THE JOURNAL OF BIOLOGICAL CHEMISTRY
3885–3892, 2004
© 2004 by The American Society for Biochemistry and Molecular Biology, Inc.
RNA Polymerase Mutation Activates the Production of a Dormant
Antibiotic 3,3ⴕ-Neotrehalosadiamine via an Autoinduction
Mechanism in Bacillus subtilis*
Received for publication, September 8, 2003, and in revised form, November 11, 2003
Published, JBC Papers in Press, November 11, 2003, DOI 10.1074/jbc.M309925200
Takashi Inaoka‡, Kosaku Takahashi‡, Hiroshi Yada§, Mitsuru Yoshida§, and Kozo Ochi‡¶
From the ‡Microbial Function Laboratory and §Molecular Elucidation Laboratory, National Food Research Institute,
Tsukuba, Ibaraki 305-8642, Japan
Bacillus and Streptomyces species possess the ability
to produce a variety of commercially important metab-
olites and extracellular enzymes. We previously demon-
strated that antibiotic production in Streptomyces coeli-
color A3(2) and Streptomyces lividans can be enhanced
by RNA polymerase (RNAP) mutations selected for the
rifampicin-resistant (Rif r) phenotype. Here, we have
shown that the introduction of a certain Rif r rpoB mu-
tation into a B. subtilis strain resulted in cells that over-
produce an aminosugar antibiotic 3,3ⴕ-neotrehalosadia-
mine (NTD), the production of which is dormant in the
wild-type strain. Mutational and recombinant gene ex-
pression analyses have revealed a polycistronic gene
ntdABC (formally yhjLKJ) and a monocistronic gene
ntdR (formally yhjM) as the NTD biosynthesis operon
and a positive regulator for ntdABC, respectively. Anal-
ysis of transcriptional fusions to a lacZ reporter re-
vealed that NTD acts as an autoinducer for its own bio-
synthesis genes via NtdR protein. Our results also
showed that the Rif r rpoB mutation causes an increase
in the activity of ␴A-dependent promoters including nt-
dABC promoter. Therefore, we propose that unlike the
wild-type RNAP, the mutant RNAP efficiently recog-
nized the ␴A-dependent promoters, resulting in the dra-
matic activation of the NTD biosynthesis pathway by an
autoinduction mechanism.
The ability of bacteria to survive in a wide range of adverse
environmental conditions depends on diverse molecular mech-
anisms that adjust gene expression pattern in response to
changing environment. DNA-dependent RNA polymerase
(RNAP),1 which is composed of an essential catalytic core en-
zyme (␣2␤␤⬘␻) and one of the sigma (␴) factors, is the central
enzyme for expression of genomic information in all organisms.
Rifampicin (Rif) inhibits transcription initiation by blocking
the ␤ subunit of bacterial RNAP (1, 2). Many Rif-resistant
(Rif r) mutants have been isolated and characterized in various
bacteria, notably Escherichia coli. To our knowledge, most Rif r
* This work was supported by a grant from the Organized Research
Combination System of the Science and Technology Agency of Japan.
The costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore be hereby marked
“advertisement” in accordance with 18 U.S.C. Section 1734 solely to
indicate this fact.
¶ To whom correspondence should be addressed: National Food Re-
search Institute, 2-1-12 Kannondai, Tsukuba, Ibaraki 305-8642, Japan.
Tel.: 81-29-838-8125; Fax: 81-29-838-7996; E-mail:kochi@affrc.go.jp.
1
The abbreviations used are: RNAP, RNA polymerase; Rif, rifampi-
cin; NTD, 3,3⬘-neotrehalosadiamine; Erm, erythromycin; IPTG, isopro-
pyl-␤-D-thiogalactopyranoside; ESI-MS, electrospray ionization mass
spectrometry; HR-ESI-MS, high resolution ESI-MS.
This paper is available on line at http://www.jbc.org
Vol. 279, No. 5, Issue of January 30, pp.
Printed in U.S.A.
mutations are found within the rpoB gene that encodes the ␤
subunit of RNAP (3– 6). E. coli Rif r rpoB mutations that sup-
press the auxotrophy due to lack of stringent response were
Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
demonstrated to affect the transcription of stringently con-
trolled genes by destabilizing the RNAP-stable RNA promoter
complex (7). Recently, we successfully activated the secondary
metabolism (antibiotic production) by introducing certain Rif r
rpoB mutations in Streptomyces coelicolor A3(2) and Strepto-
myces lividans (8 –11). On the basis of those findings, we pro-
posed that improvement of RNAP by introduction of a Rif r
mutation can be useful to elicit bacterial ability by altering the
gene expression in a variety of microorganisms.
The members of the genus Bacillus produce several antibi-
otics to inhibit growth of the competing organisms in nature.
Neotrehalosadiamine (3,3⬘-diamino-3,3⬘-dideoxy-␣,␤-trehalose;
NTD), which is an aminosugar antibiotic produced by Bacillus
pumilus (12) and Bacillus circulans (13), inhibits growth of
Staphylococcus aureus and Klebsiella pneumoniae (but not
Escherichia coli), although the inhibitory mechanism is not yet
elucidated. Unlike B. pumilus and B. circulans, Bacillus sub-
tilis normally does not produce this antibiotic. However, we
found that one of the Rif r mutations isolated here activates the
dormant ability to produce NTD in B. subtilis. In this paper,
the mechanism by which production of this antibiotic is acti-
vated by the Rif r mutation is discussed.
EXPERIMENTAL PROCEDURES
Bacterial Strains, Plasmids, and Culture Conditions—Strains of
B. subtilis and plasmids used are listed in Table I. Oligonucleotides used
in this study are listed in Table II. All of the B. subtilis strains are derived
from strain 61884 (trpC2 aspB66) (14). A mutant TI91 is a bacilysin
nonproducer strain (15). Strains UOT1285EN1 (amyE::rrnE-bgaB) and
MF1 (rpoChis6 neo) were provided by F. Kawamura and M. Fujita,
respectively. Plasmid pUB18 was provided by F. Kawamura. B. subtilis
strains were grown aerobically in S7N medium or L medium as
described previously (15).
To monitor the promoter activities of ntdABC and ntdR, each up-
stream region (490 bp from the translational start codon) was amplified
by PCR with the primer pairs PntdA-F and PntdA-R for ntdABC pro-
moter and PntdR-F and PntdR-R for ntdR promoter. The amplified
fragment was cloned into pCR2.1 and fully sequenced to confirm the
correct sequence. Each EcoRI fragment containing the upstream region
of ntdABC or ntdR was inserted into the EcoRI site of pDL2 (16),
resulting in plasmids pDL2-PntdA and pDL2-PntdR, respectively.
For overexpression of NTD biosynthesis operon in B. subtilis, the
430-bp fragment encoding N-terminal part of NtdA was synthesized by
PCR with primers ntdA-F and ntdA-R and cloned at the EcoRV site of
pHASH120 by a TA cloning method as described by Ohashi et al. (17),
resulting in pHASH120-ntdA. Similarly, for overexpression of ntdBC
(but not ntdA) in B. subtilis, the 240-bp fragment encoding the N-
terminal part of NtdB was amplified by PCR with primers ntdB-F and
ntdB-R and cloned into pHASH120, resulting in pHASH120-ntdB. To
express the NTD biosynthesis operon in E. coli, the full length of the
ntdABC coding region (3.2 kb) was amplified by PCR with the primers
3885
3886 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
TABLE I
Bacterial strains and plasmids used in this study
Strains and plasmids Genotype or description Construction or source

B. subtilis
61884 trpC2 aspB66 Ochi and Ohsawa (14)
84R2 trpC2 aspB66 rpoB2 This study
84R5 trpC2 aspB66 rpoB5 This study
84R6 trpC2 aspB66 rpoB6 This study
84R32 trpC2 aspB66 rpoB32 This study
TI91R5 trpC2 aspB66 rpoB5 ⌬ywfB::pMutinT3 (Ermr) 84R5 3 TI91a
Y8–19 trpC2 aspB66 rpoB5 ntdA::Tn10 (Spcr) This study
T5–31 trpC2 aspB66 rpoB5 ntdB::Tn10 (Spcr) This study
E2–10 trpC2 aspB66 rpoB5 ntdC::Tn10 (Spcr) This study
TI122 trpC2 aspB66 amyE::(PntdA-lacZ, Cmr) pDL2-PntdA 3 61884
TI122R5 trpC2 aspB66 rpoB5 amyE::(PntdA-lacZ, Cmr) 84R5 3 TI122
TI123 trpC2 aspB66 amyE::(PntdR-lacZ, Cmr) pDL2-PntdR 3 61884
TI123R5 trpC2 aspB66 rpoB5 amyE::(PntdR-lacZ, Cmr) 84R5 3 TI123
TI125R5 trpC2 aspB66 rpoB5 ntdR::pMutinT3(Pspac-ntdR) pMutinT3-ntdR 3 61884
TI127 trpC2 aspB66 ntdR::neo amyE::(PntdA-lacZ, Cmr) pUC18-ntdR::neo 3 TI122
TI127R5 trpC2 aspB66 rpoB5 ntdR::neo amyE::(PntdA-lacZ, Cmr) 84R5 3 TI127
TI127R2 trpC2 aspB66 rpoB2 ntdR::neo amyE::(PntdA-lacZ, Cmr) 84R2 3 TI127

Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
TI127R6 trpC2 aspB66 rpoB6 ntdR::neo amyE::(PntdA-lacZ, Cmr) 84R6 3 TI127
TI127R32 trpC2 aspB66 rpoB32 ntdR::neo amyE::(PntdA-lacZ, Cmr) 84R32 3 TI127
TI130R5 trpC2 aspB66 rpoB5 ntdA::Tn10 amyE::(PntdA-lacZ, Cmr) Y8–19 3 TI122R5
TI131R5 trpC2 aspB66 rpoB5 ntdB::Tn10 amyE:: (PntdA-lacZ, Cmr) T5–31 3 TI122R5
TI132R5 trpC2 aspB66 rpoB5 ntdC::Tn10 amyE:: (PntdA-lacZ, Cmr) E2–10 3 TI122R5
TI139 trpC2 aspB66 ntdA::pHASH120(PS10-ntdABC) pHASH120-ntdA 3 61884
TI148R5 trpC2 aspB66 rpoB5 ntdA::Tn10 pHASH120-ntdB 3 Y8–19
ntdB::pHASH120(PS10-ntdBC)
TI149 trpC2 aspB66 amyE::(PrrnE-bgaB Cmr) UOT1285EN1 3 61884
TI149R5 trpC2 aspB66 rpoB5 amyE::(PrrnE-bgaB Cmr) 84R5 3 TI149
TI149R2 trpC2 aspB66 rpoB2 amyE::(PrrnE-bgaB Cmr) 84R2 3 TI149
TI149R6 trpC2 aspB66 rpoB6 amyE::(PrrnE-bgaB Cmr) 84R6 3 TI149
TI149R32 trpC2 aspB66 rpoB32 amyE::(PrrnE-bgaB Cmr) 84R32 3 TI149
TI150 trpC2 aspB66 rpoChis6 Nmr MF1 3 61884
TI150R5 trpC2 aspB66 rpoB5 rpoChis6 Nmr 84R5 3 TI150
TI151R5 trpC2 aspB66 rpoB5 ntdR::neo amyE::(PntdR-lacZ, Cmr) TI127 3 TI123R5
Plasmids
pDL2-PntdA pDL2 containing the 490 bp of ntdABC upstream region This study
pDL2-PntdR pDL2 containing the 490 bp of ntdR upstream region This study
pMutinT3- ntdR pMutinT3 containing 5’-region of ntdR This study
pHASH120-ntdA pHASH120 containing 5’-region of ntdA This study
pHASH120-ntdB pHASH120 containing 5’-region of ntdB This study
pUC18-ntdR::neo pUC18 containing ntdR::neo This study
pUC18-ntdABC pUC18 containing complete ntdABC This study
pUB18-ntdR pUB18 containing complete ntdR This study
pQE80L-ntdR pQE80L containing complete ntdR This study
a
The latter was transformed with chromosomal DNA or plasmid of the former.

TABLE II
Oligonucleotides used in this study
Purpose Primer Oligonucleotide sequence (5⬘ 3 3⬘)

Transcriptional fusion analysis PntdA-F ATCCCATTCATTTTCTAAAGTC

PntdA-R GAACAGTACCTCCAATGATTTTA
PntdR-F TAATAGCATCGGTTCCACTG
PntdR-R TTCCCTTCCTTAAAAAAGTTGTT
Forced expression of ntdABC ntdA-F ATGCAAAAACAGGTTAAGATTTC
ntdA-R ATAACTTCATCCCCTGGGTT
Forced expression of ntdBC ntdB-F ATGTTATTAAGCAAGAAATCGGAG
ntdB-R CTAAATTTTCCTCGTCCC
Expression of ntdABC in E. coli ntdA-F2 cgaattcATTGGAGGTACTGTTCATGCAa
ntdC-R cggatccTAGTTGACTGCTGAAACAGACATa
IPTG-dependent induction of ntdR ntdR-F agaagctttAAGGAAGGGAAAATATGCCTa
ntdR-R ggaggatccCCATTCATTTTCTAAAGTCCCa
Insertional mutation of ntdR ⌬ntdR-F CGAACTTGACTACACTCCCA
⌬ntdR-R TCCATTCGCTTCTATGATGT
Purification of His6-tagged NtdR ntdR-F2 ggatccATGCCTACAATTGATGAAATa
ntdR-R2 gtcgacTTACGTTGATTCTCTCTTATAATAAGa
a
These primers have the EcoRI, BamHI, HindIII, or SalI site as indicated by underlines.

ntdA-F2 and ntdC-R. The EcoRI-BamHI fragment was cloned into the
corresponding region of pUC18, generating pUC18-ntdABC. A part of
the fragment containing PCR errors was replaced with the other cor-
responding fragment.
To generate pMutinT3-ntdR, the DNA fragment containing a Shine-
Dalgarno sequence, and the N-terminal coding region was amplified by
PCR with the primers ntdR-F and ntdR-R. A HindIII-BamHI fragment
was cloned into pMutinT3 (18), resulting in a plasmid pMutinT3-ntdR.
For disruption of the ntdR gene, the partial internal coding region of
ntdR gene (510 bp) was amplified by PCR with the primers ⌬ntdR-F
and ⌬ntdR-R and cloned into plasmid pCR2.1 (Invitrogen). The EcoRI
fragment containing the partial ntdR gene was subcloned into pUC18
(Takara), resulting in pUC18-ntdR. A 1.3-kb SmaI fragment containing
the neo gene derived from pBEST501 (19) was inserted at the EcoRV
site within the ntdR gene in pUC18-ntdR, creating pUC18-ntdR::neo.
To determine the transcriptional start point of ntdR, the PCR frag-
 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
ment synthesized with PntdR-F and ntdR-R2 was cloned into pCR2.1
and fully sequenced. An EcoRI-SalI fragment was subcloned into plas-
mid pUB18, which is plasmid pUB110 (20) containing multicloning
sites derived from pUC18, generating pUB18-ntdR.
For the expression of His-tagged NtdR, the PCR fragment synthe-
sized with ntdR-F2 and ntdR-R2 was cloned into pCR2.1 and fully
sequenced. A BamHI-SalI fragment containing the full length of the
ntdR coding region was inserted into the expression vector pQE80L
(Qiagen), generating pQE80L-NtdR. E. coli harboring the resultant
plasmid can express His6-tagged NtdR protein, which is extended with
Met-Arg-Gly-Ser-His6-Gly-Ser at the N terminus.
For the selection of B. subtilis transformants, Rif (2 ␮g/ml), erythro-
mycin (Erm; 0.5 ␮g/ml), spectinomycin (100 ␮g/ml), neomycin (3 ␮g/ml),
and chloramphenicol (5 ␮g/ml) were used. For the selection of E. coli
transformants, ampicillin (100 ␮g/ml) was used.
NTD Production—B. subtilis cells were precultured in S7N medium
at 37 °C for 12 h with vigorous shaking. The cultures were then diluted
50-fold in a fresh S7N medium and cultivated for the indicated time
under the same conditions. The growth of E. coli was monitored in M9
medium supplemented with 0.1% yeast extract. Isopropyl-␤-D-thioga-
lactopyranoside (IPTG; final concentration 10 mM) was added to the
growth medium when the culture reached A650 ⫽ 0.5. Antibiotic activity
was determined by the paper disk-agar diffusion assay using S. aureus
209P as the test organism. The culture supernatants (50 ␮l) obtained
after centrifugation were applied onto a paper disk (diameter 8.0 mm;
Advantec), and the paper disk was placed on a half-strength Mueller
Hinton agar (Difco) plate inoculated with S. aureus 209P.
Isolation and Purification of NTD—The culture supernatant (400 ml)
of strain TI91R5 prepared after 24-h cultivation was adsorbed on a
column of Dowex 50W ⫻ 8 (NH⫹ 4 form). The column was eluted with 250
ml of 50 mM ammonium acetate and 100 ml of 1 M NH4OH solutions,
successively. The second eluate was concentrated in vacuo, subjected to
a SiO2 gel column chromatography, and then eluted with 300 ml of 65%
CH3CN solution. The active fractions were collected and evaporated to
yield a brown material. This material was chromatographed using a
column packed with Sephadex LH-20 resin in 50% CH3OH to obtain a
brown solid (140 mg). The brown solid (20 mg) was further purified by
high pressure liquid chromatography (Capcell pack NH2, 4.6 ⫻ 150 mm;
Shiseido) using 90% CH3CN as a mobile phase at a flow rate of 1 ml/min
and monitored by refractive index. The resulting compound (purity
⬎95%) was analyzed by mass spectrometry and 13C NMR spectrometry.
High resolution electrospray ionization mass spectrometry (HR-ESI-
MS) was performed on a Brucker Daltonics ApexII 70e mass spectrom-
eter. 13C NMR spectra were recorded on a Brucker DRX600 spectrom-
eter operating at 150.09 MHz.
Transposon Mutagenesis—For transposon mutagenesis, the temper-
ature-sensitive mini-Tn10-containing vector pIC333 was used as de-
scribed by Steinmetz and Richter (21). We selected colonies that were
resistant to spectinomycin but sensitive to Erm and then tested for
their ability to produce NTD by cultivating the isolates for 24 h in S7N
medium. The mutants resistant to both spectinomycin and Erm were
not subjected to the NTD production test. NTD-nonproducing mutants
were selected for further analysis.
Assay for ␤-Galactosidase Activity—Strains were grown aerobically
in S7N medium, and samples were withdrawn every 1 h during 10-h
cultivation. ␤-Galactosidase activity was measured as described previ-
ously (22). Thermostable ␤-galactosidase (BgaB) activity was also meas-
ured by the same method, except that the samples were incubated at
62 °C.
Primer Extension—Strain 84R5 for ntdABC or 61884 harboring
pUB18-ntdR for ntdR was grown in S7N medium and harvested at t0
(the time points of transition from exponential to stationary phase) or t4
(4 h after t0), with corresponding A650 of 1.5 and 8.0, respectively. The
total cellular RNAs were prepared using the Isogen reagent (Nippon
Gene). To remove the contaminated DNA, the prepared RNAs were
treated with 10 units of DNase I (amplification grade; Invitrogen) at
25 °C for 15 min. DNase I was inactivated by the addition of EDTA and
heat treatment at 65 °C for 10 min. After ethanol precipitation, a total
of 50 ␮g of RNA was incubated with 1 pmol of an infrared dye-labeled
primer, IRD800-ntdA (5⬘-IRD800-TTGTTTCCACCGCTCGTTTAC-3⬘)
(Aloka) for ntdABC or IRD800-ntdR (5⬘-IRD800-TCCGAGCTAAATA-
ATTGGGAGTG-3⬘) for ntdR, at 80 °C for 15 min. After annealing, 5 ␮l
of 0.1 M dithiothreitol, 10 ␮l of 5-fold First-Strand buffer (250 mM
Tris-HCl (pH 8.3), 375 mM KCl, and 15 mM MgCl2) and 5 ␮l of dNTP mix
(10 mM each of dATP, dGTP, dCTP, and dTTP) were added. To 50 ␮l of
this reaction mixture, 200 units of SuperScript II (Invitrogen) was
added followed by incubation at 42 °C for 1 h. Subsequently, 1 ␮l of
RNase mixture (Ambion) was added to the reaction mixture and further
3887
FIG. 1. Antibiotic production by parental (61884) and Rif r mu-
tant (84R5) strains of B. subtilis. Antibiotic activity was determined
by the paper disk-agar diffusion assay. Strains 61884 and 84R5 (rpoB5)
were grown in S7N medium supplemented with amino acids as required
(50 ␮g/ml of tryptophan and 20 mM aspartate) at 37 °C for the indicated
times.
incubated at 37 °C for 30 min. After ethanol precipitation, primer
extension and sequencing reactions with the corresponding primer were
run on polyacrylamide gel. Analysis was done using DNA sequencing
system LIC-4200L(S)-2 (LI-COR).
Purification of His6-tagged Protein—E. coli BL21(DE3) harboring
Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
pQE80L-NtdR was grown aerobically to A650 ⫽ 0.6 at 37 °C in L me-
dium supplemented with 1% glucose. IPTG was then added to a final
concentration of 2 mM, and the culture was further incubated for 4 h. E.
coli cells were harvested and disrupted by sonication. The cell lysate
was centrifuged (8,000 ⫻ g for 10 min) to remove insoluble material.
The soluble His6-tagged protein was purified using the TALON purifi-
cation kit (Clontech) as described in the manufacturer’s manual. The
purified protein was dialyzed against 20 mM potassium phosphate
buffer (pH 7.5). The RNAP holoenzyme containing His6-tagged ␤⬘ sub-
unit was purified as described by Fujita and Sadaie (23).
Electrophoretic Mobility Shift Assay—DIG Gel Shift Kit (Roche Ap-
plied Science) was used for the gel retardation assay. The internal
region (100 bp) between ntdA and ntdR was amplified with primers
PntdR-R and PntdA-R (see Table II) and used for the labeling reaction.
The 100-fold diluted probe was incubated at 25 °C for 15 min with or
without His6-tagged NtdR, varying amounts of NTD, trehalose, and
neotrehalose in 15 ␮l of binding buffer (20 mM Hepes (pH 7.6), 30 mM
KCl, 1 mM EDTA, 10 mM (NH4)2SO4, 1 mM dithiothreitol, 0.2% Tween
20, and poly(dA-dT)). DNA and DNA-protein complexes were separated
on 7% nondenaturing PAGE, transferred onto a membrane (Hybond-
N⫹; Amersham Biosciences), and detected as described in the manufac-
turer’s manual.
RESULTS
A Rif r RNAP Mutation Activates Neotrehalosadiamine Pro-
duction—To investigate the effect of rpoB mutation in B. sub-
tilis, we isolated a number of spontaneous Rif r mutants on L
agar plate containing 100 ␮g/ml Rif. Of these isolates, 40
strains were tested for their ability to produce antibiotic. As a
result, a total of 16 mutants were found to produce a signifi-
cantly increased amount of antibiotic. Antibiotic production by
the mutant 84R5 is shown in Fig. 1 as an example. Nucleotide
sequence analysis revealed that all the mutants with enhanced
antibiotic production had an identical mutation at Ser-487
(corresponding to Ser-531 in E. coli) to Leu (rpoB5) in RNAP
␤-subunit. The other mutants were found to have a substitu-
tion mutation of His-482 (corresponding to His-526 in E. coli) to
Arg (rpoB2), Tyr (rpoB6), or Pro (rpoB32) (Table III). Since all
of the rpoB5-back-cross transformants tested produced antibi-
otic as much as 84R5, rpoB5 mutation was responsible for the
observed activation of antibiotic production.
When B. subtilis strain 61884 is grown in S7N medium, cells
produce the dipeptide antibiotic bacilysin after 8 h of cultiva-
tion (15). A mutant TI91, which does not produce bacilysin,
cannot accumulate antibiotic activity against S. aureus (15).
Surprisingly, the introduction of the rpoB5 mutation into the
mutant TI91, designated TI91R5, activated the antibiotic pro-
duction (data not shown). Moreover, the rpoB5 mutation did
not influence the expression of the bacilysin biosynthesis
operon (data not shown). Consequently, the rpoB5 mutation
was thought to activate a novel gene(s) for antibiotic production
in B. subtilis. Therefore, we isolated the antimicrobial sub-
3888 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
TABLE III
Mutations found in rpoB gene in Rif r mutants
Homologous rpoB
Strain Relevant genotype Nucleotide substitution Amino acid substitution Rif resistancea Antibiotic productionb
positions

E. coli S. coelicolor ␮g/ml

61884 wt(rpoB⫹) ⬍0.1 ⫺
84R5 rpoB5 1460C3 T 487S3L 531S 442N ⬎100 ⫹⫹
84R2 rpoB2 1445A3G 482H3R 526H 437H ⬎100 ⫺
84R6 rpoB6 1444C3 T 482H3Y 526H 437H ⬎100 ⫺
84R32 rpoB32 1445A3C 482H3P 526H 437H ⬎100 ⫺
a
Determined after 12 h of incubation on L agar plate.
b
Antibiotic production was determined after 24 h of cultivation in S7N medium as described in the legend to Fig. 1. ⫺, no inhibition zone; ⫹⫹,
inhibition zone of 25 mm.

TABLE IV
Chemical properties of the isolated compound and NTD
Isolated compound NTDa

Appearance White amorphous powder White amorphous powder

Elemental analysis NDb C42.54, H7.43, N8.60

Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
Electron impact mass ND 340 关M兴⫹
spectrometry (m/z)
ESI-MS (m/z) 363 关M⫹Na兴⫹
HR-ESI-MS (m/z) 363.1368
Calculated for C12H24N2O9Na 363.1374
Ninhydrin Positive Positive
13C NMR in ␦ ppm (in D2O) 54.1, 58.1, 61.1, 61.3, 70.1, 70.1, 71.8, 72.2, 54.7, 58.6, 61.7, 61.8, 70.6, 70.7, 72.2, 72.9,
74.8, 77.4, 92.3, 97.2 75.6, 77.8, 93.0, 98.3
a
The data on the physico-chemical property are from Tsuno et al. (12).
b
ND, not determined.

stance produced by TI91R5 (see “Experimental Procedures”).
The purified antimicrobial substance was positive for ninhy-
drin reaction and adsorbed in a cation exchange column chro-
matography. No UV maximum was observed in the aqueous
solution. HR-ESI-MS and 13C NMR spectral data demon-
strated that this antimicrobial substance is identical to NTD
which was previously isolated from B. pumilus (12) and
B. circulans (13). The chemical properties are summarized in
Table IV. NTD production of strain 84R5 reached as high as
500 –1000 ␮g/ml after 24 h of cultivation, whereas the parental
rpoB⫹ strain produced less than the detectable level (⬍1 ␮g/ml)
(data not shown).
Identification of the Genes Involved in NTD Production—To
identify the genes involved in NTD synthesis, we performed
transposon mutagenesis of strain 84R5 using the mini-Tn10
delivery vector pIC333 (21). Of the 1,800 mutant isolates with
mini-Tn10 insertion tested for NTD production, we found three
mutants were unable to produce NTD. These three mutants
were all found to have a Tn10-insertional mutation within the
polycistronic operon yhjLKJ (we renamed ntdABC in this
study) (Fig. 2). Even when the ntdA downstream genes (ntdB
and ntdC) was expressed from a powerful S10 promoter origi-
nating from the large S10 ribosomal gene cluster in strain
Y8 –19 (rpoB5 ntdA::Tn10), NTD production was no longer
detected, indicating that blocking the NTD synthesis by Tn10
insertion was not simply due to polar effect on ntdB and ntdC
(Fig. 2). The gene products of ntdA, ntdB, and ntdC were
putatively identified to be pyridoxal phosphate-dependent ami-
notransferase, hydrolase, and NADH-dependent dehydrogen-
ase, respectively. To confirm whether NTD synthesis is depend-
ent upon ntdABC transcription, we replaced its promoter in
rpoB⫹ strain 61884 with a S10 promoter. The resulting recom-
binant TI139 carrying S10 promoter-dependent ntdABC pro-
duced NTD just as strain 84R5 (Fig. 2), suggesting that the
activation of NTD production by rpoB5 mutation resulted from
the activation of ntdABC promoter.
The ntdR gene (formerly yhjM), which locates inversely in
the upstream region of ntdABC operon, encodes a putative LacI
family transcriptional regulator. To elucidate the possible func-
tion of NtdR protein on NTD production, we constructed the
ntdR interruption mutant (TI125R5) carrying IPTG-inducible
spac promoter-dependent ntdR (Fig. 2). Strain TI125R5 did not
accumulate NTD without the ntdR induction (in the absence of
IPTG). On the other hand, the NTD production in TI125R5 was
induced when IPTG was added into the culture broth. These
results suggest that NtdR protein takes part in the regulatory
mechanism for NTD production.
The ntdABC Operon Encodes a Complete Set of Genes for
NTD Biosynthesis—We also investigated whether or not the
ntdABC operon was the structural gene for NTD biosynthesis.
The ntdABC operon was cloned into a high copy number plas-
mid, pUC18, and expressed in E. coli BL21(DE3) under the
control of lac promoter (see “Experimental Procedures”). An
E. coli strain harboring pUC18-ntdABC displayed a prolonged
growth lag phase compared with the vector control (Fig. 3A),
although no growth inhibition was observed when a high con-
centration (1,000 ␮g/ml) of NTD was added exogenously. TLC
analysis revealed that a ninhydrin-positive spot with a corre-
sponding retention factor of NTD was detected in the culture
broth of cells expressing ntdABC (Fig. 3B). Moreover, the peak
at m/z 363 that represents the mass of NTD [M ⫹ Na]⫹ was
also detected in the culture broth, as determined by ESI-MS
spectrometry analysis (Fig. 3C). In contrast, no peak was de-
tected at m/z 363 when a sample from the cells harboring the
vector control was analyzed (data not shown). The amount of
NTD produced by the ntdABC-harboring E. coli was ⬃5 ␮g/ml.
These results strongly indicate that ntdABC operon contains a
complete set of genes required for NTD biosynthesis. This is
another instance of “exogenous” antibiotic production in E. coli,
following the previous report on erythromycin production in
E. coli (24).
Transcriptional Analysis of NTD Biosynthesis Gene and Its
Regulator—The pDL2-derivative plasmids allow the creation of
the promoter-lacZ fusion at the amyE locus via a double cross-
over event (16). To monitor the transcription of ntdABC and
ntdR, we constructed a strain carrying ntdABC-lacZ or ntdR-
lacZ transcriptional fusion. The transcription level of ntdABC
in rpoB5 mutant was 20 –50-fold higher than that in the rpoB⫹
 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
FIG. 2. The B. subtilis mutant con-
structions and the corresponding
phenotypes for NTD production.
Genes are shown as thick arrows. Pspac,
PS10, and stem-loop structure indicate
IPTG-dependent spac promoter, S10 pro-
moter, and the transcriptional termina-
tor, respectively.
FIG. 3. NTD production in E. coli transformed with the plas-
mid carrying the ntdABC gene. A, E. coli strain BL21(DE3) harbor-
ing pUC18 (open circles) or pUC18-ntdABC (closed circles) were grown
in M9 medium supplemented with 0.1% yeast extract. IPTG was added
into the culture when cells reached A650 ⫽ 0.5, as indicated by the
arrows. After a 4-h incubation, cells were removed by centrifugation,
and the supernatants were subjected to silica gel TLC analysis (B). The
area corresponding to the retention factor of NTD was scraped and then
eluted with water. The eluted sample was analyzed by ESI-MS (C).
strain throughout the growth (Fig. 4A). No change in transcrip-
tion level was observed for the other rpoB mutations, namely
rpoB2, rpoB6, and rpoB32 (data not shown). The disruption of
the ntdR gene almost completely shut off the ntdABC tran-
scription in the rpoB5 mutant (Fig. 4A). In contrast, it resulted
in an increase in its own promoter activity (Fig. 4B). These
results indicate that NtdR protein apparently acts positively on
the ntdABC transcription and negatively on its own transcrip-
tion. However, no significant difference in the ntdR expression
was observed between rpoB⫹ strain and rpoB5 mutant (Fig.
3889
Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
FIG. 4. Transcriptional analysis of ntdABC operon and ntdR
gene in B. subtilis wild-type and mutant (rpoB5) strains. The
transcription of ntdABC and ntdR were analyzed using transcriptional
lacZ fusion constructs with ntdABC (A) and ntdR (B). A, strains TI122
(squares), TI122R5 (circles), and TI127R5 (triangles) were grown in S7N
medium supplemented with the required amino acids (50 ␮g/ml Trp and
20 mM of Asp). Culture samples were withdrawn at the indicated times,
and the ␤-galactosidase activity was measured. B, strains TI123
(squares), TI123R5 (circles), and TI151R5 (triangles) were grown as in
A. C, nucleotide sequence of the intergenic region between ntdR and
ntdABC. The transcriptional start points for the ntdABC and ntdR are
indicated as bending arrows. The ⫺10 and ⫺35 hexamers and ribosome
binding site (RBS) are shown by capital boldface letters with underline.
The inverted repeat structure is represented by arrows facing
one another.
4B), although the rpoB5 mutation caused a transcriptional
burst of ntdABC throughout whole growth phase of the rpoB5
mutant (Fig. 4A). To confirm the results from the lacZ fusion
analysis, we conducted Northern blot experiments using probes
for ntdA and ntdR. The ntdABC transcript (⬃3.2 kb) was de-
tected in rpoB5 mutant 84R5 but not in rpoB⫹ strain 61884
3890 Activation of B. subtilis Neotrehalosadiamine Biosynthesis

FIG. 5. Effect of the NTD addition

on ntdABC transcription. A, strains
TI122 (rpoB⫹), TI122R5 (rpoB5), TI127R5
(rpoB5 ntdR::neo), TI130R5 (rpoB5 ntdA::
Tn10), TI131R5 (rpoB5 ntdB::Tn10), and
TI132R5 (rpoB5 ntdC::Tn10) were grown

Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
for 10 h in S7N medium containing vary-
ing concentrations of NTD (purity ⬎95%),
and ␤-galactosidase activity was meas-
ured. The average values for five separate
experiments are shown with their S.D.
values. B, gel mobility shift analysis of
the ntdR-ntdABC intergenic region with
His-tagged NtdR and NTD. DIG-labeled
DNA fragment of the ntdR-ntdABC inter-
genic region was incubated with or with-
out His-tagged NtdR, NTD, trehalose (T),
or neotrehalose (NT).

(data not shown). Consistent with the results from lacZ fusion
analysis, there was no significant difference in the amount of
ntdR transcript (⬃1.0 kb) between the 84R5 and 61884 strains
(data not shown). Thus, the ntdABC transcription was dramat-
ically activated by the rpoB5 mutation without increasing the
expression of the positive transcriptional regulator ntdR. We
therefore deduced that a specific co-factor is required (or plays
a role) for the transcriptional activation of the ntdABC by
NtdR protein.
To investigate the regulation of ntdABC transcription by
NtdR protein, we first determined the transcriptional start
sites for ntdABC operon and ntdR gene. For ntdABC primer
extension, total RNA of the 84R5 cells was isolated at t0 (the
time point of transition from exponential to stationary phase)
and t4 (representing the stationary phase) and used for primer
extension experiments. Transcription of ntdABC was initiated
at the G residue 42 bases upstream of the translational start
codon (Fig. 4C). The most probable ⫺10 and ⫺35 promoter
sequences, as recognized by housekeeping ␴ factor (␴A), were
found in the upstream region of the transcriptional start site.
Interestingly, the A-T-rich inverted repeat structure was found
in this region, overlapped with the ⫺10 hexamer and the tran-
scriptional start point, suggesting that this inverted repeat
may be a regulatory element for ntdABC transcription. For
ntdR primer extension, we used strain 61884, harboring a
multicopy number plasmid pUB18-ntdR, because the ntdR ex-
pression was too low to detect the transcriptional start site. An
intensive signal was detected at the A residue 81 bases up-
stream of its translational start codon, although no obvious
consensus sequence was found (Fig. 4C).
Recently, Bandow et al. (25) reported that the addition of Rif
to the exponentially growing B. subtilis cells induces ␴B and ␴D
regulons, eliciting the cell’s tolerance to moderate concentra-
tions of Rif. To test whether these regulon genes were involved
in the NTD production, we grew the rpoB⫹ strain TI122 in S7N
medium containing varying concentrations (10 –100 ␮g/ml) of
Rif. However, we found that Rif had no effect on the activation
of ntdABC transcription. Moreover, the disruption of these
alternative ␴ factors, ␴B and ␴D, did not affect NTD production
in the rpoB5 mutant (data not shown).
NTD Functions as an Autoinducer for Its Own Biosynthe-
sis—It was observed that the insertional mutation of ntdA,
ntdB, or ntdC abolishes their own gene expression in rpoB5
mutant (Fig. 5A), suggesting that the transcription of ntdABC
can be controlled by an autoregulation mechanism. Further-
more, the addition of purified NTD into the culture of these
mutants actually induced the ntdABC transcription in a dose-
dependent manner (Fig. 5A). Even in the rpoB⫹ strain, ntdABC
transcription was activated by the addition of NTD, although
the effect in the rpoB⫹ cells was lower than that in the rpoB5
 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
cells. No such effect was observed in the ntdR-disrupted mu-
tant. In contrast, the addition of trehalose or neotrehalose (also
known as ␣,␤-trehalose) (500 ␮g/ml) instead of NTD failed to
activate the promoter for the NTD biosynthesis gene (data
not shown).
Accordingly, we examined the ability of NtdR protein to
interact with the internal region between the ntdABC operon
and ntdR gene in the presence or absence of NTD. The 100 bp
of DNA fragment containing the deduced regulatory element as
mentioned above was used to investigate possible interaction
with His6-tagged NtdR. A gel mobility shift assay revealed that
NtdR protein apparently bound to this region even in the
absence of NTD (Fig. 5B, lane 2). A complex (NtdR-NTD-DNA)
mobilizing more slowly than the NtdR-DNA complex was de-
tected in dose-dependent manner when NTD was added (lanes
4 –7). The addition of trehalose or neotrehalose instead of NTD
did not affect the mobility of NtdR-DNA complex (lanes 8 and
9). Thus, it is concluded that NTD (but not trehalose and
neotrehalose) probably acts as an autoinducer for its own bio-
synthesis operon by directly interacting with NtdR protein.
Mutant RNAP Enhances the Activity of Promoters Recog-
nized by ␴A—Our results as described above suggest that rpoB5
mutation may render RNAP more potent for recognition of the
ntdABC promoter. To assess this hypothesis, we first compared
the amount of ␴A binding to core RNAP in rpoB⫹ and rpoB5
strains, since ntdABC promoter was recognized by ␴A (see Fig.
4C). For isolation of RNAP holoenzyme, a strain carrying a
His6-tagged ␤⬘ subunit of RNAP was used. Western blot anal-
ysis showed that the amount of ␴A co-eluted with core RNAP in
rpoB5 strain was virtually the same as that in the rpoB⫹ strain
(Fig. 6A). A similar result was obtained when whole-cell lysates
were fractionated by gel filtration (data not shown). Next, we
measured the basal promoter activity (without autoinduction)
of the NTD biosynthesis operon in rpoB⫹ and rpoB5 strains. To
avoid the effect of autoinduction by endogenous NTD, we used
the ntdR-disrupted mutants. The basal promoter strength of
ntdABC in rpoB5 mutant was 2.5-fold higher than that in the
wild-type strain (Fig. 6B), despite no observed increase in the
␴A level associated with core RNAP (see above). The basal
promoter strength was not affected when other rpoB mutants
(rpoB2, rpoB6, and rpoB32) were used, indicating that the
observed increase in promoter strength is specific to the rpoB5
mutation. Likewise, the activities of stable RNA promoter rec-
ognized by ␴A (examined for rrnA, rrnB, rrnD, rrnE, rrnI, rrnJ,
and rrnO) in the rpoB5 strain were also found to be about 2-fold
higher than that in the wild-type strain. The result for rrnE is
presented in Fig. 6C as an example. These results suggest that
rpoB5 mutation results in an increase in the ␴A-dependent
promoter activity without facilitating the ␴A-binding to core
RNAP. Thus, it is thought that the rpoB5 mutation renders
RNAP highly potent to enhance the transcription from the
␴A-dependent promoters, including the ntdABC promoter,
eventually leading to the dramatic induction of NTD biosyn-
thesis operon via the autoinduction system.
DISCUSSION
We have previously reported that antibiotic production by
Streptomyces spp. is dramatically activated by introducing cer-
tain mutations into rpoB that confer resistance to Rif (8 –11). In
the present study, we showed that the introduction of Rif r rpoB
mutation into a B. subtilis strain activates the dormant ability
for NTD synthesis. We also successfully identified the genes
required for NTD synthesis and for transcriptional activation.
Of these genes, it is highly likely that the ntdA gene product
encoding a putative aminotransferase took part in amination of
sugar moieties at positions 3 and 3⬘. Although it is difficult at
present to speculate upon the role of ntdB and ntdC gene
3891
Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
FIG. 6. Effect of rpoB mutations on the ␴A-dependent pro-
moter activity. A, Western blot analysis of the RNAP component.
TI150 (wild type; WT) and TI150R5 (rpoB5) were grown in S7N medium
until A650 ⫽ 0.5 (midexponential phase). Each His6-tagged RNAP ho-
loenzyme was isolated and quantified by antibodies for core RNAP or
␴A. B, effect of rpoB mutations on the promoter activity of ntdABC.
Strains TI127 (rpoB⫹ ntdR::neo), TI127R5 (rpoB5 ntdR::neo), TI127R2
(rpoB2 ntdR::neo), TI127R6 (rpoB6 ntdR::neo), and TI127R32 (rpoB32
ntdR::neo) were grown for 10 h (early stationary phase) in S7N medium,
and ␤-galactosidase activity was measured for each of the strains. C,
effect of rpoB mutations on the promoter activity of rrnE. Strains TI149
(rpoB⫹), TI149R5 (rpoB5), TI149R2 (rpoB2), TI149R6 (rpoB6), and
TI149R32 (rpoB32) were grown in S7N until A650 ⫽ 0.5, and ␤-galac-
tosidase activity was determined. The average values for five separate
experiments are shown with their S.D. values.
products, either or both proteins might be involved in the
formation of ␣,␤-linkage of sugar moieties. Since the addition of
trehalose (␣,␣-linkage) or neotrehalose (␣,␤-linkage) at a con-
centration of 1,000 ␮g/ml did not increase the productivity of
NTD regardless of the co-existence or absence of exogenously
added NTD (data not shown), amination of sugar moieties may
proceed prior to the formation of ␣,␤-linkage. Thus, the seem-
ingly simple biosynthetic process of NTD may offer a good
system to elucidate the regulation of bacterial secondary
metabolism.
Another point of interest is that NTD acts as an autoinducer
for its own biosynthetic process. The mechanism of autoinduc-
tion has been extensively studied in several bacteria in relation
to quorum-sensing systems that are important for various
physiological processes, such as acquisition of competence,
sporulation, motility, biofilm formation, bioluminescence, and
virulence (26 –28). In Gram-positive bacteria, most of these
signaling molecules are peptides or modified peptides including
subtilin (29) and nisin (30). In the model for the autoinduction
of subtilin and nisin production, these antibiotics induce the
transcription of their own biosynthesis genes via a two-compo-
nent signal transduction system. In contrast, it is noteworthy
that NTD bound directly to the positive regulator NtdR in vitro
(Fig. 5B) and induced the transcription of NTD biosynthesis
operon in vivo (Fig. 5A). As shown in Fig. 5B, NtdR apparently
bound to the ntdABC promoter region that contains an A-T-
rich inverted repeat sequence overlapped with the ⫺10 hex-
amer of its promoter and its transcriptional start point (Fig.
4C). Although we have no experimental evidence at this stage,
it is likely that this inverted repeat structure is a regulatory
3892 Activation of B. subtilis Neotrehalosadiamine Biosynthesis
element for ntdABC transcription. In our model, the NtdR
protein dramatically stimulates the ntdABC transcription
when its promoter region is occupied by NTD-bound NtdR
protein. In line with this notion, NTD-unbound NtdR protein
results in a failure to express ntdABC. For further understand-
ing the function of this intriguing protein, elucidation of the
ternary structure by x-ray analysis may be helpful.
One of the most important regulations for gene expression
(including that for antibiotic production) in bacteria is strin-
gent control that enables cells to adapt to nutrient-limiting
conditions (31). The effector molecule (called bacterial alar-
mone) of the stringent control is a hyperphosphorylated
guanosine nucleotide, ppGpp, which binds to the ␤ and ␤⬘
subunits of core RNAP. Alarmone takes part in the global
control of gene expression in bacteria (32, 33). In E. coli, it was
shown that certain Rif r mutants behave like “stringent”
RNAPs even in the absence of the stringent response (7). Sim-
ilarly, in S. coelicolor A3(2) and S. lividans, alteration at His-
437 (corresponding to His-482 in B. subtilis) to Arg or Tyr can
suppress the deficiency of antibiotic production resulting from
the lack of ppGpp due to relA or relC mutation (9 –11). These
results suggest that the mutant RNAPs functionally mimic
“stringent” RNAP, leading to the activation of a stringent re-
sponse-dependent antibiotic biosynthesis pathway (10, 11). Al-
though rpoB5 mutation also effectively activated NTD produc-
tion, the activation mechanism for NTD production in B.
subtilis appears quite different from that in Streptomyces spp.
in the following ways. (i) Unlike the case for NTD production,
rpoB5 mutation did not enhance the bacilysin biosynthesis
pathway (see “Results”), which is controlled in the stringent
response-dependent manner (15); (ii) the rpoB mutations alter-
ing His-437 to Arg or Tyr (corresponding to rpoB2 or rpoB6 in
B. subtilis) effectively activated antibiotic production in S. livi-
dans (9), whereas these mutations were ineffective in B. sub-
tilis NTD production (Table I); (iii) unlike bacilysin production,
NTD production was not enhanced by provoking the stringent
response upon amino acid shift-down (data not shown). It is
also notable that, unlike the case of Streptomyces spp. (9, 11),
any Rif r rpoB mutations (including rpoB5) we tested so far
were ineffective to suppress the ppGpp-deficient phenotype on
bacilysin production.2 Thus, we propose that activation of NTD
production by rpoB5 mutation emerges from events independ-
ent of the stringent response, by which bacterial secondary
metabolism is often controlled. This suggestion is supported by
the fact that rpoB5 mutation caused an increase in the pro-
moter activity of stable RNA genes as exemplified for rrnE (Fig.
6B), the expression of which is normally reduced by stringent
response. It is conceivable that the RNAP of B. subtilis rpoB5
mutant acquired a superior ability (apparently by alteration of
its ternary structure) to efficiently transcribe ␴A-dependent
promoters. For a precise understanding of the mechanism of
gene activation by rpoB5 mutation, it may be useful to per-
form comparative studies between B. subtilis and B. pumilus
(or B. circulans) that are capable of producing NTD (12, 13).
How to activate dormant antibiotic biosynthetic gene cluster
2 3
J. Yasuda, T. Inaoka, and K. Ochi, unpublished results.
is of current interest not only in basic microbiology but also in
industrial microbiology. This is because it provides a powerful
tool for the screening of novel compounds and for strain im-
provement to overproduce useful compounds. Recently, rpoB
mutations (including S487L mutation corresponding to rpoB5)
have been demonstrated to be effective for overproduction of
extracellular enzymes such as amylase and protease by several
Bacillus species.3 The present study, together with our previ-
ous works (8, 9), may be helpful in constructing the strategies
applicable to industrial microbiology.
Acknowledgments—We thank Shin-ichi Eto, Jun-ichi Yasuda, and
Chie Kobayashi for performing several experiments, Fujio Kawamura
(Rikkyo University, Tokyo, Japan) for providing the antibodies and
strain 1285EN1, and Masaya Fujita (Harvard University) for providing
strain MF1.
REFERENCES
1. Wehrli, W., Knusel, F., Schmid, K., and Staehelin, M. (1968) Proc. Natl. Acad.
Sci. U. S. A. 61, 667– 673
2. Campbell, E. A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb,
Downloaded from www.jbc.org at MAHIDOL UNIV, FAC SCIENCE on April 10, 2008
A., and Darst, S. A. (2001) Cell 104, 901–912
3. Ezekiel, D. H., and Hutchins, J. E. (1968) Nature 220, 276 –277
4. Wehrli, W., Knusel, F., and Staehelin, M. (1968) Biochem. Biophys. Res.
Commun. 32, 284 –288
5. Ingham, C. J., and Furneaux, P. A. (2000) Microbiology 146, 3041–3049
6. Nicholson, W. L., and Maughan, H. (2002) J. Bacteriol. 184, 4936 – 4940
7. Zhou, Y. N., and Jin, D. J. (1998) Proc. Natl. Acad. Sci. U. S. A. 95, 2908 –2913
8. Hu, H., and Ochi, K. (2001) Appl. Environ. Microbiol. 67, 1885–1892
9. Hu, H., Zhang, Q., and Ochi, K. (2002) J. Bacteriol. 184, 3984 –3991
10. Lai, C., Xu, J., Tozawa, Y., Okamoto-Hosoya, Y., Yao, X., and Ochi, K. (2002)
Microbiology 148, 3365–3373
11. Xu, J., Tozawa, Y., Lai, C., Hayashi, H., and Ochi, K. (2002) Mol. Genet.
Genomics 268, 179 –189
12. Tsuno, T., Ikeda, C., Numata, K., Tomita, K., Konishi, M., and Kawaguchi, H.
(1986) J. Antibiot. (Tokyo) 39, 1001–1003
13. Numata, K., Satoh, F., Hatori, M., Miyaki, T., and Kawaguchi, H. (1986) J.
Antibiot. (Tokyo) 39, 1346 –1348
14. Ochi, K., and Ohsawa, S. (1984) J. Gen. Microbiol. 130, 2473–2482
15. Inaoka, T., Takahashi, K., Ohnishi-Kameyama, M., Yoshida, M., and Ochi, K.
(2003) J. Biol. Chem. 278, 2169 –2176
16. Fukuchi, K., Kasahara, Y., Asai, K., Kobayashi, K., Moriya, S., and Oga-
sawara, N. (2000) Microbiology 146, 1573–1583
17. Ohashi, Y., Ohshima, H., Tsuge, K., and Itaya, M. (2003) FEMS Microbiol.
Lett. 221, 125–130
18. Moriya, S., Tsujikawa, E., Hassan, A. K., Asai, K., Kodama, T., and Oga-
sawara, N. (1998) Mol. Microbiol. 29, 179 –187
19. Itaya, M., Kondo, K., and Tanaka, T. (1989) Nucleic Acids Res. 17, 4410
20. Gruss, A., and Ehrlich, S. D. (1989) Microbiol. Rev. 53, 231–241
21. Steinmetz, M., and Richter, R. (1994) J. Bacteriol. 176, 1761–1763
22. Inaoka, T., and Ochi, K. (2002) J. Bacteriol. 184, 3923–3930
23. Fujita, M., and Sadaie, Y. (1998) Gene (Amst.) 221, 185–190
24. Pfeifer, B. A., Admiraal, S. J., Gramajo, H., Cane, D. E., and Khosla, C. (2001)
Science 291, 1790 –1792
25. Bandow, J. E., Brotz, H., and Hecker, M. (2002) J. Bacteriol. 184, 459 – 467
26. Kaiser, D., and Losick, R. (1993) Cell 73, 873– 885
27. Kleerebezem, M., and Quadri, L. E. (2001) Peptides 22, 1579 –1596
28. Fuqua, C., Parsek, M. R., and Greenberg, E. P. (2001) Annu. Rev. Genet. 35,
439 – 468
29. Stein, T., Borchert, S., Kiesau, P., Heinzmann, S., Kloss, S., Klein, C., Helfrich,
M., and Entian, K. D. (2002) Mol. Microbiol. 44, 403– 416
30. Kuipers, O. P., Beerthuyzen, M. M., de Ruyter, P. G., Luesink, E. J., and de
Vos, W. M. (1995) J. Biol. Chem. 270, 27299 –27304
31. Cashel, M., Gentry, D. R., Hernandez, V. J., and Vinella, D. (1996) in Esche-
richia coli and Salmonella: Cellular and Molecular Biology (Neidhardt,
F. C., Curtiss, R., III, Ingraham, J. L., Lin, E. C. C., Low, K. B., Magasanik,
B., Reznikoff, W. S., Riley, M., Schaechter, M., and Umbarger, E., eds) Vol.
1, 2nd Ed., pp. 1458 –1496, American Society for Microbiology Press, Wash-
ington, D. C.
32. Chang, D. E., Smalley, D. J., and Conway, T. (2002) Mol. Microbiol. 45,
289 –306
33. Eymann, C., Homuth, G., Scharf, C., and Hecker, M. (2002) J. Bacteriol. 184,
2500 –2520
S. T. Jørgensen, personal communication.