Académique Documents
Professionnel Documents
Culture Documents
Sequence 010.abi
Sequencing chromatogram 010.abi was assigned for interpretation. Figure 1
shows the chromatogram upon opening with the free software FinchTV
(http://mac.softpedia.com/get/Math-Scientific/FinchTv/shtml). The sequence
corresponds to a partial gene for a certain protein, thus further analysis is
required to retrieve as much information as possible on protein function,
structure, localisation and evolution.
TGTAAATTTCTCGGGAATAATCAACAGTGTATCATCAGGAAGACCACACTCCCTCAACAAATTGACACT
CTTAGCTTCATCAGCCATTTCGCTTAATGACTGTTGAAGTCGCCGTGCTTCTCCACTCTCTTCTAATGT
ATTATCTGACTTCATATGAGTCACTTGGACATCCGACATGAGTTCTGACAGTGTAATCGTCAGCAAAGC
CCTCAGCCTAGCAGTCTGCATAAAGTATAGCGAGCTCTTAACTAGTATTTGAAGACCAATAACAGCCCT
TTTCCTGACACTGTCATTGCGGTAAACAGCAAGCCGGAGAAGATGGAAGGCTATCTGTTTTAAGAAGCG
ATCATTTTCCCTGGCCCATCAGTGTAGCCCCATGAAGATCAAAGATTCTGTTGAAAATTGGAAAAGAAG
CTTTCCAGAAAGCTAATGACTGGTTTCGGGAGAGAAACTCGTCAGTATTGTAGTAATGCAGTCCAATTT
GCCATAGTCGGTCGCAATATTGTGAGGAGCTGCATGATGAAAAATTTTCAGTGATCTCAAAACTGCAGC
TAACAGTGCACTACATCTCCTCCCAAAGTTCAGTTTTGCTCAAATGGGTGCAGCGATTCTTCTTGTTGA
CTTGGTCTGGAGCTTCATTCGGAAAGAATTGGGCTGACTAAGCCATCTCACTTAGGTACAATCCAGGTG
TGACGATAAGCGA
Table 1. A comparison between the best open reading frames (ORFs) for
the top three possible sequences producing significant alignment to the
query sequence.
Top 3
Possible
Sequences
1*
2*
3*
Figure 4. The identification of the query protein from the identical open
reading frame of the top three possible sequences producing significant
alignment to the query sequence
It is shown that DOCK family guanine nucleotide exchange factor SPIKE 1 from
Arabidopsis thaliana (accession: NP_193367.7) has the most significant
alignment with a maximum score of 3793, a total score of 3793, a 100 % query
cover, an E value of 0.0, and a 100% identity.
Summary
mutant has seedling lethal; trichrome, leaf-shape, cotyledon defects; Putative
Cytoskeletal Protein
Proteomes
UP000006548: Chromosome 4
Functions
GTPase binding
GTP binding
Guanyl-nucleotide exchange factor activity
Located in
Cytosol, plasma membrane, extrinsic component of membrane, endoplasmic
reticulum exit site, nucleus
Domain hits
DHR2_DOCK (accession: cd11684): Dock Homology Region 2, a GEF
domain, of Dedicator of Cytokinesis proteins
DHR2 is one of the two domains of DOCK proteins, which are a family of atypical
guanine nucleotide exchange factors (GEFs) without the usual Dbl homology
(DH) domain. As GEFs, they activate the small GTPases Rac and Cdc42 through
bound GDP exchange for free GTP. DHR2 contains the catalytic GEF activity for
Rac and/or Cdc42.
Marchler-Bauer A et al. (2011), "CDD: a Conserved Domain Database for the functional
annotation of proteins.", Nucleic Acids Res.39(D)225-9.
Marchler-Bauer A et al. (2013), "CDD: conserved domains and protein threedimensional structure.", Nucleic Acids Res. 41(D1):D384-52.
Cellular signaling of Dock family proteins in neural function.Cell. Signal. 2010 Feb; 22(2):175-182
[Regulation of cell morphology and motility by Dock family proteins].Seikagaku 2009 Aug; 81(8):711-716
Structural basis of membrane targeting by the Dock180 family of Rho family guanine exchange factors
(Rho-GEFs).J. Biol. Chem. 2010 Apr 23; 285(17):13211-13222
Structural basis of membrane targeting by the Dock180 family of Rho family guanine exchange factors
(Rho-GEFs).J. Biol. Chem. 2010 Apr 23; 285(17):13211-13222
Identification of novel families and classification of the C2 domain superfamily elucidate the origin and
evolution of membrane targeting activities in eukaryotes.Gene 2010 Dec 1; 469(1-2):18-30
Model Structure
(Provided by ModBase)
template:
the best match after the second blast
copy of the accession number to fuckin ncbi for more info on the query protein
bottom TAIR -- arabidopsis thaliana (function, localisation)
uniprot -- enter the name