Alternative Splicingreview

2004 Nature Publishing Group http://www.nature.
com/naturebiotechnology
REVIEW
Alternative splicing in disease and therapy

Mariano A Garcia-Blanco1,2, Andrew P Baraniak1 & Erika L Lasda1
Alternative splicing is the major source of proteome diversity in humans and thus is highly relevant to disease and therapy. For example, recent work suggests that the long-sought-after target of the analgesic acetaminophen is a neural-specific, alternatively spliced
isoform of cyclooxygenase 1 (COX-1). Several important diseases, such as cystic fibrosis, have been linked with mutations or variations
in either cis-acting elements or trans-acting factors that lead to aberrant splicing and abnormal protein production. Correction of
erroneous splicing is thus an important goal of molecular therapies. Recent experiments have used modified oligonucleotides to inhibit
cryptic exons or to activate exons weakened by mutations, suggesting that these reagents could eventually lead to effective therapies.
Annotation of the human genome reveals a preponderance of complex

genes that produce equally intricate primary transcripts1,2. In humans, a
typical primary transcript, or precursor to messenger RNA (premRNA) contains seven or eight introns and eight or nine exons, which
together average more than 27,000 nucleotides in length. The removal of
introns (RNA splicing) is carried out by spliceosomes, ribonucleoprotein complexes that recognize the exon-intron junctions and catalyze the
precise removal of introns and subsequent joining of exons35.
Alternative splicing is the process by which a single primary transcript
yields different mature RNAs leading to the production of protein isoforms with diverse and even antagonistic functions. Annotation of the
human genome has revealed that the bulk of intron-containing transcripts are alternatively spliced69. A recent study of 10,000 human
genes, which used exon-exon junction microarrays to analyze RNA samples from more than 50 tissues and cell lines, concluded that transcripts
from at least 74% of all multi-exon genes were alternatively spliced7.
This review focuses on the intersection between human disease
and alternative splicing, with an emphasis on molecular therapies that
appear close to clinical application. We begin by providing a brief
overview of alternative splicing (for more comprehensive background,
the reader is referred to several recent reviews1014) and then we highlight important concepts that connect alternative splicing to human disease. To illustrate these concepts, we focus on two diseases with
well-characterized disruptions of splicing regulation: cystic fibrosis (CF)
(which underscores the newly recognized importance of splicing variation as a genetic modifier of disease phenotype) and a rare form of frontotemporal dementia (which highlights the importance of maintaining
precise ratios of alternative protein isoforms). Finally, we conclude with
a discussion of the importance of alternative splicing in conventional and
molecular therapy.
Complex genes and alternative splicing
Primary transcripts of complex protein-coding genes contain introns
that must be removed by the splicing apparatus. The efficiency and
1Department of Molecular Genetics and Microbiology and 2Department
of Medicine and 1Center for RNA Biology, Box 3053, Research Drive,
Duke University Medical Center, Durham, North Carolina 27710, USA.
Correspondence should be addressed to M.A.G.-B. (garci001@mc.duke.edu).
NATURE BIOTECHNOLOGY VOLUME 22 NUMBER 5 MAY 2004
capacity of this apparatus is underscored by calculations of the sheer

number of introns that need to be removed at any one time and the
speed with which introns are removed15. RNA splicing depends on the
proper recognition of exons, which is a challenge, given their small size.
The usual size for a human exon is 300 nucleotides with the average
internal exon measuring only 145 nucleotides in length1,2. Exon recognition in the context of the vastly larger introns is guided in part by partially conserved sequence elements at the exon-intron junctions,
denoted 5 and 3 splice sites.
Figure 1a shows consensus motifs for the major classes of exon-intron
junctions14,1618. Although the discussion in this article focuses solely on
U2-dependent introns, another class of much less common introns,
known as U12-dependent (ATAC) pre-mRNA introns16,18, also exists
that have significantly different splice site sequences.
The recognition of exon-intron boundaries also depends on sequence
elements within exons19,20 and on intronic elements distinct from the
splice sites21,22 (see Fig. 1b). These sequence elements and the factors
that recognize them, are employed for the constitutive definition of
introns and exons23. Likewise, some of these elements and factors can
be engaged to regulate alternative splicing (Fig. 1, bottom layer).
There are several different types of alternative splicing (Supplementary Fig. 1). In rare cases, a whole intron is removed or retained to
give two very different RNAs. Alternative 5 splice sites or 3 splice sites
can result in exons of different size. Inclusion or skipping of one or more
exons is a common form of alternative splicing. Additionally, alternative
splicing of transcripts initiated at different transcription start sites leads
to mature RNAs with different first exons. The 3 terminal exons can also
vary by coupling alternative splicing with alternative polyadenylation.
Finally, a rare form of alternative splicing involves reactions between two
primary transcripts in trans24.
In general, alternatively spliced exons have 5 and 3 splice site motifs
that deviate significantly from the consensus (e.g., see the 5 and 3 splice
site motifs in exons 710 of fibroblast growth factor receptor 2 (FGFR2)
transcripts; Fig. 1a). FGFR2 exons 7 (IIIa) and exon 10 are constitutive
exons, and exons 8 (IIIb) and 9 (IIIc) are alternative exons, which are
included in mature FGFR2 mRNAs in a mutually exclusive fashion.
Exon 8 is found in epithelial cells, exon 9 in fibroblasts.
In addition to the splice sites, exons are defined by cis-acting regulatory elements, which have been divided into four functional categories:
535
REVIEW
a
7
AG guaaca
AG guauau
AG gugagg
10
aucau...u4cu4gcuuc3uugu4cuag GC
G AG g gag u
ua
C
u
G
A
u
c
a c
a
u
c c
Box A
CC
g
gu
C u gc
u a
aa a
c
Box B
Cg
u
...
10
ESS
UAGG(G)
ISE
u3cau5gucu7
ISS
ucu3c2...u4gu2cu3
ESE
UGGAAGAGA4GGAGA
ISS
ucuu...ucu3cu2c
ISAR
...gcgugcaug...
exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs),

intronic splicing enhancers ((ISEs) also known as intronic activators of
splicing (IASs)) and intronic splicing silencers (ISSs) (Fig. 1b). These cisacting elements interact directly or indirectly, with trans-acting activators or repressors of splicing. ESEs activate exons and promote their
inclusion in mature transcripts. Several different families of ESEs have
been recognized; the best studied are purine-rich sequences that act by
recruiting members of the serine/arginine-rich (SR) family of splicing
factors (e.g., ASF/SF2)25. Although ESEs have been implicated in regulated alternative splicing, they appear to play an important role in defining many constitutive exons (e.g., FGFR2 exon 10 in Fig. 1b)19.
Whereas exons are activated by ESEs, they are repressed by ESSs. The
best-characterized ESSs bind heterogeneous nuclear ribonucleoprotein
A1 (hnRNP A1), which has been shown to contribute to FGFR2 exon 8
repression (Fig. 1b)26. HnRNP A1 and SR proteins can play counterbalancing roles in exon definition and their relative levels may determine
tissue-specific alternative splicing outcomes27,28. ISEs can provide constitutive or regulated enhancements of exon definition and can activate
weak exons. The long U-rich element found immediately downstream
of exon 8 in FGFR2 transcripts29,30 exemplifies an ISE (Fig. 1b).
ISSs inhibit exon definition by recruiting splicing repressors that
directly bind and occlude critical cis-acting elements of regulated
exons31 or by recruiting repressors to binding sites that flank regulated
exons creating a zone of silencing32,33. Work from our laboratory
suggests that this is the case for ISS elements that flank FGFR2 exon 8
(ref. 34). ISSs may also prevent inappropriate inclusion of pseudo exons
into mature mRNAs21. ISSs and ISEs have been found to cohabitate in
the vicinity of regulated exons and their actions appear antagonistic35.
Work in our laboratory33 has found that on occasion the same cis-acting
element mediates activation and silencing of two mutually exclusive
exons; we have named these bifunctional elements intronic splicing
activators and repressors (ISARs)36 (Fig. 1c). In epithelial cells, the ISAR
element in FGFR2 transcripts activates exon 8 and represses exon 9.
This particular ISAR element also provides an example of how secondary structures can be regulatory elements; in this case, the secondary
536
Bob Crimi
2004 Nature Publishing Group http://www.nature.com/naturebiotechnology
cuaag...uucuccugugucuguucuag CA ugcuaac...u2c2uc2uc2ugugaucugca2ucuag CG
Figure 1 Cis-acting elements that control splicing. Sequences

around exons 710 of the human FGFR2 pre-mRNA illustrate
the different types of cis-acting elements. Enhancing elements
in green, silencing elements in red, and those with both
activating and silencing function as blue. (a) Three 5 splice
site sequences and three 3 splice site sequences, with proven
or presumed roles in constitutive splicing are illustrated.
RNA sequences are shown, exonic sequences are in capital
letters, intronic sequences in lower case. These human
FGFR2 sequences diverge significantly from the consensus
motifs represented as pictographs in box A (5 splice site) and
box B (branchpointpolypyrimidine tract and 3 splice site)
modified from Lim and Burge17. The arrowheads in the boxes
denote the exonintron junctions and the dot in box B denotes
the branchpoint adenosine. (b) Four types of elements, which
play a role in both constitutive and alternative splicing, have
been found or have been proposed within the FGFR2 pre-mRNA.
FGFR2 exon 10 contains a putative ESE, identified by the
RESCUE-ESE program (http://genes.mit.edu/burgelab/rescueese/)19. Exon 8 contains an ESS that binds hnRNP A1 and
contributes to silencing of this exon, and is flanked by an ISE
(known as IAS1) and by two ISSs (UISS and DISS), which
activate or repress exon 8 respectively. Although some of these
elements are essential to set up regulation of exon choice, it is
assumed that they exert their actions in most cell types. (c) This
panel depicts a complex element that is critical for cell-type
specific FGFR2 exon choice (see text for further details).
structure mediates activation of exon 8 by approximating upstream and

downstream sequences37. The downstream sequence 5-GCGUGCAUG-3 is recognized by a protein trans-acting factor.
Alternative splicing expands the coding capacity of the human
genome, and in some instances the indistinguishable, related, diverse or
antagonistic functions of alternatively spliced isoforms have been determined. In the majority of cases, however, the precise function of each
isoform is not understood. This has led to some skepticism regarding
the prevalence of functionally relevant alternative splicing. Recently, it
has been noted that alternative splicing can lead to the production of
RNA isoforms that appear to be destined for degradation via the nonsense-mediated decay (NMD) pathway38, which targets transcripts with
nonsense codons located more than 50 nucleotides upstream of the last
exon-exon junction39. In some cases, the connection between alternative
splicing and NMD seems to be the result of inappropriate inclusion or
skipping of exons (e.g., FGFR2 transcripts that include both exons 8 and
9 (ref. 40)), which is perhaps an unavoidable side effect of the flexibility
required for regulated splicing41. Thus, NMD provides surveillance for
errors in alternative splicing. In other cases, alternative splicingcoupled
surveillance can be used to downregulate transcript levels by diverting a
larger fraction of these to be dispensed by NMD. Indeed, we42 and others43 have found evidence that several alternative splicing factors can
regulate their own synthesis by this mechanism. Alternative splicing
could also accelerate protein evolution by producing new isoforms that,
although expressed at low levels, can provide organisms with new and
important activities.
Alternative splicing and human disease
A cursory inspection of mutations that have been annotated on the
human genome reveals that about 10% of these affect canonical splice
site sequences (e.g., consensus 5 splice sites). Statistics provided by the
Human Gene Mutation Database (update of January 20, 2004) reveal
that out of 38,177 mutations annotated, 3,659 mutations impinge on
splice sites41,44. This frequency would be expected if the critical splice
site sequences span 20 nucleotides in the vicinity of 3 splice sites and
VOLUME 22 NUMBER 5 MAY 2004 NATURE BIOTECHNOLOGY
REVIEW
10 nucleotides in the vicinity of 5 splice sites of an average 300nucleotide exon1,2. These numbers, however, underestimate the number
of mutations that affect splicing because they do not take into account
the intronic and exonic enhancer and silencer elements described above.
In addition, mutations associated with disruptions in trans-acting factors can result in global splicing defects, which can nonetheless have very
specific phenotypes. It is reasonable to suggest that a large fraction of all
human mutations affect splicing. In certain disease processes, for example tumor progression, alterations in alternative splicing programs can
be a critical component of the pathophysiology, as in the changes
observed in the alternative splicing of rat Fgfr2 transcripts during
prostate tumor progression45. Several recent reviews provide comprehensive discussions of the connections between mutations that affect
splicing and human disease1014.
Mutations that alter splicing in cis can be considered gain-of-splicingfunction mutations if a splicing element is enhanced or created (e.g., creation of a cryptic splice site), or loss-of-splicing-function if a splicing
element is weakened or destroyed (e.g., disruption of an ISE). Both types
of mutations can lead to abnormal exon definition, resulting in inappropriate inclusion or skipping of an exon. Mutations, even single
nucleotide changes, can strengthen, activate or create a new splicing ciselement, or conversely, they can weaken or destroy existing ones.
Relative to the function of the gene product affected, most mutations
have a loss-of-function phenotype, as they usually result in severe disruptions of the open reading frame and often also destabilize the mRNA
through NMD.
Gain-of-splicing-function mutations. Mutations can lead to gain-ofsplicing-function by creating cryptic splice sites, or ESE, ESS, ISE and
ISS elements. One of the first splicing mutations described activates a
cryptic 3 splice site in the -globin gene resulting in +-thalassemia,
which is characterized by severe anemia and sometimes death46,47. A
well-studied example of gain-of-ESS function appears to be important
in determining the severity of spinal muscular atrophy (SMA), an autosomal recessive disorder. SMA is caused by homozygous loss of the survival of motor neurons 1 (SMN1) gene; the severity of the disease is
modified by the production of SMN protein encoded by the paralog
SMN2 (ref. 48). Although SMN2 is nearly identical to SMN1, there is a
CT transition in position 6 of exon 7 (ref. 49) that is believed to create
an ESS that increases skipping of the exon50,51. Only full-length (exon
7+) SMN protein from the SMN2 gene is active and therefore the greater
the skipping of exon 7, the more severe the symptoms among SMA
patients. This ESS is postulated to act via hnRNP A1 because siRNAmediated knockdown of this and the related hnRNP A2 proteins leads to
increased SMN2 exon 7 inclusion50. These results must be cautiously
interpreted, however, because the hnRNP A1/A2 knockdowns were not
complemented. Skipping SMN2 exon 7 has also been attributed to the
inactivation of an ESE by the aforementioned CT transition11, which
raises the possibility that a single nucleotide change could both activate
an ESS and weaken an ESE.
A gain-of-ESE function mutation has recently been reported in the
gene encoding E1 pyruvate dehydrogenase (PDH), which leads to
inappropriate exon definition and production of a deficient enzyme52.
Deficiency in PDH results in a syndrome that includes developmental
delay and lactic acidosis52. As we discuss in detail below, activation of an
ISS may be partially responsible for the variable presentations of atypical
CF. In Supplementary Figure 2, we represent multiple types of gain-ofsplicing-function mutations that can lead to aberrant splicing.
Loss-of-splicing-function mutations. Loss-of-splicing-function
mutations inactivate splicing cis-acting elements. Such mutations were
first noted in studies of -globin transcripts in + thalassemic
patients53. Since the 1980s, inherited diseases have been attributed to
mutations at the canonical splice sites; for instance, in one case of hemophilia B, which is caused by a deficiency of factor IX, the only difference
noted was a GT transversion at the +1 position downstream of exon f
of factor IX53. Disrupting a canonical splice site, an ISE or an ESE can
lead to skipping or altered splicing of exon 3 in the human growth hormone gene, resulting in a dominant condition known as familial isolated
growth hormone deficiency (IGHD II)12,55,56.
Mutations that disrupt splicing elements in the MAPT gene, which
encodes the microtubule-associated protein tau, result in abnormal
ratios of MAPT transcripts that have been found in patients suffering
from an inherited form of dementia (see below). Different types of lossof-splicing-function mutations are summarized in Supplementary
Figure 2.
Mutations and alterations of splicing factors. Mutations and nongenetic alterations of factors required for constitutive or alternative
splicing have also been implicated in the pathophysiology of human disease12. Some forms of retinitis pigmentosa, which results from the loss
of retinal rod photoreceptor cells, are caused by mutations in the constitutive splicing factors PRPF3, PRPF8 and PRPF31 (Table 1). Similarly,
spinal muscular atrophy (SMA) is caused by the lack of SMN1, and perhaps rarely by the lack of SMN2, which are components of the SMN
complex required for assembly of macromolecular splicing factors
(Table 1).
Some cancer-associated chromosomal translocations result in the
formation of fusion proteins involving splicing factors (e.g., SFPQ, better known as PSF, in renal cell carcinoma and FUS interacting protein
(FUSP1) in leukemias and sarcomas; Table 1). Paraneoplastic syndromes have been associated with formation of auto-antibodies to the
alternative splicing factor NOVA-1 and the putative splicing factor
HCC1 (Table 1). In the case of myotonic dystrophy (dystrophia myotonica; DM) the disease phenotype is likely mediated by an unprecedented sequestration mechanism. An expanded CUG repeat in the 3
untranslated region of the dystrophia myotonica protein kinase gene (in
DM1) or an expanded CCUG repeat in intron 1 of the zinc finger protein-9 gene (in DM2) binds and sequesters muscleblind (mbnl) proteins. Recently, Swanson and colleagues57 have shown that mbnl1/
mice show myotonia and RNA splicing defects observed in DM, strongly
suggesting that sequestration of mbnl1 is a cause of DM57 (Table 1). In
Table 1 we have listed splicing factors (proven and presumed) that have
strong ties to human disease.
Although variations in splicing may be critically important in
acquired diseases, such as cancer58, ischemia59 and other common
human disorders, direct links between a specific splicing defect and disease phenotypes have been elusive and thus are not described here.
Nonetheless, we suspect that in the near future significant progress will
be made toward understanding the alternative splicing failings that
cause and/or accompany these acquired diseases. For a more extensive
discussion of this subject, we refer the reader to a recent review by
Faustino and Cooper12.
Splicing variation as a genetic modifier of disease phenotype
Mutations in the CF transmembrane conductance regulator (CFTR)
gene are responsible for classic and atypical CF. Homozygous loss of this
cyclic AMPdependent chloride channel gene leads to male infertility,
pancreatic insufficiency and severe pulmonary disease60. Significant
reduction in the level of full-length functional protein, often arising
from aberrant exon inclusion or exclusion, results in atypical, adult
onset or mono-symptomatic forms of CF61, which exhibit a high degree
of phenotypic variability among affected tissue types and individuals62.
Of the 1,200 known CF diseasecausing mutations (listed at http://
www.genet.sickkids.on.ca/cftr/), between 1320% are thought to affect
537
REVIEW
Table 1 Splicing trans-acting factors associated with human disease

Splicing factora
OMIM numberb Disease associationc
Comments
CUG triplet repeat, RNA-binding protein 1;
601074
Myotonic dystrophy (DM)
CUG-binding proteins may be affected in DM.
166
602538
CUG-binding proteins may be affected in DM.
167
605221
Leukemias and sarcomas
FUSIP1 interacts with the C-terminal region of TLS and
168
Reference
CUGBP1 (CUGBP; NAB50; BRUNOL2)

CUG triplet repeat, RNA-binding protein 2;
CUGBP2 (ETR3)
FUS-interacting protein 1; FUSIP1

(TASR(1 or 2); SRp38; SRRp40; NSSR)
this interaction and perhaps the function of FUSIP1 is

disrupted by the TLS-ERG fusion found in some leukemias
and sarcomas fusion protein.
Fusion, derived from 1216 translocation,
137070
malignant liposarcoma; FUS (TLS)
Glycogen synthase kinase 3-BETA;
Liposarcomas, acute
The FUS gene is translocated in leukemias and sarcomas.
169,170
(many other
references
provided in
OMIM)
myeloid leukemia (AML)
605004
Alzheimer disease (AD)
GSK3B (GSK-3)
Inhibition of GSK3B led to an increase in the inclusion
171,172
of tau exon 10, possibly mediated by SC35. This recent

finding should be carefully examined.
Hydroxymethylglutaryl coenzyme A1a
600701
Alzheimer disease (AD)
(HMGA1a) (HMG-I)
Overexpression of HMGA1a was found to cause aberrant
173
splicing of presenilin-2 transcripts, which is a feature of

sporadic Alzheimer disease (AD). Brains from AD patients
show significant increases in HMGA1a levels.
Muscleblind-like protein 1; MBNL1
606516
(MBNL)
Both classic myotonic dystrophy (myotonic dystrophy-1;
57,174
DM1) and myotonic dystrophy-2/proximal myotonic

myopathy (DM2/PROMM) are likely caused by the
sequestration of MBNL proteins.
Muscleblind-like protein 2; MBNL2 (MBLL) 607327
See MBNL1 above.
57,174
Muscleblind-like protein 3; MBNL3 (MBXL) 300413
See MBNL1 above.
57,174
Neurooncologic ventral antigen 1; NOVA1
Paraneoplastic syndrome
602157
(Ri Ag)
Precursor mRNA-processing factor 3,
Autoantibodies to NOVA1 seen in patients with
175,176
paraneoplastic syndrome.
607301
Retinitis pigmentosa
Saccharomyces cerevisiae, homolog of
Mutations in the PRPF3 gene cause retinitis pigmentosas
177
(RP) in some families.
PRPF3 (PRP3; HPRP3)

606419
S. cerevisiae, homolog of PRPF31
Mutations in the gene encoding PRPF31 cause retinitis
178
pigmentosas in some families.
(PRP31)
607300
S. cerevisiae, homolog of PRPF8 (PRP8
Mutations in the PRPF8 gene cause retinitis pigmentosas in
179
some families.
PRPC8 U5 snRNP-specific protein,

220-K; p220)
RNA-binding motif protein, Y chromosome
400006
Azospermia
family 1, member A1; RBMY1A1
Deletions of the RBMY coding gene(s) have been associated 180,181

with azospermia.
(RBMY; RBM1; RBM2; YRRM1; YRRM2)

Splicing factor HCC1 (HCC1.3; HCC1.4)
604739
Hepatocellular carcinoma
Autoantibodies to HCC1 seen in patients with hepatocellular
182
carcinoma but pathophysiological consequences are not evident.

Splicing factor, proline- and glutamine-rich
605199
Papillary renal cell
SFPQ was fused with the TFE3 gene product as a result of a
carcinoma
translocation in papillary renal cell carcinomas t(X;1)(p11.2;p34).
600354
Spinal muscular atrophy
SMN1 mutations cause SMA.
184
601627
Spinal muscular atrophy
Deletion of SMN2 can also cause SMA.
185
603273
Hay-Wells syndrome
Mutations in the alpha isoform of TP73L protein are associated
186
SFPQ (PSF)
Survival of motor neuron 1, telomeric:
183
SMN1 (SMN; SMNT; T-BCD541)

Survival of motor neuron 2, centromeric,
SMN2 (SMNC; C-BCD541)
Tumor protein p73-like: TP73L p(63)
with altered FGFR2 splicing and developmental abnormalities

in Hay-Wells syndrome.
aFactors
that are proven or presumed splicing factors and have been specifically associated with a molecular phenotype in a disease process. bFind OMIM at (http://www.ncbi.nlm.nih.gov/
entrez/query.fcgi?db=OMIM). cThere are also several examples of variations in the levels and/or subcellular localization of splicing factors (e.g., SR proteins) that correlate with tumor
progression; however, a specific target pre-mRNA has not been identified.
538
splicing, either creating or destroying can1

352
a
onical splice sites or altering ISE, ISS, ESE and
1
381
ESS regulatory elements throughout the 1902
3R
1
kilobase gene. Disease-causing aberrations in
410
2 3
alternative splicing of many of the 27 CFTR
1
383
exons have been reported to cause reduction of
10
functional CFTR transcript levels and to influ1
412
4R
10
2
ence disease severity (Supplementary Table 1).
1
441
The alternative inclusion of CFTR exon 9
10
2 3
has been well studied and attributed to comS305N
N296H
L284L
N279K
plex interactions of polymorphisms in cisb
A
C
C
G
acting regulatory elements and trans-acting
GUGCAGAUAAUUAAUAAGAAGCUGGAUCUUAGC//AAGGAUAAUAUCAAACACGUCCCGGGAGGCGGCAGU
factors62. Although exon 9 CFTR is nonfuncC
C
DEL280K
tional, the amount of exon 9 skipping varies
S305S
N296N
(039% of all CFTR transcripts) even in nora c
c
mal, nonsymptomatic individuals6366. This
u
c
g
u
extent of exon 9 skipping also varies depending
a u
c +11
on the tissue examined. The role, if any, of exon
u +12
+3 a g c
9 alternative splicing in normal individuals is
u a
g +13
g c
u +14
unknown.
S305S 1 C U a
Exon 9 definition is regulated by a polymorS305N 2 A G c
u +16
A
phic 3 splice site, consisting of the TGm locus
C g
(913 UG repeats) immediately followed by
G u
G c
g +19
the Tn locus (a polypyrimidine tract of 5, 7 or
C
9 Us) a consensus AACAG and a noncanonical
G c
+29
5 splice site (AG|guaguu)67. A polypyrimidine
G c
a
tract encoded by a short Tn locus (T5 allele)
ACGUCCCGGGA augcgccgugcugu
leads to increased levels of exon 9 skipping and
is associated with congenital bilateral absence Figure 2 Mutations in the MAPT gene that affect 4R/3R ratio. (a) The schematic shows the six tau
of the vas deferens68. A larger number of UG protein isoforms that are produced as a result of alternative splicing of the MAPT pre-mRNA. (b) Exonic
repeats, encoded by a longer TGm locus acts mutations located in exon 10 that alter the level of exon 10 inclusion in the MAPT mRNA molecule.
as an ISS and in combination with the T5 (c) Proposed stem loop that forms between the 3 end of exon 10 and the intron immediately following
exon 10. Mutations that alter exon 10 inclusion by destabilizing the proposed stem loop are indicated.
allele, leads to even more skipping of exon 9
(refs. 69,70). Enhancement of exon 9 inclusion
relies on a downstream ISE, which binds Tia1
(ref. 71). Inclusion of exon 9 is also dependent on an ESE element, which the adult human brain8386 (Fig. 2a). Alternative splicing of exons 2, 3
is juxtaposed with an antagonizing ESS72.
and 10 in the tau pre-mRNA results in isoforms that differ in their
Several studies have begun to unravel the roles of trans-acting factors N- and C-terminal halves. In the N-terminal half, exons 2 and 3 are
in exon 9 regulation. The nuclear factor, TDP-43, previously recognized alternatively spliced to produce three separate mRNA molecules, which
as a protein that binds the HIV-1 LTR73, is thought to bind the ISS and skip both exons 2 and 3, include exon 2 or include both exons 2 and 3. In
play a role in silencing exon 9 (refs. 74,75). On the basis of overexpres- the C-terminal half, exons 912 encode four microtubule-binding
sion studies, hnRNP A1, polypyrimidine tract-binding protein and var- domains that are imperfect repeats of 31 or 32 amino acids87. Exon 10
ious SR proteins (particularly ASF/SF1) can also repress exon 9, and this is included or skipped independently of the alternative splicing event
appears to be mediated in part by an ISS element in the downstream in the N-terminal half giving rise to the three-microtubule repeat
intron70,72,76,77. Interestingly, these splicing silencing factors do not pro- (3R; exon 10) or the four-microtubule repeat (4R; exon 10+) isoforms
mote exon 9 skipping to an equivalent degree in all cell types tested, sug- of the protein. In normal human brain, the ratio of 4R to 3R is approxigesting an explanation for the tissue-specific differences observed in mately one, and this balanced isoform ratio appears to be essential for
atypical CF7578. Indeed, high levels of TDP-43 and ASF/SF2 are found proper neuronal function8891.
in tissues affected in atypical CF75. Studies on the variable inclusion of
Many neurodegenerative diseases, such as Alzheimer disease, Pick disexon 13 also suggest that individual differences are mediated by changes ease, progressive supranuclear palsy and corticobasal degeneration are
in levels of trans-acting factors79. The studies reviewed above suggest a characterized by the presence of filamentous tau protein deposits92. In
role for splicing cis-acting elements and trans-acting factors as modifiers 1994, an inherited form of fronto-temporal dementia with parkinsonof CF (for a more general discussion, see refs. 80 and 81). Subtle splicing ism was linked to chromosome 17 (FTDP-17)93. Given the neuronal
differences may explain a large fraction of the phenotypic diversity expression of tau, its connection with several neurodegenerative diseases
observed among people suffering from atypical CF61.
and the location of MAPT on chromosome 17, MAPT became a candidate for FTDP-17 (ref. 93). In 1998, three separate studies8991 demonThe importance of isoform ratios in disease
strated that mutations in MAPT resulting in dysfunctional tau protein
Tau is a microtubule-associated protein, which is required for the poly- caused neurodegeneration and provided further evidence for the role of
merization and stability of microtubules as well as axonal transport in MAPT in FTDP-17.
neurons82. Through alternative splicing, MAPT, the gene encoding tau,
Since then, many other tau mutations have been identified as causawhich is located on chromosome 17, can produce six protein isoforms in tive for FTDP-17 (refs. 9497). Mutations in tau that cause FTDP-17 can
Bob Crimi
REVIEW
539
REVIEW
a
PTGS1 (COX-1)
Bcl-x pre-mRNA
1
COX-1 pre-mRNA
Bcl-xL mRNA
Bcl-xS mRNA
1
Nucleus
Cytoplasm
RISC
>1000 m
102 m
IC50 for
Phenacetin
SMN2
IFNs
Valproic acid
Sodium butyrate
brca1
17
6
18
c
8
18
6 8
6 7 8
SMN2
smn2(exon7)
smn1
18
19
17
18
17
10
11
10
19
brca1
17
19
18
19
19
Endonucleasemediated
trans-splicing
11
17
18
17
19
AS
oligonucleotides
tau
9
18
17
Group I ribozymemediated trans-splicing
Cryptic
19
Nucleus
Cytoplasm
AS
oligonucleotides
19
Spliceosomemediated
trans-splicing
6 7 8
Cryptic
19
ESE
Topo II
globinth
1
Bcl-xL
E1694X
17
Bcl-xL
Bcl-xS
smn1
SR proteins
Aclarubicin
COX-3
COX-1
19
Restoration of BRCA1 function

U1 snRNP
hnRNP A1
SMN2
6
BRCA1
ASF/SF2
17
SMN2
Gems
SMN2
Gems
(RS)n
18
ESE
19
17
18
19
brca1E1694X
17
18
17
18
19
(RS)n
SMN2
brca1E1694X
17
19
(RS)n
17
19
18
19
TOES
ESSENCE
70K
(RS)n
GSF
TOSS
(RS)n
18
70K
U1
GSF
U1
70K
GSF
U1
Bob Crimi
Figure 3 Alternative splicing and therapy. (a) The schematic shows the alternative retention of the first intron in PTGS1 (cox-1) transcripts that leads to the
synthesis of COX-1 and COX-3 isoforms. The latter is more sensitive to phenacetin. (b) The schematic shows the paralogs SMN2 and a mutant allele of the
more telomeric smn1. The regions spanning exons 6 through 8 of the primary transcripts are shown. The C to U difference in exon 7 of the two transcripts is
indicated. This difference leads to skipping of exon 7 in a significant proportion of SMN2 transcripts (see text). The schematic summarizes the use of IFNs,
valproic acid and sodium butyrate to enhance transcription of SMN2. Enhancement of exon 7 inclusion by treatment with valproic acid, sodium butyrate and
acalrubicin, perhaps mediated by increases in levels of SR proteins, is also indicated. Green arrows indicate demonstrated effects and dashed green arrows
(or dashed red inhibitory lines) indicate weak or presumed effects. (c) A thalassemic allele of human -globin leads to production of a primary transcript that
contains a cryptic exon, which is included in the majority of the -globin mRNAs. Antisense oligonucleotides (red arrows) can block the splice sites flanking
the cryptic exon leading to a reduction in the inclusion of the cryptic exon. Similarly, antisense oligonucleotides can be used to reduce the ratio of exon 10+
to exon 10 MAPT transcripts. The inset shows the mechanism of action of a 5 splice site blocking antisense oligonucleotide that prevents U1 snRNP
binding. (d) Schematics show variation of antisense oligonucleotides with bifunctional reagents (ESSENCE, TOES and TOSS). One half of the therapeutic
reagent targets it to the correct location within the primary transcript and the second component of the reagent provides either activating or silencing
function (see text for further details). Insets provide schematics for the presumed mechanism of action. (e) Isoform-specific RNAi is presented in this panel.
Exon-specific siRNAs (or micro RNAs) can be deployed to selectively destroy the mRNA encoding the anti-apoptotic Bcl-xL while not affecting the levels
of the mRNA encoding the pro-apoptotic Bcl-xS. (f) The panel shows three distinct methods that can revise BRCA1 RNAs to change ratios of alternative
splicing isoforms. The goal of the therapeutic intervention is to increase the production of BRCA1 exon 18+ wt. The first method uses spliceosome-mediated
RNA trans-splicing to mutant pre-mRNAs. The other two methods modify mRNA pools in the cytoplasm using Group I intronmediated trans-splicing or
archeal tRNA endonuclease mediated trans-splicing.
540
REVIEW
be classified into two categories: first, missense or deletion mutations in
the coding region that alter the ability of the tau protein to associate with
microtubules; and second, mutations that affect the alternative splicing
of tau exon 10, which either increase or decrease exon 10 inclusion and
consequently alter the 4R/3R isoform ratio, eventually leading to the
development of FTDP-17 (refs. 8991).
Missense, silent and deletion mutations in exon 10 as well as mutations downstream of the 5 splice site have been identified in cases of
FTDP-17 (refs. 8991,94,9698) (Fig. 2b,c). The identification of these
mutations has provided a place to start investigating the mechanism of
exon 10 inclusion. These studies have revealed that the alternative splicing of exon 10 is determined by a complex interplay between ESEs and
ESSs, ISEs and ISSs98101. Mutation N279K in exon 10, a TG transversion (UG in the transcript; Fig. 2b), has been proposed to cause an
increase in exon 10 inclusion by strengthening a purine-rich ESE,
improving the sequence from AAUAAGAAG to AAGAAGAAG98,102.
The function of the enhancer is further supported by the Del280K
mutation, which deletes an AAG repeat from the ESE, resulting in a
decrease in exon 10 inclusion and a decrease in the 4R/3R tau ratio98.
The exonic ESE is believed to recruit Tra2, which binds the AAG repeat
and enhances inclusion of exon 10 (ref. 103). A silent mutation, L284L,
downstream of the exonic enhancer, disrupts the ESS UUAG to UCAG
(Fig. 2b), which allows an increase in exon 10 inclusion98.
Several other splicing mutations occur in intron 10 immediately
downstream of the 5 splice site. These mutations are thought to destabilize a stem-loop structure that forms between the end of exon 10 and the
5 splice site (Fig. 2c), resulting in increased recognition of exon 10 by
the U1 snRNP and subsequently an increase in exon 10 inclusion8991,94,98,100,104. Although the presence of the stem loop has been
debated, in vitro data confirm that the sequences can form a stem-loop
structure101. Furthermore, in vivo work has subsequently shown that the
extent of exon 10 inclusion is inversely proportional to the stability of
the proposed stem8991,94,98,100,101,104. The number and diversity of the
mutations involved in FTDP-17 cases highlight the importance of the
proper regulation of exon 10 inclusion. This complex alternative splicing regulation allows for production of equivalent amounts of the 4R
and 3R tau isoforms, which is necessary for proper neuronal function.
Conventional therapeutics
With the recognition of the importance of splicing defects in human
disease has come a realization that constitutive and regulated splicing
reactions are potential therapeutic targets. Many different approaches
from conventional small-molecule drugs to RNA-based gene therapy
have been proposed, but in this section, we focus on those therapies with
a proven track record and speculate on potential therapeutic interventions yet to be validated.
Targeting protein isoforms. Many diverse protein isoforms have
unique properties and can be differentially affected by pharmacological
agents105. Therefore, the most basic level at which alternative splicing
can affect therapeutics, and perhaps the level most likely to lead to efficacious and widely used therapy in the short term, is the development of
isoform-specific small molecules.
A salient example of isoform-specific pharmacology is provided by
the nonsteroidal anti-inflammatory drugs (NSAIDs; e.g., ibuprofen).
NSAIDs inhibit COX enzymes, which catalyze a critical reaction in
prostaglandin synthesis. COX isoforms are produced by transcription
from two genes, PTGS1 (also known as COX1) and PTGS2 (also known
as COX2)106. The development of drugs with COX-2 specificity (e.g.,
celecoxib) has changed recent medical practice by reducing upper gastrointestinal complications of nonselective NSAIDs107. More recently, Simmons106 and his colleagues108 have discovered novel COX-1
isoforms derived from the alternative splicing of PTGS1 transcripts in

dog cells (Fig. 3a). Two isoforms, COX-3 and PCOX-1a, are expressed
differentially in both dog and human tissues, showing the highest level
of expression in the cerebral cortex107,109. A COX-3 isoform has also
been observed in mouse neural tissues109. COX-3, which is the best studied of these isoforms, is encoded by an mRNA that retains the 90nucleotide intron 1 in the PTGS1 gene (Fig. 3a). This leads to the
production of a protein with an additional 30 amino acids inserted into
the N-terminal signal peptide. COX-3 is about threefold less active than
COX-1, but more importantly, COX-3 is significantly more sensitive to
analgesics and antipyretics, such as phenacetin and its metabolite acetaminophen. Acetominophen, which has been classified as an NSAID,
shows little anti-inflammatory activity in most tissues; however, data
from the 1970s show that this drug inhibits a COX activity from dog
brain extracts110. It appears that alternative splicing of COX-1 transcripts to produce COX-3 in the cerebral cortex may explain the unique
pharmacology of this commonly used drug (Fig. 3a).
Furthermore, the discovery of these novel COX-1 isoforms promises
the development of novel isoform-specific inhibitors. Considering estimates that 75% of transcripts are alternatively spliced and the prediction that many of the resulting isoforms will have unique functions, the
number of relevant pharmacological targets is enormous. Although the
example above illustrates the development of inhibitors, one can equally
envision the use of pharmacological agonists that activate in an isoformspecific fashion. Nonconventional therapeutics, such as monoclonal
antibodies, can also be specifically directed at unique protein isoforms111.
Targeting expression. In addition to directly inhibiting the final products of alternative splicing, small molecules can also affect gene expression directly. Several attempts have been made to use this strategy in the
treatment of SMA, specifically to activate the inclusion of exon 7 in
SMN2 transcripts (Fig. 3b). Given data that suggest the benefits of
increasing SMN2 gene dosage, a possible approach is to increase transcription of the SMN2 gene. This has been accomplished by treatment
with interferons (IFNs), which presumably act via an IFN response element found in the promoter of both SMN genes112. Stimulation of transcription also appears to be the major effect of valproic acid treatment of
fibroblast cultures from SMA patients51,113. A slight effect that specifically increased the ratio of exon7+ to exon7 SMN2 transcripts was
noted with valproic acid treatment and could be attributed to increases
in the levels of several SR proteins113. A similar general transcriptional
effect could also explain, at least in part, the results observed when a
mouse SMA model system was treated with sodium butyrate114. In this
study, sodium butyrate administration to pregnant mice led to a modest
decrease in affected pups among progeny from intercrosses of
SMN1+/SMN2+/+ mice114. Butyrate and valproic acid inhibit histone
deacetylases (HDAC), and this inhibition in turn leads to increased transcription of many genes (see ref. 115 and references therein). Several of
these agents have already been used for other conditions; butyrate has
been used in sickle cell disease116 and valproic acid is currently used as
an anti-epileptic agent and is being investigated for use in migraine and
bipolar disorders117. Aclarubicin, a catalytic inhibitor of topoisomerase
II118, also increases the level of SMN protein by increasing the inclusion
of SMN2 exon 7 (ref. 119). The mechanism of action of aclarubicin on
SMN2 has not been elucidated, but treatment leads to subcellular redistribution of SR proteins119. The above studies, although very preliminary, suggest the potential for compounds that would target alternative
splicing decisions indirectly by an effect on transcription. Clearly, these
agents tend to modulate gene expression globally and thus do not
provide gene-specific correction; nevertheless, they may still provide a
therapeutic effect.
541
REVIEW
Targeting splicing factors. Agents that target splicing factors or
enzymes that modify splicing factors have also been reported. For
instance, a novel inhibitor of Clk1/Sty kinase, which phosphorylates SR
proteins, was shown to affect ASF/SF2-dependent splicing120. Also
intriguing was the effect on caspase 9 and Bcl-x alternative splicing of
gemcitabine, an agent that increases intracellular levels of ceramide121.
Another report suggests that different steroid hormones have remarkably different effects on alternative splicing of transcripts that are produced from steroid hormonedependent genes122. This effect, which is
mediated by recruiting unique receptor coactivators, opens up the possibility that the pharmacological action of steroid hormone antagonists
may be mediated by affecting the activity of alternative splicing factors.
Therapeutic interventions on alternative splicing factors are expected to
have pleiotropic results affecting multiple transcripts. Although this
could present a problem, there are many examples of agents with
pleiotropic effects that produce effective therapeutic action.
Oligonucleotide-mediated therapies
Gene-specific therapy can be mediated by oligonucleotides or oligonucleotide-like compounds, some of which have been shown to have clinical effectiveness in other applications123,124. Gene-specificity is
accomplished by targeting the oligonucleotides by base pairing to the
desired transcript and to specific cis-acting elements within the transcript125. Oligonucleotide-based therapies have been used to inhibit or
to activate specific splicing events, accomplishing this either by binding
an element and sterically blocking its activity or by binding an element
and recruiting effectors to this site. Chemical modifications, such as a
2-O-methyl group or a morpholino backbone, prevent degradation of
the targeted precursor transcript, coaxing it toward the desired splicing
outcome.
Antisense revisited. Since antisense oligonucleotides were first used
in the 1970s by Zamecnik and Stephenson126,127 to inhibit Rous sarcoma virus in tissue culture, their potential in human therapy has
remained much anticipated, but largely unrealized. In this section, we
review what appears to be a novel application of antisense technology to
treat splicing disorders.
Many human -thalassemias are caused by mutations that map
within the human -globin intron 2 and lead to the formation of alternative and nonfunctional transcripts by activating cryptic splice sites
(Fig. 3c). The use of these cryptic splice sites has been abrogated in vitro
and in vivo by blocking these sites with antisense oligonucleotides; this
leads to the synthesis of normal hemoglobin A in human erythroid progenitor cells from thalassemic individuals125,128,129 (Fig. 3c). Sustained
correction of the -thalassemic phenotype in human hematopoietic
stem cells has also been achieved by lentiviral delivery of a vector
expressing an antisense RNA130. In some cases, the RNAs have been
modified to contain small nuclear RNA (snRNA) structures that
enhance their activity131,132. Similar approaches using different formulations of antisense oligonucleotide-like molecules have been used to
correct aberrantly spliced CFTR transcripts133 and dystrophin transcripts134,135, among others (see ref. 125 for an extensive list of targets).
Antisense oligonucleotides have also been used to modulate normal
alternative splicing events in BCL2L1 (also known as Bcl-x) transcripts136 and interleukin-5 receptor-alpha transcripts137, and to
attempt to restore normal 4R/3R isoform ratios of MAPT transcripts138 .
Although many of the aforementioned studies have been carried
out in cell culture, there have been some impressive examples of
the antisense oligonucleotides affecting splicing in animals. In one case
an enhanced green fluorescent protein (EGFP) reporter was interrupted with the -globin second intron from the -thalassemia-654,
which results in aberrant splicing and lack of EGFP production (see
542
Fig. 3c)139. Transgenic mice bearing this reporter were treated with several formulations of antisense oligonucleotides targeting the cryptic
splice sites. Efficacious formulations were identified by assaying for
EGFP fluorescence139.
In a second example, antisense oligonucleotides were used to treat
mdx mice, which are a model for Duchenne muscular dystrophy. These
animals harbor a nonsense mutation within exon 23 in the gene that
encodes dystrophin. Transcripts that include exon 23 encode nonfunctional dystrophin, whereas skipping of exon 23 leads to the production
of a shortened, but partially functional, dystrophin. Mdx mice were
treated (muscle was injected or transfected) with 2-O-methyl antisense
oligoribonucleotides targeting the splice sites of exon 23 to induce skipping of this exon140,141. The treated mdx mice show normal levels of
dystrophin production in many muscle fibers and improved muscle
function140,141. Although these studies give cause for optimism, it
should be noted that rigorous determination of specificity for these
methods is still lacking. These experiments demonstrate the potential
for the antisense approach to inhibit splicing function, resulting in exon
skipping. Antisense inhibition of either an ESS or an ISS, however, could
lead to activation of an exon.
Bifunctional oligonucleotides. The antisense approach has been
enhanced by the use of bifunctional reagents that contain an antisense
targeting domain and an effector domain, which either silences142 or
activates143,144 a targeted exon. One intriguing formulation created a
hybrid protein nucleic acid (PNA)peptide oligomer where the binding
domain targeted two exons postulated to have weak ESEs: exon 18 of
BRCA1 containing a nonsense mutation (E1694X) and exon 7 of SMN2
(refs. 143,144) (Fig. 3d). The effector domain of these oligomers were
peptides with 5, 10 or 15 arginine-serine (RS) repeats, the activity of
which was predicated on data that strongly suggest that recruitment of
RS repeats is sufficient to mediate the ESE-dependent exon activation of
SR proteins145,146. The targeted PNA-(RS)n oligomer activated the inclusion of the two weak exons, whereas nontargeted PNA-(RS)n oligomer
did not144. This clever formulation, dubbed ESSENCE (exon-specific
splicing enhancement by small chimeric effectors) may be useful to activate weak exons either mutated in disease or naturally weak in normal
individuals.
Nevertheless, several issues remain unresolved and must be carefully
evaluated before the methodology can be considered a contender for
therapy147149. First, the mechanism of action of these PNA-(RS)n
oligomers is not clear, particularly because the PNA moiety alone
showed substantial activity (could this be an antisense effect blocking an
ESS?) and because the importance of the arginine residues versus the
presence of positive charges was not evaluated (could a basic residue
enhance binding?). Second, the degree of exon-specificity remains to be
determined. Third, and most important, these experiments were exclusively carried out in extracts, and ESSENCE must be evaluated for efficacy and specificity in living cells in culture and in model organisms.
A second formulation of bifunctional oligomers uses a 2-O-methyl
modified binding domain and an effector domain that contains binding
sites for known splicing factors142,143. The effector function of these
oligomers is mediated by indirect recruitment of splicing factors via
their binding sites (Fig. 3d). The first example uses a bifunctional
oligonucleotide that, because it includes the sequence 5-GGAGGA-3
repeated three times, was predicted to recruit ASF/SF2 and act as an
ESE143. This method has been named TOES (targeted oligonucleotide
enhancer of splicing148). When the ESE-containing oligonucleotides
were targeted to SMN2 exon 7, they promoted its inclusion in cell-free
in vitro splicing reactions143. More importantly, when these bifunctional
reagents were transfected into fibroblasts from SMA patients, they
increased the level of endogenous exon 7+ SMN2 transcripts from 60%
REVIEW
to close to 85%, which is the level seen in fibroblasts of normal individuals. Increased inclusion of exon 7 was predicted to increase the level of
functional SMN protein expression that accumulates in gems, which are
nuclear bodies believed to coordinate the assembly of snRNPs150, and
indeed treatment with the ESE-containing oligonucleotide increased the
number of nuclei containing gems (13% compared with 23% in controls) and the number of gems per positive nucleus143. This level of
expression of SMN would be expected to ameliorate disease severity,
perhaps to levels seen in the milder type III SMA151.
A similar approach was used to alter the alternative splicing of
endogenous BCL2L1 transcripts to diminish the Bcl-xL/Bcl-xS ratio in
cancer cells in culture. In this case, the bifunctional oligonucleotide tethered an hnRNP A1binding ESS and inhibited the use of the alternative
5 splice site used to create the BCL2L1 mRNA142 (Fig. 3d). By analogy,
we will refer to this as TOSS (for targeted oligonucleotide silencing of
splicing). Given that the Bcl-xL is an anti-apoptotic isoform and Bcl-xS
is pro-apoptotic, lowering the Bcl-xL/Bcl-xS ratio is predicted to tilt the
balance towards apoptosis. Although this was not evaluated in this
study, previous work using the antisense approach described above had
shown that lowering the Bcl-xL/Bcl-xS ratio led to an apoptotic
response152. The intriguing studies on TOES and TOSS suggest that
these methods can be efficacious in living cells and promise trials in living animals to deal with issues of delivery.
As is true for ESSENCE, the TOES and TOSS methodologies need to
be evaluated for global specificity because off-target effects must be
avoided. All of these technologies could produce decoy effects mediated
either by (RS)n peptide interactions with cellular proteins or by ESE- or
ESS-factor interactions independent of target binding. Although TOES
and TOSS have the crucial edge over ESSENCE in having been shown to
be effective in living cells against endogenous targets, all three formulations of bifunctional reagents must be tested in animal model systems.
Given current experience in testing oligonucleotides in animals and in
humans, we suspect that these studies will not be long in coming.
Efficiency in animals and humans will likely be limited by general problems with delivery and specificity, which will need to be carefully
addressed.
Isoform-specific RNA interference. A final variation of the oligonucleotide theme involves the use of exon-specific RNA interference
(RNAi). Much has been written recently about this powerful system that
can effectively and specifically knock down transcript levels. For reviews
of the phenomenon, particularly as it offers promise for therapeutics, we
refer the reader to recent reviews153155. Given the specificity of RNAi
and the possibility of harnessing it to knock down specific mRNA isoforms156, we propose that exon-specific RNAi could be a potential therapeutic to alter the ratios of alternative splicing isoforms (Fig. 3e).
RNA-based corrective therapy
A group of methodologies that have been developed to reprogram
mRNAs can be used to modify the outcome of alternative splicing
decisions. RNA reprogramming can be achieved at multiple sites during
the process of gene expression (Fig. 3f)157,158. The earliest target for
RNA revision is the nascent primary transcript, where alternative splicing reactions can be redirected to preferentially express certain isoforms over others. We have used the nascent transcript as the target for
spliceosome-mediated RNA trans-splicing (SMaRT)157,159. Endogenous
spliceosomes catalyze splicing of an exon in the target transcript with an
exon in an engineered pre-trans-splicing molecule (PTM)157 (Fig. 3f). In
the hypothetical example presented in Figure 3f, the PTM exon replaces
the coding information so that all trans-spliced products would include
exon 18, which would otherwise be rarely included. PTM targeting is
accomplished by base pairing interactions, which could also provide an
antisense effect. After successful trans-splicing, the reprogrammed

mRNA is transported to the cytoplasm and translated to produce the
desired protein isoform. This method has recently been applied to
redirect alternative splicing of MAPT transcripts in neuroblastoma
cells in culture (J.M. Gallo, personal communication), and its potential
has been underscored by studies of our collaborators160,161 that have
revised endogenous mRNAs and restored protein function in cell culture and in animals.
The most important application of SMaRT to date is the production
of functional factor VIII and the transient correction of the bleeding
phenotype in a mouse model of hemophilia A (factor VIII deficiency)161. Although these studies merit cautious optimism, there are
many potential limitations to this methodology in reprogramming
alternative splicing. For example, the specificity of spliceosomemediated trans-splicing has not yet been completely ascertained, and
competing reactions (e.g., nonspecific trans-splicing) may lead to
expression of undesirable products. Moreover, this and the two technologies described below depend on distribution of genes into cells and
tissues in living organisms, and thus share with all gene-therapy
approaches the complex issue of delivery.
Two other trans-splicing technologies can alter isoform ratios post
facto by modifying mature mRNAs. After nuclear RNA processing and
nucleocytoplasmic transport, mRNAs can be reprogrammed using
group I ribozyme mediated trans-splicing (Fig. 3f). This reaction, which
provided the first example of RNA correction162, requires the expression
of a targeting transcript that encodes both a trans-splicing group I
intron enzyme and the coding sequence to be included in the revised
RNA. Group I ribozymemediated trans-splicing has been used to effect
mRNA repair in cells in culture163,164, but has yet to restore function in
animals. Questions remain about specificity for group I trans-splicing
mRNA reprogramming.
A third and significantly different method to revise messages uses a
tRNA splicing endonuclease, from the archeon Methanococcus jannaschii, that can carry out both cis- and trans-splicing in mouse NIH3T3
cells in culture165 (Fig. 3f). Expression of the endonuclease and a targeting RNA led to the reprogramming of exogenous luciferase transcripts
and of endogenous carnitine acetyl transferase (Crat) transcripts. Unlike
the two other methods described above, functional targeting depends
not only on base pairing, but also on the formation of a bulge (3 nucleotide)-helix (4 nucleotide)-bulge (3 nucleotide) structure between the
mRNA and the targeting RNA (Fig. 3f). The archeal endonuclease precisely cleaves the target and the targeting RNAs in the bulges, and
endogenous enzymes ligate the cleaved RNAs. These reactions result in
the production of two new transcripts: an RNA that contains the 5 end
of the targeting RNA ligated to the mutated 3 portion of the target (not
shown); and a reprogrammed target mRNA, where the 5 part of the target mRNA has been ligated to the 3 portion of the targeting RNA. The
requirement for a bulge-helix-bulge structure suggests that the specificity of this trans-splicing reaction could be higher than that achieved
by simply base pairing in group I and spliceosome-mediated transsplicing reactions. On the other hand, the efficiency of the archeal
enzyme may be limited in the mammalian cell milieu. This issue has not
been addressed and awaits careful quantification of reprogrammed
mRNA levels and protein function. Obviously, this study must also be
followed by reports that generalize this methodology to other targets
with divergent target sequences and that extend its utility to animals.
Perspectives
Alternative splicing multiplies the number of targets for conventional
therapy (the pharmaco-proteome). Alternative splicing errors caused
by mutations in cis-acting elements and by defects or imbalances in
543
REVIEW
trans-acting factors also provide critical points for intervention.
Molecular approaches to therapy can target the pre-mRNA or the splicing factors, or can alter isoform ratios by reprogramming abnormal
mRNAs. Clearly, progress in research targeting molecular therapies at
alternative splicing has been rapid and the field is quickly moving closer
to clinical application.
Note: Supplementary information is available on the Nature Biotechnology website.

ACKNOWLEDGMENTS
The authors thank Ed Otto and Jean-Marc Gallo for critically reading the
manuscript, and members of the Garcia-Blanco laboratory for helpful suggestions.
The authors also thank Annette Kennett for help in preparing the manuscript and
Candy Webster for expert work on the figures. M.A.G.-B. acknowledges support
from National Institutes of Health grants RO1 GM63090 and R33 CA97502.
COMPETING INTERESTS STATEMENT
The authors declare competing financial interests (see the Nature Biotechnology
website for details).
Published online at http://www.nature.com/naturebiotechnology/
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
26.
544
Venter, J.C. et al. The sequence of the human genome. Science 291, 13041351
(2001).
Lander, E.S. et al. Initial sequencing and analysis of the human genome. Nature 409,
860921 (2001).
Garcia-Blanco, M.A., Ghosh, S. & Lindsey-Boltz, L.A. The phosphoryl transfer reactions
in pre-messenger RNA splicing. in RNA. (eds. Soll, D., Nishimura, S. & Moore, P.B.)
109123 (Pergamon, Amsterdam, 2001).
Jurica, M.S. & Moore, M.J. Pre-mRNA splicing: awash in a sea of proteins. Mol. Cell
12, 514 (2003).
Nilsen, T.W. The spliceosome: the most complex macromolecular machine in the cell?
Bioessays 25, 11471149 (2003).
Modrek, B. & Lee, C.J. Alternative splicing in the human, mouse and rat genomes is
associated with an increased frequency of exon creation and/or loss. Nat. Genet. 34,
177180 (2003).
Johnson, J.M. et al. Genome-wide survey of human alternative pre-mRNA splicing with
exon junction microarrays. Science 302, 21412144 (2003).
Sorek, R., Shamir, R. & Ast, G. How prevalent is functional alternative splicing in the
human genome? Trends Genet. 20, 6871 (2004).
Resch, A. et al. Assessing the impact of alternative splicing on domain interactions in
the human proteome. J. Proteome Res. 3, 7683 (2004).
Caceres, J.F. & Kornblihtt, A.R. Alternative splicing: multiple control mechanisms and
involvement in human disease. Trends Genet. 18, 186193 (2002).
Cartegni, L., Chew, S.L. & Krainer, A.R. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat. Rev. Genet. 3, 285298 (2002).
Faustino, N.A. & Cooper, T.A. Pre-mRNA splicing and human disease. Genes Dev. 17,
419437 (2003).
Musunuru, K. Cell-specific RNA-binding proteins in human disease. Trends
Cardiovasc. Med. 13, 188195 (2003).
Roca, X., Sachidanandam, R. & Krainer, A.R. Intrinsic differences between authentic
and cryptic 5 splice sites. Nucleic Acids Res. 31, 63216333 (2003).
Goldstrohm, A.C., Greenleaf, A.L. & Garcia-Blanco, M.A. Co-transcriptional splicing of
pre-messenger RNAs: considerations for the mechanism of alternative splicing. Gene
277, 3147 (2001).
Burge, C.B., Padgett, R.A. & Sharp, P.A. Evolutionary fates and origins of U12-type
introns. Mol. Cell. 2, 773785 (1998).
Lim, L.P. & Burge, C.B. A computational analysis of sequence features involved in
recognition of short introns. Proc. Natl. Acad. Sci. USA 98, 1119311198 (2001).
Patel, A.A. & Steitz, J.A. Splicing double: insights from the second spliceosome. Nat.
Rev. Mol. Cell. Biol. 4, 960970 (2003).
Fairbrother, W.G., Yeh, R.F., Sharp, P.A. & Burge, C.B. Predictive identification of
exonic splicing enhancers in human genes. Science 297, 10071013 (2002).
Cartegni, L., Wang, J., Zhu, Z., Zhang, M.Q. & Krainer, A.R. ESEfinder: A web resource
to identify exonic splicing enhancers. Nucleic Acids Res. 31, 35683571 (2003).
Fairbrother, W.G. & Chasin, L.A. Human genomic sequences that inhibit splicing. Mol.
Cell. Biol. 20, 68166825 (2000).
Zhang, X.H., Heller, K.A., Hefter, I., Leslie, C.S. & Chasin, L.A. Sequence information
for the splicing of human pre-mRNA identified by support vector machine classification. Genome Res. 13, 26372650 (2003).
Berget, S.M. Exon recognition in vertebrate splicing. J. Biol. Chem. 270, 24112414
(1995).
Labrador, M. & Corces, V.G. Extensive exon reshuffling over evolutionary time coupled
to trans-splicing in Drosophila. Genome Res. 13, 22202228 (2003).
Graveley, B.R. Sorting out the complexity of SR protein functions. RNA 6, 11971211
(2000).
Del Gatto-Konczak, F., Olive, M., Gesnel, M.C. & Breathnach, R. hnRNP A1 recruited to
an exon in vivo can function as an exon splicing silencer. Mol. Cell Biol. 19, 251260
(1999).
27. Zhu, J., Mayeda, A. & Krainer, A.R. Exon identity established through differential
antagonism between exonic splicing silencer-bound hnRNP A1 and enhancer-bound
SR proteins. Mol. Cell 8, 13511361 (2001).
28. Caceres, J.F., Stamm, S., Helfman, D.M. & Krainer, A.R. Regulation of alternative
splicing in vivo by overexpression of antagonistic splicing factors. Science 265,
17061709 (1994).
29. Del Gatto-Konczak, F. et al. The RNA-binding protein TIA-1 is a novel mammalian
splicing regulator acting through intron sequences adjacent to a 5 splice site. Mol. Cell
Biol. 20, 62876299 (2000).
30. Del Gatto, F., Plet, A., Gesnel, M.C., Fort, C. & Breathnach, R. Multiple interdependent
sequence elements control splicing of a fibroblast growth factor receptor 2 alternative
exon. Mol. Cell Biol. 17, 51065116 (1997).
31. Valcarcel, J., Singh, R., Zamore, P.D. & Green, M.R. The protein Sex-lethal antagonizes
the splicing factor U2AF to regulate alternative splicing of transformer pre-mRNA.
Nature 362, 171175 (1993).
32. Horabin, J.I. & Schedl, P. Sex-lethal autoregulation requires multiple cis-acting elements upstream and downstream of the male exon and appears to depend largely on
controlling the use of the male exon 5 splice site. Mol. Cell Biol. 13, 77347746
(1993).
33. Chou, M.Y., Underwood, J.G., Nikolic, J., Luu, M.H. & Black, D.L. Multisite RNA binding and release of polypyrimidine tract binding protein during the regulation of c-src
neural-specific splicing. Mol. Cell 5, 949957 (2000).
34. Wagner, E.J. & Garcia-Blanco, M.A. Polypyrimidine tract binding protein antagonizes
exon definition. Mol. Cell Biol. 21, 32813288 (2001).
35. Charlet, B.N. et al. Loss of the muscle-specific chloride channel in type 1 myotonic
dystrophy due to misregulated alternative splicing. Mol. Cell 10, 4553 (2002).
36. Carstens, R.P., McKeehan, W.L. & Garcia-Blanco, M.A. An intronic sequence element
mediates both activation and repression of rat fibroblast growth factor receptor 2 premRNA splicing. Mol. Cell Biol. 18, 22052217 (1998).
37. Baraniak, A.P., Lasda, E.L., Wagner, E.J. & Garcia-Blanco, M.A. A stem structure in
fibroblast growth factor receptor 2 transcripts mediates cell-type-specific splicing by
approximating intronic control elements. Mol. Cell Biol. 23, 93279337 (2003).
38. Lewis, B.P., Green, R.E. & Brenner, S.E. Evidence for the widespread coupling of alternative splicing and nonsense-mediated mRNA decay in humans. Proc. Natl. Acad. Sci.
USA 100, 189192 (2003).
39. Maquat, L.E. Nonsense-mediated mRNA decay. Curr. Biol. 12, R196197 (2002).
40. Jones, R.B. et al. The nonsense-mediated decay pathway and mutually exclusive
expression of alternatively spliced FGFR2IIIb and -IIIc mRNAs. J. Biol. Chem. 276,
41584167 (2001).
41. Wagner, E.J. et al. Quantification of alternatively spliced FGFR2 RNAs using the RNA
invasive cleavage assay. RNA 9, 15521561 (2003).
42. Wollerton, M.C., Gooding, C., Wagner, E.J., Garcia-Blanco, M.A. & Smith, C.W.
Autoregulation of polypyrimidine tract binding protein by alternative splicing leading to
nonsense-mediated decay. Mol. Cell 13, 91100 (2004).
43. Le Guiner, C. et al. TIA-1 and TIAR activate splicing of alternative exons with weak 5
splice sites followed by a U-rich stretch on their own pre-mRNAs. J. Biol. Chem. 276,
4063840646 (2001).
44. Stenson, P.D. et al. Human Gene Mutation Database (HGMD): 2003 update. Hum.
Mutat. 21, 577581 (2003).
45. Yan, G., Fukabori, Y., McBride, G., Nikolaropolous, S. & McKeehan, W.L. Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy.
Mol. Cell Biol. 13, 45134522 (1993).
46. Busslinger, M., Moschonas, N. & Flavell, R.A. Beta + thalassemia: aberrant splicing
results from a single point mutation in an intron. Cell 27, 289298 (1981).
47. Spritz, R.A. et al. Base substitution in an intervening sequence of a beta+-thalassemic
human globin gene. Proc. Natl. Acad. Sci. USA 78, 24552459 (1981).
48. Helmken, C. et al. Evidence for a modifying pathway in SMA discordant families:
reduced SMN level decreases the amount of its interacting partners and Htra2-beta1.
Hum. Genet. 114, 1121 (2003).
49. Lorson, C.L., Hahnen, E., Androphy, E.J. & Wirth, B. A single nucleotide in the SMN
gene regulates splicing and is responsible for spinal muscular atrophy. Proc. Natl.
Acad. Sci. USA 96, 63076311 (1999).
50. Kashima, T. & Manley, J.L. A negative element in SMN2 exon 7 inhibits splicing in
spinal muscular atrophy. Nat. Genet. 34, 460463 (2003).
51. Singh, N.N., Androphy, E.J. & Singh, R.N. An extended inhibitory context causes skipping of exon 7 of SMN2 in spinal muscular atrophy. Biochem. Biophys. Res. Commun.
315, 381388 (2004).
52. Mine, M. et al. Splicing error in E1alpha pyruvate dehydrogenase mRNA caused
by novel intronic mutation responsible for lactic acidosis and mental retardation.
J. Biol. Chem. 278, 1176811772 (2003).
53. Maquat, L.E. et al. Processing of human beta-globin mRNA precursor to mRNA is
defective in three patients with beta+-thalassemia. Proc. Natl. Acad. Sci. USA 77,
42874291 (1980).
54. Rees, D.J., Rizza, C.R. & Brownlee, G.G. Haemophilia B caused by a point mutation in
a donor splice junction of the human factor IX gene. Nature 316, 643645 (1985).
55. Ryther, R.C. et al. Disruption of exon definition produces a dominant-negative growth
hormone isoform that causes somatotroph death and IGHD II. Hum. Genet. 113,
140148 (2003).
56. Millar, D.S. et al. Novel mutations of the growth hormone 1 (GH1) gene disclosed by
modulation of the clinical selection criteria for individuals with short stature. Hum.
Mutat. 21, 424440 (2003).
57. Kanadia, R.N. et al. A muscleblind knockout model for myotonic dystrophy. Science
302, 19781980 (2003).
REVIEW
58. Gunthert, U. et al. A new variant of glycoprotein CD44 confers metastatic potential to
rat carcinoma cells. Cell 65, 1324 (1991).
59. Daoud, R. et al. Ischemia induces a translocation of the splicing factor tra2-beta 1 and
changes alternative splicing patterns in the brain. J. Neurosci. 22, 58895899
(2002).
60. Boucher, R.C. in Harrisons Principles of Internal Medicine, edn. 15 (ed. Braunwald, E.
et al.) 14871491 (McGraw-Hill, New York, 2001).
61. Noone, P.G. & Knowles, M.R. CFTR-opathies: disease phenotypes associated with
cystic fibrosis transmembrane regulator gene mutations. Respir. Res. 2, 328332
(2001).
62. Rowntree, R.K. & Harris, A. The phenotypic consequences of CFTR mutations. Ann.
Hum. Genet. 67, 471485 (2003).
63. Chu, C.S., Trapnell, B.C., Curristin, S., Cutting, G.R. & Crystal, R.G. Genetic basis of
variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator
mRNA. Nat. Genet. 3, 151156 (1993).
64. Teng, H. et al. Increased proportion of exon 9 alternatively spliced CFTR transcripts in
vas deferens compared with nasal epithelial cells. Hum. Mol. Genet. 6, 8590 (1997).
65. Mak, V., Jarvi, K.A., Zielenski, J., Durie, P. & Tsui, L.C. Higher proportion of intact exon
9 CFTR mRNA in nasal epithelium compared with vas deferens. Hum. Mol. Genet. 6,
20992107 (1997).
66. Larriba, S. et al. Testicular CFTR splice variants in patients with congenital absence of
the vas deferens. Hum. Mol. Genet. 7, 17391743 (1998).
67. Hefferon, T.W., Broackes-Carter, F.C., Harris, A. & Cutting, G.R. Atypical 5 splice sites
cause CFTR exon 9 to be vulnerable to skipping. Am. J. Hum. Genet. 71, 294303
(2002).
68. Costes, B. et al. Frequent occurrence of the CFTR intron 8 (TG)n 5T allele in men with
congenital bilateral absence of the vas deferens. Eur. J. Hum. Genet. 3, 285293
(1995).
69. Cuppens, H. et al. Polyvariant mutant cystic fibrosis transmembrane conductance regulator genes. The polymorphic (Tg)m locus explains the partial penetrance of the T5
polymorphism as a disease mutation. J. Clin. Invest. 101, 487496 (1998).
70. Niksic, M., Romano, M., Buratti, E., Pagani, F. & Baralle, F.E. Functional analysis of
cis-acting elements regulating the alternative splicing of human CFTR exon 9. Hum.
Mol. Genet. 8, 23392349 (1999).
71. Zuccato, E., Buratti, E., Stuani, C., Baralle, F.E. & Pagani, F. An intronic polypyrimidine-rich element downstream of the donor site modulates CFTR exon 9 alternative
splicing. J. Biol. Chem., published online 13 February 2004 (PMID: 14966131).
72. Pagani, F., Buratti, E., Stuani, C. & Baralle, F.E. Missense, nonsense, and neutral
mutations define juxtaposed regulatory elements of splicing in cystic fibrosis transmembrane regulator exon 9. J. Biol. Chem. 278, 2658026588 (2003).
73. Ou, S.H., Wu, F., Harrich, D., Garcia-Martinez, L.F. & Gaynor, R.B. Cloning and characterization of a novel cellular protein, TDP-43, that binds to human immunodeficiency
virus type 1 TAR DNA sequence motifs. J. Virol. 69, 35843596 (1995).
74. Buratti, E. & Baralle, F.E. Characterization and functional implications of the RNA
binding properties of nuclear factor TDP-43, a novel splicing regulator of CFTR exon 9.
J. Biol. Chem. 276, 3633736343 (2001).
75. Buratti, E. et al. Nuclear factor TDP-43 and SR proteins promote in vitro and in vivo
CFTR exon 9 skipping. EMBO J. 20, 17741784 (2001).
76. Nissim-Rafinia, M., Chiba-Falek, O., Sharon, G., Boss, A. & Kerem, B. Cellular and
viral splicing factors can modify the splicing pattern of CFTR transcripts carrying splicing mutations. Hum. Mol. Genet. 9, 17711778 (2000).
77. Pagani, F. et al. Splicing factors induce cystic fibrosis transmembrane regulator exon 9
skipping through a nonevolutionary conserved intronic element. J. Biol. Chem. 275,
2104121047 (2000).
78. Chiba-Falek, O. et al. The molecular basis of disease variability among cystic fibrosis
patients carrying the 3849+10 kb C>T mutation. Genomics 53, 276283 (1998).
79. Aznarez, I., Chan, E.M., Zielenski, J., Blencowe, B.J. & Tsui, L.C. Characterization of
disease-associated mutations affecting an exonic splicing enhancer and two cryptic
splice sites in exon 13 of the cystic fibrosis transmembrane conductance regulator
gene. Hum. Mol. Genet. 12, 20312040 (2003).
80. Nissim-Rafinia, M. & Kerem, B. Splicing regulation as a potential genetic modifier.
Trends Genet. 18, 123127 (2002).
81. Buchner, D.A., Trudeau, M. & Meisler, M.H. SCNM1, a putative RNA splicing factor
that modifies disease severity in mice. Science 301, 967969 (2003).
82. Van Deerlin, V.M., Gill, L.H., Farmer, J.M., Trojanowski, J.Q. & Lee, V.M. Familial frontotemporal dementia: from gene discovery to clinical molecular diagnostics. Clin.
Chem. 49, 17171725 (2003).
83. Goedert, M., Wischik, C.M., Crowther, R.A., Walker, J.E. & Klug, A. Cloning and
sequencing of the cDNA encoding a core protein of the paired helical filament of
Alzheimer disease: identification as the microtubule-associated protein tau. Proc. Natl.
Acad. Sci. USA 85, 40514055 (1988).
84. Goedert, M., Spillantini, M.G., Potier, M.C., Ulrich, J. & Crowther, R.A. Cloning and
sequencing of the cDNA encoding an isoform of microtubule-associated protein tau
containing four tandem repeats: differential expression of tau protein mRNAs in human
brain. EMBO J. 8, 393399 (1989).
85. Goedert, M., Spillantini, M.G., Jakes, R., Rutherford, D. & Crowther, R.A. Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimers disease. Neuron 3, 519526 (1989).
86. Andreadis, A., Brown, W.M. & Kosik, K.S. Structure and novel exons of the human tau
gene. Biochemistry 31, 1062610633 (1992).
87. Lee, G., Neve, R.L. & Kosik, K.S. The microtubule binding domain of tau protein.
Neuron 2, 16151624 (1989).
88. Goedert, M. & Jakes, R. Expression of separate isoforms of human tau protein: correlation with the tau pattern in brain and effects on tubulin polymerization. EMBO J. 9,
42254230 (1990).
89. Hutton, M. et al. Association of missense and 5-splice-site mutations in tau with the
inherited dementia FTDP-17. Nature 393, 702705 (1998).
90. Hong, M. et al. Mutation-specific functional impairments in distinct tau isoforms of
hereditary FTDP-17. Science 282, 19141917 (1998).
91. Spillantini, M.G. et al. Mutation in the tau gene in familial multiple system tauopathy
with presenile dementia. Proc. Natl. Acad. Sci. USA 95, 77377741 (1998).
92. Goedert, M., Ghetti, B. & Spillantini, M.G. Tau gene mutations in frontotemporal
dementia and parkinsonism linked to chromosome 17 (FTDP-17). Their relevance for
understanding the neurogenerative process. Ann. NY Acad. Sci. 920, 7483 (2000).
93. Lynch, T. et al. Clinical characteristics of a family with chromosome 17-linked disinhibition-dementia-parkinsonism-amyotrophy complex. Neurology 44, 18781884
(1994).
94. Kowalska, A. et al. A novel mutation at position +11 in the intron following exon 10 of
the tau gene in FTDP-17. J. Appl. Genet. 43, 535543 (2002).
95. Grover, A., DeTure, M., Yen, S.H. & Hutton, M. Effects on splicing and protein function
of three mutations in codon N296 of tau in vitro. Neurosci. Lett. 323, 3336 (2002).
96. Tolnay, M. et al. A new case of frontotemporal dementia and parkinsonism resulting
from an intron 10 +3splice site mutation in the tau gene: clinical and pathological
features. Neuropathol. Appl. Neurobiol. 26, 368378 (2000).
97. Stanford, P.M. et al. Mutations in the tau gene that cause an increase in three repeat
tau and frontotemporal dementia. Brain 126, 814826 (2003).
98. DSouza, I. et al. Missense and silent tau gene mutations cause frontotemporal dementia with parkinsonism-chromosome 17 type, by affecting multiple alternative RNA
splicing regulatory elements. Proc. Natl. Acad. Sci. USA 96, 55985603 (1999).
99. Gao, Q.S. et al. Complex regulation of tau exon 10, whose missplicing causes frontotemporal dementia. J. Neurochem. 74, 490500 (2000).
100.Jiang, Z., Cote, J., Kwon, J.M., Goate, A.M. & Wu, J.Y. Aberrant splicing of tau premRNA caused by intronic mutations associated with the inherited dementia frontotemporal dementia with parkinsonism linked to chromosome 17. Mol. Cell. Biol. 20,
40364048 (2000).
101.Varani, L. et al. Structure of tau exon 10 splicing regulatory element RNA and destabilization by mutations of frontotemporal dementia and parkinsonism linked to chromosome 17. Proc. Natl. Acad. Sci. USA 96, 82298234 (1999).
102.Clark, L.N. et al. Pathogenic implications of mutations in the tau gene in pallido-pontonigral degeneration and related neurodegenerative disorders linked to chromosome 17.
Proc. Natl. Acad. Sci. USA 95, 1310313107 (1998).
103.Jiang, Z. et al. Mutations in tau gene exon 10 associated with FTDP-17 alter the activity of an exonic splicing enhancer to interact with Tra2 beta. J. Biol. Chem. 278,
1899719007 (2003).
104.Grover, A. et al. 5 splice site mutations in tau associated with the inherited dementia
FTDP-17 affect a stem-loop structure that regulates alternative splicing of exon 10.
J. Biol. Chem. 274, 1513415143 (1999).
105.Bracco, L. & Kearsey, J. The relevance of alternative RNA splicing to pharmacogenomics. Trends Biotechnol. 21, 346353 (2003).
106.Simmons, D.L. Variants of cyclooxygenase-1 and their roles in medicine. Thromb. Res.
110, 265268 (2003).
107.Bingham, C.O. 3rd Development and clinical application of COX-2-selective inhibitors
for the treatment of osteoarthritis and rheumatoid arthritis. Cleve. Clin. J. Med. (suppl.
1) 69, SI512 (2002).
108.Chandrasekharan, N.V. et al. COX-3, a cyclooxygenase-1 variant inhibited by acetaminophen and other analgesic/antipyretic drugs: cloning, structure, and expression. Proc.
Natl. Acad. Sci. USA 99, 1392613931 (2002).
109.Shaftel, S.S., Olschowka, J.A., Hurley, S.D., Moore, A.H. & OBanion, M.K. COX-3: a
splice variant of cyclooxygenase-1 in mouse neural tissue and cells. Brain Res. Mol.
Brain Res. 119, 213215 (2003).
110.Flower, R.J. & Vane, J.R. Inhibition of prostaglandin synthetase in brain explains the
anti-pyretic activity of paracetamol (4-acetamidophenol). Nature 240, 410411
(1972).
111.Heider, K.H., Kuthan, H., Stehle, G. & Munzert, G. CD44v6: a target for antibodybased cancer therapy. Cancer Immunol. Immunother. (2004).
112.Baron-Delage, S., Abadie, A., Echaniz-Laguna, A., Melki, J. & Beretta, L. Interferons
and IRF-1 induce expression of the survival motor neuron (SMN) genes. Mol. Med. 6,
957968 (2000).
113.Brichta, L. et al. Valproic acid increases the SMN2 protein level: a well-known drug as
a potential therapy for spinal muscular atrophy. Hum. Mol. Genet. 12, 24812489
(2003).
114.Chang, J.G. et al. Treatment of spinal muscular atrophy by sodium butyrate. Proc. Natl.
Acad. Sci. USA 98, 98089813 (2001).
115.Kramer, O.H. et al. The histone deacetylase inhibitor valproic acid selectively induces
proteasomal degradation of HDAC2. EMBO J. 22, 34113420 (2003).
116.Atweh, G.F. & Schechter, A.N. Pharmacologic induction of fetal hemoglobin: raising the
therapeutic bar in sickle cell disease. Curr. Opin. Hematol. 8, 123130 (2001).
117.Isoherranen, N., Yagen, B. & Bialer, M. New CNS-active drugs which are second-generation valproic acid: can they lead to the development of a magic bullet? Curr. Opin.
Neurol. 16, 203211 (2003).
118.Larsen, A.K., Escargueil, A.E. & Skladanowski, A. Catalytic topoisomerase II inhibitors
in cancer therapy. Pharmacol. Ther. 99, 167181 (2003).
119.Andreassi, C. et al. Aclarubicin treatment restores SMN levels to cells derived from type
I spinal muscular atrophy patients. Hum. Mol. Genet. 10, 28412849 (2001).
120.Muraki, M. et al. Manipulation of alternative splicing by a newly developed inhibitor of
Clks. J. Biol. Chem., published on line 8 March 2004 (PMID: 15010457).
121.Chalfant, C.E. et al. De novo ceramide regulates the alternative splicing of caspase 9
and Bcl-x in A549 lung adenocarcinoma cells. Dependence on protein phosphatase-1.
545
REVIEW
J. Biol. Chem. 277, 1258712595 (2002).
122.Auboeuf, D. et al. Differential recruitment of nuclear receptor coactivators may determine alternative RNA splice site choice in target genes. Proc. Natl. Acad. Sci. USA
101, 22702274 (2004).
123.A randomized controlled clinical trial of intravitreous fomivirsen for treatment of
newly diagnosed peripheral cytomegalovirus retinitis in patients with AIDS. Am. J.
Ophthalmol. 133, 467474 (2002).
124.Crooke, S.T. Progress in antisense technology. Annu. Rev. Med. 55, 6195 (2004).
125.Sazani, P. & Kole, R. Therapeutic potential of antisense oligonucleotides as modulators
of alternative splicing. J. Clin. Invest. 112, 481486 (2003).
126.Zamecnik, P.C. & Stephenson, M.L. Inhibition of Rous sarcoma virus replication and
cell transformation by a specific oligodeoxynucleotide. Proc. Natl. Acad. Sci. USA 75,
280284 (1978).
127.Stephenson, M.L. & Zamecnik, P.C. Inhibition of Rous sarcoma viral RNA translation by
a specific oligodeoxyribonucleotide. Proc. Natl. Acad. Sci. USA 75, 285288 (1978).
128.Lacerra, G. et al. Restoration of hemoglobin A synthesis in erythroid cells from peripheral blood of thalassemic patients. Proc. Natl. Acad. Sci. USA 97, 95919596
(2000).
129.Dominski, Z. & Kole, R. Restoration of correct splicing in thalassemic pre-mRNA by
antisense oligonucleotides. Proc. Natl. Acad. Sci. USA 90, 86738677 (1993).
130.Vacek, M.M. et al. High-level expression of hemoglobin A in human thalassemic erythroid progenitor cells following lentiviral vector delivery of an antisense snRNA. Blood
101, 104111 (2003).
131.Gorman, L., Suter, D., Emerick, V., Schumperli, D. & Kole, R. Stable alteration of premRNA splicing patterns by modified U7 small nuclear RNAs. Proc. Natl. Acad. Sci.
USA 95, 49294934 (1998).
132.De Angelis, F.G. et al. Chimeric snRNA molecules carrying antisense sequences against
the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and
restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc. Natl. Acad. Sci.
USA 99, 94569461 (2002).
133.Friedman, K.J. et al. Correction of aberrant splicing of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by antisense oligonucleotides. J. Biol. Chem.
274, 3619336199 (1999).
134.Dunckley, M.G., Manoharan, M., Villiet, P., Eperon, I.C. & Dickson, G. Modification of
splicing in the dystrophin gene in cultured Mdx muscle cells by antisense oligoribonucleotides. Hum. Mol. Genet. 7, 10831090 (1998).
135.Wilton, S.D. et al. Specific removal of the nonsense mutation from the mdx dystrophin
mRNA using antisense oligonucleotides. Neuromuscul. Disord. 9, 330338 (1999).
136.Taylor, J.K., Zhang, Q.Q., Wyatt, J.R. & Dean, N.M. Induction of endogenous Bcl-xS
through the control of Bcl-x pre-mRNA splicing by antisense oligonucleotides. Nat.
Biotechnol. 17, 10971100 (1999).
137.Karras, J.G., Maier, M.A., Lu, T., Watt, A. & Manoharan, M. Peptide nucleic acids are
potent modulators of endogenous pre-mRNA splicing of the murine interleukin-5
receptor-alpha chain. Biochemistry 40, 78537859 (2001).
138.Kalbfuss, B., Mabon, S.A. & Misteli, T. Correction of alternative splicing of tau in frontotemporal dementia and parkinsonism linked to chromosome 17. J. Biol. Chem. 276,
4298642993 (2001).
139.Sazani, P. et al. Systemically delivered antisense oligomers upregulate gene expression
in mouse tissues. Nat. Biotechnol. 20, 12281233 (2002).
140.Mann, C.J. et al. Antisense-induced exon skipping and synthesis of dystrophin in the
mdx mouse. Proc. Natl. Acad. Sci. USA 98, 4247 (2001).
141.Lu, Q.L. et al. Functional amounts of dystrophin produced by skipping the mutated
exon in the mdx dystrophic mouse. Nat. Med. 9, 10091014 (2003).
142.Villemaire, J., Dion, I., Elela, S.A. & Chabot, B. Reprogramming alternative premessenger RNA splicing through the use of protein-binding antisense oligonucleotides.
J. Biol. Chem. 278, 5003150039 (2003).
143.Skordis, L.A., Dunckley, M.G., Yue, B., Eperon, I.C. & Muntoni, F. Bifunctional antisense oligonucleotides provide a trans-acting splicing enhancer that stimulates SMN2
gene expression in patient fibroblasts. Proc. Natl. Acad. Sci. USA 100, 41144119
(2003).
144.Cartegni, L. & Krainer, A.R. Correction of disease-associated exon skipping by synthetic
exon-specific activators. Nat. Struct. Biol. 10, 120125 (2003).
145.Graveley, B.R. & Maniatis, T. Arginine/serine-rich domains of SR proteins can function
as activators of pre-mRNA splicing. Mol. Cell 1, 765771 (1998).
146.Graveley, B.R., Hertel, K.J. & Maniatis, T. A systematic analysis of the factors that
determine the strength of pre-mRNA splicing enhancers. EMBO J. 17, 67476756
(1998).
147.Buratti, E., Baralle, F.E. & Pagani, F. Can a patch in a skipped exon make the premRNA splicing machine run better? Trends Mol. Med. 9, 229232; discussion 233224 (2003).
148.Eperon, I.C. & Muntoni, F. Response to Buratti et al.: Can a patch in a skipped exon
make the pre-mRNA splicing machine run better? Trends Mol. Med. 9, 233234
(2003).
149.Khoo, B., Akker, S.A. & Chew, S.L. Putting some spine into alternative splicing. Trends
Biotechnol. 21, 328330 (2003).
150.Liu, Q. & Dreyfuss, G. A novel nuclear structure containing the survival of motor neurons protein. EMBO J. 15, 35553565 (1996).
151.Coovert, D.D. et al. The survival motor neuron protein in spinal muscular atrophy. Hum.
Mol. Genet. 6, 12051214 (1997).
152.Mercatante, D.R., Sazani, P. & Kole, R. Modification of alternative splicing by antisense
oligonucleotides as a potential chemotherapy for cancer and other diseases. Curr.
Cancer Drug Targets 1, 211230 (2001).
153.Hommel, J.D., Sears, R.M., Georgescu, D., Simmons, D.L. & DiLeone, R.J. Local gene
knockdown in the brain using viral-mediated RNA interference. Nat. Med. 9,
546
15391544 (2003).
154.Dykxhoorn, D.M., Novina, C.D. & Sharp, P.A. Killing the messenger: short RNAs that
silence gene expression. Nat. Rev. Mol. Cell Biol. 4, 457467 (2003).
155.Wall, N.R. & Shi, Y. Small RNA: can RNA interference be exploited for therapy? Lancet
362, 14011403 (2003).
156.Celotto, A.M. & Graveley, B.R. Exon-specific RNAi: a tool for dissecting the functional
relevance of alternative splicing. RNA 8, 718724 (2002).
157.Garcia-Blanco, M.A. Messenger RNA reprogramming by spliceosome-mediated RNA
trans-splicing. J. Clin. Invest. 112, 474480 (2003).
158.Sullenger, B.A. & Gilboa, E. Emerging clinical applications of RNA. Nature 418,
252258 (2002).
159.Puttaraju, M., Jamison, S.F., Mansfield, S.G., Garcia-Blanco, M.A. & Mitchell, L.G.
Spliceosome-mediated RNA trans-splicing as a tool for gene therapy. Nat. Biotechnol.
17, 246252 (1999).
160.Liu, X. et al. Partial correction of endogenous DeltaF508 CFTR in human cystic fibrosis
airway epithelia by spliceosome-mediated RNA trans-splicing. Nat. Biotechnol. 20,
4752 (2002).
161.Chao, H. et al. Phenotype correction of hemophilia A mice by spliceosome-mediated
RNA trans-splicing. Nat. Med. 9, 10151019 (2003).
162.Sullenger, B.A. & Cech, T.R. Ribozyme-mediated repair of defective mRNA by targeted,
trans-splicing. Nature 371, 619622 (1994).
163.Watanabe, T. & Sullenger, B.A. RNA repair: a novel approach to gene therapy. Adv. Drug
Deliv. Rev. 44, 109118 (2000).
164.Rogers, C.S., Vanoye, C.G., Sullenger, B.A. & George, A.L. Jr. Functional repair of a
mutant chloride channel using a transsplicing ribozyme. J. Clin. Invest. 110,
17831789 (2002).
165.Deidda, G., Rossi, N. & Tocchini-Valentini, G.P. An archaeal endoribonuclease catalyzes cis- and trans- nonspliceosomal splicing in mouse cells. Nat. Biotechnol. 21,
14991504 (2003).
166.Roberts, R. et al. Altered phosphorylation and intracellular distribution of a (CUG)n
triplet repeat RNA-binding protein in patients with myotonic dystrophy and in myotonin
protein kinase knockout mice. Proc. Natl. Acad. Sci. USA 94, 1322113226 (1997).
167.Lu, X., Timchenko, N.A. & Timchenko, L.T. Cardiac elav-type RNA-binding protein
(ETR-3) binds to RNA CUG repeats expanded in myotonic dystrophy. Hum. Mol. Genet.
8, 5360 (1999).
168.Yang, L., Embree, L.J. & Hickstein, D.D. TLS-ERG leukemia fusion protein inhibits
RNA splicing mediated by serine-arginine proteins. Mol. Cell Biol. 20, 33453354
(2000).
169.Crozat, A., Aman, P., Mandahl, N. & Ron, D. Fusion of CHOP to a novel RNA-binding
protein in human myxoid liposarcoma. Nature 363, 640644 (1993).
170.Ichikawa, H., Shimizu, K., Hayashi, Y. & Ohki, M. An RNA-binding protein gene,
TLS/FUS, is fused to ERG in human myeloid leukemia with t(16;21) chromosomal
translocation. Cancer Res. 54, 28652868 (1994).
171.Lovestone, S. et al. Alzheimers disease-like phosphorylation of the microtubule-associated protein tau by glycogen synthase kinase-3 in transfected mammalian cells. Curr.
Biol. 4, 10771086 (1994).
172.Hernandez, F. et al. Glycogen synthase kinase-3 plays a crucial role in tau exon 10
splicing and intranuclear distribution of SC35. Implications for Alzheimers disease.
J. Biol. Chem. 279, 38013806 (2004).
173.Manabe, T. et al. Induced HMGA1a expression causes aberrant splicing of Presenilin-2
pre-mRNA in sporadic Alzheimers disease. Cell Death Differ. 10, 698708 (2003).
174.Miller, J.W. et al. Recruitment of human muscleblind proteins to (CUG)(n) expansions
associated with myotonic dystrophy. EMBO J. 19, 44394448 (2000).
175.Buckanovich, R.J., Posner, J.B. & Darnell, R.B. Nova, the paraneoplastic Ri antigen, is
homologous to an RNAbinding protein and is specifically expressed in the developing
motor system. Neuron 11, 657672 (1993).
176.Jensen, K.B. et al. Nova-1 regulates neuronspecific alternative splicing and is essential for neuronal viability. Neuron 25, 359371 (2000).
177.Chakarova, C.F. et al. Mutations in HPRP3, a third member of pre-mRNA splicing factor genes, implicated in autosomal dominant retinitis pigmentosa. Hum. Mol. Genet.
11, 8792 (2002).
178.Vithana, E.N. et al. A human homolog of yeast pre-mRNA splicing gene, PRP31, underlies autosomal dominant retinitis pigmentosa on chromosome 19q13.4 (RP11). Mol.
Cell 8, 375381 (2001).
179.McKie, A.B. et al. Mutations in the pre-mRNA splicing factor gene PRPC8 in autosomal
dominant retinitis pigmentosa (RP13). Hum. Mol. Genet. 10, 15551562 (2001).
180.Ma, K. et al. A Y chromosome gene family with RNA-binding protein homology: candidates for the azoospermia factor AZF controlling human spermatogenesis. Cell 75,
12871295 (1993).
181.Venables, J.P. et al. RBMY, a probable human spermatogenesis factor, and other
hnRNP G proteins interact with Tra2beta and affect splicing. Hum. Mol. Genet. 9,
685694 (2000).
182.Imai, H., Chan, E.K., Kiyosawa, K., Fu, X.D. & Tan, E.M. Novel nuclear autoantigen
with splicing factor motifs identified with antibody from hepatocellular carcinoma.
J. Clin. Invest. 92, 24192426 (1993).
183.Clark, J. et al. Fusion of splicing factor genes PSF and NonO (p54nrb) to the TFE3 gene
in papillary renal cell carcinoma. Oncogene 15, 22332239 (1997).
184.Lefebvre, S. et al. Identification and characterization of a spinal muscular atrophydetermining gene. Cell 80, 155165 (1995).
185.Fomenkov, A. et al. P63 alpha mutations lead to aberrant splicing of keratinocyte
growth factor receptor in the Hay-Wells syndrome. J. Biol. Chem. 278, 2390623914
(2003).
186.Srivastava, S. et al. SMN2-deletion in childhood-onset spinal muscular atrophy. Am. J.
Med. Genet. 101, 198202 (2001).

Alternative Splicingreview

Transféré par

Informations du document

Copyright

Formats disponibles

Partager ce document

Partager ou intégrer le document

Options de partage

Avez-vous trouvé ce document utile ?

Ce contenu est-il inapproprié ?

Droits d'auteur :

Formats disponibles

Alternative Splicingreview

Transféré par

Droits d'auteur :

Formats disponibles

2004 Nature Publishing Group http://www.nature.

Alternative splicing in disease and therapy

Annotation of the human genome reveals a preponderance of complex

NATURE BIOTECHNOLOGY VOLUME 22 NUMBER 5 MAY 2004

capacity of this apparatus is underscored by calculations of the sheer

exonic splicing enhancers (ESEs), exonic splicing silencers (ESSs),

2004 Nature Publishing Group http://www.nature.com/naturebiotechnology

Figure 1 Cis-acting elements that control splicing. Sequences

structure mediates activation of exon 8 by approximating upstream and

VOLUME 22 NUMBER 5 MAY 2004 NATURE BIOTECHNOLOGY

2004 Nature Publishing Group http://www.nature.com/naturebiotechnology

NATURE BIOTECHNOLOGY VOLUME 22 NUMBER 5 MAY 2004

Table 1 Splicing trans-acting factors associated with human disease

OMIM numberb Disease associationc

CUG triplet repeat, RNA-binding protein 1;

Myotonic dystrophy (DM)

CUG-binding proteins may be affected in DM.

Myotonic dystrophy (DM)

CUG-binding proteins may be affected in DM.

Leukemias and sarcomas

FUSIP1 interacts with the C-terminal region of TLS and

CUGBP1 (CUGBP; NAB50; BRUNOL2)

2004 Nature Publishing Group http://www.nature.com/naturebiotechnology

FUS-interacting protein 1; FUSIP1

this interaction and perhaps the function of FUSIP1 is

Fusion, derived from 1216 translocation,

malignant liposarcoma; FUS (TLS)

Glycogen synthase kinase 3-BETA;

The FUS gene is translocated in leukemias and sarcomas.

myeloid leukemia (AML)

Alzheimer disease (AD)

Inhibition of GSK3B led to an increase in the inclusion

of tau exon 10, possibly mediated by SC35. This recent

Hydroxymethylglutaryl coenzyme A1a

Alzheimer disease (AD)

Overexpression of HMGA1a was found to cause aberrant

splicing of presenilin-2 transcripts, which is a feature of

Muscleblind-like protein 1; MBNL1

Myotonic dystrophy (DM)

Both classic myotonic dystrophy (myotonic dystrophy-1;

DM1) and myotonic dystrophy-2/proximal myotonic

Muscleblind-like protein 2; MBNL2 (MBLL) 607327

Myotonic dystrophy (DM)

See MBNL1 above.

Muscleblind-like protein 3; MBNL3 (MBXL) 300413

Myotonic dystrophy (DM)

See MBNL1 above.

Neurooncologic ventral antigen 1; NOVA1

Autoantibodies to NOVA1 seen in patients with

Saccharomyces cerevisiae, homolog of

Mutations in the PRPF3 gene cause retinitis pigmentosas

(RP) in some families.

PRPF3 (PRP3; HPRP3)

S. cerevisiae, homolog of PRPF31

Mutations in the gene encoding PRPF31 cause retinitis

pigmentosas in some families.

S. cerevisiae, homolog of PRPF8 (PRP8

Mutations in the PRPF8 gene cause retinitis pigmentosas in

PRPC8 U5 snRNP-specific protein,

family 1, member A1; RBMY1A1

Deletions of the RBMY coding gene(s) have been associated 180,181

(RBMY; RBM1; RBM2; YRRM1; YRRM2)

Autoantibodies to HCC1 seen in patients with hepatocellular

carcinoma but pathophysiological consequences are not evident.