Académique Documents
Professionnel Documents
Culture Documents
fda from Staphylococcus carnosus TM300, encoding the class I fructose-1,6-bisphosphate aldolase, was cloned
in Escherichia coli and sequenced. The 888-nucleotide open reading frame encoding a protein with an Mr of
32,855 had an E. coli-like promoter sequence. Plasmids containing fda complemented E. coli NP315 (Fda-).
Expression offda in S. carnosus led to a six- to eightfold increase in aldolase production and activity; low levels
of glucose in the growth medium stimulated activity.
EcoRV
1 AAQATATUATTTTGTTGAATAGGTCCTTCCTTTAATACACGAAAATACCATCCAGTTCTTCCAGTTTCTTGGATACGTCTTCCCCATTCAATCCAACGCA
101 CACGTCTCCCTGGCTTCCAACAAGGTCTGCGCGGTTGTGAAACTTGTACAGTCGCTCCTCCGATTTGATAGATGTCACCAATATAAACAGAAGTTTCATC
201 CATATCAATTACGGAAACATTCTCTCCATTCAACCCTGGTTTAAAATGAACITCCGGATATTCTACTGTCCATTTTTCATAATGCGATTTACTATAAGCA
301 AATAATGCTTTTTCTGGTCCGCCATGATGTTTTTTCTCCCCGACATCATCACCAACTAAACCTGTTTTCGTTAGTAAAACCGCTTGGTCTGTCGGATTTT
SalI
401 TAAACGCTGCTGTCGACCATTCTTGTTCTAAAGGATTTTCAGCATTCGGATCACCTACTTTTTGAATGCCGCCTCTAAATAATTGCTCGATTTGACTCAC
-35
501 TTGTTCCACCCTCTCTCAAAGCTATTATAACGACTTTTTGACAAATTCTTAAGAGTAAGCGTTTTTTTTAATTTTTTTAAAGTAAAGTA¶AATC
+1
-10 I S.D.
601 AATTATTTTTTTCCATACAGACATTGAAAGAGAAAAGCAAAATGCGGAAAGArTCAATAAATGAACCAAGAACAATTTGACAAAATTAAAAATG
M N Q B Q F D K I K N 11
701 GTAAAGGATTTATCGCAGCATTGGACCAAAGCGGTGGTAGTACTCCGAAAGCGCTAAAAGATTATGGCGTTGAAGAAAATGAATACTCTAACGATGAAGA
G K G F I A A L D Q S G G S T P K A L K D Y G V E E N E Y S N D E E 45
1001 GCGTTCAATTAATGAAACCTATTCCAGACTTAGATAAATTATTAGATCGTGCGAACGAACGTGGTATCTTCGGTACTAAAATGCGTTCTAACATCTTAGA
G V Q L M K P I P D L D K L L D R A N E R G I F G T K M R S N I L E 145
PvuII
1101 AAATAATAAAGAAGCAATTGAAAAAGTTGTTAAACAACAATTTGAAGTTGCAAAAGAAATCATTGCAGCGTCTAGTACCAATTATCGAACCTGAAGTT
N N K E A I E K V V K Q Q F E V A K E I I A A G L V P I I E P E V 178
1201 AACATCAATGCTAAAGACAAAGAAGCTATCGAAGCTAACTTAGCTGAAGCAATCAAAGCTGAATTAGATAACTTGAAAAAAGATCAATATGTAATGTTGA
N I N A K D K E A I E A N L A E A I K A E L D N L K K D Q Y V M L 211
1301 AATTAACTATTCCAACTAAAGTGAATGCTTACAGCGAATTAATTGAACATCCACAAGTAATCCGCGTGGTTGCATTATCTGGTGGTTACAGCCGCGACGA
K L T I P T K V N A Y S E L I E H P Q V I R V V A L S G G Y S R D E 245
HindIII EcoRI
1401 AGCAAACAAAATCTTGAAACAAAATGATGGTTTAATCGCA=G CTCACGTGCATTAGTATCTGACTTAAACGCACAACAATCAGATGCA AT
A N K I L K Q N D G L I A S F S R A L V S D L N A Q Q S D A E F N 278
Clal Hindlll HindlIl
1501 GAAAAATTACAAGAAGCTATCGATACAATCTTCGATGCTTCAGTAAACAAAGCTAATCTAAGCTTAAAATAATAACGAGCCCC TTC TTGAGGGCT
E K L Q E A I D T I F D A S V N K A 296
1601 CGCTTTTTTGTATAATTCCATAGATTTTCTCCGCAAATTTTCTCATACGTAATATTTTCACAATAAAAGTTCTTTTCTTTCACTGTCATACATAATAAAA
1701 TACAAGAGACTTTCAGAAATAAAGAACTAAGTCGCCAAACTTACAACAGGATCTGAACACACATGGCGTCTAATCCTATTCCTCGTTATTTACAAGATAA
1801 GCGCGCAAATTTCCATGAACTATTTTATATTAATATTTGTATATGCCTTACAAAAAATTGCGCATGTGCTTTTACATACTGAAAAAATGGCACACTTT
Xba I
1901 CCTAGA
FIG. 2. Nucleotide sequence of thefda-containing 1.9-kb EcoRV-XbaI fragment of S. carnosus TM300. The transcriptional start is marked with
+1. The -35 and -10 regions and the potential ribosome binding sequences (S.D.) are underlined. The determined N-terminal protein sequence
is marked with boldface letters. The Schiff base-forming lysine residue is marked with an asterisk. The terminator is underlined with arrows.
NQEQFDK (18a), we synthesized (Gene Assembler Plus; Chromosomal DNA from S. carnosus (29) was prepared by a
Pharmacia LKB) the wobble oligonucleotide Aldol: modification of the cleared-lysate method (22). Colonies
GAT AA
TTT grown on one B plate (10 g of casein hydrolysate 140 [GIBCO,
AAT CAA
GAA CA-A
AAT CAA
C G
CAA
C GC GAAG Eggenstein-Leopoldshafen, Germany],
[Difco], 5 g of NaCl, 1 g of glucose, 1 g 5of gK2HPO4, extract
of yeastand 12 g
The oligonucleotide was labeled with [_y-32P]ATP (Amersham) of agar [GIBCO] per liter [pH 7.3]) were resuspended in 1 ml
with T4 polynucleotide kinase (Stratagene) (27). Unincorpo- of NT buffer (100 mM NaCl and 20 mM Tris-HCl, pH 7.5).
rated nucleotides were separated from the radiolabeled oligo- After incubation with 14 U of lysostaphin (Sigma, Deisen-
nucleotide by using the Nuc Trap Push Columns (Stratagene). hofen, Germany) for 30 min at room temperature, the cells
VOL. 175, 1993 NOTES 7497
cells were harvested and disrupted with glass beads (0.1- to phate dehydrogenase and triosephosphate isomerase as de-
0.3-mm diameter; Fluka) as previously described (31). The scribed by the manufacturer (Sigma).
supernatant was loaded onto a Cs-trifluoroacetate gradient (p S. carnosus(pRB473fda2O) had an aldolase activity six- to
= 1.51 g/ml). The RNA was pelleted by ultracentrifugation. eightfold higher than that of the wild type. This observation is
RNA (10 ,ug), 0.1 pmol of 5'-end-labeled oligonucleotide corroborated by SDS-PAGE, in which a higher protein con-
Aldo2 (5'-CCG CTrL TGG TCC AAT GCT GCG ATA AAT centration was visible at the expected size of 33 kDa with S.
CCT TTA CC-3') (corresponding to nucleotide positions 734 carnosus TM300(pRB473fda2O). The specific aldolase activity
to 699 in Fig. 2), and 10 U of avian myeloblastosis virus reverse was nearly constant during the course of exponential growth
transcriptase (Stratagene) were used for the primer extension (Fig. 4A).
experiments. Extension products of DNA sequencing reactions It was suspected that the glucose concentration in the
were resolved on a denaturing 6% polyacrylamide gel and growth medium influenced aldolase production. S. carnosus
visualized by autoradiography. The promoter region is similar and S. carnosus(pRB473fda2O) were therefore aerobically
to E. coli promoters; 4 of 6 bases of the fda -35 and -10 grown in B broth (without glucose) supplemented with 0.0, 0.1,
regions match the E. coli promoter consensus sequence. 0.4, 1, or 4% glucose. After 6 h, cell extracts were assayed for
Homology with other class I FBP aldolases. The deduced specific aldolase activity. In the presence of 0.4% glucose, the
amino acid sequence of the FBP aldolase of S. carnosus was specific aldolase activity was nearly twofold higher than in the
compared with other class I aldolase sequences, in the Micro- absence of glucose. With higher glucose concentrations the
genie and EMBL-Heidelberg data banks. With the S. aureus specific aldolase activity was decreased. Anaerobic growth
FBP aldolase the amino acid sequence around the active site conditions had no significant influence on specific aldolase
12. Gotz, F., E. Nurnberger, and K. H. Schleifer. 1979. Distribution of genomic clones. Biochimie 69:137-145.
class-I and class-II D-fructose-1,6-bisphosphate aldolases in vari- 25. Rudolph, R., R. Siebendritt, and T. Kiefhaber. 1992. Reversible
ous staphylococci, peptococci and micrococci. FEMS Microbiol. unfolding and refolding behaviour of a monomeric aldolase from
Lett. 5:253-257. Staphylococcus aureus. Protein Sci. 1:654-666.
13. Gotz, F., and B. Schumacher. 1987. Improvements of protoplast 26. Sakakibara, M., T. Mukai, H. Yatsuki, and K. Hori. 1985. Human
transformation in Staphylococcus carnosus. FEMS Microbiol. Lett. aldolase isozyme gene: the structure of multispecies aldolase B
40:285-288. mRNAs. Nucleic Acids Res. 13:5055-5069.
14. Hanahan, D. 1983. Studies on transformation of E. coli with 27. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular
plasmids. J. Mol. Biol. 166:557. cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Labo-
15. Harris, C. E., R. D. Kobes, D. C. Teller, and W. J. Rutter. 1969. ratory, Cold Spring Harbor, N.Y.
The molecular characteristics of yeast aldolase. Biochemistry 28. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing
8:2442-2454. with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA
16. Horecker, B. L., 0. Tsolas, and C. Y. Lai. 1972. Aldolases.
Enzymes 7:213-258. 74:5463-5467.
17. Izzo, P., P. Costanzo, A. Lupo, E. Rippa, A. M. Borghese, G. 29. Schleifer, K H., and U. Fischer. 1982. Description of a new species
Paolella, and F. Salvatore. 1987. A new human species of aldolase of the genus Staphylococcus: Staphylococcus carnosus. Int. J. Syst.
A mRNA from fibroblasts. Eur. J. Biochem. 164:9-13. Bacteriol. 32:153-156.
18. Kelley, P. M., and D. R. Tolan. 1986. The complete amino acid 30. Schreyer, R., and A. Bock. 1973. Phenotypic suppression of a
sequence for the anaerobically induced aldolase from maize fructose-1,6-diphosphate aldolase mutation in Escherichia coli. J.
derived from cDNA clones. Plant Physiol. 82:1076-1080. Bacteriol. 115:268-276.
18a.Kula, M. R., and H. P. Brockamp. Personal communication. 31. Sizemore, C., E. Buchner, T. Rygus, C. Witke, F. Gotz, and W.