L10!

5!
3!
!

A!

A*! 3!
5!
!

Replication of the region the top DNA strand labeled

A would involve:!
a)
!Discontinuous synthesis of the lagging strand!
b)
!Discontinuous synthesis of the leading strand!
c)
!Continuous synthesis of the lagging strand!
d)
!Continuous synthesis of the leading strand!
!

Replisome structure and

accessory proteins are
highly conserved, from
virus to eukaryotes!
Origin 5 ..GATCCA.3!
Direction of DNA polymerase III movement on this strand
fragment (right or left) ? Complementary making and moving.!
What is the sequence of the leading template strand ?!
Complementary base pairs!
What is the sequence of the corresponding Okazaki fragment ?!
Complementary strand directions!

RNA is similar to DNA, but,

1. RNA is usually single stranded,
2. The strand backbone is composed
of a ribose sugar, (2OH),
not deoxyribose sugars
3. RNA contains the pyrimidine base
URACIL instead of thymine.
4.RNA can catalyze biological
reactions

RNA has a
sugar-phosphate backbone
(phosphodiester bonds).
The ribose has a OH on
the 2 carbon.
RNA is single stranded.
RNA is has 5 to 3
polarity like DNA.

There are two grades and 6+ classes of RNA: pp 287

5!

(1)
Gene information-coding
genes (a) Messenger (mRNA) is the protein encoding transcript of
a gene ( 1% of RNA in humans)
(2)
Functional RNA- may have catalytic properties
genes ? (b) Ribosomal RNA rRNA is part of the translation
complex.
genes ? (c) Transfer RNA tRNA participates in translation. It
carries specific amino acids to be incorporated into the new protein.
genes? (d) Small nuclear RNAs (sn RNAs) - spliceosome, rRNA
assembly specific to eukaryotes.
genes? (e) Micro RNAs - short 20-25 nucleotide bases, single
stranded RNAs that may be involved in gene expression or may
block the translation of mRNA.
(f) Small interfering RNAs (siRNA) exogenous double stranded RNA
19-25 bases
genes ? (g) Long noncoding RNA (lncRNA) - transcriptional control
(XIST) and epigenetic regulation (200 + bases).

RNA has (1) sugar-phosphate backbone

(2) 4 nucleotides (A U, C, G)
(3) directionality
It is synthesized from the 5 end to the 3 end.

But, it is single stranded and has uracil instead of thyamine

Convention - DNA is always drawn with the upper strand
represented in the 5 to 3 direction, mRNA same .

DNA is double stranded.

5-GCACTACGCATCGATCGACTAGCTAGCATC-3
3-CGTGATGCTTAGCTAGCTGATCGATGCTAG-5

The standard representation is the non template or

coding strand :
GCACTACGCATCGATCGACTAGCTAGCATC
Assume the sequence represents double stranded DNA
with the upper strand shown, in the 5 to 3 direction,
(unless text describes it otherwise).

mRNA is transcribed from DNA 5- 3 in the coding strand order

DNA
RNA

-The RNA product has the same sequence as the upper, coding
strand of DNA, except in has Us in place of Ts, BUT
The lower strand of DNA is the physical template for RNA synthesis.

RNA is drawn in the 5 (left) to 3 (right) direction.

8

VARIATION IN NOMENCLATURE!

The 8th edition refers to the coding and template strands.

The 9th & 10th edition (white& black books ) refers to template and
non- template strands, which is called the coding strand (pp 289).

There is not always consistency between books or people

, be careful, check sequence and direction
Elsewhere you may see:
Template strand = sometimes coding strand, nonsense strand,
antisense strand
Non template strand =coding, non coding strand, sense strand

Gene function - TRANSCRIPTION

Gene transcription the primary transcript or pre
mRNA is synthesized or transcribed from the DNA
template 5 - 3 and may then be modified into the
message (mRNA)
transcription translation
DNA
mRNA
Protein (central dogma)

But we already know of 1 exception .!

10

11

There are 3 stages of transcription:

Initiation, Elongation, Termination

12!

Initiation - Bacterial transcription is initiated (1) at a

promoter sequence (2) when a RNA polymerase holoenzyme
binds to it.!
!
A Promoter is a (small) region of (consensus) sequence
elements of DNA, which are necessary to initiate
transcription.!
!
Conserved sequence- if several nucleotide sequences (among
species) align perfectly or close to it, - effectively the same
nucleotide sequence.!
!
Consensus sequence- if several sequences align but not so
perfectly- there is some variation among sequences, but a
significant percentage of nucleotides co-occur at a high
frequency.!
!

Promoter sequences and the consensus sequence (promoters or

promoter elements) are on the 5side (upstream) of of the
transcription start site (1+) coding strand

13

Prokaryote Initiation

14

RNA polymerase is a multimeric protein complex .

Holoenzyme
(complete
enzyme)

E. coli RNA polymerase.

core enzyme

One of!
many!

~10 bases!

-assembly of core enzyme, interactions with regulatory proteins

- catalysis -ribonucleoside triphosphate binding site
- binds to DNA template, helicase activity
- core enzyme assembly, regulation of gene expression
- binding core enzyme to the promoter(position holoenzyme -10,-35),
strand separation,

15
one of many!

5 UTR
(untranslated
region)

Eukaryotic Initiation!

Eukaryotic DNA is more complicated than Prokaryotic

16

(1) Many more genes,

(2)more DNA and
(3)there is more intervening (non message-coding) DNA in eukaryotes,
thus the gene density is lower in eukaryotes:1/1400 bp in E. coli
1 gene /9000 bp in Drosophila,
1 gene / 100,000 bp in humans
(4) chromatin structure plays a key role in gene transcription.
(5) more complicated cellular structure, different tissues etc
THUS , it is not surprising that RNA polymerases are more
complicated in eukaryotes, requiring more polymerases, a more
complex promoter, accessory and regulatory proteins (transcription
factors)

In eukaryotic organisms:
-RNA polymerase I transcribes rRNA
in the nucleolus, except for the small
5S rRNA (large fraction of
transcription).
-RNA pol II transcribes all protein
coding genes, some snRNAs, in the
nucleus, Lnc RNA.
-RNA pol III transcribes small
functional RNA genes such as those
in the spliceosome, 5S rRNA, transfer
RNA (tRNA), sn RNAs not made by
RNA pol II in the nucleus
17

Eukaryotic Initiation

19

(1) Core promoter Eukaryotic genes have a TATA (TATAAAA) box is

about -30 region and an initiator site which spans 1+, specifying
where the transcription polymerase assembles and begins Other
promoter sites: -40 and -120 (GC), -80 (CAAT), -120 (Octamer)
(2) (a) There are many additional cis - regulatory sequences (activators
100s bp + upstream only, enhancers ~ 1000 bp +, up and downstream)
(b) trans acting General Transcription Factors (GTFs), and
(c) in vertebrates, particularly mammals, the absence of histone
methylation (nucleosomes) near the promoter allows expression.

(1) Expression starts with

unwinding DNA, starting with
the nucleosome, although it is in
an extended form in G1, early G2!

Extended form, local unwinding

of nucleosomes!
18!
Figure 4-57 Molecular Biology of the Cell ( Garland Science 2008)

(1) Remove methyl tags and unwind nucleosomes

(2) TranscriptionBindingProtein at the TATA box - attracts other
GTFs (TBP is part of 1, of several GeneralTranscriptionFactors)
+ RNA polymerase II core, forming the pre-initiation complex
(3) Interaction of (upstream) cis-enhancer sequences
(4) Transcription Initiation
(5) Dissociation of GTP and Elongation

TBP

Nucleosome wound, promoter methylated!

20

Transcription initiation in eukaryotes

21

Transcription initiation in eukaryotes

22

TBP is part of TFII D protein (and several TBP associated factors)

TFIID is one of several GTFs -general transcription factors
or Transcription Factor for RNA polymerase II X (X=factor letter)

Transcription initiation in eukaryotes

TBP attracts other GTFs and then,

the RNA polymerase II core
together the preinitiation complex

23

Transcription initiation in eukaryotes

Transcription is initiated with the

phosphorlation of the Carboxyl
Tail Domain, RNA polymerase
dissociates from most of the
GTFs, but some remain at the
promoter-attracting the next core
enzyme

24

ELONGATION in General

25

The bases in RNA are added in a sequence that is complementary

to the DNA sequence
G opposite Cs
C opposite Gs
U opposite As
A opposite Ts

Eukaryotes FACT (facilitates chromatin transcription)

hetero dimer deals with histones !

RNA polymerase opens the DNA duplex, RNA is synthesized in the

5 to 3 direction from one strand of DNA and then closes it. A single
gene is only transcribed in one direction.

Only one strand is the template for 1 gene

Chromosomes have different genes in different orientations, so
different strands may be transcribed for different genes at
different locations.
26

27!

Prokaryote RNA transcription termination

28

There are transcription termination signals in the DNA, beyond the

protein coding sequence:
(1) Intrinsic - GC rich hairpin which disrupts DNA-RNA binding
(2) Rho (a helicase) binding site (rut =rho utilization site), rho
unwinds RNA&DNA facilitating RNA polymerase release.

Cotranscriptional processing of Eukaryotic RNA: capping

Carboxyl Tail Domain

The initial RNA transcript is capped with a 7-methylguanosine

triphosphate.
Unusual the linkage is 5 to 5 and the three phosphates are
maintained, unlike RNA (or DNA) synthesis catalyzed by RNA
30
polymerase.

Cotranscriptional processing of Eukaryotic RNA (2)

2. Most eukaryotic genes have

blocks of coding (exons) and non
coding (intron) DNA
The mRNA is transcribed primary
transcript (pre mRNA) with the
introns and the exons
And the introns are spliced out
before the mRNA is translated.

31

Introns are looped out and are (1)cut at specific sequences

(exon-GU consensus sequence..intron..consensus sequence AGexon), (2)removed and (3)the exons are spliced together to produce a
mature mRNA with a central coding region in red).

32

Transcriptional processing (3) Many human genes have

alternate splicing patterns several different related proteins
can be produced by one gene.

products of several loci can also be spliced into one mRNA.

33

Cotranscriptional processing of RNA

Capping
Intron removal
Splicing

Termination: when the highly

conserved sequence AAUAAA or
AUUAAA is recognized , it signals a
termination enzyme to cut the end
~20 bases downstream and add a
polyA tail (AAA)- polyadenylation
signal

34

2.

Coding RNA!

35

The mRNA is cleaved about 20 bp after a polyadenylation signal

and a poly (A) tail of about 300 nucleotides is added to the 3 end
of the mRNA.

Box 1. Key Genetic Features of Multicellular Organisms - S. B.

Caroll (2005) Evolution at 2 levels Plos Biology

Individual regulatory proteins function in many different contexts.

The expression of individual genes is multiply regulated, tissue-specific
and temporal controlled.
Many regulatory proteins are members of large families and can overlap
in function..
Multiple protein forms may be encoded by single genetic loci. Alternative
protein forms (isoforms) may function in different contexts and/or
possess different activities.