Grandes Eventos da Genética

Ácidos
Nucleicos

1865 – Genes são elementos particulados
1871 – Descoberta dos Ácidos Nucléicos
1903 – Cromossomos são unidades hereditárias
1910 – Os genes estão nos cromossomos
1913 – Cromossomos são conjuntos lineares de genes
1927 – Mutações são mudanças físicas nos genes
1931 – Recombinação são geradas pelo crossing-over
1944 – O DNA é o material genético

MO640A - Biologia Computacional

1945 – Um gene codifica uma proteína
1951 – Sequenciamento de proteína
1953 – DNA é uma dupla hélice

Felipe Rodrigues da Silva

1958 – DNA replica de maneira semiconservativa

Embrapa Recursos Genéticos e Biotecnologia

1977 – Genes eucariotos podem ser interrompidos

1961 – O código genético é uma trinca

1977 – Sequenciamento de DNA
1995 – Genoma bacteriano
2001 – Genoma Humano
Felipe R. da Silva

Fases da História da Genética

Fig 1.1 do Genes IX
Benjamin Lewin
Biologia Computacional MO640A
Unicamp, 1º Sem. 2010

1859: Charles Darwin
A Origem das Espécies

• Mendeliana
• DNA (identidade)
• Dogma Central (DNA - RNA - Proteína)
• Regulação da expressão gênica
• DNA recombinante
• Totalidade da informação genética
• Previsão do desenvolvimento
Watson, JD (1993). Gene 135: 309-315
Felipe R. da Silva

Biologia Computacional MO640A
Unicamp, 1º Sem. 2010

Felipe R. da Silva

Biologia Computacional MO640A
Unicamp, 1º Sem. 2010

1

1º Sem. de Thomas Malthus (1798) 1831-1836: Viagem do Beagle Felipe R. 2010 2 . 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp.1838: lê Ensaio sobre o princípio da população. da Silva Biologia Computacional MO640A Unicamp. 1º Sem. 2010 Felipe R. 2010 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 1857: artigo de Alfred Russel Wallace? Felipe R. da Silva Biologia Computacional MO640A Unicamp.

2010 1869: Johann Friedrich Miescher descoberta da “nucleína” Felipe R. 2010 1909: Wilhelm Johannsen criação dos termos gene. 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp. 1º Sem. 2010 3 . 2010 Felipe R. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp.1866: Gregor Mendel Experimentos em hibridação de plantas Redescoberto em 1900 Felipe R. fenótipo e genótipo Felipe R. 1º Sem.

1º Sem. da Silva Biologia Computacional MO640A Unicamp. da Silva • Pentose – Ribose e Desoxirribose Monômero Felipe R. & McCarty. MacLeod. M.1928: Frederick Griffith 1944: Oswald T. Studies on the chemical nature of the substance inducing transformation of Pneumococcal types. 1º Sem. (1944). 2010 Felipe R.M. 2010 4 . Med.. J. O. Hygiene 27:113-159. 79. C. 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. Avery DNA é o “princípio transformante” princípio transformante Griffith. 137-159 Biologia Computacional MO640A Felipe R. 2010 Nucleotídeo Unicamp. 2010 Os Açúcares Unidade básica formadora dos ácidos nucléicos • Açúcar (pentose) • Base Nitrogenada • Grupo Fosfato Biologia Computacional MO640A Felipe R. Exp. Lisa (S) Avery. J. da Silva Unicamp. (1928) Significance of pneumococcal types. F.T.

1º Sem. 1º Sem. 2010 Felipe R. da Silva Unicamp. 1º Sem. 2010 Nucleotídeos Base Nitrogenada + Açúcar = Nucleosídeo Base Nitrogenada + Açúcar + Grupo Fosfato = Nucleotídeo Adenina Felipe R. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp. 2010 Nucleosídeos Base Nitrogenada Biologia Computacional MO640A Felipe R. da Silva Unicamp. 1º Sem. 2010 5 .Bases Nitrogenadas Bases Nitrogenadas • Pirimidinas • Purinas Biologia Computacional MO640A Felipe R.

9 1. 1º Sem.8 1.4 (T+C) é sempre igual a quantidade total de nucleotídeos purínicos (A+G) • A Quantidade de T = A.0 Bacilo da tuberculose 1.2 1. 1º Sem.0 2.0 1. 2010 Conclusões de Chargaff em diferentes espécies • A quantidade de nucleotídeos pirimidínicos Origem do DNA Adenina Timina Guanina Citosina Timo de bezerro 1. 2010 Conteúdo de bases Felipe R. da Silva Unicamp. 1º Sem.5 1.Nucleotídeos e Desoxirribonucleotídeos 1950: Erwin Chargaff %A = %T e %G = %C Adenina + Açúcar + Grupo Fosfato = Nucleotídeo Ribose Desoxirribose Biologia Computacional MO640A Felipe R. da Silva Biologia Computacional MO640A Unicamp.0 Figado de vaca 1. da Silva Biologia Computacional MO640A Unicamp. 2010 6 .3 1. da Silva Biologia Computacional MO640A Unicamp.1 1.6 1. 1º Sem. C = G Felipe R.6 2.0 Levedura 1. 2010 • A Quantidade de A+T é diferente de G + C • A relação A + T / G + C é espécie específica Felipe R.6 1.7 1.

1958 “degraus” 1916 . 1º Sem. 1º Sem. 1º Sem. 1º Sem. da Silva Felipe R. 2010 Felipe R. 2010 7 . da Silva Biologia Computacional MO640A Unicamp. correndo ao longo da molécula – É helicoidal – Raio de 10 Å. 2010 As bases e as medidas sugeridas por Rosalind A famosa imagem 51 Felipe R.4 Å entre 1920 .1953 – Rosalind Franklin e Maurice Wilkins (dama sombria) Descobertas que ajudaram na elucidação da estrutura do DNA • 1953 – Rosalind Franklin e Maurice Hugh Frederick Wilkins • Resultados com difração de raio X – O DNA é longo e fino – Tem partes semelhantes e paralelas. Ciclo de 34 Å e 3.2004 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp.

da Silva Felipe R. 1º Sem. 1º Sem. 2010 Biologia Computacional MO640A Unicamp. da Silva Felipe R. J. da Silva Biologia Computacional MO640A Unicamp.C. & Crick. F. da Silva Biologia Computacional MO640A Unicamp. 2010 8 .1953: Watson. 2010 Felipe R. 1º Sem. Sulco Menor Sulco Maior Felipe R. 2010 Biologia Computacional MO640A Unicamp.D.H. 1º Sem.

1º Sem.1958 . 2010 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 9 . Francis Crick. 1º Sem.Meselson e Stahl A natureza semiconservativa do DNA 1957: Francis Crick dogma central DNA proteína RNA animação Felipe R. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp. 2010 Felipe R. François Jacob e Jacques Monod Replicação DNA descoberta do mRNA Felipe R. 1º Sem. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 1960: Sydney Brenner.

1º Sem. 1º Sem. da Silva Felipe R. 2010 10 .Dogma central Dogma central DNA DNA RNA RNA proteí proteína proteí proteína Felipe R. da Silva Biologia Computacional MO640A Unicamp. 2010 Dogma central Biologia Computacional MO640A Unicamp. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. 2010 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 1º Sem. 2010 Dogma central Felipe R.

Proc. USA 69: 2904-2909. M. P (1972). Proc. Acad. Wilcox (1970). Felipe R. 2010 1970: Hamilton O. 379-391. Sci. 2010 1972: Paul Berg primeira molécula de DNA recombinante Nobel 1978 “pela descoberta das enzimas de restrição e sua aplicação nos problemas de genética molecular” Nobel 1980 “pelos estudos da bioquímica de ácidos nucleicos. RH and Berg. coli. 1588-1602 Felipe R. I. 1º Sem. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp. and Matthaei. Jackson. A restriction enzyme from Haemophilus influenzae.1961: Marshall Nirenberg Código Genético quebra o código genético Nobel 1968 “pela interpretação do código genético e sua função na síntese protéica” Nirenberg. Nat. coli upon naturally occurring or synthetic polyribonucleotides. A Biochemical Method for Inserting New Genetic Information into SV40 DNA: Circular SV40 DNA Molecules Containing Lambda Phage Genes and the Galactose Operon of E. 1º Sem. Journal of Molecular Biology 51. especialmente de DNA recombinante” Hamilton O. J. Symons. Natl. DA. W. W. H. 2010 Felipe R. da Silva Biologia Computacional MO640A Unicamp. 1º Sem. 1º Sem. USA 47. 2010 11 . Purification and general properties. Smith and K. da Silva Biologia Computacional MO640A Unicamp. Sci. (1961) The dependence of cell-free protein synthesis in E. Smith primeira enzima de restrição Felipe R.

K. The unusual origin of the polymerase chain reaction.. 252:1651-1656. 1º Sem. da Silva Unicamp.D. 230(4732):1350-4. 2010 1991: J. Horn G. 4: 56-65. Science. 1º Sem. Biologia Computacional MO640A MO640A Unicamp. T. Erlich H. B. 2010 Estrutura de um gene M. Scharf S. 1º Sem. 2010 12 . da Silva Biologia Computacional MO640A Unicamp. A.B (1983). Mullis PCR Nobel de Química 1993 “pela invenção da PCR” Mullis. Nobel 1980 “pelas contribuições na determinação de seqüências Biologia Computacional Felipe R. Arnheim N. Felipe R. (1985). Adams et al. Mullis K. K. Faloona F. Craig Venter ESTs na descoberta de genes Felipe R." tgaggaacggtgcctggaaaagggcaagaatatccggcatgggcatgagtagcttgaaactgctgaagtatgtcctgtgttt cttcaacttgccttttggatctgtgtctgctgcattttgggctttgggatctacctgctgatccacaacacttcggagtgct cttccataacctcccctccctcacgctgggcaatgtgtttgtcatcggggctctattatcatggtagttgccttcctgggct gcatgggctctagcaaggaaaacagtgtctgcttatgtcgttcttcatcctgctgctgattatcctccttgctgaggtgacc tggccatcctgctctttgtatatgaacagaagctgaatgagtatgtggctaagggtctgacgacagcatccaccgttaccac tcagacgttagcaccaaggcagcgtgggactccatccgtcatttctgcagtgttgtggtataaatggcacgagtgattggac cagtggcccaccagatcttgcccctcagatcgaaaagtggagggttgctatgcgaaagcaagactgtggtttcttccaattt cctgagtatcggaatcatcaccatctgtgtatgtgtgattgaggtgttgggatgtcctttgcactgaccctgaactgccaga ttgacaaaaccagccagaccatagggcatgatctgcagtagttctgtggtgaagagacttgtttcatctccggaagtgcaaa accattatagcatgaagccctacatgatcactgcaggatgatcctcctcccatcctttcccttttaggtccctgtcttatac aaccagagaagtgggtgttggccaggcacatcccatctcagcagcaagacaatctttcactcactgacggcagcagccatgt ctctcaaagtggtgaagtaatatctgagcatcttttagacaagagaggcaaagacaaactggatttaatggcccaaatcaaa gggtgaacccaggatatgaatttttgcatcttcccattgtcgaattagtctccgcctctaaataatgcccagtcttctcccc aaagtcaagcaagagactagttgaagggagtctggggccaggctcactggaccattgtcacaaccctctgtttctctttgac taagtgcctggctacaggaattacacagttctctttctccaaagggcaagatctcatttcaatttcttattagagggcctta ttgatgtgttctaagtctttccagaaaaaaactatccagtgattatatcctgatttcaaccagtcacttagctgataatcac agtaagaagacttctggtatatctctctatcagataagattttgttaatgtactattttactcttcaataaataaaacattt attatctcaaaatagccccggatatctgtgttaccagccttgtctcggccacctcaaggaaatcactaaatttagccgaaag gactgaggaacggtgcctggaaaagggcaagaatatccggcatgggcatgagtagcttgaaactgctgaagtatgtcctgtt tttcttcaacttgccttttggaaataaagctgctgcattttgggctttgggatctacct Introns Exons Science. Sci Am.1977: Walter Gilbert e Frederick Sanger seqüenciamento de DNA 1983: Kary B. (1991) Complementary DNA sequencing: 'expressed sequence tags' and the Human Genome Project. da Silva de ácidos nucleicos” Saiki R. 1º Sem.. da Silva Biologia Computacional MO640A Unicamp. 2010 Felipe R. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.

1º Sem. 2010 Alguns conceitos DNA 3’-UTR OH O-Me O-Me Proteína I II Exons Felipe R. da Silva III Tradução Modificação Pós-Traducional Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp. da Silva Biologia Computacional MO640A Unicamp.Splicing Estrutura e Expressão Gênica éxons Promotor I 5’-UTR III II íntrons Transcrição I RNA primário (Temporário) III II Splicing mRNA (Maduro) Felipe R. 1º Sem. 1º Sem. 2010 13 . da Silva Biologia Computacional MO640A Unicamp. 1º Sem. 2010 Felipe R. 2010 Estrutura de um promotor • Fita Codificante – a que tem a mesma seqüência que o mRNA • Intron x Exon • UTR • poliA Felipe R.

Sign up to vote on this title
UsefulNot useful