Grandes Eventos da Genética


1865 – Genes são elementos particulados
1871 – Descoberta dos Ácidos Nucléicos
1903 – Cromossomos são unidades hereditárias
1910 – Os genes estão nos cromossomos
1913 – Cromossomos são conjuntos lineares de genes
1927 – Mutações são mudanças físicas nos genes
1931 – Recombinação são geradas pelo crossing-over
1944 – O DNA é o material genético

MO640A - Biologia Computacional

1945 – Um gene codifica uma proteína
1951 – Sequenciamento de proteína
1953 – DNA é uma dupla hélice

Felipe Rodrigues da Silva

1958 – DNA replica de maneira semiconservativa

Embrapa Recursos Genéticos e Biotecnologia

1977 – Genes eucariotos podem ser interrompidos

1961 – O código genético é uma trinca

1977 – Sequenciamento de DNA
1995 – Genoma bacteriano
2001 – Genoma Humano
Felipe R. da Silva

Fases da História da Genética

Fig 1.1 do Genes IX
Benjamin Lewin
Biologia Computacional MO640A
Unicamp, 1º Sem. 2010

1859: Charles Darwin
A Origem das Espécies

• Mendeliana
• DNA (identidade)
• Dogma Central (DNA - RNA - Proteína)
• Regulação da expressão gênica
• DNA recombinante
• Totalidade da informação genética
• Previsão do desenvolvimento
Watson, JD (1993). Gene 135: 309-315
Felipe R. da Silva

Biologia Computacional MO640A
Unicamp, 1º Sem. 2010

Felipe R. da Silva

Biologia Computacional MO640A
Unicamp, 1º Sem. 2010


da Silva Biologia Computacional MO640A Unicamp. 1º Sem. da Silva Biologia Computacional MO640A Unicamp.1838: lê Ensaio sobre o princípio da população. 1º Sem. 2010 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 1857: artigo de Alfred Russel Wallace? Felipe R. de Thomas Malthus (1798) 1831-1836: Viagem do Beagle Felipe R. 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 2 . 2010 Felipe R.

1º Sem. da Silva Biologia Computacional MO640A Unicamp.1866: Gregor Mendel Experimentos em hibridação de plantas Redescoberto em 1900 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 Felipe R. 2010 1869: Johann Friedrich Miescher descoberta da “nucleína” Felipe R. 2010 1909: Wilhelm Johannsen criação dos termos gene. da Silva Biologia Computacional MO640A Unicamp. fenótipo e genótipo Felipe R. 1º Sem. 1º Sem. 2010 3 . 1º Sem. da Silva Biologia Computacional MO640A Unicamp.

Exp. 1º Sem. & McCarty. Lisa (S) Avery. 1º Sem. 79. J. da Silva Biologia Computacional MO640A Unicamp.M. (1928) Significance of pneumococcal types. Hygiene 27:113-159. 2010 4 .. Studies on the chemical nature of the substance inducing transformation of Pneumococcal types. J. 2010 Os Açúcares Unidade básica formadora dos ácidos nucléicos • Açúcar (pentose) • Base Nitrogenada • Grupo Fosfato Biologia Computacional MO640A Felipe R. da Silva • Pentose – Ribose e Desoxirribose Monômero Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 Nucleotídeo Unicamp. 1º Sem. M. C. 1º Sem.1928: Frederick Griffith 1944: Oswald T. MacLeod. da Silva Unicamp. O. (1944). 137-159 Biologia Computacional MO640A Felipe R. Med.T. Avery DNA é o “princípio transformante” princípio transformante Griffith. 2010 Felipe R. F.

da Silva Unicamp. da Silva Biologia Computacional MO640A Unicamp. da Silva Unicamp. 2010 5 . 1º Sem. 2010 Felipe R. 1º Sem. 1º Sem. 2010 Nucleosídeos Base Nitrogenada Biologia Computacional MO640A Felipe R. da Silva Biologia Computacional MO640A Unicamp.Bases Nitrogenadas Bases Nitrogenadas • Pirimidinas • Purinas Biologia Computacional MO640A Felipe R. 2010 Nucleotídeos Base Nitrogenada + Açúcar = Nucleosídeo Base Nitrogenada + Açúcar + Grupo Fosfato = Nucleotídeo Adenina Felipe R. 1º Sem.

6 2. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp.6 1. 1º Sem. 2010 6 .6 1. 2010 Conteúdo de bases Felipe R.0 Levedura 1. 1º Sem.4 (T+C) é sempre igual a quantidade total de nucleotídeos purínicos (A+G) • A Quantidade de T = A. 1º Sem.5 1.0 1.Nucleotídeos e Desoxirribonucleotídeos 1950: Erwin Chargaff %A = %T e %G = %C Adenina + Açúcar + Grupo Fosfato = Nucleotídeo Ribose Desoxirribose Biologia Computacional MO640A Felipe R. 2010 Conclusões de Chargaff em diferentes espécies • A quantidade de nucleotídeos pirimidínicos Origem do DNA Adenina Timina Guanina Citosina Timo de bezerro 1.0 Figado de vaca 1.7 1. C = G Felipe R.8 1. da Silva Biologia Computacional MO640A Unicamp. da Silva Unicamp.2 1.3 1.0 Bacilo da tuberculose 1. 2010 • A Quantidade de A+T é diferente de G + C • A relação A + T / G + C é espécie específica Felipe R.1 1.9 1.0 2.

2004 Felipe R. 1º Sem. 2010 As bases e as medidas sugeridas por Rosalind A famosa imagem 51 Felipe R. 1º Sem.1953 – Rosalind Franklin e Maurice Wilkins (dama sombria) Descobertas que ajudaram na elucidação da estrutura do DNA • 1953 – Rosalind Franklin e Maurice Hugh Frederick Wilkins • Resultados com difração de raio X – O DNA é longo e fino – Tem partes semelhantes e paralelas. da Silva Biologia Computacional MO640A Unicamp. 2010 Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp.1958 “degraus” 1916 . correndo ao longo da molécula – É helicoidal – Raio de 10 Å. 1º Sem. da Silva Biologia Computacional MO640A Unicamp.4 Å entre 1920 . 1º Sem. da Silva Felipe R. 2010 7 . Ciclo de 34 Å e 3. 2010 Felipe R.

da Silva Biologia Computacional MO640A Unicamp. 1º Sem. J. 2010 Biologia Computacional MO640A Unicamp.D. & Crick. 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. da Silva Felipe R. Sulco Menor Sulco Maior Felipe R. 2010 Felipe R.H. F.C. 2010 8 . da Silva Felipe R.1953: Watson. 2010 Biologia Computacional MO640A Unicamp. 1º Sem.

1º Sem. François Jacob e Jacques Monod Replicação DNA descoberta do mRNA Felipe R. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp.Meselson e Stahl A natureza semiconservativa do DNA 1957: Francis Crick dogma central DNA proteína RNA animação Felipe R. 2010 Felipe R. Francis Crick. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 1960: Sydney Brenner.1958 . 2010 Felipe R. 1º Sem. 2010 9 . 1º Sem. da Silva Biologia Computacional MO640A Unicamp.

Dogma central Dogma central DNA DNA RNA RNA proteí proteína proteí proteína Felipe R. 1º Sem. 1º Sem. 2010 Dogma central Felipe R. da Silva Biologia Computacional MO640A Unicamp. 1º Sem. 1º Sem. 2010 Dogma central Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp. da Silva Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 10 . 2010 Felipe R.

W. da Silva Biologia Computacional MO640A Unicamp. Nat. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. Felipe R. M. Smith and K. USA 47. and Matthaei. coli upon naturally occurring or synthetic polyribonucleotides. P (1972). Acad. DA. A restriction enzyme from Haemophilus influenzae. H. Proc. Jackson. 2010 1970: Hamilton O. Sci. Wilcox (1970). Symons. 1º Sem. 1º Sem. Smith primeira enzima de restrição Felipe R. USA 69: 2904-2909. coli. Proc. 2010 1972: Paul Berg primeira molécula de DNA recombinante Nobel 1978 “pela descoberta das enzimas de restrição e sua aplicação nos problemas de genética molecular” Nobel 1980 “pelos estudos da bioquímica de ácidos nucleicos. 379-391. da Silva Biologia Computacional MO640A Unicamp.1961: Marshall Nirenberg Código Genético quebra o código genético Nobel 1968 “pela interpretação do código genético e sua função na síntese protéica” Nirenberg. Purification and general properties. especialmente de DNA recombinante” Hamilton O. Journal of Molecular Biology 51. J. da Silva Biologia Computacional MO640A Unicamp. W. Sci. 2010 11 . A Biochemical Method for Inserting New Genetic Information into SV40 DNA: Circular SV40 DNA Molecules Containing Lambda Phage Genes and the Galactose Operon of E. Natl. (1961) The dependence of cell-free protein synthesis in E. I. 1588-1602 Felipe R. 1º Sem. 2010 Felipe R. RH and Berg.

2010 Estrutura de um gene M. da Silva Biologia Computacional MO640A Unicamp. Faloona F. 230(4732):1350-4. (1991) Complementary DNA sequencing: 'expressed sequence tags' and the Human Genome Project. Erlich H. Felipe R.1977: Walter Gilbert e Frederick Sanger seqüenciamento de DNA 1983: Kary B. 2010 1991: J. 4: 56-65. 1º Sem. T. K." tgaggaacggtgcctggaaaagggcaagaatatccggcatgggcatgagtagcttgaaactgctgaagtatgtcctgtgttt cttcaacttgccttttggatctgtgtctgctgcattttgggctttgggatctacctgctgatccacaacacttcggagtgct cttccataacctcccctccctcacgctgggcaatgtgtttgtcatcggggctctattatcatggtagttgccttcctgggct gcatgggctctagcaaggaaaacagtgtctgcttatgtcgttcttcatcctgctgctgattatcctccttgctgaggtgacc tggccatcctgctctttgtatatgaacagaagctgaatgagtatgtggctaagggtctgacgacagcatccaccgttaccac tcagacgttagcaccaaggcagcgtgggactccatccgtcatttctgcagtgttgtggtataaatggcacgagtgattggac cagtggcccaccagatcttgcccctcagatcgaaaagtggagggttgctatgcgaaagcaagactgtggtttcttccaattt cctgagtatcggaatcatcaccatctgtgtatgtgtgattgaggtgttgggatgtcctttgcactgaccctgaactgccaga ttgacaaaaccagccagaccatagggcatgatctgcagtagttctgtggtgaagagacttgtttcatctccggaagtgcaaa accattatagcatgaagccctacatgatcactgcaggatgatcctcctcccatcctttcccttttaggtccctgtcttatac aaccagagaagtgggtgttggccaggcacatcccatctcagcagcaagacaatctttcactcactgacggcagcagccatgt ctctcaaagtggtgaagtaatatctgagcatcttttagacaagagaggcaaagacaaactggatttaatggcccaaatcaaa gggtgaacccaggatatgaatttttgcatcttcccattgtcgaattagtctccgcctctaaataatgcccagtcttctcccc aaagtcaagcaagagactagttgaagggagtctggggccaggctcactggaccattgtcacaaccctctgtttctctttgac taagtgcctggctacaggaattacacagttctctttctccaaagggcaagatctcatttcaatttcttattagagggcctta ttgatgtgttctaagtctttccagaaaaaaactatccagtgattatatcctgatttcaaccagtcacttagctgataatcac agtaagaagacttctggtatatctctctatcagataagattttgttaatgtactattttactcttcaataaataaaacattt attatctcaaaatagccccggatatctgtgttaccagccttgtctcggccacctcaaggaaatcactaaatttagccgaaag gactgaggaacggtgcctggaaaagggcaagaatatccggcatgggcatgagtagcttgaaactgctgaagtatgtcctgtt tttcttcaacttgccttttggaaataaagctgctgcattttgggctttgggatctacct Introns Exons Science. Adams et al. Craig Venter ESTs na descoberta de genes Felipe R. Arnheim N.. The unusual origin of the polymerase chain reaction. B. Mullis K. K. Horn G. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. Sci Am.. 2010 12 . A. 1º Sem. da Silva de ácidos nucleicos” Saiki R. Mullis PCR Nobel de Química 1993 “pela invenção da PCR” Mullis. 1º Sem. Biologia Computacional MO640A MO640A Unicamp. da Silva Unicamp.B (1983). 1º Sem.D. da Silva Biologia Computacional MO640A Unicamp. 2010 Felipe R. (1985). 252:1651-1656. Nobel 1980 “pelas contribuições na determinação de seqüências Biologia Computacional Felipe R. Scharf S.

da Silva III Tradução Modificação Pós-Traducional Biologia Computacional MO640A Unicamp. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 13 . 2010 Felipe R.Splicing Estrutura e Expressão Gênica éxons Promotor I 5’-UTR III II íntrons Transcrição I RNA primário (Temporário) III II Splicing mRNA (Maduro) Felipe R. 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 Alguns conceitos DNA 3’-UTR OH O-Me O-Me Proteína I II Exons Felipe R. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 Estrutura de um promotor • Fita Codificante – a que tem a mesma seqüência que o mRNA • Intron x Exon • UTR • poliA Felipe R.