Vous êtes sur la page 1sur 68

GRADO

GUA DE ESTUDIO DE BIOLOGA


2 PARTE | PLAN DE TRABAJO Y ORIENTACIONES PARA SU DESARROLLO

2014-2015

Mnica Morales y scar Herrero


GRADO EN FSICA
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

BIOLOGA

1.- PLAN DE TRABAJO

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

Mnica Morales y scar Herrero


La asignatura de biologa se compone de 6 crditos ECTS repartidos en un programa en el que estn
contenidos 10 temas y dos actividades terico-prcticas de aprendizaje, denominadas Pruebas de
Evaluacin Continua (PEC). Estas PEC son de carcter OPTATIVO, no presenciales, estn
relacionadas con los aspectos tericos de la asignatura y podrn sumar hasta un punto a la nota de la
prueba presencial para obtener la calificacin final de la asignatura, tal y como viene especificado en el
apartado 3 de esta gua.
El examen de Biologa se realizar entre la ltima semana del mes de enero y la segunda
semana del mes de febrero de 2015. El examen consistir en 10 preguntas cortas sobre los temas
estudiados, las cuales podrn contestarse en un plazo mximo de 2 horas y nicamente en el
espacio asignado a las mismas. Las preguntas que sean respondidas fuera de este espacio no
sern tenidas en cuenta a la hora de calificar el examen.
El plan de trabajo le permitir establecer la planificacin del curso, organizando el tiempo de
aprendizaje. Incluye un cronograma orientativo para el estudio de los materiales y el calendario para la
realizacin de las distintas actividades programadas.
Se propone el estudio de un tema por semana y la realizacin de los ejercicios de autoevaluacin al
final del estudio de cada tema. La distribucin orientativa de tiempos para el estudio y desarrollo de las
actividades de la asignatura se muestra en la siguiente tabla:
TRABAJO AUTNOMO

Temas

Horas
Totales

Material
de estudio

Actividades
y ejercicios

Tutoras
en lnea

1
2
3
4
5

1
2
3
4
5

5
15
15
15
15

5
10
12.5
12.5
12.5

1
1
1
1
1

0.5
0.5
0.5
0.5
0.5

20

10

0.5

7
8
9

7
8
9

15
15
15

10
10
10

1
1
1

0.5
0.5
0.5

10

10

20

10

0.5

TOTAL

150

125

10

10

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

Evaluacin
continua

Semana

INTERACCIN CON EL EQUIPO DOCENTE EN ENTORNOS


VIRTUALES

Fecha entrega:
01/12/2014

Fecha entrega:
02/01/2015

BIOLOGA
El equipo docente pone de manifiesto el carcter orientativo de esta tabla, ya que la distribucin de
las horas de trabajo depender de las condiciones particulares de cada estudiante.
La fecha de entrega de la primera Prueba de Evaluacin Continua (PEC) est programada para el 1 de
diciembre de 2014. La entrega de la segunda Prueba de Evaluacin Continua (PEC) deber realizarse
el 2 de enero de 2015.
Ambas PEC deben enviarse para su correccin al Profesor Tutor asignado a travs de la
plataforma virtual. Por tanto, es necesario que el estudiante se ponga en contacto con su profesor
tutor al comienzo del curso para confirmar estas fechas.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

Mnica Morales y scar Herrero

2.- ORIENTACIONES PARA EL ESTUDIO DE LOS CONTENIDOS

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

BIOLOGA
La informacin recogida en esta parte de la Gua de Estudio tiene como finalidad ayudar y orientar al
alumno, tema a tema, en el estudio de los contenidos del programa de Biologa, y debe utilizarse como
complemento al libro de texto.
Todos los temas se han estructurado del mismo modo e incluyen los siguientes apartados:
- Guin del tema. En este apartado se plantean los puntos fundamentales del tema.
- Introduccin. Presenta un resumen detallado del contenido que se va a estudiar. Su objetivo es que
el alumno tenga una visin general de los contenidos que se incluyen en el tema y que sern
desarrollados en el libro de texto. Se plantean los aspectos fundamentales del tema, es decir, se
sealan los conceptos clave y las preguntas que uno debe plantearse ante un tema, y que sern
dilucidadas a medida que se vaya estudiando dicho tema. Se trata tambin, en la mayora de los casos,
de centrar el tema en el contexto del programa, relacionndolo con lo que se ha estudiado
anteriormente, o bien, presentndolo como una primera etapa de un proceso que ser analizado en
temas posteriores.
- Objetivos especficos del tema. Se remarcan en este apartado los principales conceptos e ideas
que el alumno habr de conocer y entender tras el estudio del tema.
- Bibliografa bsica. Hace referencia al captulo concreto del libro de texto propuesto para estudiar
cada uno de los temas:
ISBN: 978-84-9035-477-3
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
Este texto ha sido adaptado por la editorial para los alumnos de la UNED, con el fin de facilitar al
mximo el estudio de esta materia. Cada uno de los captulos contiene una introduccin en la que se
hace referencia a contenidos de temas anteriores, enlazndolos con los del tema que se va a estudiar,
el desarrollo estructurado de los contenidos con numerosos esquemas, dibujos y enlaces, y un
resumen que recoge las ideas ms relevantes del tema. Adems, se proponen diversos tipos de
preguntas de repaso y ejercicios muy tiles para la autoevaluacin del estudiante.
- Bibliografa complementaria. Incluye una relacin de libros recomendados que permiten que el
alumno pueda ampliar o profundizar en los contenidos que se han estudiado en el tema. Tambin se
deben emplear para consultar dudas o problemas de comprensin sobre aspectos concretos. Estos
libros deberan estar a disposicin de los alumnos en las bibliotecas de los Centros Asociados. Adems
de la bibliografa especificada en esta gua, el equipo docente podr proponer la lectura de diversas
publicaciones cientfico-tcnicas para ayudar a la mejor comprensin de los contenidos tericos por
parte del alumno.
- Direcciones en Internet. Se incluyen principalmente en este apartado direcciones de internet de
utilidad para el estudio sobre todo aquellas que proponen ejercicios prcticos con tutoriales para ayudar
a la resolucin de los mismos, animaciones para facilitar la comprensin de algunos de los procesos o
mecanismos biolgicos que complementan los contenidos del libro de texto.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

Mnica Morales y scar Herrero


- Preguntas y actividades para guiar el estudio. Sirven para guiar el estudio hacia los puntos
concretos y fundamentales del tema y para dirigir la atencin a los aspectos ms importantes. Las
cuestiones que se plantean exigen leer y reflexionar sobre los conceptos, ayudan a fijar y ordenar los
contenidos, a expresarlos con palabras propias y a resumirlos. Estas preguntas pueden ir realizndose
a medida que se estudia el tema.
Todas las preguntas tienen su respuesta en el libro de texto. Cualquier dificultad o duda referente a
estas preguntas ha de ser consultada al profesor tutor o al equipo docente.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

BIOLOGA

PROGRAMA
Tema 1. Introduccin.
Tema 2. Biomolculas.
Tema 3. Estructura y funcin celular.
Tema 4. Metabolismo.
Tema 5. Ciclo celular y meiosis.
Tema 6. Replicacin del DNA.
Tema 7. Transcripcin y traduccin del DNA.
Tema 8. Expresin de la informacin gnica.
Tema 9. Ingeniera gentica y biotecnologa.
Tema 10. Introduccin a la Ecologa.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

Mnica Morales y scar Herrero

TEMA 1. Introduccin
Teora celular. Teora de la evolucin. rbol de la vida. Taxonoma. Filogenia.

GUIN - ESQUEMA DEL TEMA


- Teora celular.
- Teora de la evolucin.
- Taxonoma fundamental.
INTRODUCCIN AL TEMA
Una teora es una explicacin de una clase muy general de observaciones o fenmenos. La teora
celular y la teora de la evolucin proporcionan las bases del desarrollo de la Biologa moderna debido
a que se centran en dos de las posibles preguntas ms generales: de qu estn hechos los organismos
y de dnde vienen.
El gran avance inicial de la Biologa, la teora celular, surgi tras 200 aos de trabajo. En 1665 Robert
Hooke utiliz un microscopio muy simple para estudiar la estructura del corcho de un roble. El
instrumento aumentaba los objetos slo 30 veces, pero permiti a Hooke ver pequeos
compartimentos similares a poros, que eran invisibles para el ojo humano. Estas estructuras se
llamaron clulas.
Poco despus de que Hooke publicara sus resultados, Anton van Leeuwenhoek consigui fabricar
microscopios mucho ms potentes, algunos capaces de lograr hasta 300 aumentos. Con estos
instrumentos Leeuwenhoek estudi muestras de agua de un estanque y realiz las primeras
observaciones de organismos unicelulares como los paramecios. Tambin observ y describi la
estructura de las clulas sanguneas humanas y los espermatozoides.
Los bilogos se han sorprendido por la diversidad y la complejidad de las clulas a medida que los
avances en microscopa han permitido estudiar clulas con ms aumentos. Sin embargo, la conclusin
bsica establecida en el siglo XIX se mantiene intacta: hasta donde se sabe, todos los organismos
estn compuestos por clulas. Hoy en da la clula se define como un compartimento muy
organizado rodeado de una estructura delgada y flexible llamada membrana plasmtica y que contiene
sustancias qumicas concentradas en una solucin acuosa.
La teora celular se complet en 1858, cuando Rudolph Virchow declar que todas las clulas surgen
de clulas preexistentes, echando por tierra la hiptesis de la generacin espontnea, la explicacin
dominante hasta la fecha.
En 1858, en la Sociedad Lineana de Londres, se leyeron a un pequeo grupo de cientficos unos cortos
artculos escritos independientemente por Darwin y Wallace. Un ao ms tarde Darwin public un libro
que ampliaba la idea resumida en esos breves artculos: El origen de las especies. La primera edicin
se agot en un da.
La teora de Darwin y Wallace estableca dos importantes conceptos respecto a los modelos del mundo
natural. El primer concepto era que las especies estaban relacionadas por ancestros comunes.
Esto se opona a la opinin predominante de la ciencia en ese momento, que era que las especies
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

BIOLOGA
representaban entidades independientes creadas de una en una por un ser divino. El segundo
concepto resultaba igualmente novedoso: en lugar de aceptar la hiptesis popular de que las especies
permanecen inalterables en el tiempo, Darwin y Wallace proponan que las caractersticas de las
especies pueden cambiar de generacin en generacin. Darwin denomin a este proceso como
descendencia con modificacin.
Evolucin significaba, por tanto, que las especies no son unidades independientes e inalterables, sino
que se relacionan entre s y cambian en el tiempo. Esta parte de la teora de la evolucin no era original
de Darwin y Wallace, puesto que varios cientficos haban llegado a las mismas conclusiones acerca de
las relaciones entre especies. El gran mrito de Darwin y Wallace fue proponer el proceso de la
seleccin natural como el mecanismo que explica cmo sucede la evolucin.
La seleccin natural acta sobre los individuos, pero el cambio evolutivo slo afecta a las
poblaciones. Si ciertos rasgos heredables conducen a un mayor xito en la produccin de
descendencia, entonces esos rasgos se hacen ms frecuentes en la poblacin a lo largo del tiempo. De
este modo, las caractersticas de la poblacin cambian como resultado de la seleccin natural sobre los
individuos.
Las investigaciones sobre la especiacin apoyan una idea propuesta por Darwin y Wallace hace ms
de un siglo: la seleccin natural puede provocar cambios entre las especies adems de dentro de las
especies. Las conclusiones ampliadas son que todas las especies derivan de especies previas y
que todas las especies, pasadas y presentes, comparten un nico ancestro comn. Si la teora de
la evolucin por seleccin natural es vlida, los bilogos deberan ser capaces de reconstruir un rbol
de la vida, un diagrama que describira las relaciones genealgicas entre las especies con una nica
especie ancestral en la base.
En ciencias, taxonoma significa nombrar y clasificar organismos. Esta rama de la Biologa empez a
florecer cuando un botnico llamado Carlos Linneo decidi poner orden en la increble diversidad de
organismos que se estaban descubriendo en el siglo XVIII.
El pilar del sistema de Linneo es un nombre compuesto por dos palabras, nico para cada tipo de
organismo. La primera palabra indica el gnero del organismo. Un gnero se compone de un grupo de
especies estrechamente relacionadas. El segundo trmino de este nombre identifica la especie del
organismo. Una especie est compuesta de individuos que habitualmente se reproducen entre s o
comparten caractersticas que son distintas de las otras especies. El sistema de Linneo ha resistido el
paso de tiempo y su nomenclatura binomial sigue siendo el estndar en Biologa.
Para organizar y clasificar la inmensa diversidad de especies descubiertas en el siglo XVIII, Linneo cre
una jerarqua de grupos taxonmicos. Del agrupamiento ms especfico al menos, los grupos son
especie, gnero, familia, orden, clase, filo y reino. Cada uno de estos grupos se puede denominar
taxn y, por tanto, la base del sistema de Linneo es que los taxones inferiores estn anidados con los
superiores.
Estas relaciones genealgicas entre los individuos quedan plasmadas en su filogenia. As, un
diagrama que muestre la historia evolutiva, la filogenia de los organismos, se denomina rbol
filogentico. Al igual que un rbol genealgico familiar muestra las relaciones entre individuos, un
rbol filogentico muestra las relaciones entre especies. En este tipo de rbol, las ramas cercanas
representan especies estrechamente relacionadas.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

10

Mnica Morales y scar Herrero


LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Conocer los aspectos histricos y cientficos que permitieron alcanzar el conocimiento de la
existencia de clulas.
Entender los conceptos bsicos de la teora celular y las implicaciones de echar por tierra la
hiptesis de la generacin espontnea.
Conocer las bases sobre las que Darwin y Wallace asentaron la teora de especies
relacionadas y variables en el tiempo.
Entender en qu consiste el proceso de seleccin natural y por qu se le considera el motor de
la evolucin.
Ser capaz de relacionar la teora de la evolucin con la taxonoma moderna.
Conocer la nomenclatura binomial establecida por Linneo.
Comprender el significado de un rbol filogentico y saber interpretar el parentesco entre las
especies que en l aparecen.
Alcanzar una visin dinmica e integradora de la Biologa en todo su campo de estudio y a
todos sus niveles, desde los organismos unicelulares a los ms complejos.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 1. La Biologa y el rbol de la vida.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

11

BIOLOGA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/

On-Line Biology Book: libro de biologa en lnea y en ingls.

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html

The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Cules son las dos premisas fundamentales de la teora celular? En qu consista la hiptesis de
la generacin espontnea?
2. Por qu revolucionaron Darwin y Wallace el modelo del mundo natural vigente en su poca?
3. Qu es la seleccin natural?
4. Cules son los principales grupos taxonmicos? Ejemplifique el caso del ser humano.
5. Qu se representa en un rbol filogentico y cmo?

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

12

Mnica Morales y scar Herrero

TEMA 2. Biomolculas
El agua: estructura y propiedades. El carbono como esqueleto. Protenas.
Enzimas. cidos nucleicos. Hidratos de carbono.

GUIN - ESQUEMA DEL TEMA


- Estructura y propiedades del agua.
- El carbono en los seres vivos.
- Protenas.
- Catalizadores biolgicos: enzimas.
- cidos nucleicos.
- Hidratos de carbono.
INTRODUCCIN AL TEMA
La caracterstica comn de todos los seres vivos es que ninguno podra existir sin el agua, la base de la
vida. El agua:

Es el disolvente de las molculas bioqumicas.


Participa directamente en las reacciones de estas molculas.
Recibe los desechos.
Absorbe calor.

El agua puede existir en estado slido (hielo), lquido y gaseoso (vapor). La vida surgi en el agua en
estado lquido hace miles de millones de aos y es el medio en el que ha ido evolucionando hasta lo
que conocemos hoy en da. An hoy es el componente qumico fundamental de los seres vivos (45 95% de su composicin).
Qumicamente tiene una estructura y unas propiedades nicas:
Cada molcula consta de dos tomos de hidrgeno y uno de oxigeno (H2O) dispuestos en
forma tetradrica.
Tiene naturaleza polar, siendo el disolvente ideal para las reacciones bioqumicas, ya que
puede disolver la mayora de las sustancias biolgicas.
Puede formar enlaces o puentes de hidrgeno, lo que le confiere unas propiedades
excepcionales:
- En estado slido es menos densa que en estado lquido y flota, lo que hace que la
congelacin comience por la superficie, permitiendo as la vida en las zonas bajo el
hielo, donde permanece lquida.
- Es un moderador de los cambios de temperatura, ya que tiene un calor especifico
elevado, de 4,18 J/gC (1 cal/gC) medido a 25C, lo que contribuye a la relativa
constancia de temperatura tanto de las grandes masas de agua como de las reas
terrestres costeras.
- Tiene un calor de vaporizacin elevado, por lo que es necesario mucho calor para
convertir agua lquida en vapor y por tanto ayuda al enfriamiento del ambiente.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

13

BIOLOGA
-

Los enlaces por puentes de hidrgeno de las molculas de agua son dbiles, por lo
que al romperse y formarse de manera continua dan una gran libertad de
movimiento al agua lquida.
- Posee una elevada tensin superficial, que hace referencia a la dificultad de
penetrar la superficie acuosa expuesta al aire (p. ej. animales pequeos que
caminan sobre el agua o agua que rebosa en un recipiente pero no se derrama).
El agua es un cido dbil, pues tiende a ionizarse en un in hidrxido (OH-) y un hidrogenin
(H+). Esta reaccin se da entre dos molculas de agua, capturando cada una el hidrogenin de
la otra, pero se simplifica con la reaccin: H2O H+ + OH-.
Las molculas que componen los seres vivos pueden ser de diversa naturaleza y de tamaos
diferentes. Entre ellas las hay de naturaleza inorgnica, como el agua y las sales minerales, y de
naturaleza orgnica, que tienen en comn el hecho de contener un esqueleto de tomos de carbono.
La mayora de los compuestos importantes de los organismos contienen carbono. Por sus electrones
de cuatro valencias, puede formar muchos enlaces covalentes. Estos enlaces pueden ser tanto simples
como dobles, lo que permite una variedad muy amplia de formas moleculares.
En los seres vivos gran, parte de las molculas principales son de gran tamao debido a que se forman
por una gran cantidad de tomos unidos en formas especficas. Son las macromolculas: protenas,
hidratos de carbono, cidos nucleicos y lpidos.
Las macromolculas son polmeros de molculas ms pequeas de la misma naturaleza, unidas entre
s por enlaces especficos. Estas molculas ms pequeas se denominan monmeros. Cada una de
estas macromolculas tiene funciones especficas, que guardan relacin con su estructura y con las
propiedades qumicas de los monmeros que las forman.
Si bien todas las molculas de los seres vivos tienen funciones importantes, las protenas son
probablemente las macromolculas con mayor diversidad de funciones y actividad en los procesos
biolgicos. De hecho participan en todas las funciones de los seres vivos salvo el almacenamiento de
energa y la herencia. Las protenas intervienen en:

Defensa de los organismos vivos.


Movimiento.
Catlisis de las reacciones qumicas (enzimas).
Mensajes.
Funciones estructurales y de sostn.
Transporte de sustancias y movimiento de los organismos.

Las protenas estn compuestas por polmeros de aminocidos, es decir, cadenas formadas por
aminocidos unidos entre s por un enlace entre el grupo carboxilo de un aminocido y el grupo amino
de otro aminocido, denominado enlace peptdico. Los aminocidos tienen distintas estructuras y
funciones debido a la composicin de su cadena lateral o grupo R.
Las protenas tienen una estructura variable que se puede analizar en distintos niveles bsicos de
organizacin:
Estructura primaria: cada protena tiene una secuencia nica y especfica de aminocidos.
Estructura secundaria: es el primer plegamiento que sufre la protena hasta llegar a su
conformacin final, pudiendo ser en forma de hlice o lmina plegada . Su formacin

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

14

Mnica Morales y scar Herrero


depende de la estructura primaria de la molcula, ms concretamente de la geometra de los
aminocidos.
Estructura terciaria: se trata de un plegamiento adicional, resultado de las interacciones entre
grupos R, que hace que se d la estructura tridimensional del polipptido. Las interacciones
ms importantes entre las cadenas laterales son: enlaces de hidrgeno, fuerzas de Van der
Waals, enlaces disulfuro y enlaces inicos.
Estructura cuaternaria: aparece en aquellas protenas que presentan varias subunidades y
consiste en la combinacin de estructuras terciarias.
Una protena puede alterarse o inhibirse por la destruccin de su plegamiento tridimensional,
fundamentalmente de su estructura terciaria. Es lo que se conoce como desnaturalizacin de la
protena y suele ser un proceso irreversible.
En los seres vivos hay unas protenas denominadas chaperonas moleculares que facilitan el
plegamiento de cada protena.
Las protenas tienen diferentes funciones. La gran mayora de las protenas celulares son enzimas que
actan como catalizadores. Los catalizadores proteicos son importantes porque aceleran las
reacciones qumicas importantes para la vida.
Un catalizador es una sustancia que acelera una reaccin qumica sin consumirse l mismo, es decir,
sin sufrir ninguna transformacin en la reaccin. A nivel biolgico, un catalizador es una sustancia que
permite que una reaccin tenga lugar en unas determinadas condiciones de presin, temperatura, etc.,
ya que muchas reacciones qumicas requieren un aporte de energa para iniciarse (energa de
activacin).
Los catalizadores biolgicos se denominan enzimas, siendo protenas en su mayor parte. En una
reaccin catalizada por una enzima, los elementos fundamentales son:
Sustrato: la/s molcula/s que va/n a sufrir la reaccin qumica; es decir, el/los reactivo/s.
Sitio activo: lugar de la superficie de la enzima al que se une el sustrato y donde tiene lugar la
reaccin (catlisis). Es especfico para cada sustrato de cada reaccin qumica.
Complejo enzima-sustrato: el producido por la unin del sustrato al sitio activo de la enzima.
En este momento la enzima cambia su conformacin original y da lugar al producto de la
reaccin qumica, tras lo cual vuelve a quedar libre con su forma y estado original.
Algunas enzimas requieren la presencia en su estructura de otras molculas que les permitan ser
qumicamente activas. Estas molculas pueden ser de diferente naturaleza:
Cofactores: iones inorgnicos (cobre, hierro, cinc, etc.).
Coenzimas: molculas orgnicas pequeas que se unen temporalmente al sitio activo de la
enzima para que esta acte (vitaminas, ATP, ADP, etc.)
Grupos prostticos: unidos de forma permanente a la enzima para que sta sea activa.
La actuacin de las enzimas determina el metabolismo, por lo que es necesario regular la actividad
enzimtica para regular la actividad metablica. Para ello existen inhibidores, molculas que se unen a
la enzima impidiendo su actuacin. La inhibicin de la actividad enzimtica puede ser irreversible o
reversible.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

15

BIOLOGA
Los cidos nucleicos son las molculas que almacenan la informacin gentica y la transmiten entre
generaciones. Hay dos tipos de cidos nucleicos, que se diferencian en su estructura qumica y
tamao: el DNA (cido desoxirribonucleico) y el RNA (cido ribonucleico). Las molculas de DNA son
polmeros que contienen codificada la informacin hereditaria y la transmiten de una generacin a la
siguiente. El RNA acta como intermediario temporal del DNA, de tal forma que moviliza copias de
fragmentos del DNA para la sntesis de protenas especficas. De este modo, la informacin pasa del
DNA al RNA y de ah a las protenas.
En cuanto a su composicin qumica, los cidos nucleicos se forman a partir de unos monmeros
llamados nucletidos. Cada nucletido se compone de un azcar pentosa, un grupo fosfato y una base
nitrogenada (prica o pirimidnica). En el DNA la pentosa es desoxirribosa y en el RNA es ribosa.
La estructura primaria del DNA est formada por una secuencia de bases nitrogenadas. La estructura
secundaria del DNA est formada por dos hebras de DNA que discurren en direcciones opuestas y que
se encuentran enfrentadas por las bases nitrogenadas, por las que se mantienen unidas mediante
puentes de hidrgeno. Las bases nitrogenadas del DNA son adenina (A), guanina (G), citosina (C) y
timina (T), que aparecen siempre emparejadas AT y GC, unidas por puentes de hidrgeno (dos en el
caso de A=T y tres en el caso de GC). Este emparejamiento de bases es muy estable, es universal y
es la clave de la informacin contenida en los cidos nucleicos y de su transmisin. La secuencia de
las bases nitrogenadas es el lenguaje en el que se escribe toda la informacin vital para la clula.
La estructura primaria del RNA est formada por una secuencia de bases nitrogenadas que son
adenina (A), guanina (G), citosina (C) y uracilo (U). En la inmensa mayora de los casos, las bases del
RNA forman enlaces de hidrgeno con bases complementarias de la misma hebra, en vez de formar
los enlaces con bases de una hebra diferente, como en el DNA. Esto da lugar a una estructura
secundaria conocida como horquilla. Las molculas de RNA se pliegan y pueden interaccionar entre s,
formando algunas estructuras terciarias y cuaternarias.
En 1989, el descubrimiento de RNA cataltico (las ribozimas) marc un cambio en la investigacin, al
demostrar que las protenas no son las nicas molculas capaces de catalizar reacciones qumicas.
Los hidratos de carbono son compuestos carbonados, aldehdos y cetonas, con grupos hidrgeno e
hidroxilo (H-C-OH), cuyas funciones principales son servir como fuente de energa y constituir
esqueletos carbonados a partir de los cuales se puedan formar otras molculas importantes para los
seres vivos.
Los hidratos de carbono pueden existir como:
Monosacridos: son azcares simples, como la glucosa o la fructosa, que constituyen los
monmeros a partir de los que se forman los hidratos de carbono ms grandes y complejos.
Polisacridos: polmeros que se forman por la unin de monosacridos. Los polisacridos
ms sencillos se llaman disacridos y estn formados de dos monosacridos.
Los monosacridos pueden ser de varios tipos segn el nmero de carbonos que los forman, siendo
los ms frecuentes las hexosas y las pentosas. Los monosacridos se unen para formar polmeros
mediante enlaces glucosdicos, que son de tipo covalente. La orientacin de los estos enlaces tiene
una gran importancia en la formacin de los polisacridos, determinando tanto sus propiedades fsicas
como qumicas.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

16

Mnica Morales y scar Herrero


Los hidratos de carbono tienen distintas funciones en las clulas: proporcionan materiales fibrosos,
indican la identidad celular y almacenan energa qumica.
Por ltimo, los lpidos son otra clase de biomolculas, pero se estudiarn en el tema 3, Estructura y
funcin celular, como componentes fundamentales de las membranas celulares.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Conocer las principales biomolculas implicadas en los diferentes procesos biolgicos.
Entender el papel del agua como catalizador de la vida.
Conocer el papel del carbono como esqueleto molecular.
Saber qu son las protenas, conocer sus diferentes funciones y entender el papel de los
grupos prostticos en la composicin de las mismas.
Conocer los distintos niveles de complejidad de las protenas y su implicacin en la funcin que
desempean.
Conocer los distintos tipos de enzimas y los elementos principales en las reacciones qumicas
que catalizan.
Conocer la composicin de los cidos nucleicos y diferenciar la estructura del DNA Y RNA,
tanto en cuanto al azcar que entra en su composicin como a sus bases nitrogenadas.
Diferenciar los distintos tipos de hidratos de carbono y entender el papel que desempean.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 2. Agua y carbono: la base qumica de la vida.
- Captulo 3. Estructura y funcin de las protenas.
- Captulo 4. cidos nucleicos y el mundo del ARN.
- Captulo 5. Introduccin a los carbohidratos.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

17

BIOLOGA
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/

On-Line Biology Book: libro de biologa en lnea y en ingls.

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html

The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
Problemas de enlaces intermoleculares en el agua.
http://www.biologia.arizona.edu/biochemistry/tutorials/chemistry/08q.html
Estructura del agua.
http://www.biorom.uma.es/contenido/UIB/Jmoldesarrollo/aguajmol/agua_jmol.html
http://www.biorom.uma.es/contenido/JCorzo/temascompletos/InteraccionesNC/agua/agua.htm
Estructura de carbohidratos y una revisin de las molculas ms importantes.
http://www.biorom.uma.es/contenido/UIB/Jmoldesarrollo/carbohidratosjmol/carbohidratosjmol.html
Estructura general de un aminocido.
http://www.biorom.uma.es/contenido/UIB/Jmoldesarrollo/aaestructurajmol/aaestjmol.html

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

18

Mnica Morales y scar Herrero


PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Cules son las principales propiedades qumicas del agua?
2. Enumere los tipos de macromolculas ms importantes.
3. Cules son las funciones principales de las protenas? Explique cmo es su estructura en cuanto a
los niveles bsicos de organizacin.
4. Qu son las enzimas y cules son los elementos principales en las reacciones que catalizan?
5. Describa las caractersticas y las diferencias de los dos tipos de cidos nucleicos existentes.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

19

BIOLOGA

TEMA 3. Estructura y funcin celular


Lpidos y membranas. Mitocondrias. Retculo endoplsmico. Complejo de Golgi. Lisosomas.
Peroxisomas. Ncleo. Citoesqueleto. Movimiento intracelular.
Movimientos celulares. Comunicacin celular.

GUIN - ESQUEMA DEL TEMA


- Organizacin celular.
Estructura de la clula procariota.
Estructura de la clula eucariota.
Lpidos y membrana plasmtica.
Sistema de endomembranas.
Ncleo.
Citoesqueleto.
- Comunicacin celular.
Recepcin de la seal.
Transduccin de la seal.
Respuesta a las seales.
INTRODUCCIN AL TEMA
La clula es la unidad estructural y funcional de los seres vivos. Todos los seres vivos estn
constituidos por clulas. Los hay formados por una nica clula (organismos unicelulares) y existen
seres vivos formados por multitud de clulas (organismos pluricelulares).
Toda clula proviene de una clula anterior, es decir, se origina por la divisin de otra clula. Por tanto,
la clula es tambin la unidad bsica de reproduccin de los seres vivos. Por otro lado, todas las
clulas de todos los organismos comparten ciertas caractersticas estructurales, tales como la
arquitectura de sus membranas. Asimismo muchos procesos metablicos complejos son llevados a
cabo bsicamente de la misma manera por todos los organismos: la replicacin del DNA, la sntesis de
protenas y la produccin de energa qumica a partir de la conversin de glucosa en dixido de
carbono. Estas similitudes bioqumicas no son mera coincidencia: todas las clulas tienen un ancestro
comn a partir del cual han evolucionado.
Segn el grado de diferenciacin estructural alcanzado a travs de la evolucin, se han establecido dos
tipos de organizacin celular: procariota y eucariota.
La clula procariota es la ms sencilla estructuralmente. Sus caractersticas se resumen en:

Son ms pequeas que las clulas eucariotas, aunque visibles al microscopio ptico.
Son unicelulares, aunque podemos encontrarlas en colonias de varios cientos de individuos.
Son ms sencillas que las clulas eucariotas en su arquitectura interna.
Tienen membrana plasmtica.
El DNA se encuentra libre en el citoplasma, ausencia de ncleo rodeado de membrana.
Casi todas presentan pared celular rgida.
Adems, algunas clulas procariotas tienen: membrana externa, cpsula y/o flagelos.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

20

Mnica Morales y scar Herrero


Las caractersticas principales de las clulas eucariotas son las siguientes:
Su organizacin se basa en: membrana plasmtica, citoplasma y ncleo.
Adems, poseen un esqueleto interno que mantiene la forma de la clula y participa en el
transporte de los materiales.
Tienen compartimentos membranosos u orgnulos, localizados en el citoplasma y separados
del citosol por una membrana, cada uno con funciones especficas:
- El ncleo: donde se encuentra el DNA, rodeado por una membrana.
- Ribosomas: de mayor tamao que los de procariotas y encargados de la sntesis
de protenas.
- Retculo endoplasmtico (liso y rugoso) y aparato de Golgi: empaquetan las
protenas y se ocupan de su envo a los lugares de destino.
- Lisosomas y vacuolas: sistemas celulares digestivos de macromolculas, as
como de acumulacin y reserva de molculas.
- Mitocondrias: orgnulos para la produccin energtica de la clula.
- Cloroplastos: exclusivos de clulas fotosintticas, encargados de la fotosntesis.
Los lpidos son molculas hidrocarbonadas, muy heterogneas desde el punto de vista qumico, pero
que comparten todas ellas la propiedad de ser insolubles en agua, aunque se vuelven solubles en
disolventes apolares. Aunque forman agregados macromoleculares, no se pueden considerar como
polmeros propiamente dichos, ya que estos agregados se mantienen gracias a fuerzas no covalentes
dbiles como son las fuerzas de Van der Waals, tpicas de molculas no polares.
Los tres tipos de lpidos presentes en las clulas son:
Las grasas tienen como funcin principal almacenar energa. Se llaman grasas cuando son
slidos a temperatura ambiente y aceites cuando son lquidos.
Los esteroides modificados tienen una funcin reguladora.
Los fosfolpidos tienen una funcin estructural muy importante en la membrana de las clulas.
Las membranas celulares presentan una doble capa de fosfolpidos, enfrentados por sus colas
hidrofbicas.
Todas las membranas tienen una estructura semejante, con los fosfolpidos como las molculas
esenciales en su composicin. Los fosfolpidos son molculas anfipticas: tienen una regin hidrfila y
una regin hidrfoba. La membrana es una parte esencial de la clula, ya que delimita su territorio
fsico y controla su ambiente qumico. Cuando la membrana falla o pierde su funcin, la clula muere.
Todas las membranas tienen una estructura semejante, con los fosfolpidos como las molculas
esenciales en su composicin. Otras molculas como las protenas, los glcidos y las glicoprotenas
son la base de los procesos de reconocimiento de seales qumicas y transporte de molculas a travs
de las membranas, jugando un papel esencial en la comunicacin entre clulas y el reconocimiento
celular, procesos clave en la regulacin hormonal, el desarrollo y la inmunidad.
Las bicapas lipdicas son altamente impermeables a la mayora de las molculas polares. Con el fin de
transportar estas molculas hacia el interior o hacia el exterior de las clulas, las membranas plasmticas
poseen muchas protenas especficas de transporte (protenas transportadoras), cada una de las cuales
es responsable de la transferencia de un determinado soluto. Por otra parte, el transporte de
macromolculas y partculas de gran tamao requiere otros mecanismos ms complejos, siendo
normalmente liberadas al exterior por exocitosis y penetrando al interior por endocitosis, procesos que
conllevan la formacin de vesculas transportadoras rodeadas de membrana.
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

21

BIOLOGA
El sistema interno de membranas se compone de una serie de membranas que forman sculos,
cisternas y tbulos esparcidos por el citoplasma. Estos elementos se pueden encontrar de manera
aislada o agrupada y, a su vez, aparecer formando una red o apilados.
El retculo endoplsmico es una estructura donde cisternas y tbulos se agrupan formando una red
que ocupa una gran extensin del citoplasma. Se pueden diferenciar dos tipos de retculo, el rugoso y
el liso.
El retculo endoplsmico rugoso (RER) est formado por una red de cisternas que presentan
en su cara externa ribosomas. Los ribosomas tienen una especial importancia en la funcin del
RER ya que realizan la sntesis de protenas hacia el interior del retculo.
El retculo endoplsmico liso (REL) se compone de tbulos que en ciertas partes se
conectan, por lo que se piensa forma un sistema continuo con el RER. La principal
caracterstica morfolgica del REL es que carece de ribosomas. La funcin del RER es
participar en la sntesis de protenas y su modificacin post-traduccional, determinando el
destino final de esas protenas segn las modificaciones que se realizan. En este proceso
tambin participar el aparato de Golgi, ya que existe una conexin entre el retculo
endoplsmico y el aparato de Golgi.
El aparato de Golgi es un orgnulo formado por sculos apilados que vara en su situacin segn el
tipo celular. La unidad estructural del aparato de Golgi es el dictiosoma, un conjunto de sculos
apilados en cuya periferia se pueden observar vesculas. Conectado con el retculo endoplsmico, la
funcin del aparato de Golgi es participar en la sntesis de protenas a travs de las modificaciones
post-traduccionales.
Los lisosomas son orgnulos que se originan en el aparato de Golgi, consistentes en bolsas rodeadas
de una membrana sencilla. Estn llenos de enzimas digestivas y en su interior se hidrolizan las
macromolculas, as como cuerpos extraos que hayan podido entrar en la clula.
El ncleo se encuentra delimitado por una doble membrana llamada envoltura nuclear, semejante en
su estructura a la membrana plasmtica, pero que presenta poros nucleares que conectan el interior
del ncleo con el citoplasma y permiten el paso de RNA y protenas.
Entre las funciones fundamentales del ncleo destacan:
Es el lugar donde se encuentra almacenado el DNA de la clula (aunque tambin hay DNA en
algunos orgnulos celulares, como mitocondrias y cloroplastos), en forma de cromatina.
Cuando la clula no se encuentra en divisin es una estructura donde las hebras del DNA se
encuentran poco enrolladas, mientras que cuando la clula se va a dividir la cromatina se
condensa de tal manera que las hebras del DNA se encuentran muy empaquetadas formando
los cromosomas.
Es donde tiene lugar la duplicacin del DNA, necesaria para la reproduccin celular.
Es el lugar desde el que el DNA controla todas las funciones de la clula.
En l se encuentra una regin denominada nuclolo, ms oscura y densa que el resto al
observarla al microscopio, donde se inicia el ensamblaje de los ribosomas a partir de protenas
especficas y RNA ribosmico.
La envoltura nuclear se disgrega cuando la clula eucariota se divide, para volver a formarse una vez
que la divisin ha concluido.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

22

Mnica Morales y scar Herrero


El citoesqueleto est formado por una serie de fibras delgadas que se localizan en el citoplasma de
las clulas. Sus funciones principales son:
Mantener la forma y dar sostn a la estructura celular.
Permitir diferentes tipos de movimiento, tanto de materiales dentro de la clula como de la
propia clula.
El citoesqueleto se compone de:
Filamentos de actina o microfilamentos. Su principal componente es la protena actina y
tienen dos funciones principales: ayudar a que toda o parte de la clula se contraiga
(movimiento) y estabilizar la forma celular (soporte).
Filamentos intermedios. Exclusivos de clulas de organismos pluricelulares. Se forman por
protenas de la familia de la queratina y sus funciones principales son estabilizar la estructura
celular y resistir la tensin.
Microtbulos. Son largos cilindros huecos y sin ramificaciones, formados por la protena
tubulina. Sus funciones principales son formar un esqueleto interno rgido en la clula y
constituir elementos esenciales en las extensiones celulares como cilios, flagelos y
centrolos. Actan como un andamiaje sobre el que las protenas motoras pueden mover
estructuras en la clula.
Todas las clulas perciben y procesan informacin de su entorno y responden modificando su actividad
para adecuarse a las condiciones ambientales. Estos procesos se observan tanto en clulas
procariotas como en clulas eucariotas, tanto de vida libre (unicelulares) como asociadas en un
organismo pluricelular.
El proceso completo desde que se detecta la seal hasta que se produce una respuesta se denomina
va de transduccin de la seal. Este proceso de comunicacin entre clulas y adaptacin al
ambiente requiere de la existencia de diversos elementos que actan en cascada, con el siguiente
esquema:
Seales Receptores Transductores Efectos/Respuestas.
Las seales pueden tratarse tanto de sustancias qumicas como de factores fsicos. Segn quin las
produce y a qu tipo de clulas afectan, se clasifican en:
Seales autocrinas: la misma clula que la produce se ve afectada por ella.
Seales paracrinas: las clulas que las producen no se ven afectadas por ellas, sino que se
transmiten por el medio extracelular y afectan a otras clulas.
Toda sealizacin tiene que tener un receptor que reconozca la seal, slo de esta forma se puede
producir la respuesta especfica de la clula. Las clulas no responden a todas las seales, sino
solamente a aquellas para las que tiene receptores especficos.
Los receptores se unen a la seal de forma especfica. Las seales se denominan ligandos. La unin
del ligando al receptor siempre produce un cambio de conformacin de ste ltimo, lo que inicia la
respuesta celular. No obstante, la unin ligando-receptor es reversible, ya que en caso contrario la
estimulacin por parte de la seal sera permanente. As, una vez que la seal se transmite, el ligando
se libera de su receptor.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

23

BIOLOGA
Hay diferentes tipos de receptores, que se pueden diferenciar por su ubicacin celular, que a su vez
tiene relacin con la naturaleza qumica de los ligandos: receptores de membrana (canales inicos,
proten-quinasas y receptores asociados a protenas G) y receptores citoplasmticos.
La transduccin de la seal convierte una seal intercelular en una seal intracelular. Una misma seal
no produce el mismo tipo de respuesta en todas las clulas que son capaces de reconocerla. La
diferencia viene mediada por los transductores de la seal, de los que depende el tipo de respuesta
celular. Estos transductores pueden ser:
Transductores directos: la respuesta puede desencadenarla el propio receptor, en la
membrana plasmtica.
Transductores indirectos: existe una molcula, denominada segundo mensajero, que media
la interaccin entre la unin ligando-receptor y la respuesta de la clula.
La transduccin nunca es un suceso nico que ocurre tras la unin ligando-receptor, sino que siempre
implica una cascada de sucesos en la que una serie de protenas interaccionan entre ellas transfiriendo
la seal hasta provocar la respuesta de la clula.
La unin ligando-receptor estimula una transduccin, directa o indirecta, que conduce a la tercera etapa
del proceso de comunicacin celular, que es la produccin de uno o varios efectos sobre la clula
estimulada. Estos efectos pueden resumirse en:
Cambios en la permeabilidad de la membrana, fundamentalmente por apertura de canales
inicos en la membrana plasmtica.
Cambios en el metabolismo, al activarse o desactivarse ciertas enzimas con funciones en una
o varias rutas metablicas.
Cambios en la expresin o actividad de los genes, debido a que se activa o inhibe la
transcripcin de algunos de ellos, modificndose la sntesis de las protenas para las que
codifican.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Entender por qu se considera a la clula como la unidad bsica de la vida.
Conocer y distinguir las caractersticas principales de las clulas procariotas y eucariotas.
Comprender la estructura de las membranas celulares y su funcin en el mantenimiento de la
integridad celular.
Describir la funcin del ncleo y diferenciar los diferentes orgnulos que compartimentalizan el
interior de la clula y que permiten explicar la diversidad de procesos moleculares que ocurren
simultneamente y de forma ordenada en su interior.
Diferenciar la estructura y funcin del retculo endoplsmico rugoso y liso, as como analizar la
relacin entre este orgnulo y otras membranas internas de la clula.
Conocer el papel del retculo endoplsmico en la sntesis, procesamiento y transporte de
protenas.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

24

Mnica Morales y scar Herrero


Entender el papel del aparato de Golgi en el procesamiento y la modificacin de las protenas.
Describir las funciones de los lisosomas.
Conocer los mecanismos bioqumicos generales de sealizacin que emplean las clulas para
comunicarse, lo cuales implican interacciones entre sustancias qumicas y receptores.
Conocer las biomolculas implicadas en la sealizacin, su estructura y mecanismos de
accin.
Entender los diferentes mecanismos a travs de los cuales los receptores detectan y
transmiten las seales qumicas a las que est expuesta una clula.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 6. Lpidos, membranas y las primeras clulas.
- Captulo 7. El interior de la clula.
- Captulo 11. Interacciones clula-clula.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

25

BIOLOGA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/

On-Line Biology Book: libro de biologa en lnea y en ingls.

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html

The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
Excelentes fotos de clulas.
http://www.cellalive.com/index.htm
Estructura de los lpidos.
http://www.biorom.uma.es/contenido/UIB/Jmoldesarrollo/lipidosjmol/index_jmol.html
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Comente las diferencias ms importantes entre las clulas procariotas y las eucariotas.
2. Cules son los tipos de lpidos presentes a nivel celular y qu funcin tienen? Describa las
caractersticas principales de las membranas celulares.
3. Explique la funcin y las caractersticas ms importantes de:
Retculo endoplsmico liso y rugoso.
Aparato del Golgi.
Lisosomas.
4. Describa los principales componentes del citoesqueleto.
5. En qu consiste la transduccin de la seal? Qu tipos de transductores encontramos? Cules
son los distintos tipos de receptores?

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

26

Mnica Morales y scar Herrero

TEMA 4. Metabolismo
Anabolismo y catabolismo. ATP. Gluclisis. Respiracin celular. Fermentacin. Fotosntesis.

GUIN - ESQUEMA DEL TEMA


- Conceptos generales sobre el metabolismo.
Anabolismo.
Catabolismo.
Reacciones exergnicas y endergnicas.
- El ATP como transportador de energa qumica.
- Metabolismo y obtencin de energa.
Gluclisis.
Respiracin celular.
Fermentacin.
- Redes metablicas.
- Fotosntesis.
INTRODUCCIN AL TEMA
Las clulas vivas estn altamente ordenadas, siendo imprescindible tan alto grado de ordenacin para
su supervivencia y crecimiento. Desde el punto de vista termodinmico, esto slo es posible gracias a
una entrada continua de energa, parte de la cual las clulas ceden a su entorno en forma de calor.
Esta energa procede en ltimo trmino de la radiacin electromagntica del sol, que impulsa la
formacin de molculas orgnicas en los organismos fotosintetizadores.
Las reacciones qumicas que tienen lugar en las clulas componen el metabolismo celular y se
clasifican en dos grandes grupos:
Reacciones para la formacin de nuevas molculas a partir de otras ms pequeas, con gasto
energtico: anabolismo.
Reacciones para la ruptura de molculas existentes en otras ms pequeas, con liberacin de
energa: catabolismo.
En estas reacciones qumicas la energa que se libera en las reacciones del catabolismo se utiliza en
las reacciones del anabolismo. En cuanto a esta transferencia de energa, las reacciones pueden ser:
Exergnicas: cuando la reaccin se produce espontneamente y libera energa.
Endergnicas: cuando la reaccin no es espontnea y slo tiene lugar con un aporte de
energa.
Los animales obtienen su energa ingiriendo estas molculas orgnicas y oxidndolas en una serie de
reacciones catalizadas enzimticamente y acopladas a la formacin de ATP. El ATP es un nucletido
que almacena en sus enlaces la energa libre producida en determinadas reacciones y la transfiere
cuando es hidrolizado para realizar algn trabajo qumico o de mantenimiento celular. Es un nucletido
de adenosina con tres grupos fosfatos adheridos. Para liberar la energa almacenada, hidroliza los
enlaces entre los fosfatos y deja libre un in fosfato inorgnico segn la reaccin:

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

27

BIOLOGA
ATP + H2O ADP + Pi + energa libre
Se trata de una reaccin exergnica, por lo que en todas las clulas el ATP es un dador general de
energa y su hidrlisis, energticamente favorable, est acoplada a otras reacciones, impulsando
diversos procesos que requieren esta energa.
Aunque la clula puede emplear cualquier biomolcula para obtener energa, los hidratos de carbono
son la fuente primaria, especialmente la glucosa (C6H1206). Este azcar es la fuente principal de
energa y electrones por reacciones de tipo redox. Cuando la clula no dispone de glucosa pero tiene
otros hidratos de carbono disponibles, transforma stos en glucosa para obtener la energa a partir de
sta (en forma de ATP en su mayor parte). La reaccin que resume el proceso de obtencin de energa
es:
C6H1206 + 6O2 6CO2 + 6H2O + energa
Este proceso se produce en presencia de oxgeno (ambiente aerobio) y supone la oxidacin de la
glucosa para liberar la energa. En ausencia de oxgeno (ambiente anaerobio) no se puede realizar una
oxidacin completa de la glucosa, por lo que se realiza una fermentacin, la cual produce una
cantidad de energa mucho menor.
El proceso de oxidacin completa de la glucosa (ambiente aerobio) implica dos procesos
fundamentales:
Gluclisis: ocurre en el citoplasma de las clulas y no requiere oxgeno. Consiste en la
degradacin de la glucosa hasta formar dos molculas de piruvato.
Respiracin celular: tiene lugar en las mitocondrias de las clulas eucariotas y en el citosol de
las procariotas, pero siempre en presencia de oxgeno. Consiste en la oxidacin del piruvato
procedente de la gluclisis hasta transformarlo en CO2. Metablicamente comprende tres vas
fundamentales: la oxidacin del piruvato, el ciclo del cido ctrico (o ciclo de Krebs) y la cadena
respiratoria (o cadena transportadora de electrones).
Cuando la oxidacin no es completa (ambiente anaerobio) los procesos son:
Gluclisis: degradacin de la glucosa hasta formar dos molculas de piruvato.
Fermentacin: degradacin del piruvato a cido lctico o etanol.
El balance energtico es mucho ms favorable tras la oxidacin aerobia total de la glucosa a CO2
(obtencin de 36+2 molculas de ATP) que tras la fermentacin hasta dar cido lctico o etanol
(obtencin de 2 molculas de ATP).
Las enzimas, los productos y los intermediarios que participan en la respiracin celular y la
fermentacin no estn aislados. Por el contrario, son parte de un gran inventario dinmico de
sustancias qumicas dentro de la clula. Dado que el metabolismo incluye miles de reacciones
qumicas diferentes, las cantidades y la naturaleza de las molculas dentro de las clulas permanecen
en un estado de cambio continuo. Las vas de fermentacin, el transporte de electrones y otros
aspectos del metabolismo de los hidratos de carbono pueden ser cruciales para la vida de una clula,
pero tambin tienen que ser contemplados como partes de un todo.
Para entender el inventario qumico de las clulas y el alcance global del metabolismo, es crucial darse
cuenta de que las clulas tienen dos requisitos fundamentales para vivir, crecer y reproducirse: energa

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

28

Mnica Morales y scar Herrero


y carbono. Ms formalmente, las clulas necesitan una fuente de electrones de alta energa qumica
en forma de ATP y una fuente de molculas compuestas por carbono que puedan usarse para
sintetizar DNA, RNA, protenas, cidos grasos y otras molculas. Todo ello a travs de las reacciones
propias del anabolismo y el catabolismo.
La fotosntesis es la conversin de energa lumnica en energa qumica, almacenada en los enlaces
de hidratos de carbono. La sacarosa generada por la fotosntesis sirve como combustible para la
respiracin celular, as como sustrato para la sntesis de hidratos de carbono complejos, aminocidos,
cidos grasos y otros componentes celulares.
El proceso fotosinttico, que en las clulas eucariotas ocurre en los cloroplastos, consiste en dos
conjuntos de reacciones conectadas:
Las reacciones dependientes de la luz transforman la energa de la luz solar en energa
qumica en forma de electrones con alta energa potencial. Los electrones excitados se usan
para producir NADPH o bien se donan a una cadena de transporte a partir de la cual se
obtendr ATP por quimismosis.
Las reacciones posteriores (ciclo de Calvin) usan el ATP y el NADPH para, partiendo de la
enzima rubisco, reducir el dixido de carbono a hidratos de carbono.
Se pueden resumir en la ecuacin opuesta a la de la respiracin celular:
CO2 + H2O + energa lumnica azcar + O2
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Diferenciar los procesos de anabolismo y catabolismo, los dos grandes grupos en los que se
dividen las reacciones qumicas dentro del metabolismo celular.
Conocer la existencia de reacciones exergnicas y endergnicas.
Comprender la funcin crucial de la molcula de ATP como transportador de energa qumica.
Conocer las principales rutas metablicas para la obtencin de energa.
Entender los aspectos ms importantes de la gluclisis, la respiracin celular y la fermentacin,
as como las diferencias en los balances energticos propios de las oxidaciones aerobias y
anaerobias.
Entender las distintas reacciones del metabolismo energtico como partes de un todo
perfectamente integradas entre ellas.
Conocer los pasos fundamentales de los procesos fotosintticos y entender el significado de
las reacciones qumicas que en ellos se producen.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

29

BIOLOGA
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 8. Energa y enzimas: introduccin a las vas metablicas.
- Captulo 9. Respiracin celular y fermentacin.
- Captulo 10. Fotosntesis.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

30

Mnica Morales y scar Herrero


On-Line Biology Book: libro de biologa en lnea y en ingls.

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html

The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
BioROM 2008. Visitar las pginas sobre transporte electrnico y fosforilacin oxidativa, donde se
muestran enlaces sobre el transporte mitocondrial y mecanismo de la ATP sintasa mediante grficos
animados muy claros y sencillos.
http://www.biorom.uma.es/indices/index.html
Una comprensin bsica de algunos conceptos fundamentales del metabolismo mediante problemas y
cuestiones, complementado con explicaciones que refuerzan la comprensin de los conceptos bsicos
del metabolismo aplicados a la biologa humana.
http://www.biologia.arizona.edu/biochemistry/problem_sets/metabolism/metabolism.html
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Defina brevemente:
Anabolismo.
Catabolismo.
Reaccin exergnica.
Reaccin endergnica.
2. Qu es el ATP?
3. Cul es la principal fuente de energa de una clula y qu procesos de oxidacin se pueden dar
para obtener dicha energa?
4. Qu va metablica tiene un balance energtico ms favorable?
5. Comente las principales caractersticas del proceso fotosinttico.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

31

BIOLOGA

TEMA 5. Ciclo celular y meiosis


Etapas del ciclo celular. Divisin celular en eucariotas: mitosis. Citocinesis.
Control de ciclo celular y cncer. Reproduccin sexual: meiosis.

GUIN - ESQUEMA DEL TEMA


- Mitosis y ciclo celular.
Fases o etapas del ciclo celular: G1, S, G2 y divisin.
- Divisin celular en eucariotas.
Divisin nuclear: mitosis.
Etapas de la mitosis:
o Profase
o Prometafase
o Metafase
o Anafase
o Telofase
Divisin del citoplasma: citocinesis.
- Control del ciclo celular y cncer.
Molculas reguladoras: quinasas dependientes de ciclina.
Puntos de control.
Factores de crecimiento y proliferacin celular.
- Meiosis.
Fases de la Meiosis I:
o Profase I
o Prometafase I
o Metafase I
o Anafase I
o Telofase I
Fases de la Meiosis II:
o Profase II
o Prometafase II
o Metafase II
o Anafase II
o Telofase II
INTRODUCCIN AL TEMA
Los organismos vivos estn formados por clulas que a lo largo de su vida se dividen. La divisin
celular es una actividad comn a todas las clulas, ya que toda clula procede de otra clula por
divisin de sta y puede, a su vez, llegar a dividirse o no para dar otras clulas. En las bacterias, la
divisin de la clula equivale a su mtodo de reproduccin y se realiza por medio de la biparticin,
dando dos clulas iguales entre s e iguales a la clula original. Las clulas eucariotas, al ser ms
complejas, se dividen para dar lugar a rganos y sistemas, existiendo en el caso de la reproduccin
clulas especializadas que tienen una forma de divisin particular llamada meiosis.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

32

Mnica Morales y scar Herrero


El ciclo celular es el proceso que transcurre desde que una clula se divide hasta que vuelve a
dividirse. Tanto en eucariotas como en procariotas, el ciclo celular tiene dos fases diferenciadas:
Interfase: periodo del ciclo vital en el que la clula no se divide.
Divisin celular: periodo de divisin de la clula propiamente dicho.
Este tema se centra en el estudio de la divisin de las clulas eucariotas y los procesos asociados a
sta. La interfase es la fase ms larga del ciclo vital de las clulas eucariotas y consta de tres fases:
Fase G1: comienza tras la divisin celular que ha dado lugar a la clula. Durante esta fase la
clula crece. Las clulas que se han diferenciado permanecen en esta fase de manera
continuada.
Fase S: posterior a la fase G1, es una fase de sntesis en la que se duplica el DNA y se
producen protenas.
Fase G2: posterior a la fase S. La clula sigue aumentando su tamao y contina
preparndose para entrar en divisin.
La preparacin para la divisin comienza cuando la clula entra en fase S y replica su DNA.
Posteriormente aparece el centrosoma (orgnulo que slo interviene en la divisin celular) y se sita
cerca del ncleo antes de duplicarse. Cada centrosoma hijo se separa hacia un polo opuesto de la
clula, indicando as la orientacin que tomar la divisin celular. En ese momento acaba la interfase y
comienza la mitosis. Las etapas en que se divide son:
Profase: los cromosomas, que constan de dos cromtidas hermanas debido a la duplicacin
del DNA durante la fase S, se empaquetan totalmente. Los centrosomas forman el huso
mittico, que es una estructura de microtbulos que dirige el reparto del DNA durante la
mitosis.
Prometafase: desaparece la membrana nuclear y las fibras del huso mittico se unen a una de
las dos cromtidas hermanas de cada cromosoma. La unin entre las fibras del huso y los
cromosomas se da gracias a los cinetocoros. Los cromosomas se desplazan hacia la placa
ecuatorial del huso mittico.
Metafase: los cromosomas llegan a la placa ecuatorial y se alinean respecto a la misma por
sus cinetocoros.
Anafase: las cromtidas hermanas se separan. Los cromosomas son empujados a los polos
opuestos de la clula.
Telofase: las cromtidas llegan a sus respectivos polos del huso. La membrana nuclear se
vuelve a formar y el huso se degrada. El resultado son dos ncleos con la misma informacin
gentica que la clula madre.
El control del ciclo celular es decisivo para el normal desarrollo del embrin y el mantenimiento
adecuado de los tejidos y rganos en el organismo adulto. El sistema de control debe cumplir varias
funciones. En primer lugar, comprobar que los eventos de cada fase se lleven a cabo en el momento
apropiado y en la secuencia adecuada. Por otro lado, asegurar que cada fase del ciclo se ha
completado correctamente antes de que se inicie la siguiente etapa. Asimismo, debe ser capaz de
responder a condiciones y seales externas que indiquen la necesidad o no de que las clulas se
dividan. Finalmente, deben existir mecanismos que controlen que las clulas de un determinado tejido
dejen de proliferar en funcin de los requisitos especficos de cada rgano o estructura corporal. Los
fallos en este ltimo proceso conducen a la proliferacin inadecuada en el tiempo o en el espacio,
como la proliferacin descontrolada que se puede observar tpicamente en los procesos tumorales.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

33

BIOLOGA
El ciclo celular est regulado por un sistema que vigila cada paso realizado. En regiones concretas del
ciclo, la clula comprueba que se cumplan las condiciones para pasar a la etapa siguiente. Si no se
cumplen estas condiciones, el ciclo se detiene.
Existen tres puntos principales de control del ciclo celular:
Punto de control G1. Establece si la clula contina el ciclo celular y se divide o, por el
contrario, sale del ciclo y entra en G0. Es dependiente del tamao celular, la disponibilidad de
nutrientes, la ausencia de dao en el DNA y/o seales de crecimiento de otras clulas.
Punto de control G2. Las clulas se detienen en este punto si la replicacin cromosmica no
se ha completado correctamente o si el DNA est daado.
Punto de control de metafase. Se detiene la metafase hasta que los cromosomas estn
unidos correctamente al huso mittico.
El ciclo celular tambin est regulado por diferentes molculas a travs de los puntos de control del
ciclo celular, como son las quinasas dependientes de ciclinas (CdK) y las ciclinas de las clulas
eucariotas. Las Cdk activas son enzimas que permiten el paso del punto de control mediante la
fosforilacin de protenas diana. Las ciclinas son protenas cuyas concentraciones oscilan durante el
ciclo celular, regulando la actividad de las Cdk. En los organismos pluricelulares, las concentraciones
de ciclinas estn controladas parcialmente por factores de crecimiento de otras clulas.
El cncer es un tipo de crecimiento tisular anormal en donde las clulas se dividen de manera
relativamente autnoma e incontrolada, dando un aumento progresivo del nmero de clulas en
divisin. La masa resultante de tejido en crecimiento se denomina tumor.
Los tumores se clasifican en benignos o malignos, segn el patrn de crecimiento. Un tumor benigno
crece en un rea delimitada y localizada y normalmente no es peligroso. El tumor maligno es capaz
de invadir otros tejidos, de entrar en el torrente circulatorio y de diseminarse hacia partes distantes del
cuerpo, caracterstica por la que se convierte en una amenaza. Este proceso se llama metstasis. El
trmino cncer se refiere a cualquier tumor maligno.
La meiosis es un tipo de divisin celular que se puede definir como dos divisiones nucleares
consecutivas precedidas por una nica duplicacin del DNA, de tal forma que a partir de una clula
diploide se obtienen cuatro clulas haploides. La finalidad de la meiosis se resume en:
Reducir el nmero de cromosomas celulares, es decir, obtener clulas haploides a partir de
clulas diploides.
Asegurar que cada clula haploide resultante tenga un juego completo de cromosomas de los
dos de la clula original.
Promover la diversidad gentica en los gametos: conseguida por intercambio de material
gentico entre cromosomas homlogos (sobrecruzamientos).
A la meiosis la precede una interfase, igual que ocurra con la mitosis, pero en este caso la divisin
celular en s misma suele durar mucho ms que la divisin mittica. De igual manera, es un proceso
que se divide en etapas para su estudio:
Meiosis I, formada por diferentes fases:
o Profase I temprana: los cromosomas replicados se condensan, el huso mittico se
forma y la membrana nuclear desaparece. Sinapsis de homlogos forman ttradas
(cuatro cromtidas de dos cromosomas homlogos). Las fibras del huso se unen a los
cinetocoros en los centrmeros de los cromosomas.
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

34

Mnica Morales y scar Herrero


o Profase I tarda: las regiones por las que entran en contacto se denominan quiasmas
y por esas zonas pueden intercambiar material gentico entre cromosomas
(sobrecruzamientos), dando lugar a una mezcla de segmentos cromosmicos de los
cromosomas maternos y paternos.
o Metafase I: las ttradas se alinean en la placa metafsica.
o Anafase I: los cromosomas homlogos (con sus dos cromtidas intactas) se separan y
las fibras del huso tiran de los cromosomas hacia cada polo.
o Telofase I: un cromosoma de cada par ha llegado a cada polo del huso mittico.
Meiosis II, similar a una mitosis y que consta de las fases:
o Profase II: se forma el huso mittico. Si se form la membrana nuclear al final de la
meiosis I, se rompe.
o Metafase II: los cromosomas, formados por dos cromtidas hermanas, se alinean en la
placa metafsica.
o Anafase II: las cromtidas hermanas se separan. Los cromosomas no replicados que
resultan comienzan su migracin a los polos opuestos de la clula.
o Telofase II: los cromosomas finalizan su movimiento hacia los lados opuestos de la
clula. Se forma una membrana nuclear alrededor de cada juego de cromosomas
haploides.
La principal consecuencia de la meiosis es un aumento de la variabilidad gentica, es decir, de la
diversidad, gracias a los sobrecruzamientos que se producen durante la profase I. No obstante, este
tipo de divisin celular no est exento de riesgos en lo que a errores en la separacin de los
cromosomas y las cromtidas se refiere. As, puede ocurrir que la separacin no se haga
correctamente dando lugar a:
Aneuploidas: se producen cuando no se separan correctamente los cromosomas y alguno de
los gametos queda con un cromosoma completo en lugar de una cromtida. La fecundacin de
ese gameto da lugar a un individuo con un nmero irregular de alguno de los cromosomas (por
ejemplo. trisoma del cromosoma 21 o sndrome de Down en humanos).
Poliploidas: en este caso, todo el conjunto de los cromosomas aparece en ms copias de las
normales, dando lugar a individuos triploides (tres copias), tetraploides (cuatro copias), etc., los
cuales no siempre son viables o frtiles.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Entender el ciclo celular y su significacin para la vida de la clula, as como la trascendencia
de su regulacin para el correcto funcionamiento de los tejidos y, en definitiva, para el
organismo pluricelular.
Conocer las principales etapas que se pueden diferenciar dentro del ciclo celular y los procesos
que caracterizan a cada una de ellas.
Distinguir las etapas y los procesos cruciales que operan en la divisin del material gentico del
ncleo celular, as como la relacin de fallos en la distribucin cromosmica con sndromes
genticos debidos a la carencia o al exceso de cromosomas.
Entender la importancia de los procesos de control del ciclo celular y conocer algunos de los
mecanismos que operan a este nivel y los tipos de genes implicados en la regulacin.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

35

BIOLOGA
Entender el significado de la diferenciacin y especializacin celular y la existencia de clulas
madre, as como su potencial en las tcnicas de medicina regenerativa tisular.
Conocer la meiosis y sus principales etapas.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 12. El ciclo celular.
- Captulo 13. Meiosis.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

36

Mnica Morales y scar Herrero


DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/
Excelente lugar en la web donde se pueden encontrar clulas vivas y animaciones sobre el ciclo
celular:
http://www.cellalive.com/index.htm
On-Line Biology Book: libro de biologa en lnea y en ingls.
http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html
The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
Imgenes del ciclo celular de una clula vegetal (raz de cebolla) y una animal (Ascaris).
http://www.joseacortes.com/galeriaimag/citologia/index.htm
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Nombre las etapas de la mitosis, resumiendo en una frase qu caracteriza a cada una de ellas.
2. Explique brevemente los principales procesos que ocurren en la profase.
3. Qu es la citocinesis?
4. Defina brevemente:
Citocinesis
Cinetocoro
Centriolo
Anafase
5. Indique las diferencias clave entre la mitosis y la meiosis.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

37

BIOLOGA

TEMA 6. Replicacin del DNA


Descubrimiento del DNA como material gentico. Replicacin del DNA: modelo y mecanismo.
Replicacin de los extremos de los cromosomas lineales. Dao y reparacin del DNA.

GUIN - ESQUEMA DEL TEMA


- Cmo es la replicacin del DNA?
Caractersticas de la replicacin: bidireccional y discontinua.
Mecanismo de la replicacin:
o Orgenes de replicacin.
o Hebra conductora o continua.
o Hebra retrasada o discontinua.
o Fragmentos de Okazaki.
o Cebadores de RNA.
Enzimas implicadas:
o DNA polimerasas.
o DNA ligasa.
o DNA helicasas.
o Topoisomerasas.
o Primasa.
- Replicacin de los extremos de los cromosomas lineales.
- Reparacin de errores y dao del DNA.
Dao espontneo y dao inducido por mutgenos
Mecanismos de reparacin
INTRODUCCIN AL TEMA
La replicacin tiene como misin la transmisin fiel y exacta de la informacin gentica de clula a
clula y de generacin en generacin. En este tema se estudiar el mecanismo de replicacin del
DNA, el cual fue propuesto por los descubridores de la estructura de la doble hlice de DNA, Watson y
Crick. Durante la replicacin, la doble hlice se separa en sus dos hebras o cadenas por ruptura de los
enlaces de hidrgeno, que mantienen unidas a sus bases. Cada una de las hebras separadas acta
como molde para otras dos hebras que sern complementarias a las del DNA molde. De esta forma, a
partir de una doble hlice se obtiene otra. La sntesis de las nuevas hebras se realiza por la adicin de
los nucletidos complementarios, que se van uniendo (A-T y G-C) en una reaccin catalizada por la
enzima DNA polimerasa. Es un proceso muy complejo en el que intervienen muchas ms enzimas y
protenas reguladoras.
En un principio, los modelos que se propusieron sobre cmo se produce la replicacin son:
Replicacin conservadora: resulta en hebras parentales intactas y una molcula hija de DNA
compuesta totalmente por hebras recin sintetizadas.
Replicacin disgregadora: la hlice parental se corta y desenrolla en pequeos fragmentos
antes de copiarse y ensamblarse. Entonces las dos molculas resultantes contendrn
fragmentos nuevos y originales a lo largo de las hebras.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

38

Mnica Morales y scar Herrero


Replicacin semiconservadora: cada hebra del DNA original sirve de molde para una nueva
hebra. De las dos dobles hlices resultantes, cada una tendr una hebra del DNA original y
otra de nueva sntesis.
Una vez establecido que la replicacin es semiconservadora, se determin que para producirse era
necesario la presencia de:

Un DNA que acte como molde para ser copiado.


Los cuatro tipos de desoxirribonucletidos trifosfato: dATP, dGTP, dCTP y dTTP.
La enzima DNA polimerasa, que es parte de un complejo enzimtico mayor.
Energa qumica, ya que es una reaccin anablica con alto consumo energtico para formar
los enlaces entre los desoxirribonucletidos.

Y que los pasos fundamentales en la replicacin del DNA eran los siguientes:
1. En un punto determinado, las dos hebras de la doble hlice se abren y desenrollan. Una
enzima llamada helicasa va abriendo poco a poco el camino, de manera que las bases de las
dos hebras ahora separadas quedan expuestas y se produce lo que se conoce como burbuja
de replicacin.
2. Cada una de las hebras comienza a unir nucletidos sobre los que han quedado expuestos,
cuyas bases sern las complementarias. En el proceso intervienen dos molculas de la enzima
llamada DNA polimerasa, una por cada cadena, que avanzan en direcciones opuestas, ya que
el crecimiento de las nuevas cadenas ocurre siempre en el mismo sentido qumico de 5' a 3'
(recordemos que las cadenas tenan sentidos contrarios y que, por tanto, la replicacin es un
proceso bidireccional).
Aunque lo podemos esquematizar en pasos relativamente sencillos, el proceso en realidad es
tremendamente complejo e intervienen multitud de factores. Adems, existen importantes problemas
topolgicos que resolver, ya que la hlice se va desenrollando y se generan problemas de torsin que
hay que liberar, para lo que intervienen unas enzimas llamadas topoisomerasas.
Adems, la replicacin no ocurre de igual forma en las dos hebras. As, tenemos:
Hebra conductora: la DNA polimerasa trabaja en la direccin 5-3, desde el origen hasta el
final de la hebra de forma continuada y utilizando un nico cebador para iniciar la replicacin.
Hebra retrasada: la DNA polimerasa trabaja por tramos, de forma discontinua, de tal forma
que cada tramo debe utilizar un cebador para iniciar su copia. A estos fragmentos discontinuos
de DNA copiado se les denomina fragmentos de Okazaki. Posteriormente, la DNA ligasa
unir los fragmentos de Okazaki para tener una hebra de DNA completa y continua.
La replicacin de los extremos de los cromosomas lineales.
En eucariotas existe un problema en la finalizacin de la replicacin, ya que en las molculas lineales
(como las de los cromosomas) la maquinaria de replicacin habitual no es capaz de replicar los
extremos. Los eucariotas han solucionado el problema del final de la replicacin incorporando
secuencias cortas de DNA altamente repetitivas, llamadas telmeros, en los extremos terminales de
cada cromosoma lineal. Estas secuencias son sintetizadas por una enzima llamada telomerasa, que
usa su RNA como molde para crear secuencias repetidas de DNA en los extremos de cada DNA
cromosmico.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

39

BIOLOGA
La reparacin de errores y dao del DNA.
La replicacin del DNA no es un proceso perfecto ni exento de errores. En parte debido a la elevada
velocidad de replicacin (50 bases por segundo, dependiendo de las condiciones) y en parte por fallos
qumicos espontneos en las bases, se introducen errores que se estiman son del orden de 1 por cada
100.000 pares de bases. Si estos errores no son reparados se producen lo que denominamos
mutaciones. Pero existen mecanismos de correccin. Hay enzimas, incluida la propia polimerasa, que
chequean y arreglan los errores introducidos en el proceso de replicacin, de forma que finalmente la
frecuencia estimada de error es de tan slo uno por cada cien millones de pares de bases en clulas
de mamferos. Los mecanismos de reparacin del DNA, tanto para arreglar los errores que se
producen durante la replicacin como para arreglar los daos que se producen en el DNA
(espontneamente o por exposicin a diversos agentes mutagnicos tales como radiaciones, productos
qumicos, etc.), tienen una enorme trascendencia para mantener la integridad fsica de los genes. Las
clulas poseen mecanismos de reparacin:
Correctora de pruebas. Corrige los errores que se detectan a medida que la DNA polimerasa
va aadiendo nucletidos al DNA de nueva formacin. Lo realiza la propia DNA polimerasa,
ayudada por las otras enzimas del complejo de replicacin.
Mecanismo de reparacin de emparejamientos errneos. Repasa el trabajo de la DNA
polimerasa y corrige los errores cuando detecta apareamientos de bases incorrectos, una vez
se ha completado la sntesis de DNA.
Mecanismo de reparacin por escisin. Detecta bases nitrogenadas daadas o bien un
exceso de bases en una de las hebras, que formara un bucle no apareado en la hebra de DNA
donde se encuentran. Elimina las bases daadas y pone en su lugar otras bases nitrogenadas
funcionales. La eliminacin de las bases errneas las realizan protenas especficas y la
colocacin de las bases correctas lo hace la DNA polimerasa.
La reparacin, al igual que la replicacin del DNA, requiere un aporte energtico, que procede
principalmente de la hidrlisis del grupo difosfato de los desoxirribonucletidos trifosfato sin ensamblar
en el nuevo DNA.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Enumerar y razonar las caractersticas generales de la replicacin: semiconservadora,
bidireccional.
Conocer el mecanismo de replicacin del DNA.
Explicar el carcter semidiscontinuo de la replicacin.
Enumerar las enzimas que participan en el proceso de la replicacin.
Explicar cmo se asegura la fidelidad de la replicacin por la DNA polimerasa.
Conocer el modelo de replicacin por fragmentos de Okazaki.
Conocer los mecanismos especiales de replicacin para cromosomas lineales y telmeros.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

40

Mnica Morales y scar Herrero


Conocer la existencia de mecanismos de reparacin del DNA y su importancia para la
integridad y constancia del material gentico, as como la relacin de daos en el DNA y/o en
los mecanismos de reparacin con determinadas patologas.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 15. El ADN y los genes: sntesis y reparacin.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

41

BIOLOGA
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/
On-Line Biology Book: libro de biologa en lnea y en ingls.
http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html
The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
En las siguientes direcciones se puede encontrar informacin actualizada, vdeos, ejercicios y otros
enlaces de inters relacionados con el DNA:
http://www.dnai.org
http://www.dna50.org/main.htm
http://www.nature.com/nature/dna50/
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Por qu la sntesis de una de las cadenas del DNA se realiza de forma discontinua? Explique
brevemente cmo se realiza esta sntesis.
2. Qu es un fragmento de Okazaki?
3. Qu es un cebador de RNA? Qu papel desempea en la replicacin del DNA?
4. Qu quiere decir que la replicacin es semiconservativa?
5. Dibuje en la figura, la hebra de DNA que se replicar de manera continua e indique la polaridad de sus
extremos. Haga un breve comentario explicativo.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

42

Mnica Morales y scar Herrero

TEMA 7. Transcripcin y traduccin del DNA


Codificacin, transmisin y decodificacin de la informacin. El cdigo gentico.
Transcripcin de la informacin: sntesis de RNA. Procesamiento del RNA.
La sntesis de protenas o traduccin. Mecanismos y regulacin de la traduccin.
Procesos postraduccionales. Mutaciones en los genes y consecuencias en las protenas.

GUIN - ESQUEMA DEL TEMA


- Flujo direccional de la informacin gentica y el dogma central de la biologa.
- El cdigo gentico.
- La transcripcin de la informacin: sntesis de RNA.
Transcripcin en bacterias:
o Enzima: RNA polimerasa.
o Etapas: iniciacin, elongacin, terminacin.
Transcripcin y procesamiento del RNA en los eucariotas:
o Enzimas: RNA polimerasa I, II y III.
o Procesamiento del RNA ribosomal (rRNA).
o Procesamiento del RNA de transferencia (tRNA).
o Procesamiento del RNA mensajero (mRNA).
Adicin de la caperuza (CAP) en el mRNA.
Corte y empalme (eliminacin de los intrones).
Adicin de la cola de poli(A) 3.
- Componentes de la traduccin:
Ribosomas.
RNA de transferencia (tRNA).
RNA mensajero (mRNA).
- El mecanismo de traduccin.
Iniciacin y factores de iniciacin.
Elongacin.
Terminacin.
- Mutaciones y efectos en la sntesis de protenas.
Mutaciones puntuales:
o Silenciosas.
o Sentido errneo (sustitucin).
o Sin sentido.
o Desfase del marco de lectura.
Mutaciones a nivel cromosmico:
o Inversin cromosmica.
o Translocacin cromosmica.
INTRODUCCIN AL TEMA
Hasta ahora hemos visto que el DNA es la molcula que contiene la informacin hereditaria. En este
tema trataremos de responder a dos preguntas que surgen inmediatamente: de qu forma esta
molcula contiene la informacin gentica? y cmo se expresa o se manifiesta esta informacin?

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

43

BIOLOGA
Los genes tienen la informacin hereditaria, es decir, la informacin que determina aquellas
caractersticas, propiedades o actividades de un determinado ser vivo, que lo identifican como individuo
de una especie y que transmitir a sus descendientes. Tambin sabemos que los genes son DNA. Las
cuestiones en las que nos vamos a centrar en este tema son conocer cmo el DNA es capaz de
almacenar informacin y cmo esa informacin se materializa en un carcter, una propiedad o una
actividad, es decir, en un fenotipo. Un fenotipo es siempre el resultado, directo o indirecto, de una
protena, bien de su presencia o ausencia (o de una forma variante de la misma) o bien de su actividad
o inactividad si se trata de una enzima.
El flujo de informacin gentica en las clulas tiene lugar generalmente desde el DNA al RNA y a las
protenas. El DNA, ms concretamente un fragmento de una hebra de DNA, sirve de molde para la
sntesis de una molcula de RNA, que en la mayora de los casos dirige despus la sntesis de una
protena concreta. El principio del flujo direccional de informacin del DNA al RNA y protena se conoce
como dogma central de la biologa molecular.
Este dogma indica que:
DNA RNA protenas
La informacin fluye del DNA al RNA en un proceso de sntesis denominado transcripcin.
Posteriormente, la informacin fluye del RNA a las protenas en un proceso de sntesis
denominado traduccin.
Adems, el DNA puede copiarse a s mismo por replicacin y transmitir su informacin a la
descendencia.
Hoy en da sabemos que esto es cierto, pero con ciertos matices. El flujo de informacin no siempre es
exclusivamente unidireccional. La primera flecha de esta transferencia de informacin, en algunos
casos, es reversible. Por ejemplo, en los retrovirus como el virus del SIDA la molcula hereditaria que
porta la informacin es un RNA, el cual se copia a un DNA que posteriormente sintetizar otros RNAs.
Esto no slo ocurre en virus, sino tambin en los genes denominados retrotransposones, que se
mueven en los genomas. Una enzima denominada transcriptasa inversa (o reversa) es la responsable
de este proceso. Tambin es sabido que muchos virus con genoma de RNA sintetizan molculas de
RNA utilizando RNA como molde. En estos casos el RNA puede copiarse a s mismo por replicacin y
transmitir su informacin a la descendencia.
Ms recientemente, hemos sabido que tambin determinadas protenas tienen la capacidad de
transformarse en otras solo por un cambio conformacional de su estructura. Este es el caso de los
priones, las protenas responsables de la encefalopata espongiforme en diversos mamferos
(enfermedad de las vacas locas).
Por tanto, actualmente la ecuacin que resume el flujo informativo quedara:
DNA RNA protenas
La transcripcin consiste en el paso de la informacin del DNA al RNA mensajero (mRNA). Esto no
presenta gran dificultad, ya que un sistema enzimtico sintetiza una hebra de RNA que tiene una
secuencia de bases complementaria nucletido a nucletido a la hebra no codificante del DNA. La
informacin contenida en la secuencia de DNA se representa en una informacin escrita en el mismo
lenguaje de cuatro bases en forma de cadena de RNA, con la nica diferencia de que el uracilo (U)
sustituye a la timina (T).

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

44

Mnica Morales y scar Herrero


Sin embargo, el paso de la informacin del RNA a las protenas, proceso conocido como traduccin,
presenta mayor dificultad, puesto que es necesario cambiar la secuencia de bases de una molcula de
RNA mensajero a una secuencia de aminocidos en un polipptido. Establecer las correspondencias
supuso desentraar el cdigo gentico, que no es sino el diccionario molecular que permite la
traduccin del lenguaje de 4 bases al de 20 aminocidos. ste es un cdigo de tripletes (3 bases = 1
aminocido), denominados codones.
Para finalizar este tema, se analizan las mutaciones y su efecto en la sntesis de protenas. Las
mutaciones son cambios al azar en el DNA que pueden producir cambios en el fenotipo o no. Se
describen los tipos de mutaciones puntuales en funcin de los diferentes efectos que provocan en las
protenas. Tambin se estudian las alteraciones en los cromosomas, llamadas mutaciones
cromosmicas, que afectan al nmero o a la estructura de los cromosomas y, por tanto, a todos los
genes contenidos en ellos.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Comprender la lgica de la informacin gentica y su codificacin molecular.
Entender el flujo direccional de la informacin gentica y las etapas intermediarias de su
expresin.
Comprender el proceso de la transcripcin.
Entender el papel del RNA bien como producto final de un gen o como intermediario en la
expresin de los genes que codifican protenas.
Conocer los distintos tipos de RNAs, y diferenciar sus funciones, su localizacin y su
estructura.
Conocer la transcripcin o sntesis de RNA en bacterias.
Entender y distinguir las etapas del mecanismo de transcripcin o sntesis de RNA en
eucariotas.
Conocer las etapas fundamentales de los complejos mecanismos de maduracin de los RNA
mensajeros.
Explicar el proceso de eliminacin de intrones del transcrito primario (corte y empalme).
Explicar el proceso de poliadenilacin y adicin de la secuencia CAP y su posible funcin.
Conocer la existencia de regiones codificantes y no codificantes dentro de un gen y los
mecanismos de eliminacin de intrones.
Conocer el significado del cdigo gentico y las reglas de su interpretacin.
Describir cmo los mRNA, producidos por los genes que codifican protenas, se traducen a
polipptidos, y cmo los polipptidos se convierten en protenas funcionales.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

45

BIOLOGA
Conocer los elementos implicados en el proceso de traduccin o sntesis de protenas.
Describir por medio de un esquema el ciclo de prolongacin de la cadena polipeptdica: a)
Unin del aa-tRNA entrante, b) Formacin del enlace peptdico, y c) Translocacin.

Conocer la existencia de mutaciones, y la implicacin de estos cambios o mutaciones en la


sntesis y estructura de una determinada protena.

BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 16. Cmo funcionan los genes.
- Captulo 17. Transcripcin, procesamiento del ARN y traduccin.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

46

Mnica Morales y scar Herrero


DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/
Ejercicios de transcripcin y traduccin, del 9 al 15.
http://www.biologia.arizona.edu/molecular_bio/problem_sets/nucleic_acids/nucleic_acids_1.html
Ejercicios transcripcin-traduccin.
http://web.educastur.princast.es/proyectos/biogeo_ov/2BCH/B4_INFORMACION/T404_TRAS_TRADU/
EJERCICiOS.htm
http://web.educastur.princast.es/proyectos/biogeo_ov/2BCH/B4_INFORMACION/T402_ACIDNUCLE/EJ
ERCICiOS.htm
Animacin esquemtica de las distintas fases de la transcripcin.
http://www.medmol.es/tema.cfm?id=66
Animacin del proceso de splicing.
http://www.medmol.es/tema.cfm?id=69
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Cmo se lleva a cabo el trasvase de la informacin desde el DNA a las protenas? Esquematice el
proceso, explicando los pasos necesarios para obtener una protena activa.
2. Comente brevemente los tipos de mutacin puntual que conoce y los efectos que pueden tener.
3. Defina brevemente:
Codn:
Cdigo gentico:
Intrn:
Exn:
4. Considere la secuencia de bases de una cadena de DNA:
ATAGACCGTACGATCGCCCTTGTTGTTGCATGCATGGGTA
a) Escriba la cadena complementaria.
b) Escriba la cadena de RNA que resultara de la transcripcin de los nucletidos 5 al 31, de la
cadena representada en el apartado anterior.
5. Suponga que usted tiene un pptido met-arg-phe-pro y sabe que las molculas de tRNA usadas en
su sntesis tienen los siguientes anticodones:
(3)- GGU-(5); (3)- GCU-(5) ;(3)- AAG-(5);(3)-UAC-(3)

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

47

BIOLOGA
a) Determine la secuencia de nucletidos del gen que codifica este pptido (cadena
codificante).Cdigo Gentico: AUG: Met; UUC: Phe; CGA: Arg; CCA: Pro.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

48

Mnica Morales y scar Herrero

TEMA 8. Expresin de la informacin gnica


Regulacin de la expresin gnica en procariotas. El concepto de opern.
Regulacin de la expresin gnica en eucariotas.

GUIN - ESQUEMA DEL TEMA


- Regulacin de la expresin de genes en procariotas.
Operones: regulacin coordinada de los genes funcionalmente relacionados.
Regulacin de la unin de la RNA polimerasa por represores.
o Inductores.
o Correpresores.
- Regulacin de la expresin de los genes en eucariotas.
Regulacin de la expresin gnica.
o Cmo se estructura la cromatina.
o Cmo se altera la cromatina.
Secuencias reguladoras y protenas reguladoras.
o Secuencias reguladoras cerca del promotor.
o Secuencias reguladoras lejos del promotor.
o Papel de las protenas reguladoras.
Iniciacin de la transcripcin.
Control postranscripcional.
o Ayuste alternativo de los mRNA.
o Estabilidad del mRNA y la interferencia de RNA.
o Corte y empalme alternativo y lugares de poliadenilacin.
Control postraduccin
INTRODUCCIN AL TEMA
La mayora de los genes no se estn expresando siempre. Una de las caractersticas ms importantes
de los sistemas vivos es su capacidad para regular la expresin de sus genes. Mientras que
determinadas protenas o enzimas se expresan de manera constitutiva en la mayora de las clulas o
tejidos, otras son especficas de determinados tejidos o clulas, variando su nivel de expresin durante
el desarrollo o en funcin de su interaccin con hormonas u otros mensajeros intercelulares.
En este tema se abordar el estudio de los mecanismos de regulacin de la expresin gnica,
comenzando por el mecanismo de control en procariotas, para abordar posteriormente el control
ms complejo de eucariotas.
En los procariotas, los genes regulados coordinadamente suelen estar agrupados en operones y la
regulacin gnica se controla fundamentalmente a nivel de transcripcin, aunque tambin se conocen
controles a nivel de traduccin o postraduccin (activacin proteica). Los cambios en la expresin
gnica hacen que las clulas bacterianas respondan a los cambios ambientales. El control
transcripcional puede ser negativo o positivo. El control negativo es cuando una protena reguladora
impide la transcripcin. El control positivo se produce cuando una protena reguladora incrementa la
tasa de transcripcin. Las protenas reguladoras se unen a sitios especficos del DNA. Como cada tipo

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

49

BIOLOGA
de protena reguladora tiene una secuencia de aminocido diferente, cada una se une a secuencias de
DNA distintas.
La regulacin es ms compleja en eucariotas, debido al tamao y complejidad estructural de su
genoma eucariota. En este caso la expresin gnica puede controlarse a nivel de remodelado de
cromatina, iniciacin de la transcripcin, procesamiento del RNA, estabilidad del mRNA, traduccin y
modificacin postraduccional de protenas. La activacin de los genes probablemente implica una
descondensacin selectiva de la cromatina. Este cambio estructural se puede observar al
microscopio en los cromosomas politnicos gigantes de las glndulas salivales de insectos, pero
probablemente es un fenmeno general.
La transcripcin no puede iniciarse hasta que la interaccin entre el DNA y las histonas de la cromatina
se relaje. Estos cambios dependen de la acetilacin o metilacin y de la accin de los complejos de
remodelado de la cromatina. Una vez desenrollado, el DNA est ms accesible a las RNA
polimerasas y a los factores proteicos necesarios para la iniciacin de la transcripcin. Tanto en
eucariotas como en procariotas, la iniciacin de la transcripcin es probablemente el punto de
control ms importante para la expresin gnica. La transcripcin solo puede iniciarse cuando
protenas especficas se unen al promotor y a secuencias reguladoras que estn cerca o lejos del
promotor. La unin de factores reguladores de transcripcin a varios tipos de secuencias de control
del DNA, junto con la accin de protenas que relajan la pinza de las histonas sobre el gen, hacen que
el promotor sea accesible a los factores basales de la transcripcin. La interaccin lleva a la
formacin del complejo basal de la transcripcin. Este gran complejo multiproteico, permite a la RNA
polimerasa acceder al lugar e iniciar la transcripcin.
Adems de la regulacin transcripcional, las clulas poseen numerosos mecanismos para el control de
la expresin gnica a nivel postraduccional. En los eucariotas, donde los controles postranscripcionales
estn especialmente bien desarrollados, estos mecanismos incluyen: la capacidad de generar mltiples
mRNAs a partir del mismo gen mediante ayuste alternativo; mecanismos generales, as como mRNAespecficos, para regular la traduccin y degradacin del mRNA; y modulacin postranslacional de la
estructura de las protenas, su actividad y degradacin. La interaccin de protenas reguladoras con
secuencias de DNA y RNA especficas tiene un papel fundamental en muchos de estos mecanismos de
control de la expresin gnica. Adems, se ha descubierto que ciertos tipos de RNAs pequeos, como
los RNAs de interferencia (siRNA) y los microRNA (miRNA), pueden regular tambin la expresin de
determinados genes mediante un proceso conocido como RNA de interferencia. Unindose a
secuencias complementarias de un mRNA especfico (en algunos casos a DNA), estos pequeos RNA
silencian la traduccin y transcripcin de genes concretos.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Describir las diferencias entre los controles positivo y negativo de la transcripcin.
Describir las diferencias entre genes reguladores y estructurales.
Definir los conceptos de opern y operador.
Definir los conceptos de represor, co-represor, activador e inductor.
Indicar el papel desempeado por la protena receptora del AMPc (CAP o CRP) en la
regulacin del operador lac.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

50

Mnica Morales y scar Herrero


Describir las principales causas que originan las diferencias en los mecanismos de regulacin
de la expresin de los genes en eucariotas y procariotas.
Distinguir los diferentes niveles de regulacin en los eucariotas.
Indicar la forma en que la estructura de la cromatina influye en la expresin de los genes.
Describir el papel desempeado por la metilacin del DNA en el control de la transcripcin en
eucariotas.
Definir el concepto de factor de transcripcin.
Describir los principales dominios estructurales que podemos encontrar en los factores de
transcripcin y su papel en la regulacin gnica.
Identificar algunos de los tipos de control que pueden ejercerse en eucariotas despus de la
formacin del mRNA maduro.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 18. Control de la expresin gnica en bacterias.
- Captulo 19. Control de la expresin gnica en los eucariotas.
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

51

BIOLOGA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/
Problemas sobre expresin gnica en eucariotas:
http://www.biologia.arizona.edu/molecular_bio/problem_sets/mol_genetics_of_eukaryotes/eukaryotes.ht
ml
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Qu es un opern?
2. Defina un opern inducible.
3. Defina un opern reprimible.
4. Describir el papel desempeado por la metilacin del DNA en el control de la transcripcin en
eucariotas.
5. Describa las diferencias entre los controles positivo y negativo de la transcripcin.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

52

Mnica Morales y scar Herrero

TEMA 9. Ingeniera gnica y biotecnologa


Tcnicas del DNA recombinante para producir protenas. Reaccin en cadena de la polimerasa.
Secuenciacin del DNA. Terapia gnica. Genmica.

GUIN - ESQUEMA DEL TEMA


- Tcnicas del DNA recombinante para producir protenas.
- La reaccin en cadena de la polimerasa.
- Secuenciacin de DNA por el mtodo didesoxi.
- Localizacin de genes por su posicin.
- Terapia gnica.
- Biotecnologa en la agricultura.
- Secuenciacin de genomas completos.
- Genmica.
INTRODUCCIN AL TEMA
La Ingeniera gentica es un conjunto de mtodos, tcnicas y procedimientos destinados al aislamiento,
caracterizacin, modificacin, clonaje y expresin de cidos nucleicos. Estas tcnicas permiten
manipular genes para obtener protenas, en cantidades mayores de las que se obtienen normalmente,
e incluso producirlas en organismos que no poseen los genes necesarios. Esto se ha logrado gracias al
descubrimiento de las endonucleasas de restriccin, que permiten cortar el DNA por sitios especficos e
insertarlo en plsmidos u otros vectores, por medio de la DNA ligasa, para posteriormente introducirlo
en clulas que se encargarn de multiplicarlo y/o expresarlo, dando lugar a la protena deseada. En
este tema vamos a estudiar diferentes tcnicas utilizadas rutinariamente en la tecnologa del DNA
recombinante y su utilidad en el mundo actual.
El objetivo principal de las tcnicas de ingeniera gentica es obtener mltiples copias idnticas de
algn gen en poco tiempo. Esto se puede hacer insertando el gen en una bacteria que lo copie, o bien
mediante la reaccin en cadena de la polimerasa.
Para obtener fragmentos de DNA que contengan la secuencia de la protena que queremos producir e
introducirla en las clulas que lo van a multiplicar hay que seguir una serie de pasos bsicos:
1. Aislamiento del fragmento de DNA con el gen o genes de inters. Para ello se corta el DNA
con endonucleasas de restriccin, enzimas que reconocen sitios de restriccin en el DNA.
Estos sitios son secuencias de nucletidos que suelen ser palndromos, es decir, la secuencia
de nucletidos se lee igual en ambas cadenas del DNA en direccin 5 a 3.
2. Manipulacin in vitro del DNA. Tras localizar el gen deseado, cortarlo con la endonucleasa
de restriccin adecuada y aislarlo, se debe utilizar la misma endonucleasa de restriccin para
cortar el DNA donde se va a introducir nuestro gen, en este caso un plsmido o vector de
clonacin. Los vectores de clonacin son molculas de DNA que deben ser capaces de
replicarse. Esto lo consiguen porque en su secuencia incluyen un origen de replicacin
adecuado para la clula en la que se van a introducir. Adems, un vector tiene que tener una
diana adecuada para la enzima de restriccin que se utilice en el aislamiento del gen y, al

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

53

BIOLOGA
menos, un marcador gentico que permita asegurarse de que ha entrado en la clula
hospedadora.
3. Tecnologa del clonaje. Ambos DNAs (gen y plsmido) se unen por los extremos cohesivos,
que en ambos casos son iguales. Para unir los extremos y que se forme una nica molcula de
DNA se emplea DNA ligasa.
4. Una vez que tenemos el gen clonado dentro del vector de clonacin, el siguiente paso es
introducir el plsmido en clulas bacterianas mediante transformacin. Este plsmido ser
copiado y transmitido a las nuevas clulas cuando crezca y se divida. De este modo, podemos
obtener millones de copias de nuestro gen.
La reaccin en cadena de la polimerasa (polimerase chain reaction, PCR) es la alternativa ms
comn a la clonacin de genes en plsmidos. Es una tcnica que ha revolucionado el trabajo de la
biologa molecular. Las aplicaciones tecnolgicas y cientficas de esta tcnica hacen de ella una
herramienta muy til en gentica y biologa molecular. La reaccin en cadena de la polimerasa permite
conseguir un nmero creciente exponencialmente de copias de DNA, ya que a partir de una copia se
obtienen dos, a partir de esas dos se obtienen otras cuatro y as sucesivamente. Se trata de un
proceso cclico que se puede repetir tantas veces como se quiera. Para ello se precisa:
Una copia del DNA que se quiere amplificar.
Una DNA polimerasa que resista las altas temperaturas: se utiliza la de una bacteria llamada
Thermus aquaticus (Taq) que habita en fuentes termales y resiste hasta 95C.
Una pareja de cebadores u oligonucletidos.
Los cuatro desoxirribonucletidos.
Ciclos controlados de subidas y bajadas de temperaturas.
La reaccin de amplificacin consiste en la repeticin de un ciclo formado por tres etapas:
1. Desnaturalizacin del DNA molde mediante la elevacin de la temperatura. Se separan as
las dos hebras de DNA.
2. Hibridacin de los cebadores. Reduciendo la temperatura se induce la unin de los
cebadores a las zonas complementarias del DNA desnaturalizado, lo que permite iniciar la
sntesis de nuevas cadenas de DNA complementarias al molde.
3. Elongacin. La DNA polimerasa, resistente al calor, realiza la sntesis de las nuevas hebras
complementarias a las originales del molde a partir de los cebadores.
Despus el ciclo comienza de nuevo, pero ahora hay el doble de copias de DNA que en el ciclo
anterior. El ciclo se puede repetir tantas veces como se desee mientras existan nucletidos para formar
nuevas hebras, pues la polimerasa no se altera con cada ciclo.
Una vez obtenidas las mltiples copias de DNA por insercin del gen en una bacteria o por PCR, se
puede conocer la secuencia de bases mediante la secuenciacin de DNA por el mtodo didesoxi.
Es una reaccin de sntesis in vitro que utiliza didesoxirribonucletidos para interrumpir la replicacin
del DNA en cada base de la secuencia. Los fragmentos obtenidos de esta reaccin se someten a
electroforesis en gel y despus se puede determinar la secuencia de nucletidos del gen. El
conocimiento de la secuencia completa de un fragmento de DNA clonado es un dato de gran
importancia en s mismo (por ejemplo, para la comprensin de ciertos defectos genticos), pero
tambin resulta fundamental para continuar con el trabajo experimental (por ejemplo, mapas de
restriccin para poder clonar o manipular el gen).

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

54

Mnica Morales y scar Herrero


Una solucin a las enfermedades genticas es la terapia gnica, que intenta aplicar la tecnologa de la
ingeniera gentica para sustituir el gen alterado causante de una enfermedad por el gen normal y as
lograr que se exprese en el momento adecuado para paliar la enfermedad. Para esto es necesario
primero conocer el gen defectuoso. Para encontrar el/los gen/genes asociado/s a una enfermedad los
investigadores comienzan con un mapa gentico. De esta forma, si existen marcadores del mapa que
solo se encuentran en individuos con un fenotipo distinto, es probable que el gen responsable de la
enfermedad est cerca del marcador. En segundo lugar es necesario disponer de una tcnica que
permita introducir el gen normal en las clulas o tejidos del individuo y que el gen se exprese de forma
normal. La administracin de genes puede hacerse de distintas formas, dependiendo de las especies
implicadas. En humanos, el DNA puede ser introducido utilizando los mtodos virales, que utilizan las
estrategias utilizadas por los virus para introducirse en las clulas. El introducir genes ajenos en
personas es complicado y conlleva grandes problemas de seguridad. En cambio la ingeniera gentica
de plantas de cosecha es mucho ms sencilla. Algunas bacterias que infectan a las plantas tienen
plsmidos que integran sus genes en el genoma de la planta husped. En estos plsmidos se
introducen genes que mejoran la calidad nutricional de las cosechas, pudiendo hacerlas resistentes a
los herbicidas o capaces de producir insecticidas.
Aunque la terapia gnica no ha conseguido los objetivos esperados, la ampliacin de los conocimientos
hace pensar que incrementar su importancia en un futuro prximo.
La secuenciacin, interpretacin y comparacin entre genomas completos se denomina genmica. La
genmica proporciona una serie de genes presentes en el organismo. La genmica funcional es la
que se pregunta cundo se expresan esos genes y cmo interaccionan sus productos. Esto ha
permitido la secuenciacin del genoma de diferentes especies, entre ellas el del hombre. Los datos
obtenidos en los proyectos de secuenciacin de genomas se estn usando actualmente para el
desarrollo de nuevas vacunas, nuevas dianas farmacolgicas y nuevos marcadores genticos que
ayuden en la bsqueda de alelos asociados a enfermedades humanas.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Describir estrategias para obtener fragmentos de DNA y copias de los genes:
o Fragmentos de restriccin.
o DNA producido por la transcriptasa inversa.
o Sntesis qumica del DNA.
Conocer las tcnicas para identificar secuencias de DNA:
o Uso de sondas.
o Deteccin de secuencias especficas de DNA: southern-blot.
o Secuenciacin del DNA.
Conocer las tcnicas para amplificar las secuencias de DNA.
o Clonacin del DNA.
o Reaccin en cadena de la polimerasa: fundamentos, etapas y variables a tener en
cuenta.
Describir las caractersticas de las endonucleasas en cuanto a la seleccin de los lugares de
corte en el DNA y los tipos de fragmentos terminales producidos.
Conocer como localizar genes asociados a enfermedades.
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

55

BIOLOGA
Conocer las principales aplicaciones de la tecnologa recombinante para la mejora de la salud y
la agricultura.
BIBLIOGRAFA BSICA:
Libro adaptado para la UNED:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED
- Captulo 20. Anlisis e ingeniera gentica.
- Captulo 21. Genmica y ms all (este tema no ser evaluado en el examen, pero el alumno debe
hacer una lectura comprensiva del tema para conocer los ltimos avances en genmica del momento
actual).
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479035235
Ttulo: INTRODUCCIN A LA BIOLOGA CELULAR (2008)
Autor/es: Alberts, Bruce; Bray, Dennis; Hopkin, Karen;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

56

Mnica Morales y scar Herrero


DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/
Problemas sobre tecnologa del DNA recombinante.
http://www.biologia.arizona.edu/molecular_bio/problem_sets/Recombinant_DNA_Technology/recombinant
_dna.html
Actividad con el DNA de la Familia Blackett.
http://www.biologia.arizona.edu/human/activities/blackett/introduction.html
Fundamento de PCR y RT-PCR.
http://www.biorom.uma.es/contenido/UIB/pcresp/index.html
Animaciones de diferentes tcnicas de biologa molecular (PCR, secuenciacin, etc.).
http://www.medmol.es/tecnicas.cfm
Laboratorio virtual.
http://learn.genetics.utah.edu/
Extraccin de DNA.
http://learn.genetics.utah.edu/content/labs/extraction/
Electroforesis en gel de agarosa.
http://learn.genetics.utah.edu/content/labs/gel/
Electroforesis en gel de poliacrilamida.
http://sebbm.bq.ub.es/BioROM/contenido/biomodel/lab/inicio.htm#sdspage
Tcnicas de biologa molecular.
http://www.dnai.org/b/index.html
Lectura recomendada sobre terapia gnica.
http://www.ugr.es/~eianez/Biotecnologia/tergen-1.htm
http://www.ugr.es/~eianez/Biotecnologia/tergen-2.htm
Animaciones y explicacin de las tcnicas para desarrollar ratones transgnicos y transfecciones gnicas.
http://www.medmol.es/tecnicas.cfm
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Explique brevemente en qu consiste la reaccin en cadena de la polimerasa.
2. Defina brevemente:

Cromosoma bacteriano artificial (BAC):

Elementos de transposicin:

Vector de clonaje:
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

57

BIOLOGA

PCR:

3. Qu es necesario para realizar una PCR (Reaccin en Cadena de la Polimerasa)?


4. Explique de manera breve qu medios empleara para clonar un gen y poder introducirlo en una
bacteria.
5. Qu es una enzima de restriccin? Qu utilidades tiene?

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

58

Mnica Morales y scar Herrero

TEMA 10. Introduccin a la Ecologa


reas de estudio de la Ecologa. Organismos, poblaciones, comunidades y ecosistemas.
Tipos de ecosistemas acuticos. Tipos de ecosistemas terrestres. Clima y cambio climtico.
Biogeografa. Biodiversidad y biologa de la conservacin.

GUIN - ESQUEMA DEL TEMA


- reas de estudio de la Ecologa.
Ecologa de los organismos.
Ecologa de las poblaciones.
Ecologa de las comunidades.
Ecologa de los ecosistemas.
- Tipos de ecosistemas acuticos.
Lagos y charcas.
Humedales.
Torrentes.
Estuarios.
El ocano.
- Tipos de ecosistemas terrestres.
Bosques lluviosos.
Desiertos subtropicales.
Estepas.
Bosques templados.
Bosques boreales.
Tundra rtica.
- El papel del clima y las consecuencias del cambio climtico.
- Biogeografa.
Factores biticos.
Factores abiticos.
- Ecosistemas.
Flujo de energa y estructura trfica.
Ciclos biogeoqumicos.
- Biodiversidad y biologa de la conservacin.
INTRODUCCIN AL TEMA
La Ecologa es el estudio de la interaccin de los organismos con el medio. Tiene como objetivo
entender la distribucin y abundancia de los organismos. En este tema se tratar de analizar los
principales tipos de medios donde habitan los organismos, cmo es esa interaccin y hasta qu punto
afecta el cambio climtico.
La ecologa de los organismos, o autoecologa, centra su atencin en cmo los individuos
interaccionan con su entorno, explorando las adaptaciones morfolgicas, fisiolgicas y de conducta que
permiten el xito en el desarrollo de la vida de los individuos en un rea determinada. El estudio del
comportamiento es un aspecto importante de la autoecologa, ya que se centra en cmo los
organismos responden a ciertos estmulos procedentes del entorno.
UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

59

BIOLOGA
Una poblacin es un grupo de individuos de la misma especie que habita en la misma rea al mismo
tiempo. Los estudios de las poblaciones se centran en el cambio del nmero de individuos que las
componen con el paso del tiempo. Algunas de las herramientas que se han desarrollado para analizar y
predecir los cambios del volumen de una poblacin se usan para valorar el futuro de las especies en
peligro, como los modelos matemticos de crecimiento poblacional.
Una comunidad biolgica consiste en las especies que interaccionan entre ellas en un rea
determinada. Ya que las actividades del ser humano llevan a la extincin de muchas especies y alteran
comunidades a gran escala, los eclogos de las comunidades se ven obligados a generar hiptesis y
datos de cmo pueden producirse los impactos del hombre.
La ecologa de los ecosistemas se considera una extensin de la ecologa de las comunidades. Un
ecosistema consiste en todos los organismos de una regin en particular, junto con todos los seres y
componentes inertes. Estos componentes fsicos, o abiticos, incluyen el aire, el agua y el suelo. Los
eclogos de los ecosistemas son responsables de evaluar el impacto de la contaminacin y el
incremento de la temperatura en la distribucin y abundancia de especies, o lo que es ms, de la
disposicin de la Tierra para mantener la vida.
La biologa de la conservacin es el esfuerzo para estudiar, preservar y restaurar las poblaciones,
comunidades y ecosistemas amenazados.
Los componentes fsicos o abiticos de un determinado medio incluyen temperatura, precipitaciones,
luz solar y viento. Los componentes biticos consisten en todos los organismos presentes, de
cualquier especie.
En los ecosistemas acuticos los factores fsicos clave que constituyen el medio son la profundidad de
las aguas y los movimientos de las corrientes. La profundidad de las aguas dicta cunta luz reciben los
organismos que viven en una regin determinada. Las corrientes presentan un desafo fsico:
literalmente pueden arrasar con los organismos.
Las diferentes profundidades y tipos de movimiento de las aguas definen la disposicin de los medios
acuticos disponibles para los organismos:
Lagos y charcas. Divididos en cinco zonas en funcin de la profundidad del agua: zona litoral,
zona limntica, zona bntica, zona fotoide y zona aftica. Los movimientos del agua se deben
al viento y a la temperatura.
Humedales. Slo tienen aguas superficiales y las plantas crecen por encima de la superficie
del agua (vegetacin emergente). Las marismas y los pantanos se caracterizan por corrientes
lentas pero continuas, mientras que las cinagas se desarrollan en depresiones donde la
corriente de agua es lenta o inexistente.
Torrentes. Suelen ser superficiales y su estructura vara a lo largo de su cauce, tendiendo a
ser fros, estrechos y rpidos en su nacimiento y grandes, clidos y lentos a medida que
descienden.
Estuarios. Se forman donde los ros se encuentran con el ocano, es decir, donde el agua
dulce se encuentra con la salada. Suelen ser bastante superficiales y la corriente de agua
flucta diariamente y de forma estacional debido a las mareas, tormentas e inundaciones.
El ocano. Su profundidad se estructura en seis zonas: intermareal, nertica, ocenica,
bntica, fotoide y aftica. Los movimientos de agua estn dominados por diferentes procesos
en diferentes profundidades.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

60

Mnica Morales y scar Herrero


Los biomas son comunidades de plantas y animales caracterizadas por un tipo de vegetacin
dominante. Cada uno de los biomas que se encuentran en el mundo est asociado a un conjunto de
condiciones abiticas determinadas. El tipo de bioma presente en una regin terrestre depende del
clima (el tiempo atmosfrico predominante a largo plazo en un rea determinada). En concreto, la
naturaleza del bioma que se desarrolla en una regin en particular est regida, en primer lugar, por la
temperatura y las temperaturas medias anuales y, en segundo lugar, por la variacin anual de
temperatura y precipitaciones. Entre los biomas terrestres encontramos:
Bosques lluviosos tropicales. Se hallan en las regiones ecuatoriales de todo el mundo.
Temperatura media alta y variacin muy baja. Precipitacin anual total muy alta y variacin
alta.
Desiertos subtropicales. Se encuentran a lo largo del planeta en dos reas distintas, a 30 de
latitud tanto al norte como al sur del Ecuador. Temperatura media alta y variacin moderada.
Precipitacin anual total muy baja y variacin baja.
Estepas. Son comunidades de praderas de clima templado y se encuentran a lo largo de la
zona central de Norteamrica, conocidas comnmente como praderas, y en el centro de
Eurasia. Temperatura media moderada y variacin moderada. Precipitacin anual total baja y
variacin moderada.
Bosques templados. Son el bioma ms comn en el este de Norteamrica, el oeste de
Europa, el este de Asia, Chile y Nueva Zelanda. Temperatura media moderada y variacin
moderada. Precipitacin anual total moderada y variacin baja.
Bosques boreales. Tambin llamado taiga. Se extiende a travs de la mayor parte de Canad,
Alaska, Rusia y el norte de Europa. Temperatura media baja y variacin muy alta. Precipitacin
total anual baja y variacin baja.
Tundra rtica. Se encuentra desde el subrtico hacia los polos, en ambos hemisferios.
Temperatura media muy baja y variacin alta. Precipitacin anual total muy baja y variacin
baja.
Cada tipo de medio acutico y bioma terrestre alberga especies que se adaptan a las condiciones
abiticas presentes en ese enclave. El calentamiento global, provocado por el aumento de la
concentracin atmosfrica de CO2, est teniendo un impacto significativo en esos factores abiticos,
produciendo cambios ms o menos importantes en los patrones globales del clima.
Comprender por qu los organismos habitan en un lugar determinado es una de las tareas ms bsicas
de la Ecologa. El estudio de la distribucin geogrfica de los organismos se llama Biogeografa.
Debido a la compensacin de aptitud, los organismos tienden a estar adaptados a un conjunto limitado
de condiciones fsicas. Aunque algunas especies se encuentras en extensiones geogrficas mucho
ms amplias que otras, ningn organismo puede vivir en cualquier parte.
Los ecosistemas tienen cuatro componentes, unidos todos por un flujo de energa:
El medio abitico.
Productores primarios.
Consumidores.
Saprofitos.
La productividad total de los ecosistemas est limitada por una combinacin de temperatura y
disponibilidad de agua y luz solar. Las cadenas trficas son una forma concisa de resumir los flujos de
energas y documentar las interacciones trficas complejas que tienen lugar en las comunidades.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

61

BIOLOGA
Todos los ecosistemas comparten una pauta caracterstica: la biomasa total producida cada ao
declina desde los niveles trficos bajos a los altos.
La energa no es lo nico que se transfiere cuando un organismo se come a otro. El organismo que es
comido tambin contiene carbono, nitrgeno, fsforo, calcio y otros nutrientes. Los tomos son
reutilizados constantemente a medida que circulan a travs de los niveles trficos y el aire, agua y
suelo. El camino que toma un elemento para desplazarse de un sistema abitico a travs de los
organismos y viceversa se denomina ciclo biogeoqumico. Entre los ciclos biogeoqumicos globales
encontramos el del agua, el del carbono y el del nitrgeno.
La biodiversidad puede analizarse a tres niveles: diversidad gentica, diversidad de especies y
diversidad de ecosistemas. Los beneficios de la biodiversidad van ms all del uso directo de los
diversos genes y especies por los seres humanos para introducirlos en los servicios de los
ecosistemas, procesos que incrementan la calidad del medio abitico.
LOS OBJETIVOS ESPECFICOS DE ESTE TEMA SON:
Conocer los cuatro niveles principales en el estudio de la Ecologa:
o Organismos.
o Poblaciones.
o Comunidades.
o Ecosistemas.
Entender la importancia de la biologa de la conservacin.
Conocer los principales factores abiticos de un medio.
Saber y entender las principales diferencias entre los principales medios acuticos:
o Lagos y charcas.
o Humedales.
o Torrentes.
o Estuarios.
o El ocano.
Conocer y entender las principales diferencias entre los principales biomas terrestres:
o Bosques lluviosos tropicales.
o Desiertos subtropicales.
o Estepas.
o Bosques templados.
o Bosques boreales.
o Tundra rtica.
Entender en qu consiste el calentamiento global y sus principales consecuencias ecolgicas.
Conocer los patrones globales del clima.
Conocer los ciclos biogeoqumicos principales.
Valorar la importancia de la biodiversidad, a todos sus niveles.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

62

Mnica Morales y scar Herrero


BIBLIOGRAFA BSICA:
Este captulo no se encuentra dentro del temario contenido en el libro recomendado como bibliografa
bsica, por lo que el equipo docente pondr a disposicin de los alumnos la informacin necesaria para
su estudio. Aun as, se recomienda consultar el captulo 50 del libro:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
BIBLIOGRAFA COMPLEMENTARIA:
ISBN: 9788478290987
Ttulo: BIOLOGA (3)
Autor/es: Freeman, Scott;
Editorial: PEARSON ADDISON-WESLEY
ISBN: 9788479039981
Ttulo: BIOLOGA (7)
Autor/es: Reece, Jane; Campbell, Neil;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789500604239
Ttulo: BIOLOGA (6)
Autor/es: Curtis, Helena; Barnes, Sue N;
Editorial: EDITORIAL MDICA PANAMERICANA
ISBN: 9789701063767
Ttulo: BIOLOGA (8)
Autor/es: Solomon, Eldra Pearl;
Editorial: MCGRAW-HILL - INTERAMERICANA
ISBN: 9788478290840
Ttulo: ECOLOGA (2008)
Autor/es: Smith, TM; Smith, RL;
Editorial: PEARSON ADDISON-WESLEY
DIRECCIONES EN INTERNET:
Para aquellos estudiantes que no hayan cursado asignaturas de biologa en el bachillerato o quieran
actualizar sus conocimientos, se recomienda el CURSO CERO de BIOLOGA, cuyos contenidos son
accesibles a travs de la siguiente pgina web:
http://ocw.innova.uned.es/biologia/

On-Line Biology Book: libro de biologa en lnea y en ingls.

http://www.emc.maricopa.edu/faculty/farabee/BIOBK/BioBookTOC.html

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

63

BIOLOGA
The Biology Project: recurso para aprender biologa en lnea de la Universidad de Arizona,
principalmente en ingls y con algunos temas traducidos al espaol.
http://www.biology.arizona.edu
PREGUNTAS Y ACTIVIDADES PARA GUIAR EL ESTUDIO:
1. Defina brevemente:
Poblacin.
Comunidad.
Ecosistema.
2. Enumere los principales factores abiticos por los que se ve condicionado un ecosistema.
3. Cules son los distintos medios acuticos disponibles para los organismos?
4. Cules son las caractersticas principales de los estuarios? En qu se diferencian de los
humedales?
Explique brevemente las principales caractersticas de los siguientes biomas:
Bosques lluviosos boreales.
Bosques templados.
Bosques boreales.
5. Cules son los principales ciclos biogeoqumicos?

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

64

Mnica Morales y scar Herrero

3.- ORIENTACIONES PARA LA REALIZACIN DEL PLAN DE ACTIVIDADES

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

65

BIOLOGA
En este apartado se proporcionan las indicaciones necesarias para que el estudiante pueda desarrollar
el plan de actividades propuesto para la asignatura. Estas actividades son: trabajo con los contenidos
tericos, realizacin de Prcticas Virtuales, realizacin de Pruebas de Evaluacin Continua (PEC) y
realizacin de la Prueba Presencial.
Trabajo con los contenidos tericos
La primera actividad del estudiante consiste en trabajar con los contenidos propios de la asignatura.
Para ello, debe realizar diferentes tareas, como son: leer, comprender y asimilar los contenidos de la
materia. En el estudio de esta asignatura tiene gran importancia el componente visual, por lo que la
realizacin de esquemas y dibujos ayudan en gran medida a comprender los distintos procesos
biolgicos, y las distintas rutas o relaciones entre los componentes de los seres vivos; tambin resulta
muy til elaborar resmenes con las ideas esenciales de los temas y glosarios de los trminos.
Adems, es muy recomendable realizar los ejercicios de autoevaluacin recogidos en esta gua, en el
curso virtual o en las pginas de internet indicadas. Para facilitarle la labor de aprendizaje, dispone de
los instrumentos de apoyo (introduccin a cada tema, guin de los contenidos, objetivos, bibliografa,
actividades y ejercicios) que se recogen en el apartado anterior Orientaciones para el estudio de los
contenidos.
Para la realizacin de esta actividad, el estudiante contar con la ayuda del equipo docente
(principalmente a travs de los foros de la asignatura en la plataforma aLF y del correo electrnico),
con el asesoramiento del profesor-tutor (a travs de las tutoras en los Centros Asociados) y con la
informacin, recomendaciones e indicaciones que estarn disponibles en el curso virtual.
Realizacin de la Prueba Presencial
La Prueba Presencial consistir en un examen escrito sobre el temario contenido en la programacin
(10 temas). El examen contendr 10 preguntas cortas, referentes a conceptos del programa, que en
algn caso podrn requerir la interpretacin o realizacin de grficos, figuras o esquemas. Estas
preguntas debern ser respondidas en el espacio asignado y abarcarn todos los temas del programa.
Cada pregunta se puntuar con un punto como mximo y no se permitir el uso de ningn material
auxiliar. La duracin de la prueba ser de dos horas.
Sobre todo, se considerar de forma positiva la exactitud, el razonamiento y la justificacin de las
respuestas, as como la capacidad de sntesis, la claridad y el orden de la exposicin, la forma de
expresin y la presentacin.
El alumno podr examinarse en la convocatoria de febrero y, en caso de no superar el examen o no
presentarse a l, dispondr tambin de la convocatoria extraordinaria de septiembre.
Realizacin de Pruebas de Evaluacin Continua (PEC)
El alumno tendr la posibilidad de realizar dos Pruebas de Evaluacin Continua en el semestre. Estas
pruebas tienen carcter voluntario y estarn colgadas en el curso virtual. Sern corregidas por los
profesores tutores de los Centros Asociados y su elaboracin ser tenida en cuenta en la calificacin
final, tal y como se especifica en el apartado de Evaluacin final.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

66

Mnica Morales y scar Herrero


Evaluacin final
La evaluacin de los conocimientos adquiridos en esta asignatura constar de:
- Prueba Presencial (PP): Supone el 100% de la Calificacin Final de la asignatura. Consta de un
nico examen de carcter OBLIGATORIO. Es IMPRESCINDIBLE APROBAR este examen (calificacin
igual o superior a 5.00) para poder aprobar la asignatura.
PP = Nota Examen
- Evaluacin Continua (EC): Consta de dos actividades terico-prcticas de aprendizaje (PEC) de
carcter OPTATIVO, las cuales sern corregidas por los Profesores Tutores. Estas actividades slo
podrn entregarse en los plazos sealados en el apartado 1 de esta gua y la calificacin
obtenida en las mismas se tendr en cuenta tanto en la convocatoria de febrero como en la de
septiembre. nicamente cuando la calificacin media final obtenida en estas actividades sea igual o
superior a 4.00 y adems el alumno haya aprobado el examen de la Prueba Presencial, se podr
sumar hasta un mximo de un punto sobre la nota de la prueba presencial ambas calificaciones.
EC = Nota Actividades * 0.10
NOTA: Dado que es necesario tener una nota media igual o superior a 4.00 para que la Evaluacin Continua sume en la
Calificacin Final, es importante destacar que, en caso de realizar una sola actividad, para que compute es necesario que
sea calificada con una nota igual o superior a 8.00.
EJEMPLO: Un alumno que tenga un 5.00 como media entre la puntuacin de las dos actividades obtendr una puntuacin
en la Evaluacin Continua de 0.50 (EC = 5.00 * 0.10 = 0.50). En caso de que este alumno haya obtenido una nota igual o
superior a 5.00 en el examen, se le podr sumar este medio punto a su nota final.

CALIFICACIN FINAL (CF)


Tendr que ser IGUAL O SUPERIOR A 5.00 para poder aprobar la asignatura. Se obtendr a partir
de las notas obtenidas en la Prueba Presencial (PP) y la Evaluacin Continua (EC), mediante la
siguiente frmula:
CF = PP + EC
NOTA: Se recuerda que es necesario tener una calificacin igual o superior a 5.00 en el examen de la Prueba Presencial
(PP) para poder sumar la Evaluacin Continua (EC), as como una media igual a superior a 4.00 entre las dos actividades.
EJEMPLO: Siguiendo con el caso anterior, el alumno que fue calificado con un 6.5 en el examen y que adems fue
calificado tambin con un 5.00 en las actividades (lo que le supuso una puntuacin de 0.50 en la Evaluacin Continua),
aprobar la asignatura y tendr en su Calificacin Final un 7 (CF = 6.5 + 0.50 = 7). Si este alumno no hubiera realizado las
actividades propuestas para la Evaluacin Continua, su Calificacin Final habra sido nicamente el 6.50 de la Prueba
Presencial.

En caso de no superar el examen de la Prueba Presencial en primera instancia, el alumno dispondr


de una convocatoria extraordinaria en el mes de septiembre, para la cual se le guardar la calificacin
obtenida en la Evaluacin Continua.

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

67

BIOLOGA
4.- GLOSARIO
El libro de estudio que aparece en la bibliografa bsica de la asignatura incluye un amplio glosario:
ISBN UNED: 978-84-3626-438-8
Ttulo: FUNDAMENTOS DE BIOLOGA (5 edicin)
Autor/es: Freeman, Scott;
Editorial: PEARSON-UNED

UNIVERSIDAD NACIONAL DE EDUCACIN A DISTANCIA

68