultness.
Child Development, 50, 794-803.
Belsky, J. (1984). The determinants of parenting: A process model. Child Development, 55(1),
83-96.
Belsky, J., & Jaffee, S. R. (2006). The multiple determinants of parenting. In D. Cicchetti & D. J.
Cohen (Eds.), Developmental Psychopathology; Volume 3: Risk, Disorder, and
Adaptation (pp. 38-85). New Jersey: John Wiley & Sons, Inc.
Benoit, D., & Parker, K. (1994). Stability and transmission of attachment across three
generations. Child Development, 65, 1444-1456.
Bifulco, A., Figueiredo, B., Guedeney, N., Gorman, L. L., Hayes, S., Muzik, M., et. al., (2004).
Maternal attachment style and depression associated with childbirth: preliminary results
from a European and US cross-cultural study. British Journal of Psychiatry, 184(46), 31-
37.

113
Bisceglia, R., Bailey, H. N., Jenkins, J., & Moran, G. (2009). Maternal Sensitivity: From Child to
the Neighborhood. A poster presented at the Society for Research in Child Development,
April 2009.
Bornstein, M. H., Tamis-LeMonda, C. S., & Haynes, O. M. (1999). First words in the second
year: Continuity, stability, and models of concurrent and predictive correspondence in
vocabulary and verbal responsiveness across age and context. Infant Behavior and
Development, 22, 65-85.
Bosch, O. J., & Neumann, I. D. (2008). Brain vasopressin is an important regulator of maternal
behavior independent of dams' trait anxiety. Proceedings of the National Academy of
Sciences of the United States of America, 105 (44), 17139-17144.
Bowlby, J. (1969). Attachment and Loss, Vol. 1: Attachment. Hogarth Press, London.
Bowlby, J. (1970). Attachment and Loss, Vol 1. Attachment. Hogarth Press, London.
Bowlby, J. (1982) Attachment and loss. Vol. I. Attachment (2
nd
ed.). New York: Basic Books.
Bowlby, J. (1988). Developmental psychiatry comes of age. American Journal of Psychiatry,
145(1), 1-10.
Bowlby, J. (1989). The role of attachment in personality development and psychopathology.
Madison, CT, US: International Universities Press, Inc.
Brennan, P. A., Le Brocque, R., & Hammen, C. (2003). Maternal Depression, Parent-Child
Relationships, and Resilient Outcomes in Adolescence, Journal of the American
Academy of Child & Adolescent Psychiatry. US: Lippincott Williams & Wilkins.
Brody, G. H., Ge, X., Conger, R., Gibbons, F. X., Murry, V. M., Gerrard, M., & Simons, R. L.
(2001). The influence of neighborhood disadvantage, collective socialization, and

114
parenting on African American childrens affiliation with deviant peers. Child
Development, 72, 12311246.
Brophy, M., Dunn, J. (2002). What did mummy say? Dyadic interaction between young hard
to manage children and their mothers. Journal of Abnormal Child Psychology, 30, 103
112.
Bronfenbrenner, U. (1979). The Ecology of Human Development: Experiments by Nature and
Design. Cambridge, MA.
Brown, G. W., & Harris, T. O. (1993). Aetiology of anxiety and depressive disorders in an inner-
city population: I. early adversity. . Psychological Medicine, 23(1), 143-154.
Brown, G. W., & Moran, P. (1994). Clinical and psychosocial origins of chronic depressive
episodes I: a community survey. British Journal of Psychiatry, 165, 447-456.
Byrne, B. M. (2001). Structural Equation Modeling with AMOS; Basic Concepts, Applications
and Programming. New Jersey: Mahwah: Lawrence Erlbaum Associates Inc.
Caliso, J., & Milner, J. (1992). Childhood history of abuse and child abuse screening. Child
Abuse & Neglect, 16, 647-659.
Capaldi, D. M., Pears, K. C., Kerr, D. C. R., & Owen, L. D. (2008). Intergenerational and Partner
Influences on Fathers Negative Discipline. Journal of Abnormal Child Psychology(36),
347-358.
Caspi, A., Bolger, N., & Eckenrode, J. (1987). Linking person and context in the daily stress
process. Journal of Personality and Social Psychology, 52, 184195.
Caspi, A., Wright, B. R. E., Moffitt, T. E., & Silva, P. A. (1998). Early failure in the labor
market: childhood and adolescent predictors of unemployment in the transition to
adulthood. American Sociological Review, 63, 424-451.

115
Cassidy, J., & Shaver, P. (1999). Handbook of attachment theory, research, and clinical
applications: Guilford Press.
Clark, D. A., Beck, A. T. & Brown, G. K. (1992). Sociotropy, autonomy and life event
perceptions in dysphoric and nondysphoric individuals. Cognitive Therapy and Research
16, 635-652.
Coffman, D. L., & MacCallum, R. C. (2005). Using parcels to convert path analysis models into
latent variable models. Multivariate Behavioral Research, 40(2), 235-259.
Corapci, F., Radan, A. E., Lozoff, B. (2006). Iron deficiency in infancy and motherchild
interaction at 5 years. Journal of Developmental & Behavioral Pediatrics, 27, 371378.
Cohen, S., & Wills, T. A. (1985). Stress, social support, and the buffering hypothesis.
Psychological Bulletin, 98, 310-357.
Coleman, J. S. (1988). Social capital in the creation of human capital. American Journal of
Sociology, 94, S95S120.
Coleman, J. S. (1994). Social capital, human capital, and investment in youth. In A. C. Petersens
& J. T. Mortimer (Eds.), Youth unemployment and society (pp. 3450). New York:
Cambridge University Press.
Coleman, J. T., & Hoffer, T. (1987). Public and private high schools: The impact of
communities. New York: Basic Books.
Coleman, P. K. & Karraker, K. H. (2003) Maternal self-efficacy beliefs, competence in parenting
and toddlers behavior and developmental status. Infant Mental Health Journal, 24, 126
148.

116
Conger, R. D., & Conger, K. J. (2002). Resilience in Midwestern Families: Selected Findings
from the First Decade of a Prospective, Longitudinal Study. Journal of Marriage and the
Family, 64(2), 361-373.
Coulton, C. J., Korbin, J. E., Su, M., & Chow, J. (1995). Community level factors and child
maltreatment rates. Child Development, 66, 12621276.
Crooks D. 1995. American children at risk: poverty and its consequences for childrens health,
growth, and school achievement. Yearbook of Physical Anthropology, 38, 5786
Cummings, M. E., Davies, P. T., & Campbell, S. B. (2000). Developmental Psychopathology
and Family Process: Theory, Research, and Clinical Implications. New York: The
Guilford Press.
Cutrona, C., & Suhr, J. (Eds.). (1990). The transition to parenthood and the importance of social
support. Chichester: John Wiley & Sons.
Cutrona, C., & Troutman, B. (1986). Social support, infant temperament and parenting self-
efficacy: a mediational model of postpartum depression. Child Development, 57, 1507-
1518.
Dallaire, D. H., Pineda, A. Q., Cole, D. A., Ciesla, J. A., Jacquez, F., LaGrange, B., et al. (2006).
Relation of Positive and Negative Parenting to Children's Depressive Symptoms. Journal
of Clinical Child and Adolescent Psychology, 35, 313-322.
Dalton, K. M., Nacewicz, B. M., Johnstone, T., Schaefer, H. S., Gernsbacher, M. A., Goldsmith,
H. H. et al., (2005). Gaze fixation and the neural circuitry of face processing in autism.
Nature Neuroscience 433, 68-72.

117
Dearing, E. & Hamilton, L.C. (2006). Contemporary approaches and classic advice for analyzing
mediating and moderating variables. Monographs of the Society for Research in Child
Development, 71, 88-104.
Deater-Deckard, K., (2000). Parenting and child behavior adjustment in early childhood: A
quantitative genetic approach to studying family processes. Child Development, 71, 468-
484.
Deater-Deckard, K., Pylas, M.V., & Petrill, S.A. (1997). Parentchild interaction system
(PARCHISY). London: Institute of Psychiatry.
DeVos, G. A. (1993). A cross-cultural perspective: The Japanese family as a unit in moral
socialization. In P. A. Cowan, D. Field, D. A. Hansen, A. Skolnick & G. E. Swanson
(Eds.), Family, self, and society: Toward a new agenda for family research (pp. 115-
142): Hillsdale, NJ: Erlbaum.
DeWolff, M. S., VanIjzendoorn, M. H., VanDenBoom, D. C., Thompson, R. A., Belsky, J., &
Cowan, P. A. (1997). Sensitivity and attachment : A meta-analysis on parental
antecedents of infant attachment. Commentaries. Reply. Child Development, 68(4), 571-
609.
Dodge, K. A., Petit, G. S. & Bates, J. E. (1994). Socialization mediators of the relation between
socioeconomic status and child conduct problems. Child Development, 65, 649665.
Dong, M., Anda, R. F., Felitti, V. J., Dube, S. R., Williamson, D. F., Thompson, T. J., et al.
(2004). The interrelatedness of multiple forms of childhood abuse, neglect, and
household dysfunction. Child Abuse and Neglect, 28(7), 771-784.

118
Ebstein, R. P., Israel, S., Lerer, E., Uzefovsky, F., Shalev, I., Gritsenko, I., et al. (2009). Arginine
Vasopressin and Oxytocin Modulate Human Social Behavior. Values, Empathy, and
Fairness across Social Barriers: Ann. N.Y. Acad. Sci, 1167, 87-102.
Edhborg, M., Selmyr, L., Lunsh, W., & Widstrom, A. M. (2000). Fussy child-difficult
parenthood? Comparisons between families with a depressed mother and non-
depressed mother 2 months postpartum. Journal of Reproductive and Infant Psychology,
18(3), 225-238.
Edwards, J. R., & Lambert, L. S. (2007). Methods for Integrating Moderation and Mediation: A
General Analytical Framework Using Moderated Path Analysis. Psychological Methods,
12(1), 1-22.
Egeland, B., Jacobvitz, D., & Papatola, K. (1987). Intergenerational continuity of abuse. In R.
Gelles & J. Lancaster (Eds.), Child Abuse and Neglect (pp. 225-276). New York: Aldine.
Feinstein, L., & Bynner, J. (2004). The importance of cognitive development in middle
childhood for adulthood socioeconomic status, mental health, and problem behavior.
Child Development, 75, 1329-1339.
Fonagy, P., Gyrgy, G., Jurist, E. L., & Target, M. (2002). Affect regulation, mentalization, and
the development of the self. New York, NY, US: Other Press. .
Fonagy, P., Steel, H., & Steele, M. (1991). Maternal representations of attachment during
pregnancy predict the organization of infant-mother attachment at one year of age. Child
Development, 62, 891-905.
Fonagy, P., Steele, M., Steele, H., Leigh, T., Kennedy, R., Mattoon, G., et al. (1995).
Attachment, the reflective self, and borderline states: The predictive specificity of the
adult attachment interview and pathological emotional development. . In S. Goldberg, R.

119
Muir & J. Kerr (Eds.), Attachment theory: Social, developmental, and clinical
perspectives. (pp. 233-278).
Garbarino, J., & Crouter, A. (1978). Defining the community context for parent-child relations:
The correlates of child maltreatment. Child Development, 49, 604616.
Gonzalez, A., Jenkins, J. M., Steiner, M., & Fleming, A. S. (2009). The relation between early
life adversity, cortisol awakening response and diurnal salivary cortisol levels in
postpartum women. Psychoneuroendocrinology, 34(1), 76-86.
Gordon, Burge, Hammen, Adrian, Jaeniecke, & Hiroto, (1989). Observations of interactions of
depressed women with their children. American Journal of Psychiatry, 146, 50-55.
Gore, S. (1981). Stress-buffering functions of social supports: An appraisal and clarification of
research models. In B. S. Dohrenwend & B. P. Dohrenwend (Eds.), Stressful life events
and their contexts. (pp. 202-222). New York: Prodist.
Grych, J. H. (2002). Marital relationships and parenting. In Bornstein, M. H. (Ed.), Handbook of
parenting: Vol. 4: Social conditions and applied parenting (2nd ed.). (pp. 203-225).
Mahwah, NJ, US: Lawrence Erlbaum Associates Publishers.
Hammen, C. (2002). Context of stress in families of children with depressed parents. In S. H.
Goodman & I. H. Gotlib (Eds.), Children of depressed parents: Mechanisms of risk and
implications for treatment. (pp. 175-199). Washington, DC, US: American Psychological
Association.
Hammock, E. A. D., Lim, M. M., Nair, H. P., & Young, L. J. (2005). Association of vasopressin
1a receptor levels with a regulatory microsatellite and behavior. Genes, Brain and
Behavior, 4(5), 289-301.

120
Harkness, S., Super, C. M., & Keefer, C. H. (1992). Learning to be an American parent: How
cultural models gain directive force. In R. A. Paul, R. A. Shweder, R. G. DAndrade & C.
Strauss (Eds.), Publications of the Society for Psychological Anthropology: Human
motives and cultural models (pp. 163-178). Cambridge, England: Cambridge University
Press.
Hobcraft, J. (2004). Parental, Childhood, and Early Adult Legacies in the Emergence of Adult
Social Exclusion: Evidence on What Matters from a British Cohort. In P. L. Chase-
Lansdale, K. Kiernan & R. J. Friedman (Eds.), Human development across lives and
generations: The potential for change. (pp. 63-92). New York, NY, US: Cambridge
University Press.
Hoff, E., Laursen, B., & Tardif, T. (2002). Socioeconomic status and parenting. In M. H.
Bornstein (Ed.), Handbook of parenting: Vol. 2: Biology and ecology of parenting (2nd
ed.). (pp. 231-252). Mahwah, NJ, US: Lawrence Erlbaum Associates Publishers.
Hoffman, L. (2003). Mothers' ambivalence with their babies and toddlers: Manifestations of
conflicts with aggression. Journal of the American Psychoanalytic Association, 51(4),
1219-1240.
Hoffman, C., (2006). Maternal depression and parenting across the preschool period:
Implications for regulatory competence and psychological functioning. Dissertation
Abstracts International: Section B: The Sciences and Engineering, 66 (9-B), 5123
5270.
Hofheimer, J. A., Lewis, M. H., & Porges, S. W. (1996). Covariation in neonatal autonomic and
affective behavior patterns associated with mother-infant interaction across the first two
years. Infant Behavior and Development, 19 (Supplement 1), 507-507.

121
Hoyt, W. T. (2000). Rater bias in psychological research: When is it a problem and what we can
do about it? Psychological Methods, 5(1), 64-86.
Hughes C, Ensor R. (2005). Executive function and theory of mind in 2-year olds: A family
affair? Developmental Neuropsychology,28, 645668.
Hughes, C. & Ensor, R. (2007). Positive and protective : effects of early theory of mind on problem
behaviors in at-risk preschoolers. Journal of Child Psychology and Psychiatry, 48, 1025-1032.
Hunter, R., & Kilstrom, N. (1979). Breaking the cycle in abusive families. American Journal of
Psychiatry, 136, 1320-1322.
Insel, T. R., Wang, Z.-X., & Ferris, C. F. (1994). Patterns of Brain Vasopressin Receptor
Distribution Associated with Social Organization in Microtine Rodents. The Journal of
Neuroscience, 14(9), 5381-5392.
Jacobvitz, D., Leon, K., & Hazen, N. (2006). Does expectant mothers' unresolved trauma predict
frightened/frightening maternal behavior? Risk and protective factors. Development and
psychopathology, 18, 363-379.
Jenkins, J. M., Rasbash, J., & O'Connor, T. G. (2003). The role of the shared family context in
differential parenting. Developmental psychology, 39, 99-113.
Jenkins, J., Shapka, J. D., & Sorenson, A. M. (2006). Teenage mothers anger over twelve years:
partner conflict, partner transitions and childrens anger. Journal of Child Psychology
and Psychiatry, 47(8), 775-782.
Joels M (2008). Functional actions of corticosteroids in the hippocampus. European Journal of
Pharmacology 583 (2-3), 312321.
Jones, T. L. & Prinz, R. J. (2005) Potential roles of parental self-efficacy in parent and child
adjustment: a review. Clinical Psychology Review, 25, 341363.

122
Judge, T. A., Higgins, C. A., Thoresen, C. J., & Barrick, M. R. (1999). The Big Five personality
traits, general mental ability, and career success across the life span. Personnel
Psychology, 52, 621-652.
Kaufman, J., & Zigler, E. (1987). Do abused children become abusive parents? American
Journal of Orthopsychiatry, 57, 186-192.
Kendler, K. S. (1996). Parenting: A genetic-epidemiologic perspective. The American Journal of
Psychiatry, 153(1), 11-20
Kendler, K. S., & Greenspan, R. J. (2006). The nature of genetic influences on behavior:
Lessons from "simpler" organisms. American Journal of Psychiatry, 163, 1683-1694.
Kerig, P. K. (1996) Assessing the links between interparental conflict and child adjustment: The
conflicts and problem-solving scales. Journal of Family Psychology, 10 (4), 454-473.
Kessler, R., & Cleary, P. D. (1980). Social class and psychological distress. American
Sociological Review, 45, 463-478.
Kim, S. J., Young, L. J., Gonen, D., Veenstra-VanderWeele, J., Courchesne, R., Courchesne, E.,
et al. (2002). Transmission disequilibrium testing of arginine vasopressin receptor 1A
(AVPR1A) polymorphisms in autism. Molecular psychiatry, 7(5), 503-507.
Klebanov, P. K., Brooks-Gunn, J., & Duncan, G. J. (1994). Does neighborhood and family
poverty affect mothers parenting, mental health, and social support? Journal of
Marriage and the Family, 56, 441455.
Knafo, A., Israel, S., Darvasi, A., Bachner-Melman, R., Uzefovsky, F., Cohen, L., et al. (2008).
Individual differences in allocation of funds in the dictator game associated with length
of the arginine vasopressin 1a receptor RS3 promoter region and correlation between RS3
length and hippocampal mRNA. Genes, Brain and Behavior, 7(3), 266-275.

123
Kokko, K., & Pulkkinen, L. (2000). Aggression in childhood and long-term unemployment in
adulthood: a cycle of maladaptation and some protective factors. Developmental
Psychology, 36, 463-472.
Kochanska, G. (1997). Mutually Responsive Orientation Between Mothers and their Young Children:
Implications for Early Socialization. Child Development, 68(1), 94-112.
Kochanska, G., & Murray, T. K. (2000). Mother-Child Mutually Responsive Orientation and
Conscience Development: from Toddler to Early School Age. Child Development, 71(2),
417-431.
Leerkes, E. M., Blankson, A. N., & OBrien, M. (2009). Differential effects of maternal
sensitivity to infant distress and nondistress on social-emotional functioning. Child
Development, 80, 762-775.
Leventhal, T. & Brooks-Gunn, J. (2000). The neighborhoods they live in: The effects of
neighborhood residence on child and adolescent outcomes. Psychological Bulletin, 126
(2), 309-337.
Leventhal, T. & Brooks-Gunn, J. (2003). Children and youth in neighbourhood contexts. Current
Directions in Psychological Science, 12 (1), 27-31.
Levine, J., Pollack, H., & Comfort, M. (2001). Academic and behavioral outcomes among the
children of young mothers. Journal of Marriage and the Family, 63(2), 351-356.
Losoya, S. H., Callor, S., Rowe, D. C., & Goldsmith, H. H. (1997). Origins of familial similarity
in parenting: a study of twins and adoptive siblings. Developmental Psychology, 33,
1012-1023.
Maccoby, E. E. & Martin, J. (1983). Socialization in the context of the family: Parentchild
interaction. In P. H. Mussen (Series Ed.) & E. M. Hetherington (Vol Ed.), Handbook of

124
child psychology: Vol. 4. Socialization, Personality and Social Development (4th edn, pp.
1101).New York: Wiley.
Maccoby, E. E., & Martin, J. A. (1983). Socialization in the context of the family: Parent-child
interaction. In E. M. Hetherington (Ed.), Handbook of child psychology (4
th
ed., Vol. 4,
pp. 1-102.) New York: Wiley.
MacKinnon, D. P., Krull, J. L., Lockwood, C. M. (2000). Equivalence of the Mediation,
Confounding and Suppression Effect. Prevention Science, 1(4), 173181.
Magnuson, K. A., & Duncan, G. J. (2002). Parents in poverty. In M. H. Bornstein (Ed.),
Handbook of Parenting. (Vol. Volume 4, Social Conditions and Applied Parenting, pp.
63-92): Lawrence Erlbaum.
Malone, J. C., Levendosky, A. A. Dayton, C. J. & Bogat, A. G. (2010). Understanding the
ghosts in the nursery of pregnant women experiencing domestic violence: prenatal
maternal representations and histories of childhood maltreatment. Infant Mental Health
Journal, 31(4), 432454.
Main, M., & Goldwyn, R. (1995). Interview based adult attachment classifications: Related to
infant-mother and infant-father attachment. (Unpublished manuscript, Department of
Psychology, University of California, Berkeley).
Marks, N., Ashleman, K. (2002). Life course influences on womens social relationships at
midlife. In Kuh, D., & Hardy, R. (Eds.), A Life Course Approach to Womens Health
(pp. 255-278) Oxford: Oxford University Press.
Marks, D. J., Cyrulnik, S. E., Kera, E. C., Berwid, O. G, Santra, A., Halperin, J. M. (2006).
Objective and subjective assessments of parenting in hyperactive preschoolers. Infant and
Child Development, 15, 439 442.

125
Martini, T. S., Root, C. A., & Jenkins, J. M. (2004). Low and Middle Income Mothers
Regulation of Negative Emotion: Effects of Childrens Temperament and Situational
Emotional Responses. Social Development, 13(4) 515-530.
Masten, A. S. (2006). Developmental psychopathology: Pathways to the future. International
Journal of Behavioral Development, 30(1), 47-54.
Mathey, S., Barnett, B., Ungerer, J., Waters, B. (2000). Paternal and maternal depressed mood
during the transition to parenthood. Journal of Affective Disorders, 60(2), 75-85.
Matias, C. (2006) Direct observation of parent-child interaction based on attachment theory.
Unpublished doctoral dissertation, Institute of Psychiatry, Kings College London, UK.
Matias, C., OConnor, T. G., Futh, A., & Scott, S. (submitted). Contrasting models of parent-
child relationship quality in middle-childhood: Specific and non-specific predictions from
attachment and social learning theory
Matias, C., Scott, S. & OConnor, T. G. (2006) Coding of Attachment-Related Parenting
(CARP). Unpublished manuscript, Institute of Psychiatry, Kings College London, UK.
McGuire, J. B. (1997). The reliability and validity of a questionnaire describing neighborhood
characteristics relevant to families and young children living in urban areas. Journal of
Community Psychology, 25(6), 551-566.
McLaren, L., Kuh, D., Hardy, R., & Mishra, G. (2007). Postnatal depression and the original
mother-child relationship: A prospective cohort study. Journal of Affective Disorders,
100, 211-219.
McLeod, J. D., & Kaiser, K. (2004). Childhood emotional and behavioral problems and
educational attainment. American Sociological Review, 69, 636-658.

126
McLeod, J. D., & Kessler, R. (1990). Socioeconomic status differences in vulnerability to
undesirable life events. Journal of Health and Social Behavior, 31, 162-172.
McLoyd, V. (1990). The impact of economic hardship on black families and children:
Psychological distress, parenting and socioeconomic development. Child Development,
61, 311-346.
McLoyd, V. C. (1990). The impact of economic hardship on Black families and children:
Psychological distress, parenting, and socioemotional development. Child Development,
61, 311346.
McMahon, C., Barnett, B., Kowalenko, N., & Tennant, C. (2005). Psychological factors
associated with persistent postnatal depression: past and current relationships, defence
styles and mediating role of insecure attachment style. Journal of Affective Disorders,
84, 15-24.
Merali, Z., Hayley, S., McIntosh, J., Bdard, T., & Anistman, H. (2009). Impact of repeated
stressor exposure on the release of corticotrophin-releasing hormone, arginine-
vasopressin and bombesin-like peptides at the anterior pituitary. Behavioral Brain
Research, 198, 105-112.
Mertesacker, B., Bade, U., Haverkock, A., & Pauli-Pott, U. (2004). Predicting maternal
reactivity/sensitivity: The role of infant emotionality, maternal depressiveness/anxiety,
and social support. Infant Mental Health Journal, 25(1), 47-61.
Meyer-Lindenberg, A., Kolachana, B., Gold, B., Olsh, A., Nicodemus, K. K., Mattay, V., et al.
(2008). Genetic variants in AVPR1A linked to autism predict amygdala activation and
personality traits in healthy humans. Molecular Psychiatry, 13(2), 1-8.

127
Muller, D., Judd, C. M., & Yzerbyt, V. Y. (2005). When Moderation is Mediated and Mediation
is Moderated. Journal of Personality and Social Psychology, 89(6), 852-863.
Murgatroyd, C., Wigger, A., Frank, E., Singewald, N., Bunck, M., Holsboer, F., et al. (2004).
Impaired repression at a vasopressin promoter polymorphism underlies overexpression of
vasopressin in a rat model of trait anxiety. Journal of Neuroscience, 24, 7762-7770.
Murray, L., & Cooper, P. J. (1997). EDITORIAL: Postpartum depression and child development.
Psychological Medicine, 27(2), 253-260.
Nelson, D., Hammen, C., & Brennan, P. (2003). Adolescent children of depressed mothers: the
role of expressed emotion. Journal of Consulting and Clinical Psychology, 71, 935-944.
Neppl, T. K., Conger, R. D., Scaramella, L. V., & Ontai, L. L. (2009). Intergenerational
Continuity in Parenting Behavior: Mediating Pathways and Child Effects. Developmental
Psychology, 45(5), 1241-1256.
Neumann, I. D. (2003). Brain mechanisms underlying emotional alterations in the peripartum
period in rats. Depression and Anxiety, 17, 111-121.
NICHD, E. C. C. R. N. (1999). Child Care and MotherChild Interaction in the First 3 Years of
Life. Developmental Psychology, 35(6), 1399-1413.
ONeil, R., Parke, R. D., & McDowell, D. J. (2001). Objective and subjective features of
childrens neighborhoods: Relations to parental regulatory strategies and childrens social
competence. Applied Developmental Psychology, 22, 135155.
O'Connor, T. G. (2006). The persisting effects of early experiences on psychological
development. In D. Cicchetti & D. J. Cohen (Eds.), Developmental Psychopathology;
Volume 3: Risk, Disorder, and Adaptation (pp. 202-234). New Jersey: John Wiley &
Sons, Inc.

128
Okagaki, L., & Johnson Divecha, D. (1993). Development of parental beliefs. In T. Luster & L.
Okagaki (Ed.), Parenting an Ecological Perspective (pp. 35-67). Hillsdale, NJ:
Lawrence Erlbaum Associates.
Parke, R. D., Burks, V. M., Carson, J. L., Neville, B., & Boyum, L. A. (1994). Family-peer
relationships: A tripartite model. In R. D. Parke & S. Kellam (Eds.), Exploring Family
Relationships with Other Social Contexts (pp. 115145). Hillsdale, NJ: Erlbaum.
Parker G. (1981). Parental reports of depressives. An investigation of several explanations.
Journal of Affective Disorders, 3(2), 131-140.
Parker G. (1989). The Parental Bonding Instrument: psychometric properties reviewed. Psychiatr
Dev. 7, 317-335.
Pedersen, C. A., Caldwell, J. D., Walker, C., Ayers, G., & Mason, G. A. (1994). Oxytocin
activates the postpartum onset of rat maternal behavior in the ventral tegmental and
preoptic areas. Behavioral Neuroscience, 108(6), 1163-1171.
Pederson, D. R., & Moran, G. (1995). Maternal behavior Q-set. Monographs of the Society for
Research in Child Development, 60(2-3), 247-254.
Pederson, D. R., Moran, G., Sitko, C., Campbell, K., Ghesquire, K., & Acton, H. (1990).
Maternal sensitivity and the security of infant-mother attachment: a Q-Sort study. Child
Development, 61(6), 1974(1910)-1984.
Perrigo, G., Belvin, L., Quindry, P., & Kadir, T. (1993). Genetic mediation of infanticide and
parental behavior in male and female domestic and wild stock house mice. Behavior
Genetics, 23(6), 525-531.

129
Perusse, D., Neale, M. C., Heath, A. C., & Eaves, L. J. (1994). Human Parental Behavior -
Evidence for Genetic Influence and Potential Implication for Gene-Culture Transmission.
Behavior Genetics, 24(4), 327-335.
Phelps, J. L., Belsky, J., & Crnic, K. (1998). Earned security, daily stress, and parenting: a
comparison of five alternative models. Developmental Psychopathology, 10, 21-38.
Plomin, R., DeFries, J., & Loehlin, J. (1977). Genotype-environment interaction and correlation
in the analysis of human behavior. Psychological Bulletin 84(2), 309-322.
Prescott, A., Bank, L., Reid, J., Knutson, J. F., Burraston, B. O., & Eddy, J. M. (2000). The
veridicality of punitive childhood experiences reported by adolescents and young adults.
Child Abuse & Neglect, 24(3), 411-423.
Pryce, C. R. (1995). Determinants of motherhood in human and nonhuman primates: A biosocial
model. In Pryce, C. R., Martin, R. D., & Skuse, D. (Ed.), Schultz-Beigert Symposium, Sep
1994, Kartause Ittingen, Switzerland (pp. 1-15). Basel, Switzerland: Karger.
Radloff, L. S. (1977). The CES-D Scale: A Self-Report Depression Scale for Research in the
General Population. Applied Psychological Measurement, 1(3), 385-401.
Ross, C. E. (2000). Neighborhood disadvantage and adult depression. Journal of Health and
Social Behavior, 41, 177187.
Ross, G. (1987). Temperament of preterm infants: its relationshp to prenatal factors and one-
year outcome. Journal of Developmental and Behavioral Pediatrics, 8, 106-110.
Rutter, M. (1979). Protective factors in children's responses to stress and disadvantage. In M. W.
Kent & J. E. Rolf (Eds.), Primary Prevention in Psychopathology, Vol. 3: Social
competence in children (pp. 49-74). Hanover, NH: University Press of New England.

130
Rutter, M. (2004). Intergenerational Continuities and Discontinuities in Psychological Problems.
In P. L. Chase-Lansdale, K. Kiernan & R. J. Friedman (Eds.), Human Development
Across Lives and Generations: The potential for change. (pp. 239-277). New York, NY,
US: Cambridge University Press.
Rutter, M., & Maughan, B. (1997). Psychosocial adversities in childhood and adult
psychopathology. . Journal of Personality Disorders. Special Issue: Trauma and
Personality Disorders, 11(1), 4-18.
Saltsman, B. M TRICSY: A system for coding parent-twin triadic interactions. Dissertation Abstracts
International: Section B: The Sciences and Engineering, 68(10-B), 6948
Sameroff, A. J. (2000). Developmental systems and psychopathology. Development and
Psychopathology. Special Issue: Reflecting on the past and planning for the future of
developmental Psychopathology, 12(3), 297-312.
Sampson, R. J., & Groves, W. B. (1989). Community structure and crime: Testing social-
disorganization theory. American Journal of Sociology, 94, 774-802.
Sampson, R. J., & Laub, J. H. (1994). Urban poverty and the family context of delinquency: A
new look at structure and process in a classic study. Child Development, 65, 523540.
Sampson, R., J. (1992). Family management and child development: Insights from social
disorganization theory. In J. McCord (Ed.), Facts Frameworks and Forecasts: Advances
in criminological theory; (pp. 63-93). New Brunswick, NJ: Transaction.
Schaefer, E., S., & Edgertibm, M. (1985). Parent and child correlates of parental modernity. In
I. E. Sigel (Ed.), Parental Belief Systems: The psychological consequences for children
(pp. 287-318). Hillsdale, NJ: Lawrence Erlbaum Associates.

131
Serbin, L. A., & Karp, J. (2004). The intergenerational transfer of psychosocial risk: Mediators
of vulnerability and resilience. Annual Review of Psychology, 55, 33-63.
Shiner, R. L., Masten, A. S., & Roberts, J. M. (2003). Childhood personality foreshadows adult
personality and life outcomes two decades later. Journal of Personality., 71, 1145-1170.
Simons, R. L., Johnson, C., Beaman, J., Conger, R. D., & Whitbeck, L. B. (1996). Parents and
peer group as mediators of the effect of community structure on adolescent problem
behavior. American Journal of Community Psychology, 24, 145171.
Slade, A. & Cohen, L. J. (1996). The process of parenting and the remembrance of things past.
Journal of Infant Mental Health, 17(3), 217-238.
Slade, A., Grienenberger, J., Bernbach, E., Levy, D., & Locker, A. (2005). Maternal reflective
functioning, attachment, and the transmission gap: A preliminary study. Attachment &
Human Development, 7(3), 283-298.
Solomon, J., & George, C. (1999). The measurement of attachment security in infancy and
childhood. In P. R. Cassidy, & J. Shaver, (Eds.), The Handbook of Attachment: Theory,
Research and Clinical Applications (pp. 287-316). London: Guildford Press.
Spencer, R. L., & Hutchison, K. E. (1999). Alcohol, aging, and the stress response. Alcohol
Research & Health, 23(4), 272-281.
Spinath, F. M., & O'Connor, T. G. (2003). A behavioral genetic study of the overlap between
personality and parenting. Journal of Personality, 71(5), 786-808.
SPSS for Windows, Rel. 15.0.0. 2006. Chicago: SPSS Inc.
Statistics Canada, Human Resources Development Canada. National Longitudinal Survey of
Children and Youth, Overview of the Survey Instruments for 1994-95 Data Collection,
Cycle 1. Ottawa: Statistics Canada, 1995 (Catalogue No. 95-02).

132
Statistics Canada (2008). Employment Income Statistics (4) in Constant (2005) Dollars, Work
Activity in the Reference Year (3), Aboriginal Identity, Registered Indian Status and
Aboriginal Ancestry (21), Age Groups (5A), Highest Certificate, Diploma or Degree (5)
and Sex (3) for the Population 15 Years and Over With Employment Income of Canada,
Provinces, Territories, 2000 and 2005 - 20% Sample Data. Census Tables Retrieved
September 11, 2009, from http://cansim2.statcan.ca/cgi-
win/cnsmcgi.pgm?Lang=E&SP_Action=Result&SP_ID=3874&SP_TYP=60&SP_Sort=-
2&SP_Portal=2
Stein, A., Arteche, A., Lehtonen, A., Craske, M., Harvey, A., Counsell, N., & Murray, L. (2010).
Interpretation of infant facial expression in the context of maternal postnatal depression.
Infant Behavior and Development, 33, 273-278.
Stein, M. B., Goldin, P. R., Sareen, J., Zorilla, L. T., & Brown, G. G. (2002). Increased
amygdala activation to angry and contemptuous faces in generalized social phobia.
Archives of General Psychiatry, 59, 1027-1034.
Steinberg, L., Darling, N. E., & Fletcher, A. C. (1995). Authoritative parenting and adolescent
adjustment: An ecological journey. In P. Moen, G. H. Elder, & K. Luscher (Eds.),
Examining Lives in Context: Perspectives on the ecology of human development (pp.
423466). Washington, DC: American Psychological Association.
Tarabulsy, G. M., Bernier, A., Provost, M. A., Maranda, J., Larose, S., Moss, E., et al. (2005).
Another Look Inside the Gap: Ecological Contributions to the Transmission of
Attachment in a Sample of Adolescent Mother and Infant Dyads. Developmental
Psychology, 41(1), 212-224.

133
Tarabulsy, G. M., Provost, M. A., Bordeleau, S. p., Trudel-Fitzgerald, C., Moran, G., Pederson,
D. R., et al. (2009). Validation of a short version of the maternal behavior Q-set applied
to a brief video record of mother-infant interaction. Infant Behavior & Development, 32,
132-136.
Thomas, A., & Chess, S. (1977). Temperament and Development. New York: Brunner/Mazel.
Thompson, R. A., & Raikes, H. A. (2003). Toward the next quarter-century: Conceptual and
methodological challenges for Attachment Theory. Development and Psychopathology,
15, 691-718.
Tonge, W. L., James, D. S., & Hillam, S. M. (1975). Families without hope: a study of 33
problem families. British Journal of Psychiatry (Special publication No. 11).
Trentacosta, C. J., Hyde, L. W., Shaw, D. S., Dishion, T. J., Gardner, F., & Wilson, M. (2008).
The relations among cumulative risk, parenting, and behavior problems during early
childhood. Journal of Child Psychology and Psychiatry, 49(11), 1211-1219.
Tronick, E., Als, H., Adamson, L., Wise, S., & Brazelton, T. B. (1978). Infants response to
entrapment between contradictory messages in face-to-face interaction. Journal of the
American Academy of Child and Adolescent Psychiatry, 17, 113.
van Bakel, H. J. A., & Riksen-Walreven, J. M. (2002). Parenting and development of one-year-
olds: Links with parental, contexual, and child characteristics. Child Development, 73(1),
256-273.
van Doesum, K. T. M., Hosman, C. M. H., Riksen-Walraven, J. M., & Hoefnagels, C. (2007).
Correlates of depressed mothers' sensitivity toward their infants: The role of maternal,
child, and contextual characteristics. Journal of the American Academy of Child and
Adolescent Psychiatry, 46(6), 747-756.

134
van IJzendoorn, M. H., Bakermans-Kranenburg, M. J., & Mesman, J. (2008). Dopamine system
genes associated with parenting in the context of daily hassles. Genes, Brain, and
Behavior, 7, 403410.
Walsh, C. A., MacMillan, H. L., Trocme, N., Jamieson, E., & Boyle, M. (2008) Measurement of
victimization in adolescence: Development and validation of the Childhood Experiences
of Violence Questionnaire. Child Abuse & Neglect, 32(11), 1037-1057.
Walum, H., Westberg, L., Henningsson, S., Neiderhiser, J. M., Reiss, D., Igl, W., et al. (2008).
Genetic variation in the vasopressin receptor 1a gene (AVPR1A) associates with pair-
bonding behavior in humans, PNAS Proceedings of the National Academy of Sciences of
the United States of America. US: National Academy of Sciences.
Wang, Z. X., Liu, Y., Young, L. J., & Insel, T. R. (2000). Hypothalamic Vasopressin Gene
Expression Increases in Both Males and Females Postpartum in a Biparental Rodent,
Journal of Neuroendocrinology.12, 111-120.
West, M., Spreng, S., Rose, S., & Adam, K. (1999). Relationship between attachment-felt
security and history of suicidal behaviors in clinical adolescents. Canadian Journal of
Psychiatry, 44(6), 578-582.
Whalen, P. J., Rauch, S. L., Etcoff, N. L., McInerney, S. C., Lee, M. B., & Jenike, M. A. (1998).
Masked presentations of emotional facial expressions modulate amygdala activity
without explicit knowledge. Journal of Neuroscience, 18, 411-418.
Yirmia, N., Rosenberg, C., Levi, S., Salomon, S., Shulman, C., Nemanov, L. et al., (2006).
Association between the arginine vasopressin 1a receptor (AVPR1A) gene and autism in
a family-based study: mediation by socialization skills. Molecular Psychiatry, 11, 488-
494.

135
Young, L. J. (1999). Oxytocin and vasopressin receptors and species-typical social behaviors.
Hormones and Behavior, 36, 212-221.

136

Appendix A

Comparison of original and imputed data and percentage of missing data.


Original data Imputed data

N available
(Total N=501) % missing Mean SD Mean SD
Cumulative early adversity risk 501 0 2.09 1.28 2.09 1.28
MBQS 381 24 0.28 0.49 0.27 0.49
Ainsworth acceptance 381 24 6.27 1.74 6.29 1.74
Ainsworth accessibility 381 24 5.83 1.99 5.82 2.01
Ainsworth cooperation 381 24 5.57 1.9 5.59 1.9
Ainsworth sensitivity 381 24 5.4 1.96 5.42 1.98
Infant temperament 500 0.2 3.05 0.97 3.05 0.97
No. of children in the home 501 0 2.55 0.99 2.37 0.82
Family income 472 6 11.81 4.1 11.81 4.1
Infant weight (kilos and grams) 498 0.6 3.4 0.51 3.4 0.51
Mothers' education 500 0.2 15.12 2.7 15.27 2.7
Mothers' age 499 0.4 32.87 4.9 32.71 4.9
Maternal depression 493 1.6 9.45 7.3 9.46 7.27
Prenatal problems 500 0.2 0.08 0.11 0.08 0.11
Neighborhood quality 498 0.6 0 1 0 1


137

Appendix B

Change in maternal sensitivity measurement.

A switch in measurement of maternal behavior took place in study 2. Study 1 used the
Maternal Behavior Q-Sort (Pederson & Moran, 1995) a validated measure of maternal sensitivity
during the infancy period. Assessing maternal sensitivity with this measure yielded no significant
findings with mothers genotype. In study 2, maternal sensitivity was assessed with older
children (18 months of age to 6 years of age) and while mothers performed several tasks
independently with two of her children (the 18-month old infant and sibling closest in age).
Mothers assessments were averaged across the multiple children within the family. Observing
mothers interact separately with more than one child strengthens the quality of the measure as it
increases confidence that the assessment is that of mothers behavior and not an assessment of
the interaction pattern of a specific mother-child dyad. Thus, it was reasoned that the Time 2
assessment of sensitivity may have been a stronger measure of maternal behavior thus increasing
the likelihood of detecting the possible, albeit small, effect of the AVPR1A gene on mothers
behavior and stress reactivity.

Table 21. Correlations between time1 and time 2 maternal behavior measures.


MBQS AINSW.
ACCEPTANCE
AISNW.
ACCESSABILITY
AINSW.
COOPERATION
T1 SENSITIVITY
FACTOR SCORE
(WITH MBQS &
AINSWORTH)

T2 sensitivity
(CARP and
PARCHISY)
(N=377)
.21* .24* .25* .22* .26*
*p < .00001