American Journal of Hematology 65:8789 (2000)

LETTERS AND
CORRESPONDENCE
Letters and correspondence submitted for possible publication must
be identified as such. Text length must not exceed 500 words and
five bibliographic references. A single concise figure or table may be
included if it is essential to support the communication. Letters not
typed double-spaced will not be considered for publication. Letters not
meeting these specifications will not be returned to authors. Letters to
the Editor are utilized to communicate a single novel observation or
finding. Correspondence is to be used to supplement or constructively
comment on the contents of a publication in the journal and cannot
exceed the restrictions for Letters to the Editor. The Editor reserves
the right to shorten text, delete objectional comments, and make
other changes to comply with the style of the journal. Permission for
publication must be appended as a postscript. Submissions must be
sent to Paul Chervenick, M.D., Editor of Brief Reports/Letters to
Editors, American Journal of Hematology, H. Lee Moffitt Cancer
Center, University of South Florida, 12902 Magnolia Drive, Tampa,
FL 33612 to permit rapid consideration for publication.

Repeated Efficacy of all-trans-Retinoic Acid in an Acute

Promyelocytic Leukemia Patient
To the Editor: Differentiation therapy with all-trans-retinoic acid (ATRA)
has marked a major advance and is now the first in the treatment of acute
promyelocytic leukemia (APL). However, patients who relapse after
ATRA-induced complete remission (CR) have difficulty in obtaining a
second CR with a second course of ATRA therapy alone [1]. We report a
patient diagnosed with relapsed APL who succeeded in achieving ATRAinduced CR four times.
A 56-year-old man was diagnosed with APL with chromosomal abnormality t(15;17)(q22;q11) in May of 1995. He had typical APL cells with
many Auer bodies and faggot cells and was complicated with disseminated
intravascular coagulation (DIC). He received 70 mg/day (45 mg/m2/day) of
oral ATRA and 40 mg of daunorubicin (DNR) for 2 days on treatment days
12 and 13, when the white blood cell (WBC) count was elevated to 30
109/l. He achieved CR on treatment day 39, when the chromosomal abnormality had disappeared. He received consolidation chemotherapies
[DNR, enocitabine (BHAC), 6-mercaptopurine (6MP), and prednisolone]
twice, but after that he arbitrarily discontinued intensification therapy.
In December of 1996, he relapsed. He received oral ATRA (80 mg/day)
and achieved CR again on treatment day without 40 using DNR. He received consolidation therapy consisting of DNR, BHAC, and 6MP followed by high-dose Ara-C. He subsequently received high-dose chemotherapy (Ara-C, busulfan, and etoposide) with autologous peripheral blood
stem cell support.
In May of 1998, he relapsed again with the same chromosomal abnormality t(15;17)(q22;q11). He received oral ATRA (80 mg/day) and 300 g
of intravenous G-CSF (treatment days 215 and 3042) and 40 mg of DNR
for 4 days (treatment days 5, 6, 13, and 14), when the WBC count was
elevated to 15 109/l [2]. He again achieved CR on treatment day 59. He

2000 Wiley-Liss, Inc.

Fig. 1. Clinical course of the patient. Horizontal bars at

upper column indicate chemotherapies.

received consolidation chemotherapy (ICE; Ara-C, idarubicin, etoposide)

and subsequent intensification chemotherapy with an alternating regimen
of ICE and middle-dose Ara-C with mitoxantrone.
In November of 1999, a bone marrow study showed 46% atypical APL
cells with rare Auer bodies and azurophilic granules. No additional chromosomal abnormality was found besides t(15;17)(q22;q11). Spinal tap
revealed central nervous system invasion by APL cells. He was treated
with oral ATRA (80 mg/day) and intrathecal administration of methotrexate. He achieved a fourth CR on treatment day 61.
In general, APL patients who have relapsed from ATRA-induced CR
rarely achieve a second CR with ATRA therapy alone [1]. However, our
present patient achieved ATRA-induced CR four times. To our knowledge,
there is no previous report of such a patient. The mechanisms of resistance
to second ATRA therapy have been studied in many laboratories [3] but are
not yet fully understood. The reason for the repeated efficacy of ATRA in
our present case is unclear, but the duration of ATRA treatment necessary
to achieve CR became longer with each repetition of the therapy.

AYAKO WATANABE
KOITI INOKUCHI
TAROH MIZUKI
HIROKI YAMAGUCHI
NORIO YOKOSE
KAZUO DAN
Division of Hematology, Department of Internal Medicine, Nippon
Medical School, Tokyo, Japan

REFERENCES
1. Castaigne S, Chomienne C, Daniel MT, et al. all-trans-Retinoic acid as a differentiation therapy for acute promyelocytic leukemias. I. Clinical results. Blood
1990;76:1704.
2. Nakajima K, Hatake K, Miyata T, et al. Acute promyelocytic leukemia, tretinoin,
and granulocyte colony-stimulating factor. Lancet 1994;343:173174.
3. Degos L, Dombret H, Chomienne C, et al. all-trans-Retinoic acid as a differen-

88

Letters and Correspondence

tiating agent in the treatment of acute promyelocytic leukemia. Blood 1995;85:

26432653.

frequency of FV4070G carriers is about one-fourth of the patients with

FV1691A.
We conclude that the 4070G allele of the factor V gene is frequently
coinherited in symptomatic FV1691A carriers. Thus a careful search for
the 4070G allele should be included in thrombophilia screening programs
in FV1691A carriers, particularly in populations with high frequencies of
this mutation.

Coexistence of Factor V 1691 GA and Factor V 4070 AG

Mutation in Turkish Thromboembolic Patients
To the Editor: A mutation in the factor V gene (1691 GA) was identified
that formed the molecular explanation for the phenotype of APC-resistance
in the majority of effected individuals. This mutation, which is associated
with a significant increase in thrombotic risk, has been found in 3050% of
selected families with thrombophilia and in almost 20% of consecutive
patients with venous thrombosis [1].
A4070G (FV1299 His-Arg) polymorphism in exon 13 of the factor V
gene (HR2 haplotype) was shown to influence circulating FV levels and
contribute to the activated protein C (APC) resistance phenotype [24].
Although previous reports on the effect of A4070G on the occurrence of
deep vein thrombosis were controverisal [5,6] double heterozygosity for
FV1691A and FV4070G conferred a 34-fold increase in the relative risk
of venous thromboembolism compared with FVR506Q alone [7].
We recently reported the frequency of FV1299G allele as 8.5% and
FV1691A allele as 9.8% in Turkish population [6,8]. As both mutations is
common in the Turkish population, we aimed to study the relative risk of
the coexistence of these mutations in Turkish thromboembolic patients.
One hundred fourty-four healthy unrelated individuals from Ankara
without any familial history of thrombosis and stroke were included in the
study. One hundred twenty-nine patients with the diagnosis of thromboembolism were included. DNA was extracted by conventional methods,
and polymerase chain reaction of exon 13 of the factor V gene was performed according to previously described method using primers
5CAAGTCCTTCCCCACAGATATA3 and 5AGATCTGCAAAGAGGGGCAT3. Amplication was performed for 35 cycles with
annealing temperature of 57C (Ericomp, USA). Amplified DNA was digested with RsaI enzyme (Promega, Madison WI) and 37C and subjected
to 2% agarose gel electrophoresis [6]. FV1691 GA and PT20210 GA
mutations were performed according to previously described methods
[8,9].
The results of the FV mutations in healthy individuals and patients with
thromboembolism are shown in Table I. Three of these six patients carried
an additional prothrombotic factor. FV4070G mutation did not have any
effect on thromboembolism with an odds ratio of 1.2 (CI 95%, 0.562.56).
On the other hand, it was 1.93 (CI 95%, 0.13.8) for FV1691A. When both
mutations taken together, it was 6.7 (CI 95%, 0.8254.6).
Of the symptomatic 26 FV1691A carriers, 6 had the FV4070G mutation
(23.0%). It is interesting that of these 6 patients, two patients carried the
prothrombin 20210A mutation and one patient had protein C deficiency at
the same time. Two of the PT20210A carriers had mesenteric artery thrombosis. The protein C-deficient patient was a four-year-old female child with
the diagnosis of cerebral thrombosis. The other three had clinical presentation of cerebral infarct, vascular graft thrombosis, and Budd-Chiari Syndrome.
Our data revealed once more that carrying FV1691A is a risk factor for
thromboembolism but FV4070G is not [6,8]. It is worth noting that the

NEJAT AKAR
ECE AKAR
ERKAN YILMAZ
Pediatric Molecular Genetic Department of Ankara University,
Ankara, Turkey

REFERENCES
1. Bertina RM, Reitsma RH, Rosendaal FR, Vanderbroucke JP. Resistance to activated protein C and factor V Leiden as risk factor for venous thrombosis. Thromb
Haemost 1995;74:449453.
2. Bernardi F, Faioni EM, Castoldi E, Lunghi B, Castaman G, Sacchi E, Manucci
PM. A factor V genetic component differing from factor V R506Q contributes to
the activated protein C resistance phenotype. Blood 1997;90:15521557.
3. Castaman G, Lunghi B, Missiaghia E, Bernardi F, Rodeghiero F. Phenotypic
homozygous activated protein C resistance associated with compound heterozygosity for Arg 506 Gln and His 1299 Arg substitutions in factor V. Br J Haematol
1997;99:257261.
4. Lunghi B, Iacoviello L, Gemmati D, di Iasio MG, Castoldi E, Pinotti M, Castaman
G, Redaelli R, Mariani G, Marchetti G, Bernardi F. Detection of new polymorphic
markers in the factor V gene: association with factor V levels in plasma Thromb
Haemost 1996;75:4548.
5. Alhenc-Gelas M, Nicaud V, Gandrille S, van Dreden P, Amiral J, Aubry ML,
Fiessinger JN, Emmerich J, Aiach M. The factor V gene A4070G mutation and the
risk of venous thrombosis. Thromb Haemost 1999;81(2):193197.
6. Akar N, Akar E, Ylmaz E. Factor V (His 1299 Arg) in Turkish patients with
venous thromboembolism. Am J Hematol 2000;63(2):102103.
7. Faioni EM, Franchi F, Bucciarelli P, Margaglione M, De Stefano V, Castaman G,
Finazzi G, Mannucci PM. Coinheritance of the HR2 haplotype in the factor V gene
confers an increased risk of venous thromboembolism to carriers of factor V
R506Q. Blood 1999;94(9):30623066.
murlu K, Cin S. Frequency of factor V
8. Akar N, Akar E, Dalgn G, Sozuoz A, O
(1691 GA) mutation in Turkish Population. Thromb Haemost 1997;78:1527
1528.
9. Akar N, Msrloglu M, Akar E, Avcu F, Yalcn A, Sozuoz A. Prothrombin gene
20210 GA mutation in the Turkish Population. Am J Hematol 1998;58:249.

Spontaneous Regression of Chronic Lymphocytic

Leukemia and Simultaneous Development of Autoimmune
Hemolytic Anemia and Autoimmune Thrombocytopenia
To the Editor: Spontaneous remission of chronic lymphocytic leukemia
(CLL) is extremely rare, although chemotherapy with alkylating agents,
purine analogues, and corticosteroids often induces temporary remission.
We describe the case of a 77-year-old man who developed spontaneous
regression of CLL without any treatment. Simultaneously, he developed
autoimmune hemolytic anemia (AIHA) and autoimmune thrombocytope-

TABLE I. Distribution of FV1691A and FV4070G Mutations in Turkish Population

Normal controls
Thromboembolic patients
a

FV1691A

(%)

FV1691A
frequency

FV4070G

(%)

FV4070G
frequency

Both
mutations

(%)

144
129

15
26(2)a

10.4
20.1

0.052
0.1085

14
15

9.7
11.6

0.048
0.058

1
6

0.7
4.6

Two patients were homozygous FV1691A.

Letters and Correspondence

nia (AIT). Patient was asymptomatic when initially seen. There was no
lymphadenopathy or hepatosplenomegaly. WBC was 35,000/l with 80%
lymphocytes, absolute lymphocyte count 28,480/l, Hgb 14.2 g/dl, Hct
41%, and platelets 212,000/l. Bone marrow lymphocyte was >50%, and
immunophenotype of the bone marrow cells was CD20+, CD19+, CD5+,
B-cell. He was diagnosed with CLL, stage 0. He did not receive any
chemotherapy for CLL. During 3 years of follow-up, WBC and lymphocyte counts declined gradually while anemia and thrombocytopenia developed. After 3 years, WBC was 3,000/l with 47% lymphocytes (absolute
lymphocyte count 1,410/l), 33% neutrophils, 17% monocytes, 2% eosinophils, and 1% basophils. Hgb was 8.3 g/dl, Hct 23.5%, platelets
74,000/l, MCV 105.5 fl, MCH 37.5 pg. Reticulocyte was 3.68%. Peripheral blood smear showed large platelets, spherocytes, polychromatophilic
cells, hypogranular neutrophils, and a few small lymphocytes.
Bone marrow aspiration and biopsy showed hypocellularity (15%), i.e.,
decreased numbers of erythroid progenitor cells, myeloid precursor cells,
and megakaryocytes. Residual foci of lymphocytes revealed CD19+/
CD5+, B-cell. Cytogenetic examination was not done. Serum B12 and folic
acid were normal. Blood chemistry and urinalysis were normal. Blood type
was O, Rh+. The patient developed shortness of breath and further anemia.
Type and cross-match of red blood cells revealed IgG warm antibodies.
Both direct and indirect Coombs tests were positive. He received the
most compatible 2 units of available type-specific blood with prednisone
(1 mg/kg/day). He responded to prednisone. His Hgb rose to 12.9/dl, Hct
to 38%, and platelets to 235,000/l. WBC also increased to 14.400/l with
74% lymphocytes (absolute lymphocyte count 10,700/l), 18% neutrophils, and 6% monocytes.
Regression of CLL with development of AIHA and AIT has never
reported in English written literature.
CLL is not only a malignant disease but also a complex immunologic
disease. The paradoxical findings of immune deficiency and autoimmune
phenomena have been hallmarks of CLL. Autoimmune-associated phenomena are frequently observed in CLL. These autotoxic manifestations
are mainly directed against hematopoietic cells [1]. Spontaneous regression
of CLL is an extremely rare event [24]. The mechanism is poorly understood. The remission-associated event was infection, mainly viral, vaccination, and epithelial neoplasms before spontaneous remission was docu-

89

mented [2]. These suggest that spontaneous remission in CLL is the result
of an altered hosttumor relationship that seems to play a major role in
disease regression.
The potential role of T-cell defects in inducing autoimmune complications in B-cell CLL has been stressed by increased frequency of AIHA in
patients treated with purine nucleoside analogues like fludarabine and
2-chlorodeoxyadenosine [5]. These drugs induce severe depletion of the
CD4 cell subset and, to a lesser extent, the CD8 subset.
In this case regression was not related to chemotherapy, infection, or
other neoplasm. The mechanism for the remission in the current case is
unknown. It is hypothesized that spontaneous remission of CLL was the
result of an altered hosttumor relationship. In the absence of chemotherapy in this patient, lymphocyte production may have been under the
control of a readjusted hematopoietic mechanism. CLL in bone marrow
evidently altered stroma function and induced stromal abnormalities that
selectively suppressed lymphocyte production and induced AIHA and AIT.
Prednisone altered this autoimmune phenomenon. CLL reappeared with
improvement of AIHA and AIT.

TAKESHI WAJIMA
Texas A&M University Health Science Center, College of Medicine and
Central Texas Veterans Health Care System, Temple, Texas

REFERENCES
1. Prisch O, Malourna K, Dighiero G. Basic biology of autoimmune phenomena in
chronic lymphocytic leukemia. Semin Oncol 1998;25:34.
2. Ribera JM, Vinolas N, Urbano-Ispizua A, Montserrat E, Rozman C. Spontaneous
complete remissions in chronic lymphocytic leukemia: report of three cases and
review of the literature. Blood Cells 1987;12:471483.
3. Holmes JA, Whittaker JA. Spontaneous remission in chronic lymphocytic leukemia. Brit J Haematol 1988;69:9798.
4. Denes AE, Shalhav AL, Kovacs G, Ralph V. Chronic lymphocytic leukemia
remission following extra corporeal shock wave lithotripsy for urinary calculi. Am
J Hematol 1998;58:239240.
5. Myrnt H, Copplestone JA, Orchard J, Graig V, Curtis D, Prentice AG, Hamon
MD, Oscier DG, Hamblin J. Fludarabinrelated autoimmune haemolytic anaemia
in patients with chronic lymphocytic leukemia. Br J Haematol 1995;91:341.