Biosci. Biotechnol. Biochem.

, 72 (6), 15501557, 2008

High-Level Expression, Purication, and Characterization of the Recombinant

Grass Carp Pituitary Adenylate Cyclase-Activating Polypeptide
Zhangzhi WANG, Mu Y ANG, Xinyan W ANG, and Hong Z HOUy
School of Life Science and Technology, University of Electronic Science and Technology of China,
Chengdu 610054, China
Received January 23, 2008; Accepted March 12, 2008; Online Publication, June 7, 2008
[doi:10.1271/bbb.80057]

Pituitary adenylate cyclase-activating polypeptide-38

(PACAP38 ) is a potent secretagog for growth hormone
and gonadotropin in sh species. To obtain recombinant
grass carp PACAP38 , its open reading frame was
subcloned in pET32a(+) vector to express thioredoxin
(Trx)-PACAP fusion protein in Escherichia coli BL21
(DE3). The resulting expression level of the thioredoxinPACAP reached 36% of the total proteins, and more
than 85% of fusion protein existed as soluble form.
Using Ni2 -chelating anity chromatography, 102 mg
of Trx-PACAP38 with a purity of 97% was obtained
from 342 mg of crude proteins from a 1-liter culture of
Escherichia coli. The puried Trx-PACAP specically
inhibited T98G human glioblastoma cell proliferation,
but the fusion partner had no eect in this regard.
Moreover, this inhibition was totally abolished by
PACAP-specic antibody.
Key words:

recombinant pituitary adenylate cyclaseactivating polypeptide (PACAP); fusion

expression; purication; biological activity

Pituitary adenylate cyclase-activating polypeptide

(PACAP), a member of the secretin/glucagon/vasoactive intestinal peptide (VIP) superfamily, was rst
identied in ovine hypothalamus by its stimulatory
eect on cAMP production in rat pituitary cells.1) This
peptide exists in two forms, PACAP38 and PACAP27 ,
the latter being the N-terminal portion of PACAP38 .
Both forms of PACAP act by binding to their G proteincoupled receptors: PAC1, VPAC1, and VPAC2.2)
Activation of multiple receptors by PACAP has broad
physiological eects on the nervous, endocrine, reproductive, cardiovascular, muscular, and immune systems.35)
In teleost sh, PACAP immunoreactivity can be
detected in dierent parts of the pituitary. In goldsh,

PACAP bers are present in the pars distalis and

neurointermediate lobe of the pituitary,6) and more
recently, nerve bers with PACAP immunoreactivity
were found to overlap with the distribution of somatotrophs in the grass carp pituitary.7) The presence of a
PACAP neuronal system within the pituitary is consistent with ndings that PACAP can act as a potent
secretagog for GH secretion in salmon,8) goldsh,6)
European eel,9) common carp,10) and grass carp.7)
Notably in goldsh, both PACAP27 and PACAP38 were
eective in stimulating GH secretion through activation
of the adenylate cyclase-cAMP-protein kinase A and
phospholipase C-IP3-protein kinase C pathways in
cultured pituitary cells.6) In another teleost grass carp,
two forms of ovine PACAP not only trigger GH release
but also enhance GH synthesis at the pituitary cell
level.7) In the same animal model, a full-length cDNA of
PACAP has been cloned and conrmed to be a singlecopy gene in the genome.11) Similarly to ovine PACAP,
two synthetic forms of grass carp PACAP were eective
in elevating GH release and GH transcripts in pituitary
cells, and PACAP38 was consistently found to be more
potent in GH secretion than PACAP27 .11) In mammals,
GH secretion is primarily under the stimulatory control
of GHRH, while studies aimed at the eect of PACAP
on GH secretion have indicated that PACAP probably
plays a minor role in the control of GH secretion.12)
Recently, non-mammal GHRH peptides encoded in
cDNAs isolated from goldsh, zebrash, and frog were
identied.13) In the goldsh, a 4-h incubation of pituitary
cells with increasing doses (0.1 nM1 mM) of goldsh
GHRH resulted in a dose-dependent increase in GH
release, the minimum eective dose being 10 nM.13) Like
GHRH, PACAP38 (0.1 nM1 mM) was also eective in
inducing GH release from both goldsh and grass carp
perifused pituitary cells in a dose-dependent manner.6,7)
These ndings indicate that both PACAP and GHRH are

y
To whom correspondence should be addressed. Tel: +86-28-83206437; Fax: +86-28-83208238; E-mail: zhouhongzh@uestc.edu.cn
Abbreviations: PACAP, pituitary adenylate cyclase-activating polypeptide; ORF, open reading frame; Trx, thioredoxin; E. coli, Escherichia coli;
VIP, vasoactive intestinal peptide; GHRH, growth hormone releasing hormone; GH, growth hormone; IP3, inositol 1,4,5-triphosphate; GTH,
gonadotropin; LB, Luria-Bertani; IPTG, isopropyl-
-D-thiogalactoside; SDSPAGE, sodium dodecyl sulfate-polyacrylamide gel electrophoresis; PB,
phosphate buer; IMAC, immobilized metal anity chromatography; TBS, tris-buered saline; PMSF, phenylmethanesulfonyl uoride; WST-8,
4-[3-(2-methoxy-4-nitrophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1,3-benzene disulfonate sodium salt

Expression and Purication of Grass Carp PACAP

potent GH-releasing factors in teleost sh, and suggest

that PACAP can be applied to increase yields in
commercial shery.
The relationship between PACAP and food intake is
still a matter of heated debate. PACAP has been reported
to inhibit food intake during 60 min of observation in
goldsh, as in mice and chickens,14) which might
compromise the growth-promoting action resulting from
PACAP-induced GH secretion. However, a more recent
study indicated that PACAP is not required for the
regulation of food intake in PACAP-null mice.15) The
reason for this discrepancy is still unknown, but might
be species-specic variability and/or dierences in
research methodology. Moreover, it is still unclear
how PACAP regulates appetite in the long term. Since
the results of GH administration16) and GH transgenesis17) stimulating body growth might be attributable to
increased feeding and improved food assimilation in
sh,16,17) we do not exclude the possibility that PACAP
administration optimized to stimulate GH release can
lead to increased body growth. Possible additional roles
of PACAP have been conrmed in sh models, e.g.,
in inducing gonadotropin release in goldsh6,18) and
a developmental role in zebrash,19) indicating that
PACAP, alone or in concert with other regulators, plays
dierent roles in sh life. Consequently, mass preparation of recombinant grass carp PACAP38 can be used
in the improvement of sh culture, and allows further
in vitro and possibly in vivo studies to determine the
physiological roles of PACAP in commercial sh.
Chemical synthesis is an option for producing
PACAP, but the technique encounters potential problems. First, peptide synthesis of over 35 amino acids is
generally not economically feasible, since the chemical
synthesis of longer peptides (more than 50 amino acids)
is technically challenging.20) In addition, the process of
chemical synthesis is step-intensive, and does not serve
well for large-scale production. Alternatively, recombinant DNA technology provides a ready means of greater
production yields at decreased cost, and reduces the use
of hazardous materials. In the present study, an ecient
method of producing recombinant PACAP38 of grass
carp was developed. Fusion of grass carp PACAP38 to
thioredoxin (Trx) not only facilitated the high expression
and accumulation of fusion proteins in soluble form,
but also simplied the purication procedures. Notably,
small peptides (< 5 kDa) are rapidly degraded and thus
can have extremely short half-lives.21) In this regard,
fusion peptide can enhance its stability. In this study,
deoxyoligonucleotide encoding grass carp PACAP38
was designed according to the codon preference of
E. coli, which improved the translation eciency of
grass carp PACAP in the E. coli expression system.

Materials and Methods

Strains and plasmids. Escherichia coli (E. coli)
strains JM109 and BL21 (DE3) were used as host cells

1551

in subcloning and PACAP fusion protein expression

respectively. pUCm-T vector was purchased from
Shenergy Biocolor (Shanghai, China). pET32a(+)
vector was obtained from Novagen (Madison, WI).
Other reagents were from commercial resources, and
were of high quality.
Construction of pET32a(+)/PACAP expression plasmid. The amino acid sequence of grass carp PACAP38
was obtained from GenBank (accession no. ABQ81649),
and was back-translated to the DNA sequence using
E. coli preferential codons.22,23) To eectively terminate
the translation, two continuous termination codons were
supplemented to the 30 end of this DNA fragment. The
PACAP open reading frame (ORF) was synthesized and
amplied by a two-step strategy with three oligonucleotides (Fig. 1). A pair of restriction endonuclease (BamH
I and Hind III) sites anked the 50 upstream and 30
downstream of PACAP ORF respectively. First, a chain
extension reaction was completed with oligonucleotide
F1 (50 -GCGGATCCCATTCTGATGGCATCTTCACCGACATTTACAGCCGCTACCGTAAACAGATG-30 )
and oligonucleotide R1 (50 -ACGAC GACCCAGGACGGCTGCTAAATACTTCTTGACGGCCATCTGTTTACGGTAGCGGCT-30 ), which were denatured at
94
C for 10 min following 10 min of annealing at
55
C. Then Taq DNA polymerase was added, and
extension was carried out at 72
C for 5 min. Secondly,
the PACAP fragment was amplied using chain extension reaction product as template, and oligonucleotide
F1 and oligonucleotide R2 (GCAAGCTTTCACTATTTGTTTTTAATGCGCTGGCGGTAACGACGACCCAGGACGGCTGC) as primers. The conditions for
PCR amplication were as follows: 94
C for 3 min; 30
cycles of 94
C for 30 s, 57
C for 30 s, and 72
C for
30 s, and a nal extension for an extra 10 min at 72
C.
After PCR, the product was digested with BamH I and
Hind III, and the digested DNA fragment was inserted
into BamH I-Hind III digested pET32a(+) vector to
form a PACAP expression plasmid named pET32a(+)/
PACAP. The sequence of PACAP ORF in this plasmid
was conrmed by DNA sequencing (ABI PRISM 3730
sequencer, Applied Biosystems, Foster City, CA).
Fusion protein expression. After pET32a(+)/PACAP
was transformed into E. coli BL21 (DE3) cells, a pilot
experiment was done to optimize the time and temperature for the expression of thioredoxin-PACAP (TrxPACAP) fusion protein. The clone of interest was
streaked onto a Luria-Bertani (LB) plate containing
100 mg/ml of ampicillin, and incubated at 37
C overnight. The single colony selected harboring the plasmid
was cultured in 5 ml of LB medium containing 100 mg/
ml of ampicillin, and incubated at 37
C with shaking at
210 rpm (Thermo 481, Boston, MA). Overnight culture
(2.5 ml) was used to inoculate 50 ml of fresh LB medium
in a 250-ml culture ask, and we grew this culture
at 30
C until the OD600 was between 0.6 and 0.8.

1552

Z. WANG et al.

B
F1
R1

Ampr

R2
Chain extension
and PCR amplification
Hind III

BamH I

132bp
gcPACAP38 ORF
BamH I/Hind III digestion

Ligation
PACAP ORF

Ampr

Fig. 1. Construction of Trx-PACAP Fusion Protein Expression Plasmid.

A, Modied grass carp PACAP38 open reading frame and corresponding amino acids. The nucleotides, modied according to the codon
preference of E. coli, are shadowed with dark gray. The oligonucleotides used in PCR are indicated by an arrowhead line. The restriction
enzyme cut sites are noted as black triangles. B, Strategy for Trx-PACAP expression vector construction. Oligonucleotide encoding grass
carp PACAP was prepared by two-step PCR, and the PCR product was subcloned into bacteria expression vector pET32a (+) by BamH I and
Hind III digestion.

Expression of the fusion protein was induced with

isopropyl-
-D-thiogalactoside (IPTG, Merck, Darmstadt, Germany) at a nal concentration of 1 mM. To
perform time-course expression, 1-ml cultures were
sampled at 2-h intervals after induction for up to 8 h.
Cells were collected by centrifugation for 3 min at
13,200 rpm (Eppendorf 5415, Hamberg, Germany) and
stored at 20
C. After the supernatant was decanted,
cell pellets were resuspended in 500 ml of ice-cold
imidazole buer (20 mM PB, pH 6.6, 2.5 mM EDTA, and
5 mM imidazole), and kept on ice. Then each sample was
sonicated in 10-s bursts 3 times using a hand-held
sonicator (Cole-Parmer, Vernon Hills, IL) with a microtip. These samples were snack-frozen at a 80
C
freezer and quickly thawed at 37
C. The sonicationfreeze-thaw cycle was repeated 3 times. Cell lysate was

centrifuged at 13,200 rpm at 4
C for 30 min to pellet

cell debris and insoluble matter. The supernatant was
transferred to new tubes, and the pellet was resuspended
in 500 ml of ice-cold imidazole buer. Finally, each
sample was analyzed with SDSPAGE gel (15%
separating gel and 4% stacking gel).
Purication of fusion protein. For PACAP fusion
protein purication, E. coli BL21(DE3) cells transformed with pET32a(+)/PACAP plasmid were cultured
in 50 ml of LB medium containing 100 mg/ml of
ampicillin overnight at 30
C at 210 rpm. In a parallel
experiment, pET32a(+) vector was transformed into
BL21(DE3) cells, and this served as a negative control.
Then the culture was transferred to 1 liter of fresh LB
medium with 100 mg/ml of ampicillin, and incubated at

Expression and Purication of Grass Carp PACAP

30 C until the OD600 was between 0.6 and 0.8. Then

1 mM IPTG was added for an additional 4 h. Cells were
harvested by centrifugation at 3,000 g at 4
C for 10 min.
The harvested cells were resuspended in 40 ml of
buer A (20 mM imidazole, 500 mM NaCl, and 20 mM
phosphate buer, PB, pH 6.6) supplemented with 1 mM
phenylmethanesulfonyl uoride (PMSF, Amresco, Solon, OH), 1 mM MgCl2 , and 0.2 mg/ml lysozyme. The
suspension was incubated for 30 min at room temperature with a gentle vortex and sonicated at 500 watts
(25%) for 50 cycles (5 s working, 10 s free). The cell
lysate was claried by centrifugation at 13,200 rpm
for 30 min at 4
C.
The claried supernatant was loaded in an IMAC
(Immobilized Metal Anity Chromatography) column
HiTrap FF (Amersham-Pharmacia Bio-Science, Uppsala,
Sweden) packed with 1.0 ml of nickel-iminodiacetic
acid resin equilibrated with 5 column volumes of buer
A. Buer A and buer B (50 mM imidazole, 500 mM
NaCl, and 20 mM PB, pH 6.6) were applied at a ow
rate of 1 ml/min to remove unbound proteins in turn.
Bound proteins were eluted with buer C (500 mM
imidazole, 500 mM NaCl, and 20 mM PB, pH 6.6), and
the eluted protein was desalted with a desalting column
(Sephadex G-25) in buer D (20 mM PB, pH 6.6)
at 4 ml/min. Anity chromatography and desalting
KTA Explorer100 FPLC
proceedings were run on A
(Amersham Biosciences, Uppsala, Sweden). Eluted
protein was monitored by OD at 280 nm, and the protein
concentration was determined by Bradford assay with
bovine serum albumin (Sigma, St. Louis, MO) as the
standard. Finally, the fractions were collected and
applied to 15% SDSPAGE. After Coomassie Brilliant
Blue staining, protein bands were analyzed by optic
densitometry using Quantity One software (Bio-Rad,
Hercules, CA).
In parallel experiments, the fusion partner (including
Trx, the enterokinase site, and the multiple cloning site)
was expressed and puried by methods similar to those
described above. In this case, incubation of E. coli
BL21(DE3) cells containing blank vector was noted at
37
C but not at 30
C.
Western blot assay. Protein samples were separated
by 15% (w/v) SDSPAGE and transferred to PVDF
membrane (Millipore, Billerica, MA) using a semi-dry
transfer apparatus (Bio-Rad, Hercules, CA) according
to the manufacturers instructions. After incubation
with 5% (w/v) non-fat milk in TBS (10 mM TrisHCl,
150 mM NaCl, 0.05% Tween 20, pH 7.4) for 4 h at room
temperature, the membrane was incubated with rabbit
anti-PACAP-27/38 polyclonal antibody (Bios, Beijing,
China) at 1:300 dilution with gentle agitation overnight
at 4
C. After a brief washing step, the membrane was
incubated with horseradish peroxidase-conjugated goat
anti-rabbit IgG (ZSGB-BIO, Beijing, China) at 1:10,000
dilution with gentle agitation for 1 h at room temperature. Finally, protein was visualized with an enhanced

1553

horseradish peroxidase-diaminobenzidine substrate kit

(Tiangen Biotech, Beijing, China).
Bioactivity assay of Trx-PACAP fusion protein. To
test the biological activity of Trx-PACAP, the eect of
Trx-PACAP on T98G human glioblastoma cell proliferation was examined. In this case, T98G cells (1  105
cells/well) were cultured in a 24-well plate (Becton
Dikinson, Franklin Lakes, NJ) in 0.5 ml of RPM-1640
medium (Gibco BRL, Grand Island, NY) supplemented
with 10% fetal bovine serum (PAA, Haidmannweg,
Germany). After the cells were recovered at 37
C under
5% CO2 and saturated humidity for 24 h, the time-course
eect of the Trx-PACAP fusion protein was determined
by incubation with the cells for 48, 72, and 96 h. For
dose-dependent studies, T98G cells were incubated with
increasing concentrations of either the Trx fusion partner
or the Trx-PACAP fusion protein for 72 h. In this
experiment, the eect of the fusion protein on T98G
proliferation was determined with a WST-8 (4-[3-(2methoxy-4-nitrophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]-1, 3-benzene disulfonate sodium salt) assay kit
(Beyotime Institute of Biotechnology, Haimen, China).
Briey, 100 ml of Cell Counting Kit solution was added
to each well after treatment. The plates were then
incubated for additional 3 h, and 100 ml of completely
mixed solution of each sample was collected into a
96-well plate. The absorbance was measured with a
Model 680 micro-plate reader (Bio-Rad, Hercules, CA)
at 450 nm with a reference wavelength of 630 nm. Cell
viability was calculated by the following formula:
Cell Viability OD450 (sample)  OD630 (sample)
=OD450 (control)  OD630 (control):

Results and Discussion

Construction of the plasmid and expression of the
fusion protein
To improve translation eciency, oligonucleotides
for PACAP38 ORF synthesis and amplication were
designed based on the E. coli preferred codons (Fig.
1A). The DNA fragment was subcloned into pET32a(+)
vector, resulting in a Trx-PACAP fusion protein
expression plasmid, pET32a(+)/PACAP (Fig. 1B). In
this study, the BL21(DE3)/pET32a(+) system was
selected for the following reasons: both the ompT and
Lon proteases are decient in the BL21(DE3) strain,
which are important proteases responsible for the
degradation of heterologous proteins; in DE3 lysogen,
the T7 RNA polymerase gene is under the control of
the lacUV5 promoter, which protects the host cells from
the toxicity of the Trx-PACAP fusion protein before
IPTG induction; the T7lac promoter can also be induced
by IPTG to initiate fusion protein expression.24) Thus
the Trx-PACAP fusion protein could be expressed at a
high level in the E. coli expression system.

1554

Z. WANG et al.

A
kDa

B
1

94.0
66.2
45.0
35.0
26.0

22.4 kDa

20.0

14.4
Fig. 2. SDSPAGE (15% gel) Analysis of Total Proteins Expressed in the Supernatant (A) and Pellet (B) of BL21 (DE3).
Lane M, molecular weight marker; lane 1, cell lysate prior to IPTG induction; lanes 2, 3, 4, and 5, samples after 2 h, 4 h, 6 h, and 8 h of IPTG
induction.

A
kDa

B
M

94.0
66.2
45.0
35.0

26.0
20.0

Trx-PACAP38
22.4 kDa

14.4

Fig. 3. SDSPAGE (15% gel, A) and Western Blot (B) Analysis of Samples in Fusion Protein Expression and Purication Procedures.
Lane M, molecular weight marker; lane 1, cell lysate from BL21(DE3) cells transformed with blank vector after 4 h of IPTG induction; lane 2,
supernatant after IPTG induction; lane 3, ow-through fraction from IMAC column; lane 4, elution fraction with 20 mM PB solution (pH 6.6)
containing 500 mM imidazole and 500 mM NaCl.

To test the time-course eect of IPTG induction on

Trx-PACAP fusion protein expression, samples from
the supernatant or the pellet of cell lysate were analyzed
by SDSPAGE after the addition of 1 mM IPTG for
durations as indicated above. Compared with the sample
without IPTG induction, an extra 23-kDa band was
detected in the total protein sample from the supernatant
after 2, 4, 6, and 8 h of induction by IPTG. The size of
this new protein was in accordance with the size of the
Trx-PACAP fusion protein (22.4 kDa, calculated from
the amino acid sequence), and its expression reached a
maximum after 4 h of induction (Fig. 2A). In a parallel
experiment, the new protein in the pellet was signicantly lower in quantity than that in the supernatant
(Fig. 2B), indicating that the fusion protein was mainly
retained in the supernatant in a soluble form (> 85%).
Apparently, fusion of a small peptide to Trx is helpful
in improving protein yield and solubility. Notably, the
expression level of the 23-kDa soluble protein at 37
C

was signicantly less than at 30
C, but the fusion

partner was highly expressed after induction at 37
C
(data not shown).
Purication of the fusion protein
Large scale expression of fusion protein was performed in 1 liter of culture following the procedures
described above. After centrifugation, a Bradford assay
showed that a total of 342 mg of soluble protein was
obtained from the cell lysate. The fusion protein in the
supernatant was then puried by Ni2 -chelating chromatography based on the hexa-histidine tag in the fusion
protein. SDSPAGE analysis revealed the eectiveness
of this one-step purication (Fig. 3). Undesirable proteins caused to ow through the column or were washed
by 50 mM imidazole, and the majority of fusion protein
was eluted by 500 mM imidazole. Densitometry analysis
using Quantity One software showed that the fusion
protein reached more than 36% of the total protein

Expression and Purication of Grass Carp PACAP

Table 1. Purication of Trx-PACAP Fusion Protein from 1 Liter
E. coli Culture

Total proteina Purityb Object proteinc Yield

(mg)
(%)
(mg)
(%)

Cell lysate

342

36

123

IMAC + Desalting

102

97

99

100
80d

Total protein concentration was determined by Bradford protein assay,

using bovine serum albumin as a standard.
b
Purity was determined by densitometry scanning of Coomassie Blue stained
SDSPAGE using Quantity One software (Bio-Rad).
c
The quantity of object protein was calculated based on the % purity.
d
The purication yield was calculated based on the amount of object protein.

Fusion partner
Trx-PACAP

1.2
1
% Cell viability

Purication
Step

1555

0.8
0.6
0.4
0.2
0
48 h

96 h

B
Fusion partner
Trx-PACAP

1.2
1
% Cell Viability

(Fig. 3A, lane 2) and the purity of the fusion protein

reached 97% or more (Fig. 3A, lane 4). The amount of
fusion protein was 123 mg in the supernatant (Table 1).
Finally, a total of 99 mg of fusion protein was obtained
through purication and desaltication, indicating that
the yield of fusion protein was 80% (Table 1). To
conrm the identity of the expressed fusion protein,
Western blot analysis was performed. It showed that
the puried protein was specially recognized by antiPACAP-27/38 antibody (Fig. 3B).

72 h
Time (h)

0.8
0.6
0.4
0.2
0
Control

0.1 nM

1 nM

10 nM
Doses

100 nM 1,000 nM

C
1.2
1
% Cell viability

Characterization of Trx-PACAP fusion protein

Given that the amino acid sequence of grass carp
PACAP38 is highly homologous to sequences reported
for other species11) and that PACAP receptors were
present in T98G human glioblastoma cell line,25) we
used this cell line to test the biological activity of
grass carp PACAP fusion protein. Time-course studies
showed that 100 nM Trx-PACAP fusion protein markedly inhibited T98G cell proliferation after treatment for
48 h, 72 h, and 96 h as compared with the time-matched
controls (fusion partners) (Fig. 4A). The time point
corresponding to maximal eect was 72 h (Fig. 4A).
This inhibitory action was consistently observed in the
same cells exposed to human PACAP.25) On the other
hand, a 72-h incubation of T98G cells with increasing
concentrations of Trx-PACAP fusion protein (0.1
1,000 nM) resulted in a dose-dependent decrease in cell
proliferation. The minimal dose of fusion protein tested
triggering a drop in cell proliferation was noted at 1 nM
(Fig. 4B). In parallel experiments, the Trx fusion partner
did not alter T98G cell proliferation in this regard
(Fig. 4B). To further conrm that the eect of the fusion
protein on cell proliferation was specically caused by
PACAP, PACAP immunoneutralization was performed.
In this case, the responsiveness of T98G cells to TrxPACAP was tested in the presence of anti-PACAP
antibody. The results showed that the inhibitory eect of
Trx-PACAP was totally abolished by anti-PACAP-27/
38 antibody at 1:1,000 and 1:300 dilutions (Fig. 4C).
These results indicate that the fusion partner did not
aect the function of PACAP. They are in agreement
with a report that prion protein fused to blue uorescent
protein retained its biological activity.26) Another nding also showed that the presence of human serum

0.8
0.6
0.4
0.2
0
Control

Trx-PACAP
+1:300
PACAP antibody

Trx-PACAP
+1:1,000
PACAP antibody

Fig. 4. Eects of Trx-PACAP Fusion Protein on T98G Human

Glioblastoma Cell Proliferation.
A, Time-course eects of Trx-PACAP on T98G cell proliferation.
T98G cells were incubated with 100 nM fusion partner or TrxPACAP for 48, 72, and 96 h. B, Dose-dependent eects of TrxPACAP and of the fusion partner on T98G cell proliferation.
Cells were incubated with increasing doses of Trx-PACAP and
of the fusion partner for 72 h. C, Eects of PACAP antibody on
Trx-PACAP inhibited T98G cell proliferation. T98G cells were
incubated with 100 nM Trx-PACAP supplemented with 1:300 or
1:1,000 PACAP antibody or not for 72 h. Cell proliferation was
measured by WST-8 assay. Data presented (mean  SEM, N 5)
are pooled results from three separate experiments. Asterisks denote
signicant dierence (P < 0:05).

albumin (fusion part) on the C-terminus of glucagon-like

peptide-1 did not aect peptide activity, and that the
fusion protein presented a longer action time than the
native peptide.27)

1556

Z. WANG et al.

In conclusion, a grass carp PACAP38 bacterial

expression plasmid was constructed according to the
codon preference of E. coli using a two-step PCR
strategy. A high yield of soluble Trx-PACAP protein
(123 mg/l) was obtained using a BL21 (DE3) E. coli
expression system, and a large quantity of recombinant
PACAP (99 mg/l) was puried with an IMAC column.
Moreover, the biological activity of this peptide was
conrmed by inhibiting T98G human glioblastoma cell
proliferation. This PACAP preparation method is simpler and more cost-eective for large-scale production
than chemical synthesis. Signicant quantities of recombinant grass carp PACAP have the potential to
facilitate analysis of physiological role of PACAP in
sh, as well as to facilitate the development of
applications to sh culture in regard to increasing
evidence of PACAP-inducing GH release in sh models.

Acknowledgments
This work was supported by research grants from the
Program for the New Century Excellent Talents at
University of China (NCEF-06-0814) and the Science
and Technology Committee of Sichuan Province
(05NG002-004, to H.Z.). Special thanks are given to
Dr. Lixia Tang and Dr. Juan Feng (UESTC) for advice
and assistance.

8)

9)

10)

11)

References
1)

2)

3)
4)

5)

6)

7)

Miyata, A., Arimura, A., Dahl, R. R., Minamino, N.,

Uehara, A., Jiang, L., Culler, M. D., and Coy, D. H.,
Isolation of a novel 38-residue hypothalamic polypeptide
which stimulates adenylate cyclase in pituitary cells.
Biochem. Biophys. Res. Commun., 164, 567574 (1989).
Harmar, A. J., Arimura, A., Gozes, I., Journot, L.,
Laburthe, M., Pisegna, J. R., Rawlings, S. R.,
Robberecht, P., Said, S. I., Sreedharan, S. P., Wank,
S. A., and Waschek, J. A., International Union of
Pharmacology. XVIII. Nomenclature of receptors for
vasoactive intestinal peptide and pituitary adenylate
cyclase-activating polypeptide. Pharmacol. Rev., 50,
265270 (1998).
Fahrenkrug, J., PACAP: a multifacetted neuropeptide.
Chronobiol. Int., 23, 5361 (2006).
Delgado, M., Abad, C., Martinez, C., Juarranz, M. G.,
Leceta, J., Ganea, D., and Gomariz, R. P., PACAP in
immunity and inammation. Ann. NY Acad. Sci., 992,
141157 (2003).
Carlsson, P. O., Ostenson, C. G., Efendic, S., Langel, U.,
and Jansson, L., Pituitary adenylate cyclase activating
polypeptide (PACAP) redistributes the blood within the
pancreas of anesthetized rats. Regul. Pept., 63, 123128
(1996).
Wong, A. O., Li, W. S., Lee, E. K., Leung, M. Y., Tse,
L. Y., Chow, B. K., Lin, H. R., and Chang, J. P.,
Pituitary adenylate cyclase activating polypeptide as a
novel hypophysiotropic factor in sh. Biochem. Cell
Biol., 78, 329343 (2000).
Wong, A. O., Li, W., Leung, C. Y., Huo, L., and Zhou,

12)

13)

14)

15)

16)

17)

18)

H., Pituitary adenylate cyclase-activating polypeptide

(PACAP) as a growth hormone (GH)-releasing factor in
grass carp. I. Functional coupling of cyclic adenosine
30 ,50 -monophosphate and Ca2+/calmodulin-dependent
signaling pathways in PACAP-induced GH secretion
and GH gene expression in grass carp pituitary cells.
Endocrinology, 146, 54075424 (2005).
Parker, D. B., Power, M. E., Swanson, P., Rivier, J., and
Sherwood, N. M., Exon skipping in the gene encoding
pituitary adenylate cyclase-activating polypeptide in
salmon alters the expression of two hormones that
stimulate growth hormone release. Endocrinology, 138,
414423 (1997).
Montero, M., Yon, L., Rousseau, K., Arimura, A.,
Fournier, A., Dufour, S., and Vaudry, H., Distribution,
characterization, and growth hormone-releasing activity
of pituitary adenylate cyclase-activating polypeptide in
the European eel, Anguilla anguilla. Endocrinology,
139, 43004310 (1998).
Xiao, D., Chu, M. M., Lee, E. K., Lin, H. R., and Wong,
A. O., Regulation of growth hormone release in common
carp pituitary cells by pituitary adenylate cyclaseactivating polypeptide: signal transduction involves
cAMP- and calcium-dependent mechanisms. Neuroendocrinology, 76, 325338 (2002).
Sze, K. H., Zhou, H., Yang, Y., He, M., Jiang, Y., and
Wong, A. O., Pituitary adenylate cyclase-activating
polypeptide (PACAP) as a growth hormone (GH)releasing factor in grass carp. II. Solution structure of a
brain-specic PACAP by nuclear magnetic resonance
spectroscopy and functional studies on GH release
and gene expression. Endocrinology, 148, 50425059
(2007).
Montero, M., Yon, L., Kikuyama, S., Dufour, S., and
Vaudry, H., Molecular evolution of the growth hormonereleasing hormone/pituitary adenylate cyclase-activating
polypeptide gene family: functional implication in the
regulation of growth hormone secretion. J. Mol. Endocrinol., 25, 157168 (2000).
Lee, L. T., Siu, F. K., Tam, J. K., Lau, I. T., Wong,
A. O., Lin, M. C., Vaudry, H., and Chow, B. K.,
Discovery of growth hormone-releasing hormones and
receptors in nonmammalian vertebrates. Proc. Natl.
Acad. Sci. USA, 104, 21332138 (2007).
Matsuda, K., and Maruyama, K., Regulation of feeding
behavior by pituitary adenylate cyclase-activating polypeptide (PACAP) and vasoactive intestinal polypeptide
(VIP) in vertebrates. Peptides, 28, 17611766 (2007).
Adams, B. A., Gray, S. L., Isaac, E. R., Bianco, A. C.,
Vidal-Puig, A. J., and Sherwood, N. M., Feeding and
metabolism in mice lacking pituitary adenylate cyclaseactivating polypeptide. Endocrinology, 149, 15711580
(2008).
Silverstein, J., Wolters, W., Shimizu, M., and Dickho,
W., Bovine growth hormone treatment of channel
catsh: strain and temperature eects on growth, plasma
IGF-I levels, feed intake and eciency and body
composition. Aquaculture, 190, 7788 (2000).
Abrahams, M. V., and Sutterlin, A., The foraging and
antipredator behaviour of growth-enhanced transgenic
Atlantic salmon. Anim. Behav., 58, 933942 (1999).
Chang, J. P., Wirachowsky, N. R., Kwong, P., and
Johnson, J. D., Pacap stimulation of gonadotropin-II

Expression and Purication of Grass Carp PACAP

19)

20)
21)

22)

23)

secretion in goldsh pituitary cells: mechanisms of

action and interaction with gonadotropin releasing
hormone signalling. J. Neuroendocrinol., 13, 540550
(2001).
Sherwood, N. M., and Wu, S., Developmental role of
GnRH and PACAP in a zebrash model. Gen. Comp.
Endocrinol., 142, 7480 (2005).
Latham, P. W., Therapeutic peptides revisited. Nat.
Biotechnol., 17, 755757 (1999).
Sato, A. K., Viswanathan, M., Kent, R. B., and Wood,
C. R., Therapeutic peptides: technological advances
driving peptides into development. Curr. Opin. Biotechnol., 17, 638642 (2006).
Kane, J. F., Eects of rare codon clusters on high-level
expression of heterologous proteins in Escherichia coli.
Curr. Opin. Biotechnol., 6, 494500 (1995).
Wu, X., Jornvall, H., Berndt, K. D., and Oppermann, U.,
Codon optimization reveals critical factors for high level
expression of two rare codon genes in Escherichia coli:
RNA stability and secondary structure but not tRNA
abundance. Biochem. Biophys. Res. Commun., 313, 89
96 (2004).

24)

25)

26)

27)

1557

Studier, F. W., Rosenberg, A. H., Dunn, J. J., and

Dubendor, J. W., Use of T7 RNA polymerase to
direct expression of cloned genes. Methods Enzymol.,
185, 6089 (1990).
Vertongen, P., Camby, I., Darro, F., Kiss, R., and
Robberecht, P., VIP and pituitary adenylate cyclase
activating polypeptide (PACAP) have an antiproliferative eect on the T98G human glioblastoma cell line
through interaction with VIP2 receptor. Neuropeptides,
30, 491496 (1996).
Arii, Y., Yamaguchi, H., and Fukuoka, S., Production
of a soluble recombinant prion protein fused to blue
uorescent protein without refolding or detergents in
Escherichia coli cells. Biosci. Biotechnol. Biochem., 71,
25112514 (2007).
Chen, J., Bai, G., Cao, Y., Gao, Z., Zhang, Q., Zhu, Y.,
and Yang, W., One-step purication of a fusion protein
of glucagon-like peptide-1 and human serum albumin
expressed in Pichia pastoris by an immunomagnetic
separation technique. Biosci. Biotechnol. Biochem., 71,
26552662 (2007).