Vous êtes sur la page 1sur 11

:

Structure and regulation of the SSA4


HSP70 gene of Saccharomyces cerevisiae.
W R Boorstein and E A Craig
J. Biol. Chem. 1990, 265:18912-18921.

Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
When this article is cited
When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 0 references, 0 of which can be accessed free at
http://www.jbc.org/content/265/31/18912.full.html#ref-list-1

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

Access the most updated version of this article at http://www.jbc.org/content/265/31/18912

THE JOURNAL OF BIOLOGXAL CHEMKWRY


0 1990 by The American Society for Biochemistry

Structure

of the SSA4 HSP70

and Regulation

Saccharomyces

Vol. 26.5, No. 31, Issue of November 5, pp. 18912-18921, 1990


Printed in Cl S. A.

and Molecular Biology, Inc.

Gene of

cerevisiae*
(Received for publication,

William

R. BoorsteinS

From the $Molecular


Madison,
Wisconsin

and Elizabeth

and Cellular
53706

Biology

Program

A. CraigSV
and the ?lDepartment

Cells exposed to a variety of environmental


stresses, including elevated temperature,
respond by rapidly synthesizing
a small set of evolutionarily
conserved proteins, known as the
heat-shock
proteins (HSPs). This heat-shock
or stress response is a universal
biological
phenomenon
(reviewed
in
* This work was funded by United States Public Health Service
grants from the National Institutes of Health (to E. A. C.). The costs
of publication of this article were defrayed in part by the payment of
page charges. This article must therefore be hereby marked aduertisement
in accordance with 18 U.S.C. Section 1734 solely to indicate
this fact.
reported
in this paper has been submitted
Data
Bank
with
accession
number(s)

Supported by a United States Public Health Service training


grant in molecular and cellular biology. Present address: Howard
Hughes Medical Institute, Division of Biology 156-29, California
Institute of Technology, Pasadena, CA 91125.
The abbreviations used are: HSP, heat-shock protein; hsp70, 70kDa heat-shock protein; HSE, heat-shock element; HSF, heat-shock
transcription factor; UAS, upstream activation sequence; ORF, open
reading frame; bp, base pair; kb, kilobase pair; ATF, activating
transcription factor.

of Physiological

Chemistry,

University

of Wisconsin,

Craig, 1985). Stress induction


of HSPs is regulated primarily
at the level of transcription.
The mechanism by which heatshock genes are activated has also been highly conserved
(reviewed in Bienz and Pelham, 1987). Identification
of related heat-shock elements (HSEs) in many eukaryotic species,
including yeast, plants, and mammals, has led to the derivation of the HSE consensus sequence, CNNGAANNTTCNNG, where N is any nucleotide
(Pelham, 1985). Recently,
the definition
of HSEs in Drosophila
has been revised, based
on the effects of site-directed
mutations
(Amin et al., 1988;
Xiao and Lis, 1988). Functionally
defined Drosophila
HSEs
can be viewed as modular, consisting of at least three repeats
of the sequence GAA in alternating
orientation
and separated
from each other by two nucleotides. HSEs are specific binding
sites for the heat-shock transcription
factor, HSF (Top01 et
al., 1985; Perisic et al., 1989; Wiederrecht
et al., 1987; Wu et
al., 1987). Transcriptional
activation
of heat-shock genes occurs by a posttranslational
mechanism
believed to involve
phosphorylation
of HSF (Sorger et al., 1987; Sorger and
Pelham, 1988; Zimarino and Wu, 1987). Studies of Drosophila
suggest that HSF/HSE-mediated
control acts at an early step
in transcriptional
elongation
(Rougvie and Lis, 1988).
The 70-kDa heat-shock proteins
(hsp70s) are among the
most highly conserved of all proteins. Species as distantly
related as archeobacter
and human contain related genes
(Craig, 1985). In S. cereuisiae, a large multigene
family encodes eight hsp7Os that are both expressed and localized
differentially
within the cell. These HSP70 genes have been
divided into four subfamilies
based on conservation
at the
amino acid level (reviewed in Lindquist
and Craig, 1988).*
Genetic analyses suggest that members of the subfamilies are
functionally
related as well (reviewed in Craig, 1989). SSA4,
the subject of this study, is one of four members of the most
complex group, the SSA subfamily. While none of the individual SSA genes are required for viability, this subfamily is
essential (Werner-Washburne
et al., 1987). SSAl and SSAQ
are the only two members of the SSA subfamily
that are
expressed at detectable
levels in cells under nonstressed
growth conditions. ssalssa2 double mutants are temperaturesensitive for growth but viable at 30 C. ssalssa2ssa4 cells are
inviable, indicating
that the SSA4 gene can partially compensate for the ssalssa2 defects (Werner-Washburne
et al., 1987).
SSA4 is the only classic HSP70 gene in yeast; it is expressed
at extremely low levels under normal conditions and is rapidly
and dramatically
induced following
heat-shock
treatment.
The previously analyzed SSAl and SSA3 genes are also heatinducible;
however, they differ from SSA4 in that SSAl is
expressed at high basal levels and SSA3 is induced under
conditions of lowered intracellular
CAMP (such as starvation)
(Werner-Washburne
et al., 1989). Heat-shock
activation
of

18912

2 W. R. Boorstein and E. A. Craig, unpublished

observations.

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

SSA4 is the only one of five heat-inducible


HSP70
genes in Saccharom
yces cereuisiae
whose expression
is restricted
to conditions
of stress. Comparison
of the
nucleotide
sequences
of the SSA4
gene with
other
HSP70
genes indicates
that it diverged
from its most
closely related
yeast homologues
hundreds
of millions
of years ago. However,
a high degree of identity
has
been maintained
between
Ssa4p and other yeast 70kDa heat-shock
proteins
at the amino
acid level suggesting,
in light of its distinct
pattern
of regulation,
that it performs
an important
function.
A 44-base pair
region of the SSA4 promoter
containing
an extended
match to the conserved
eukaryotic
heat-shock
element
(HSE) is necessary
and sufficient
to mediate
heat-inducible
regulation.
HSE~S~~ is capable
of promoting
only a low level of transcription
under nonstress
conditions.
We present
evidence
in support
of a revised
definition
of the functional
HSE in S. cereuisiae,
similar to the recently
proposed
modular
Drosophila
HSE.
Elevated
expression
of several
heat-shock
proteins
in
an ssalssa2
double-mutant
strain has previously
been
reported.
The SSA4 promoter
is activated
in this
strain.
The increase
in expression
of SSA4 caused by
deletion
of these closely related
genes is mediated
via
the same upstream
activating
sequences
that activate
transcription
in response
to heat shock. Activation
of
HSE-mediated
transcription
by disruption
of constitutively
expressed
HSP70
genes supports
an autoregulatory
model of control
of the heat-shock
response.

The nucleotide
sequence(s)
to the GenBankTM/EMBL
505637.

June 4, 1990)

Structure

and Regulation

of a Yeast Heat-shock

Gene

18913

the SSAl

subsequently inserted into this SphI site. The central

activating sequences

of the SalI-recognition

MATERIALS

S. cereuisiae
Strains-DSlO
112, lysl, lys2, Atrpl,
ura3-52)

AND

METHODS

(MAT
a, hisd-11,
hk3-15,
h&3,leu2was utilized
in all experiments
pre-

sented here unless specifically noted. DS16 is isogenic to DSlO and


contains disrupted alleles of SSAl
and SSAP (ssal::HZS3
and
ssa2xLEU2)
(Craig
and Jacobsen,
1984; Werner-Washburne
et al.,
1987).
Plasmid
Constructions-An
SSA4/lacZ
translational
fusion
(Fig.
1A) was constructed in a derivative of the promoter cloning vector
pHT102
(Tu and Casadaban,
1990). The EcoRI
to Sac1 fragment
of
pHT102
was replaced
with the EcoRI
to SmaI
fragment
of the
Escherichiu
coli uric operon from pAP55 (Brusilow
et al., 1983) ligated
to the SmaI to Sac1 fragment
of pSKS105
(Casadaban
et al., 1983) to
generate
the translational
lacZ fusion vector
pWB201.
pWB201
includes
an extended
polylinker
(5-AGCATTCCCGGGGATCCGTCGACCTGCAGCCAAGCTTGGCACTGGCC-3)
immediately
upstream of lacZ, as well as uric operon sequences,
to facilitate
construction of promoter
deletions
by providing
an upstream
buffer of nonessential
vector sequences
and an XhoI site to provide
constant
vector
sequences upstream of the SSA4 deletion end points. An SphI linker
(5-pGGCATGCC-3)
was cloned into the SmaI site of the polylinker
of pWB201.
The 856-bp
pSSA4H
NlaIII
fragment
(Fig. 2B) was

four base pairs


removed
with mung
bean exonuclease to generate the correct reading frame (pWB209).
The SSAlllacZ
fusion junction
was verified
by DNA sequence
analysis. Subsequently,
an SphI linker
(5-pGGCATGCC-3)
was inserted
into the filled in BglII site at position
-594
(indicated
in Fig. 2B) to

provide

a unique restriction

nmpR

ori

CENll

FIG. 1. Plasmids
utilized
to identify
sequences
controlling
SSA4
expression.
A, pWB213,
the plasmid
containing
the SSAI/
1acZ hybrid
gene (used to construct
the 5 deletion
series plasmids).
B, the centromeric
UAS cloning
vector
pWB220,
a derivative
of
pWB213.
pWB220
and pWB213
differ
only in the region between
1acZ and ARSl
sequences.
Genes and other functional
plasmid
sequences are labeled in bold type; the location, size, and orientation
of
genes are indicated
by curved arrows. The two large unshaded
arcs in
each plasmid
represent
sequences
of pBR322
origin. Lightly
stippled
arcs represent
sequences
from the E. coli uric operon. SSA4 sequences
are represented
by solid black arcs. Restriction
enzyme
recognition
sites used in plasmid
constructions
are labeled. The entire nucleotide
sequence
of these vectors
is known
with the exception
of approximately
400 nucleotides
at each end of the CENll
sequence. RI,
EcoRI; Sa, SacI; Sp, SphI; X, XhoI.

were

site for the construction

of deletion

derivatives.
The EcoRI
site upstream
of the SSA4 sequences
was
eliminated
with mung bean exonuclease,
creating
pWB213
(Fig. 1A).
Deletion
derivatives
of the SSA4/lacZ
fusion plasmid,
pWB213,
were created
by cleavage
with SphI followed
by Bal31 exonuclease
treatment
for various
time intervals,
creation
of blunt ends, ligation
of XhoI
linkers
(5-pCCTCGAGG-3),
XhoI cleavage,
and unimolecular
reclosure,
joining
the XhoI linker
at the SSA4 deletion
end
point to a common
XhoI site present
upstream
of the deleted region.
pWB213A-594
was created by inserting
an XhoI linker into the SphI
site and recircularizing
as described
above, without
exonuclease
treatment.
The precise
position
of pWB213A-594
A-234,
and A-174
deletion
end points were determined
by DNA sequence
analysis.
The
remaining
deletion
end points were mapped to within
f3 nucleotides
by polyacrylamide
gel electrophoresis
of small restriction
fragments.
A centromeric
UAS cloning
vector,
pWB220
(Fig. lB), was constructed
by replacing
the SSA4 sequences
of pWB213
with CYCl
promoter
sequences.
Specifically,
the small XhoI to Sac1 region of
pWB213
(containing
the entire SSA4 region and the amino-terminal
portion
of the &Z-coding
region)
was replaced
with the corresponding restriction
fragment
of pLG669-Z
(Guarente
and Ptashne,
1981).
The CYCI sequences
in pWB220
extend from 178 bp upstream
of the
primary initiation site, through the amino-terminal codon. pWB220
also contains
different
linker
and 1acZ fusion
sites from those in
pWB213.
pWB227
and pWB227-R
were constructed
by inserting
a
synthetic
double-stranded
oligonucleotide
matching
the 44 bp indicated in Fig. 8A, flanked
by sequences
necessary
to generate
an XhoI
site and an XhoI
complementary
overhang,
into the XhoI site of
pWB220.
The pWB227
and pWB227-R
inserts
were verified
to be
identical with the native SSA4 sequence. All plasmid constructions
utilized
standard
methods
(Ausubel
et al., 1987).
DNA Sequence
Determination
and Analysis-Appropriate
regions
of the SSA4H
plasmid
were subcloned
into M13mp
vectors
and

sequenced by the dideoxy chain termination


Ausubel
et al., 1987).
sites used for cloning

method (as described in

Sequence
was obtained
across all restriction
and on both DNA strands.
DNA and protein

sequence analyses were performed

with University

of Wisconsin

Genetics
Computing
Group programs
(Devereux
et al., 1984).
mRNA
Analysis-RNA
was isolated
by vigorous
vortexing
of S.
cerevisiae
cells suspended
in 0.1 M Tris (pH 7.5), 0.1 M LiCl, 0.01 M
dithiothreitol,
in the presence
of glass beads, 0.5% sodium
dodecyl
sulfate,
phenol,
and chloroform.
Lysis
was followed
by multiple
phenol/chloroform
extractions
and ethanol
precipitations
as described (Ellwood and Craig, 1984). Yields were determined by AzGO ~

and normalized
A

site in the polylinker

by comparison

of ethidium

bromide-stained

rRNA

following
gel electrophoresis.
A Sau3A to RsaI (position
+147 to +87) fragment
was used as a
DNA
primer
for extension
analysis
of transcripts
from the native
gene. A Sau3A to AuaI (+147 to -402)
fragment
was used as a probe
for Sl analysis
(Fig. 2B). The DNA fragments
were 5 end-labeled
at
the Sau3A termini.
The standard
17-bp lncZ sequencing
primer
5GTAAAACGACGGCCAGT-3
was utilized
for priming
extension
of
SSAl/lacZ
fusion
transcripts.
DNA
restriction
fragments
were hybridized
to RNA in 80% formamide,
0.4 M NaCl following
brief (45s) denaturation
at 80 C; hybridization
reactions
were slowly cooled
from 48 to 37 C over 7 h. Oligonucleotide
primers
were prepared
and
hybridized
under aqueous conditions
in the presence
of poly(A)
RNA

as carrier as described (Boorstein and Craig, 1989). 40-80 pg of total


RNA were utilized per reaction.
Nuclease
protection
samples
were
treated with 100 units of nuclease Sl at 28 C for 60 min in the
presence of denatured salmon sperm DNA as described (Berk and
Sharp,

1977).

Primer

extension

reactions

were

performed

in the

presence of actinomycin D as described (Boorstein and Craig, 1989).


The samples were run on denaturing
8 M urea, 6% polyacrylamide
gels and subsequently visualized by autoradiography.
Yeast Growth
and Enzyme
Assays-Transformants
freshly selected
on minimal
medium
lacking
tryptophan
were inoculated
into YPD
medium (Sherman et al., 1982) and grown (-20 h) to AeWn,,, = 0.4 f
0.05. The culture
was then divided
and one portion
was transferred
to a prewarmed
flask at 39 C while the remainder
was retained
at
23 C. Samples
were collected
1 h (or indicated
times)
following
temperature
upshift.
Stationary
phase cells were collected
after 4.5-

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

and SSA3 promoters is dependent upon upstream


(UAS) similar to the HSEs of higher
eukaryotes
(Boorstein
and Craig, 1990b; Slater and Craig,
1987). HSEs are also involved in mediating basal expression
of SSAl and enhancing the level of expression of SSA3 under
conditions of lowered CAMP. The role of HSEs in promoting
transcription
under nonstress conditions
is consistent with
evidence demonstrating
that yeast HSF is bound to HSEs
under normal, as well as stressed conditions
(Jakobsen and
Pelham, 1988; Sorger and Pelham, 1987).
Here we present the initial characterization
of the SSA4
gene and its transcriptional
regulation.
We define the promoter element that mediates heat-inducible
regulation
of
SSA4 and compare its activity with that of HSEs from SSAl
and SSA3, which contribute
both to heat induction
and to
high expression levels under nonstressed conditions. We have
also analyzed SSA4 promoter activity in mutant strains lacking constitutively
expressed,
closely related
homologues,
SSAl and SSAB. We evaluate the modular
HSE concept,
defined by experiments
in Drosophila,
in light of the data
presented here and recent analyses of heat-inducible
S. cereuisiae promoters.

Structure

18914

and Regulation

of a Yeast Heat-shock

Gene

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

5 days of growth
at 23 C. Cells were collected
in siliconized
1.5-ml
microcentrifuge
tubes; cell pellets
were rapidly
frozen
in a -70 C
bath and were stored
at this temperature.
Optimization
of growth
conditions
by using rich medium
resulted
in lower basal and higher
heat-shocked
levels of expression
than observed
in defined,
plasmidselective,
medium
(data not shown).
Plasmid
stability
was routinely
assessed as follows:
an aliquot of cells was plated on rich medium
and
the fraction
of resultant
colonies
that contained
the TRPI marker
carried
on the plasmid
was determined
following
replica
plating
to
the medium lacking
tryptophan.
More than 80% of the cells routinely
retained
plasmid
at the time of sample collection.
fl-Galactosidase
activity
was determined
by microfluorometric
assay utilizing
the substrate
4-methylumbelliferyl-fl-n-galactoside
(to
be described
in detail elsewhere).
Briefly,
cells were suspended
and
permeabilized
in 1 ml of Z buffer
(Miller,
1972) with 0.05% sodium
dodecyl
sulfate,
50 mM P-mercaptoethanol,
1 mM phenylmethylsulfonyl fluoride,
vortexed
vigorously,
diluted
to yield fluorogenic
product in the linear detection
range of the fluorimeter,
and incubated
with 1 mM 4-methylumbelliferyl-/3-n-galactoside
for 15-120
min at
room temperature.
The reactions
were performed
in a final volume
of 200 ~1 in 96-well
microtiter
plates. Fluorescence
of samples
with
extremely
low fi-galactosidase
levels was enhanced
by the addition
of
50 ~1 of 1 M Na2C03
after 2 h of incubation.
Fluorescence
was
determined
using a Titertek
Fluoroskan
I fluorimeter.
fi-Galactosidase activities
are presented
as (f2-l/(tz-1
x AGNnm x u x s)) x C x N,
where fi-, is the increase
in fluorescence
between
times 1 and 2, tzmL
is the time in minutes,
between
the two fluorescence
readings,
Asw nm
is a measure
of cell density
at the time of cell collection,
u is the
volume of the culture
assayed, in milliliters,
and s is correction
factor
for plasmid
stability
that is equal to the fraction
of cells retaining
the
plasmid at the time of cell collection.
The arbitrary
fluorescence
units
were converted
to Miller
units
(Miller,
1972) by the empirically
derived
constant,
C = 5.7 x 10. N is a normalization
factor
determined by assay of a known
standard
quantity
of fl-galactosidase
to
control
for differences
in temperature
and pH which affect @-galactosidase
activity
and fluorescence
of methylumbelliferone,
respectively.
Selected
samples
were permeabilized
as described
above and
were assayed in parallel
with the substrate
o-nitrophenyl-fl-n-galactopyranoside,
as described
(Slater and Craig, 1987); results of the two
assays were similar,
with the exception
of the low activity
samples
that were below the accurate
detection
limits of the 0-nitrophenyl-@D-galactopyranoside
assay. Data presented
are averages
from two to
six determinations
of at least two independent
transformants.
Individual determinations
were almost always within
20% of the averages
shown here. Occasionally,
high or low values were obtained.
In these
cases, samples
from all treatments
of a single culture
were similarly
affected
(i.e. basal, heat-shock,
and stationary
phase);
thus, patterns
of induction
were highly reproducible.

RESULTS

Characterization
of the SSA4 Gene and Encoded Transcripts-The
SSA4 gene was isolated on a 9-kb genomic
clone.3 We constructed
a restriction
map of the pSSA4H
genomic insert and localized the SSA4 coding region by DNA
hybridization
analysis utilizing fragments of the related SSAI
gene as probes (Fig. 2A and data not shown). The nucleotide
sequence of the coding region, as well as 1.2 kb of flanking
DNA upstream of the gene, was determined
(Fig. 28). A single
large open reading frame with similarity to SSAl was identified. This SSA4 ORF has the potential of encoding a protein
of 642 amino acids with a predicted molecular mass of 69,650
Da and an isoelectric point of 4.86. These values are consistent
with previous estimates based on polyacrylamide
gel electrophoresis analysis of the SSA4 protein, Ssa4p (Werner-Washburne et al., 1987).
While Ssa4p is closely related to hsp70s and noninducible
cognates of distantly related species (68-75% identity to Drosophila and human homologues),
it is most closely related to
the yeast hsp70 Ssalp and Ssa2p, which are 97% identical.
Ssalp and Ssalp are each 642 amino acids in length, although
optimal alignment involves the introduction
of at least three
J. C. A. Bardwell

and E. A. Craig,

unpublished

data.

FIG. 2. Restriction
map and nucleotide
sequence
of SSA4
and flanking
genomic
DNA.
A, restriction
map of the 9.0-kb SSA4
Hind111 fragment,
SSA4H.
The SSA4 protein-coding
region and the
upstream
open reading
frame are represented
by arrows.
The filled
region of the map indicates
the part of the clone whose DNA sequence

Structure

and Regulation of a Yeast Heat-shock Gene

18915

FIG. 3. Comparison
of predicted
complete
SSA4 and SSAI
hsp70
protein
sequences.
Solid bars, colons, or dots between
corresponding
amino acids of the two proteins
indicate
identity,
or high
or low levels of similarity,
respectively.
This alignment
was obtained
by optimizing
matches
while introducing
the smallest
number
of gaps
(represented
by dots in the sequence
lines) according
to the algorithm
of Needleman
and Wunsch
(1970).
Matches
between
nonidentical
amino
acids were weighted
as described
by Gribscov
and Burgess
(1986). Alternative
alignments
can be obtained
with a larger number
of gaps, particularly
in the C-terminal
region,
but these do not
significantly
increase
the similarity.
Ssalp is from Slater and Craig
(1989).
gaps,
indicating
that insertion/deletion
mutations
occurred
during the divergence of these genes (Fig. 3). Ssalp and Ssa4p
are 82% identical; they are 90% similar, accounting
for conservative amino acid substitutions
as described by Gribscov
and Burgess (1986). There is an abrupt decrease in similarity
near the carboxyl termini of the proteins. The amino-terminal
525 amino acids of Ssa4p are 89% identical with Ssalp, while
the carboxyl-terminal
117 amino acids share only 50% idenis shown in B. B, Rⅈ
Bs. BsrEII;
H. HindIII:
HD, HnaI: K, KnnI:
M, MluI; N, NdeI; p, I%tI; Pv, Pⅈ
RI, EcoRI;~$
salI; Sk, SacIt
SC, ScaI; S,o, SphI; St, StuI; X, XhoI. The following
enzymes
do not
cleave the SSA4H
fragment:
ApaI, BarnHI,
BclI, NruI,
PuuI, SacII,
SmaI. B, nucleotide
sequence
of SSA4 and flanking
DNA.
The 5
ends of the heat-shock
SSA4 mRNA
map to the double-overlined
nucleotides;
the center
of this region has been designated
+l. The
arrowhead
at position
32 marks the putative
initiation
site for SSA4
transcription
under control
conditions
(see the legend to Fig. 5). Long
bars above the sequence
indicate
occurrences
of matches
to the
canonical
heat-shock
consensus
sequence,
CNNGAANNTTCNNG,
where
N is any nucleotide,
in at least six of the eight conserved
positions.
The only match to the extended
modular
HSE definition
is in the region
of three overlapping
canonical
HSEs
centered
at
-188. The putative
TATA
element and the initiation
and termination
codons
are enclosed
in boxes. A match to the ATF consensus
binding
site is underscored
with a broken line (positions
-103 through
-97).
Positions
of restriction
enzyme
recognition
sites used in cloning
and
in construction
of primers
and probes for mRNA
mapping
are indicated. The amino acid translation
of the incomplete
ORF upstream
of SSA4 is included.
The translation
of the SSA4 ORF is shown
in
Fig. 3.

TAA

00

05

distance

.ccucGGticMcroo
IIIII
IIIIIIII
CCUCCCTTGAAGAAG

10
SSA4
from transcription

1.5

slaR

20

(kb)

SSAI
~=T~~TAA;rT1\CA~~T~~~~T~~~
IIIIIIII
III
-=WGCCMTTGGTGCGGC~TTGAT:
ssA.1

2000
III
2012

FIG. 4. Comparison
of SSA4 to SSAI DNA
sequences.
A,
graphic
matrix
comparison
of the entire
SSA4 and SSAl proteincoding
regions
plus flanking
DNA
(Maize1
and Lenk,
1981).
Wide
bars on the ares indicate
the positions
of the coding regions; initiation
and termination
codons
are labeled. Each dot represents
a match of
17 of 24 adjacent
nucleotides
between
the two sequences.
Diagonal
lines indicate
contiguous
colinear
similarity
between
the two genes.
B, alignment
of SSA4 and SSAl nucleotide
sequences
flanking
the
initiation
(top) and termination
(bottom)
codons.
Vertical
lines indicate identity
between
nucleotides
at corresponding
positions
in the
two genes. Coding
portions
of the genes are in bold type. Numbers
indicate
positions,
as in Fig. 2B, for SSA4 and, as in Slater and Craig
(1987), for SSAI.

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

tity. However, two short highly conserved domains are present


within
the C-terminal
region; the eight extreme terminal
amino acids of Ssa4p are identical
to those of Drosophila
hsp70s, as well as to those of Ssalp. 85% of the amino acids
between these two conserved domains (610 through 636) are
glycine, alanine, and proline, including
six glycine-alanine
repeats; therefore, this region is likely to be highly flexible.
The nucleotide sequence similarity is strictly limited to the
coding region (Fig. 4), in which the genes share 67% identity.
The high degree of divergence between SSA4 and SSAl based
on silent (synonymous)
substitutions
(182%, calculated and
corrected for multiple substitution
events by the method of
Perler et al. (1980)) indicates that these genes are likely to
have arisen from a duplication
event a minimum
of 100
million years ago. The relatively low divergence, 13%, based
on replacement
(nonsynonymous)
substitutions
indicates that
a high level of selective pressure has maintained
the similarity
in the coding potential of these two genes.
An additional
open reading frame of at least 434 nucleotides
was identified
on the same strand as SSAC (Fig. 2, and data
not shown). This ORF begins 5 to the region included in Fig.
2B and terminates 889 bp upstream of the SSA4 coding
domain. The upstream ORF is predicted to encode a protein
by the TESTCODE
algorithm, an empirically
derived method
based primarily
on the periodic compositional
bias of coding
sequences (Fickett, 1982). The ORF sequence is not closely

Structure

18916
related to entries

in GenBank,

EMBL,

and Regulation

and NBRF

data bases.

Mapping the 5 Termini of SSA4 mRNA and Identification


of Putative SSA4 Transcriptional Regulatory Sequences-The
5 ends of SSA4 transcripts
were mapped to the gene by

B.

A.

--Extension Sl Nuclease
Ss123456
-------

HS:-

A-234
+
-113456J-8910

A-594
+

Standards

E
I
-*
-c

l-

r
e
0

104-5 *

l w

145-9

ma
e.

FIG. 5. Analysis
of SSA4 RNA.
A, Sl and primer extension
analvses
of the native SSA4 RNA isolated
from heat-shocked
DSlO.
S and S are DNA size standards
(pBR322
cleaved
with MspI
and
HaeIII, respectively).
Lanes 1 and 6, controls
containing
the same
quantities
of primer
and probe,
respectively,
used in the mapping
reactions;
Lanes 2 and 5, reaction controls
containing
tRNA,
but no
yeast mRNA;
Lanes 3 and 4, SSA4 primer extension
and Sl nuclease
mapping
reactions
with 13 fig of total RNA per lane. S1 probes
and
extension
primers
were labeled at a common
5 terminus,
therefore,
bona fide 5 ends mapped by each method
should yield comigrating
products.
Unextended
primer
and undigested
probe bands are indicated by arrowheads to the right of A. Higher
resolution
electrophoresis of aliquots
of the samples
shown here suggest the presence
of a
single predominant
5 terminus;
the less abundant
products
from the
two reactions
do not comigrate
(data not shown).
B, primer extensions
of SSA4/lacZ fusion
RNAs
from pWB213n-234
and J-594
transformants
in DSlO under control
(-) and heat-shock
(+) conditions
(Lanes 3-6). Lanes 1 and 2 contain controls: primer only (no reaction)
and primer plus poly(A)
RNA (no yeast RNA), respectively.
A dideoxy
DNA-sequencing
ladder is included
as a size standard
in Lanes 7-10.
The 5 termini
of native and fusion transcripts
were indistinguishable.
The range of sizes of Sl nuclease
and primer
extension
products
are
indicated
in nucleotides.
Comigrating
single faint bands were detected
on long exposures
of extension
products
from
nonheat-shocked
pWB2131-234
and pWB213J-594
transformants
(data not shown).
These
may represent
a very low level of transcriptional
initiation
from position
-+32
(as marked
in Fig. 2H).

Gene

occur near the actual initiation


sites; however, these do not
appear to be active sites of transcriptional
initiation.
Six matches to the canonical
dyad heat-shock
element
CNNGAANNTTCNNG,
where N is any nucleotide (Pelham,
1985), occur upstream
of the transcribed
region of SSA4.
Three of these, including
the two closest matches (seven of
eight) to the consensus, are present in an overlapping
arrangement centered at position -188. The -188 region contains
four perfect plus three imperfect GAA blocks with relative
spacing and orientation
consistent with the extended modular
HSE definition
from Drosophila (Amin et al., 1988). In addition, an exact match to the ATF consensus binding site, (G/
T)(A/T)CGTCA,
occurs at position -100, 17 bp upstream of
the TATA sequence (reviewed in Jones et al., 1988). Very
similar sequences have been shown to bind yeast ATF and
exhibit UAS function (Kornuc et al., 1988; Jones and Jones,
1989; Lin and Green, 1989). It is intriguing
that an HSP70
gene from both yeast and human genomes contain putative
ATF-binding
sites, although the function of these sequences
in heat-shock regulation
is not known (Greene et al., 1987)
Expression of an SSA4/lacZ Fusion Gene-To
facilitate
identification
of SSA4 transcriptional
regulatory
sequences,
SSA4 DNA from -801 to the initiation
codon was fused to
the 1acZ gene of E. coli. The fusion gene included three HSElike regions, the putative TATA element, the transcriptional
initiation
region, and the entire untranslated
leader from
SSA4. @-Galactosidase activity from cells transformed
with
this construct was very low under optimal growth conditions
at 23 C. Activity increased 70-fold following 39 C heat-shock
treatment
(Fig. 6, top line). Basal activity was only slightly
(0.8 Miller units) higher in stationary phase than in exponentially growing cells at 23 C.
Localization of Regulatory Sequences-A
progressive series
of deletions of SSA4 upstream sequence was constructed
to
delineate
regions involved
in transcriptional
control. The
deleted fusion constructs retaining
sequences from at least
-234 to +59 were regulated in a heat-inducible
manner (Fig.
6). The largest and smallest deletion derivatives of the SSA4/
1acZhybrid gene that gave rise to heat-inducible
P-galactosidase activity were analyzed in greater detail. Both constructs
exhibited a high degree of heat-shock regulation
at the RNA
level (Fig. 5B). Furthermore,
the 5 termini
of the fusion
mRNAs mapped to the same nucleotides
in the SSA4 sequence as did the native SSA4 transcript
termini (Fig. 5B).
P-Galactosidase
activity from both constructs increased dramatically
within 30 min of temperature
upshift, reached a
maximum after 60 min, and then gradually declined (Fig. 7).
Therefore, expression of the fusion genes corresponds to that
of the native SSA4 gene.
Removal of an additional
60 bp downstream
of the -234
deletion endpoint
essentially abolished heat-inducible
regulation, indicating
that the -188 HSE-like region is critical to
SSA4 heat induction. This region contains the only match to
the newly extended HSE definition
within 1.2 kb upstream
of the SSA4 gene, as well as the closest matches to the
canonical HSE 14-bp palindromic
sequence. In addition, /3galactosidase activity under basal (23 C) conditions is 3-fold
lower from constructs lacking the -188 HSE region than from
slightly
larger constructs
that retain these HSE-like
sequences, suggesting that the HSE sequences may be capable
of mediating a low level of expression under optimal conditions, as well as increased expression
under conditions
of
stress. The deletion analysis also demonstrates
that the HSE
match at position -549 is not essential for heat-shock regulation and that both the ATF- and HSE-like
sequences at
-100 and -14, respectively, are not sufficient to drive heat-

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

primer extension and sl nuclease techniques


(Fig. 5). Heatinduced transcripts
from the native gene mapped to a fivenucleotide
region. The HSP70-related
open reading frame
begins at the first AUG downstream of this putative initiation
site. The region flanking this AUG matches the S. cereuisiae
translational
initiation
consensus sequence in 8 of 10 positions (Cigan and Donahue, 1987). The length, 53 nucleotides,
and the adenine-rich
content of the predicted 5 untranslated
SSA4 mRNA leader are typical of yeast genes transcribed by
RNA polymerase II.
The sequence TATAAA,
which matches the functionally
defined TATA element (Chen and Struhl, 1988), is present
75 bp upstream
of the putative
transcriptional
initiation
site(s). Interestingly,
several occurrences of sequences that
have been shown to act as preferred initiation
sites in CYCl,
PH05, and other yeast promoters, TC(G/A)A
and RRYRR
(where R and Y are purine and pyrimidine
nucleotides,
respectively) (Hahn et al., 1985; Rudolph and Hinnen, 1987),

of a Yeast Heat-shock

Structure

and Regulation

of a Yeast Heat-shock

18917

Gene
f3-galactosidase

-801

-188

tl

ATG

-23X
0.2

--T39"C
14

activity
f3943'
70

0.2

12

60

0.1

10

100

0.1

10

100

0.2

11

55

0.7

17

24

0.6

15

25

0.2

0.4

2.0

0.2

0.6

3.0

0.3

0.3

1.0

IacZ
FIG. 6. ,%Galactosidase
activities
from
the SSAsCllacZ
fusion
gene and the promoter
deletion
derivatives.
The solid black lines represent
SSA4 sequences.
The positions
of the initiation
codon, the transcription
initiation
site, and the deletion
end points
are indicated,
pWB21311-234
contains
1 bp beyond
that indicated
identical
with that in the native
gene because
of the addition
of linker
sequences.
Diamonds
represent
partial
matches
to the HSE consensus,
as overlined
in Fig. 2B. The putative
TATA
element
is denoted by T. The plasmid
on the top line, pWB213,
is the parental
plasmid
from which
the deletions
were derived
as described
under
Materials
and Methods.
Deletion
derivative
plasmids,
from
top to bottom,
are named
pWB213A-594
to
pWB213A-61.
pWB213
contains
an 8-bp linker
inserted
at position
-594 of the SSA4 DNA as described
under
Materials
and Methods.
pWB213
also contains
665 bp of vector
sequence
immediately
upstream
of SSA4 that
are not present
in the deletion
derivatives.
All other plasmids
represented
here differ from each other only in the
extent of 5 noncoding
SSA4 sequence
included
(and consequently
the relative
spacing of DNA sequences
flanking
the deletion
end points and the actual junction
sequences).
P-Galactosidase
activities
from transformants
growing
exponentially
at 23 C and following
a l-h 39 C heat-shock
treatment,
are presented
in Miller
units.
Vector

SSA4

presence of an intact SSA4 gene, even though SSA4 is not


expressed in wild-type cells growing at this temperature.
The
SSA4 protein has been shown to be abundant in ssalssa2 cells
(Werner-Washburne
et al., 1987). To determine if the SSA4
promoter exhibits altered regulation in ssalssa2
cells at 23 C,
expression of the A-594 construct, which is regulated like the
native SSA4 gene in wild-type cells, was assayed in a doublemutant background.
p-Galactosidase
activity from the SSA4/
la&Z fusion in an ssalssa2 double-mutant
strain was 600-fold
greater than levels in wild-type isogenic strains during growth
at 23 C (Table I). To determine
whether UA&s was alone
sufficient to drive this abnormally
high basal activity, expression driven by the UAS&CYCl
hybrid promoter was assayed
in cells with disrupted
SSAl and SSA2 genes. The UAS
cloning vector, pWB220, yielded an extremely low basal level
of P-galactosidase
activity, 0.3 units, in the double-mutant
strain. Insertion
of the 44-bp HSESsA4 oligonucleotide
into
the UAS cloning site of this vector resulted in 185 units of pgalactosidase
activity
under the same growth conditions
(Table I). This confirms that the constitutive
activation
in
the mutant strains is at the level of transcription
and demonstrates
that a common
upstream
activating
sequence,
heat-inducible
expression
in wild-type
UASHS, mediates
strains and high basal levels of transcription
in cells lacking
SSAl and SSAB.
Neither the SSA4jlacZ fusion nor the UAS&CYCl
hybrid
promoter were activated to higher levels by a 39 C! heat shock
in the ssalssa2 background,
although both constructs exhibited induction
in wild-type cells following heat shock. Heatshock treatment
may have failed to activate the SSA4 promoter over the high basal expression levels in ssalssa2
mutants because the promoter was already maximally
induced.
Alternatively,
the prolonged activation of the stress response
may have induced a steady state that was unable to readily
respond to increased stress.

UAS, Mediates High Levels of Transcription in ssalssa2


Mutants-SSAl
and SSAP are the only SSA genes actively
transcribed
in cells under normal growth conditions. Viability
of ssalssa2 double-mutant
strains at 23 C! depends on the

DISCUSSION

We have localized
bp region containing

the heat-inducible
UAS of SSA4 to a 44extensive similarity
to sequences that

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

inducible expression, at least from their native locations. An


increase in both basal and induced levels of expression upon
removal of sequences between -366 and -240 suggests elements that negatively
modulate
SSA4 expression may be
present in this region. However, no match to the upstream
repression
sequence that negatively
modulates
SSA 1 transcription
was identified
in the SSA4 promoter
(Park and
Craig, 1989).
Definition of UASHs-To
determine whether the sequences
shown to be required for heat-shock
activity of the SSA4
promoter by 5 deletion analysis were sufficient to mediate
heat-inducible
transcription
in the absence of flanking SSA4
sequences, a short region containing
the HSEs centered at
-188 was tested for upstream activation
sequence activity.
The vector employed for these experiments,
pWB220,
is a
derivative of the SSA4/lucZ deletion plasmids in which the
SSA4 sequences were replaced with DNA from the downstream portion of the CYCl promoter
that includes TATA
elements and initiation
sites, but lacks upstream activation
sequences. Thus, expression of this la& fusion is dependent
upon UAS activity from DNA inserted into a cloning site
adjacent to the upstream boundary
of CYCl sequences. An
oligonucleotide
identical with 44 bp encompassing
the HSElike sequences at -188 was synthesized and cloned into the
UAS test vector (Fig. 8). The insertion
of this HSEs,,
oligomer upstream of the CYCl/lucZ fusion resulted in a 4fold increase in basal levels of activity of the CYCl/lucZ
hybrid protein. Following
heat shock, the heterologous
promoter mediated a further 12-fold increase in activity. The
kinetics of the change in /3-galactosidase
activity following
temperature
upshift mediated by the hybrid SSA4-oligonucleotide/CYCl
promoter was similar to that from the complete
SSA4 promoter (Fig. 7). Since the 44-bp SSA4 sequence was
able to mediate heat-inducible
transcription
in either orientation (Fig. 8B), we designate it UASHs.

18918

Structure

and Regulation

of a Yeast Heat-shock

Gene

A.
B

15--

A-594

B.

P-galactosidase
Iz!z!zs

none

0.3

0.2

0.7

44-mer

1.1

13

12

300

360

7. &Galactosidase
activity
from
transformants
of
SSAl/lacZ
fusion
plasmids
under
heat-shock
and control
conditions.
Each pair of curues represents
data from a single exponentially growing
culture
at 23 C; at time 0, an experimental
aliquot was
transferred
to 39 C (solid black symbols)
while a control
was maintained at 23 C (open symbols).
Samples
were collected
at the indicated times and fl-galactosidase
activities
were determined.
&rues
shown are representative
for each plasmid.
/3-Galactosidase
activity
is presented
in Miller
units. A, pWB213A-594.
B, pWB213A-234.
C, pWB227
(circles),
the HSEssar
44-bp oligonucleotide
in pWB220,
as well as a heat-shock
curve only from the UAS vector,
pWB220,
with no insert (triangles).
The plasmids
are illustrated
in Figs. 6 and
8B.
FIG.

regulate
stress-induced
transcription
of heat-shock
genes
from distantly
related eukaryotic
species. These HSEaa,+,
sequences alone mediate a very similar pattern of transcription to those regulated by the isolated HSEs of SSA3 and
SSAl (Boorstein
and Craig, 1990b; Slater and Craig, 1987).
Therefore,
the role of HSEs in contributing
to the high
expression of the SSAl and SSA3 promoters under nonstress
conditions
(in which the HSE-containing
SSA4 promoter
is
not active) appears to result from differences in regions of the
promoters
distinct from the HSEs (Slater and Craig, 1987;
Boorstein and Craig, 1990a). For example, expression of SSA3
in stationary
phase is dependent upon a distinct promoter
element, UASPDS, but is further enhanced by HSEssa3 (Boorstein and Craig, 1990a).
The difference in regulation
between the SSA subfamily
genes, resulting
from different
promoter
composition,
may
provide an explanation
for the maintenance
of similar genes
over a long period of evolutionary
time; the gene products
may be functionally
equivalent, multiple genes being required
for an appropriate
pattern of expression and/or rapidity
of

TABLE

Activity

of the SSA4
versus

promoter
and UASHs
an SSAlSSA2
strain
&Galactosidase

Hybrid

ssolssa2

gene

SSAl/lacZ
A-594
UAS/CYCl/lacZ
No insert
HSEd

in an ssalssa:!
activity
SSAlSSAP

23 C

t39 C

23 C

122

122

0.2

0.3
185

0.2
162

0.2
1.1

o /3-Galactosidase
activity
was determined
in DS16 and DSlO under
indicated
conditions
as described
in Fig. 6.
* pWB213A-594.
The promoter
region of this plasmid
is depicted
in Fig. 6.
pWB220.
The promoter
region of this plasmid
is depicted
in Fig.
8B.
d pWB227.
The pWB220
derivative
containing
the 44-bp HSE,sA,
oligonucleotide
in the native orientation,
as depicted
in Fig. 8B.

induction under certain circumstances.


However, it is possible
that the amino acid differences between the proteins, perhaps
in the divergent C termini, may confer distinct functions, or
at least specialized abilities to perform a common function
under different environmental
conditions.
HSEs in Yeast-The
functional
Drosophila
HSE is comprised of at least three inverted GAA modules separated from
each other by 2 bp (Amin et al., 1988; Xiao and Lis, 1988).
The three modules need not be contiguous, a gap of precisely
one module width (5 bp) is tolerated, provided the modules
flanking the gap are direct repeats (i.e. oriented as if the gap
contained a GAA sequence). All seven heat-shock elements
that have been functionally
defined from heat-inducible
yeast

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

li0
180 240
Time (minutes)

*3ocr

FIG. 8. The SSA4


HSE
region
centereyat
-lk.
A,;NA
sequence
of the 44-bp HSEsa..,,
oligonucleotide.
Diamonds
over the
sequence
indicate
overlapping
matches
to the canonical
HSE sequence. Triangles
below the sequence mark appropriately positioned
matches
to the repeating
core units of the revised
HSE definition;
filled triangles
represent
exact
matches
and open triangles
mark
sequences
with a single mismatch
to GAA (in either orientation).
B,
/3-galactosidase
activity
from the CYCl/lacZ
UAS cloning
vector
alone (pWB220)
or with the 44-bp
oligonucleotide
(shown
in A)
inserted
at the XhoI site of CYCI,
178 bp upstream
of the transcriptional
initiation
site. pWB227
and pWB227-R
contain
the SSA4
oligonucleotide
in native and reverse orientations,
respectively,
relative to the orientation
in the SSA4 promoter.
The plasmids
are
diagrammatically
represented
as in Fig. 6. These plasmids
are centromeric
and differ from those in Fig. 6 only in the region depicted
here. &Galactosidase
activities
from transformants
growing
exponentially at 23 C and following
a l-h 39 C heat-shock
treatment
are
presented
in Miller units.

UAS,

60

3%

Insert

44-mer/Reverse

activity

Structure

and Regulation

of a Yeast Heat-shock

genes match the extended modular HSE definition derived


from analysis of a Drosophila HSP70 promoter. The yeast
HSEs are comprised of at least three and as many as five
appropriately positioned GAA modules spanning up to four
turns of the DNA helix (Table II). The functionally defined
HSE of SSA4 meets the criteria of the modular HSE definition; sequences upstream of the transcribed portion of the
SSA4 gene that match the canonical HSE but not the modular
HSE appear to be nonfunctional. Strong matches to the
modular HSE are also found upstream of heat-inducible yeast
genes whose promoters have not yet been analyzed (Table II:
KARP and SZII). Yeast HSE regions also contain as many
as four appropriately positioned sequences with a single mismatch to the core consensus GAA (TTC) in addition to the
perfect matches; one such imperfect core sequence, TTA, is

Gene

18919

present with particularly high frequency (for example SSA3;


see Table II). These occurrences of imperfect GAA blocks
suggest that they function as components of HSF-binding
sites. In fact, in vitro binding experiments indicated that HSF
contacts at least some imperfect GAA blocks (Shuey and
Parker, 1986).
Direct evidence supporting an extended HSE definition in
yeast comes from reevaluation of previous analysis of
HSE2ssa,. An oligonucleotide containing 22 bp of the
HSE2ssa, region contains three GAA blocks and is sufficient
to mediate heat-inducible transcription (Table II, line 3).
However, a shorter (15bp) region that includes the identical
14-bp match with the canonical HSE, but only two of the
three GAA modules, was unable to function as a UAS (Table
II, line 11). Interestingly, an even shorter HSEBssAloligonu-

TABLE II

1.

elements

from

Saccharomyces

cerevisiae

genes
4, Slater and Craig, 1987, and
and Finkelstein,
1984, and McDaniel
et al., 1989; line 6, Piper et al., 1988;
et al., 1987; line 9, Rose et al., 1989; line 10, Nicolet
and Craig, 1989; line

Boorstein and Craig, 1990b; lines 3 and

11, Slater, 1986;line 12, Slater and Craig, 1987.


sequence*
Gene
Function"
SSA4
+
CAATGAAGTACAT-&TAGAAGT~TAGAACCTTATGGAAGCAC
--=
+

2. SSAJ
3. SSAZ-HSEP

(22-mer)

4. SSAl-HSE3

+, B
B
B, M
M
M

5. HSP82
6. PGK
7. iJBI4

TAATTAGGGATCGCTGTGGAAAGTTATAGAATATTACAGAAGCAG
-----TTTT&ZAGA&ZGECATCGGC
TGTAAACTZCAGAACATTCTAGAAAGA
AGTTTCGCAGAACTTTTT=TT;CTTTTTTTCTAGAACGCCGTGGAAGAA
---=
ATCGAAGGTTCTGGAATGGCGGGAAAGGGTTTAGTACCA
TGTGTAEZGTTCTAGAATAATCCTGGATAA
-~~~~

8. Consensus
Frequent:
Core:

Examples

Rare:
9. KAR2

ND

10. STIl
11. SSAI-HSE2
12. SSAI-HSE2+

(15-mei)
(9-mer)

ND
+

TA
cg
TA
..E..TTC..GAA,
==
RY
wy
RY

TA
cg
..TTC..GAA..TTC
==ac

RY

wy

ATAGAACCTTCTGGAAATTTCACC
ATC~GTGAAGATTCGT~GT~TAGAACA~CAGAAAAA
-c-cc
ttaggctcgaCCAGj&CGCGTTCCATCtcgagcaga
aggctcgAG&CGEtcgagcag

+ or -, sequence
is or is not sufficient
to function
as a heat-inducible
UAS, respectively;
M, sequence
has been
shown to function
in heat-inducible
regulation
by mutational
analysis;
B, sequence
is known
to act as a proteinbinding
site, and in particular
as a site of HSF binding
in the case of lines 3 and 4; ND, function
of HSE-like
region of these heat-inducible
promoters
has not been determined.
* HSE region sequences
are shown,
including
all GAA modules,
in alternating
orientation
and separated
by two
nucleotides
(allowing
for a gap of one module,
provided
GAA elements
flanking
the gap are positioned
as if the
gap contained
a GAA sequence)
according
to the HSE definition
of Amin et al. (1988). All sequences
are from
within
400 bp upstream
of the initiation
codons.
Plus strands
are shown. Exact matches
and single mismatches
to
the consensus
core module sequence
(GAA and TTC)
are doubleand single-underlined,
respectively.
Lines l-3,
11, 12: large uppercase
characters
represent
the full extent
of native sequences
tested for UASns
activity;
line 2:
smaller
uppercase
letters
represent
native
SSA3 sequence
beyond
the region shown to be sufficient
for UASns
function;
lines 11 and 12: lowercase
characters
represent
vector sequences
flanking
the SSAI-HSE2
sequences
in
the UAS test constructs.
SSAI-HSE2
22-mer,
15mer,
and 9-mer are from pZJHSE2-26,
pZJHSE2-19,
pZJHSE2-12,
respectively.
Two
example
consensus
sequences,
each consisting
of three adjacent
exact GAA modules,
illustrate
the
sequence
bias at positions
between
GAA blocks.
Nucleotides
that occur frequently
are indicated
on the upper line,
whereas
nucleotides
that occur rarely,
if at all, are shown
below the core modules.
Consensus
sequences
were
derived
from the plus strand
of functionally
defined
HSEs
(lines l-7) only. Consensus
nucleotides
upstream
of
exact GAA blocks that are also downstream
of exact TTC blocks (TTC--GAA)
were derived only from comparably
positioned
nucleotides
in the native
sequences.
Consensus
nucleotides
upstream
of exact GAA blocks,
but not
between
two adjacent
blocks
(NNN--GAA)
were derived
from nucleotides
found upstream
of all exact GAA
modules.
Sequence
bias at positions
upstream
of TTC
sequences
was determined
as described
for positions
upstream
of GAA sequences.
No strong bias was observed
in positions
downstream
of exact GAA or TTC modules
that are not also upstream
of exact core modules.
For line 8, R represents
G or A; Y represents
C or T; W
represents
A or T. Uppercase
letters
in the consensus
sequence
indicate
a greater
degree of sequence
bias than
lowercase
letters.
The requirements
for a functional
HSE are discussed
in the text. As indicated
by the sequences
in lines l-7, arrangements
of GAA and GAA-like
core modules
other than those shown in the consensuses
allow
HSE function.

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

Heat-shock
Sources:line 1, this work; line 2,
Wiederrecht
et al., 1987; line 5, Farrelly
line 7, Tanaka
et al., 1989, and Ozkaynak

18920

Structure

and Regulation

Gene

via sequences distinct from the HSEs (Stone and Craig, 1990).
Therefore,
it is likely that there are other components, possibly additional
HSPs, in the control loop modulating
the
HSF activity state. In E. coli, mutations in any of three HSP
genes, grpE, dnaJ, or the HSP70 homologue, dnaK, result in
cr3-dependent
increased transcription
of heat-shock
genes4
(Tilly et al., 1983). Since DnaK can interact directly with
DnaJ and GrpE (Sell, 1987; Johnson et al., 1989), analogues
of the latter two proteins may interact with hsp70 in yeast to
control the activation
state of HSF. Perhans the mechanism
by which the primary intracellular
stress stimulus
is transduced, resulting in induction
of the stress response, is conserved between prokaryotes
and eukaryotes,
although
the
mechanism
of activating
RNA polymerase
on heat-shock
promoters
has diverged. Elucidation
of the mechanisms
by
which HSP70 expression controls transcription
of heat-shock
genes will require further definition
of the function of the
HSP70 gene products and the means by which the stress
pathway is activated.
Acknowledgments-We
wish to thank
Jeffrey
Shilling
and the
University
of Wisconsin
Biotechnology
Center
for sequencing
portions
of the SSA4 gene and Diane
Gambill,
Lynn
Manseau,
and
Carolyn
Norris
for comments
on the manuscript.
We also thank
Helen Tu for pHT102
and Dave Stone for the yeast strains
used in
this study.
REFERENCES

Amin, J., Ananthan,

J., and Voellmy, R. (1988) Mol.

Cell. Biol. 8,
3761-3769
Ausubel,
F. M., Brent,
R., Kingston,
R. E., Moore,
D. D., Seidman,
J. G., Smith,
J. A., and Struhl,
K. (1987)
Current
Protocols
in
Molecular
Biology, John Wiley and Sons, Inc., New York
Berk, A. J., and Sharp, P. A. (1977) Cell 12, 721-732
Bienz, M., and Pelham,
H. R. B. (1987) Adv. &net.
24,31-72
Boorstein,
W. R., and Craig, E. A. (1989) Methods
Enzymol.
180,

347-369
Boorstein,
W. R., and Craig, E. A. (1990a) EMBO
J. 9, 2543-2553
Boorstein,
W. R., and Craig, E. A. (199Ob) Mol. Cell. Biol. 10, 32623267
Brusilow,
W. S. A., Porter,
A. C. G., and Simoni,
R. D. (1983) J.
Bacterial.
155, 1265-1270
Casadaban,
M. J., Martinez-Arias,
A., Shapira,
S. K., and Chou, J.
(1983) Methods
Enzymol.
100,293-308
Chen, W., and Struhl, K. (1988) Proc. N&l. Acad. Sci. U. S. A. 85,

2691-2695
Cigan, M. A., and Donahue,
T. F. (1987) Gene (Am&)
59, l-18
Craig, E. A. (1985) Crit. Rev. Biochem.
18, 239-280
Craig, E. A. (1989) Bioessays
11, 48-52
Craig; E. A., and Jacobsen:
K. (1984) Cell 38,841-849
Craig. E. A.. Kramer.
J.. Shilline.
J.. Werner-Washburne.
M., Holmes.
S.:Kosic:Smithers,
J., and tiicoiet,
C. M. (1989) Mol.Celi.
Biol. 9;
3000-3008
Devereux.
J.. Haeberli.
P.. and Smithies.
0. (1984) Nucleic Acids Res.

12,387-395
DiDomenico,

B. J., Bugaisky,

G. E., and Lindquist,

S. (1982)

Cell

31,

593-603

M. S., and Craig, E. A. (1984) Mol. Cell. Biol. 4, 1454-1459


F. W., and Finkelstein,
D. B. (1984) J. Biol. Chem. 259,

Ellwood,
Farelly,

5745-5751
Fickett,
J. W.
Greene,
J. M.,
and Kingston,
Gribscov,
M.,
6763
Guarente.
L.,

(1982) Nucleic
Acids Res. 10, 5303-5318
Larin,
Z., Taylor,
I. C. A., Prentice,
H., Gwinn,
K. A.,
R. E. (1987) Mol. Cell. Biol. 7,3646-3655
and Burgess,
R. R. (1986) Nucleic Acids Res. 14,6745and Ptashne,

M. (1981)

Proc.

Natl.

Acad.

Sci.

U. S. A.

78,2199-i203
Hahn.

S.. Hoar.

L? k/i.
Hill,

E. T.. and Guarente.

82,8562-8566

D. E., Hope,

I. A., Macke,

, L.

(1985)

Proc.

J. P., and Struhl,

N&l.

Acad.

K. (1986)

234,451-457
4 D. Straus,

W. Walter,

and C. Gross,

personal

communication.

Sci.

Science

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

cleotide was able to function efficiently


as a heat-inducible
UAS; the vector nucleotides
flanking the short SSAl
insert
created appropriately
oriented and positioned
matches (2 of
3 bp) to the GAA module on either side of the SSAl
oligonucleotide (Table II, line 12). This result further supports the
idea that partial matches to the core consensus, GAA, can
contribute to HSE function in yeast.
The base pairs flanking highly conserved core GAA modules
of an HSE are also conserved, but to a lesser extent. The bias
of nucleotides between GAA blocks is indicated in line 8 of
Table II for two model HSEs that each consist of three
adjacent GAA repeats. The bias is strongest upstream of 5GAA-3 sequences on the plus strand, particularly
between
two exact consensus modules (TTC--GAA).
The sequence
bias we observed between GAA blocks differs somewhat from
that in HSE-like
regions from heat-shock
genes of higher
eukaryotic
species (Amin et al., 1988). Most notably, G was
not present in the position two nucleotides upstream of GAA
in any of the 16 perfect or imperfect core GAA modules in
the region of functional
HSEs (Table II); Amin et al. (1988)
observed that G occurs frequently
in this position of HSEs
from Drosophila and other species and demonstrated
its ability to contribute to HSE function in Drosophila cells.
It is clear from examination
of the sequences in Table II
and the analysis of HSE-containing
constructs that HSEs of
different yeast genes share many common features. However,
the flexibility
of the functional
HSE sequence is also striking
(Wei et al., 1986). The required degree of specificity for HSF
binding
appears to be achieved by a long but degenerate
recognition
site, rather than a short strictly conserved UAS
as, for example, is the case for Gcn4-binding
sites (Hill et al.,
1986). Perhaps differences between sequence composition
of
UASHs elements allows a single transcription
factor, HSF, to
stimulate transcription
of many genes at different
relative
levels in response to a common signal.
Autoregulation of the Heat-shock Response-Transcription
of heat-shock genes has been proposed to be negatively regulated by heat-shock proteins. This autoregulatory
hypothesis
is based on studies in which blocked translation
caused abnormally high levels of heat-shock gene transcription
following stress exposure (McAlister
and Finkelstein,
1980; DiDomenico et al., 1982; Plesset et al., 1982). We have shown
that disruption
of two constitutively
expressed HSP70 genes
causes increased transcription
of the heat-inducible
SSA4
gene. Because the same short UASns element is necessary
and sufficient to mediate high basal expression in an ssalssa2
strain as mediates stress-activated
transcription
in wild-type
strains, we surmise that the general stress response is constitutively
activated in the double-mutant
strain. Additional
mutant phenotypes of ssalssa2
strains, including constitutive
thermotolerance
and active synthesis of Hsp82, support this
conclusion (Craig and Jacobsen, 1984).
These results suggest that SSA proteins
function
in a
negative feedback loop, regulating the transcription
of heatshock genes. Thus, hsp70 is critical to maintenance
of the
heat-shock
response in the OFF (uninduced)
state, and a
decrease in hsp70 availability,
either by disruption
of the
constitutively
expressed HSP70 genes or the increased demand for hsp7Os under conditions
of stress, is sufficient to
activate the response. HSF may be modulated
by hsp70 directly or indirectly
via proposed activities in protein folding
and mediation of interactions
between polypeptides
(reviewed
by Lindquist
and Craig, 1988). Overexpression
of the SSAl
HSP70 gene (from a heterologous
promoter)
does not appear
to decrease either basal or heat-induced
HSF/HSE-mediated
transcription,
although it does repress SSAl promoter activity

of a Yeast Heat-shock

Structure

and Regulation

Gene

18921

B., eds), pp. 495-514,


Elsevier
Science Publishing
Co., New York
Rose, M. D., Misra,
L. M., and Vogel, J. P. (1989) Cell 57,1211-1221
Rougvie,
A. E., and Lis, J. T. (1988) Cell 54, 795-804
Rudolph.
H.. and Hinnen,
A. (1987) Proc. Nutl. Acad. Sci. U. S. A.
84,-134o-i344
Sell, S. M. (1987) Studies
of Bacterial
Genes Whose Products
Are
Involved
in Heat-shock
Regulation
and Bacteriophage
h DNA Replication
Ph.D. dissertation,
University
of Utah, Salt Lake City
Sherman.
F.. Fink. G. R.. and Hicks.
J. B. (1982) Methods
in Yeast
Genetics,
Cold Spring Harbor
Laboratory,
Cold Spring Harbor,
NY
Shuey, D. J., and Parker,
C. S. (1986) J. Biol. Chem. 261, 7934-7940
Slater. M. R. (1986) Transcrintional
Regulation
of a Yeast Heat-shock
Gene. Ph.D. dissertation,
eniversityof
Wisconsin,
Madison
Slater. M. R.. and Craig. E. A. (1987) Mol. Cell. Biol. 7. 1906-1916
Slateri M. R.; and Craig; E. A. (1989) Nucleic Acids Res. 17, 805-806
Sorger,
P. K., and Pelham,
H. R. B. (1987) EMBO
J. 6, 3035-3041
Sorger,
P. K., and Pelham,
H. R. B. (1988) Cell 54, 855-864
Sorger, P. K., Lewis, M. J., and Pelham, H. R. B. (1987) Nature
329,
81-84
Stone, D. E., and Craig, E. A. (1990) Mol. Cell. Biol. 10, 1622-1632
Tanaka,
K., Yatomi,
T., Matsumoto,
K., and Toh-e,
A. (1989) UCLA
Svmn
Mol. Cell. Biol. New Series 96. 63-72
Tiliy, K., McKittrick,
N., Zylicz, M., and Georgopoulos,
C. (1983) Cell
34,641-646
Topol, J., Ruden, D. M., and Parker,
C. S. (1985) Cell 42, 527-537
Tu, H., and Casadaban,
M. J. (1990) Nucleic
Acids Res. 18, 39233931
Wei, R., Wilkinson,
H., Pfeifer,
K., Schneider,
C., Young,
R., and
Guarente,
L. (1986) Nucleic Acids Res. 14, 8183-8188
Werner-Washburne.
M., Stone. D. E.. and Craig, E. A. (1987) Mol.
Cell. Biol. 7, 256812577
I
Werner-Washburne.
M.. Becker. J.. Kosic-Smithers.
I J.. and Craie. Yl E.
A. (1989) J. Bacterial.
17 1, 2686-2688
Wiederrecht,
G., Shuey, D. J., Kibbe, W. A., and Parker,
C. S. (1987)
Cell 48,507-515
Wu, C., Wilson,
S., Walker,
B., Dawid,
I., Paisley,
T., Zimarino,
V.,
and Ueda, H. (1987) Science 238, 1247-1253
Xiao, H., and Lis, J. T. (1988) Science 239, 1139-1142
Zimarino,
V., and Wu, C. (1987) Nature
327, 727-730

Downloaded from http://www.jbc.org/ at INDIAN INST OF SCIENCE on May 6, 2014

Jakobsen,
B. K., and Pelbam, H. R. B. (1988) Mol. Cell. Biol. 8,50405042
Johnson,
C., Chandrasekhar,
G. N., and Georgopoulos,
C. (1989) J.
Bacterial.
171, 1590-1596
Jones, R. H., and Jones, N. C. (1989) Proc. N&l. Acod. Sci. U. S. A.
86,2176-2180
Jones, N. C., Rigby, P. W., and Ziff, E. B. (1988) Genes Deu. 2, 267281
Kornuc,
M., Altman,
R. Harricb,
D., Garcia,
J., Chao, J., Kayne,
P.,
and Gaynor,
R. (1988) Mol. Cell. Biol. 8, 3717-3725
Lin, Y. S., and Green, M. R. (1989) Proc. N&l. Acad. Sci. U. S. A.
86, 109-113
Lindquist,
S., and Craig, E. A. (1988) Annu. Rev. Genet. 22,631-677
Maizel,
J. V. J., and Lenk,
R. P. (1981) Proc. Natl. Acad. Sci. U. S.
A. 78,7665-7669
McAlister,
L., and Finkelstein,
D. B. (1980) J. Bacterial.
143, 603612
McDaniel,
D., Caplan,
A. J., Lee, M. S., Adams,
C. C., Fishel,
B. R.,
Gross. D. S.. and Garrard.
W. T. (1989) Mol. Cell. Biol. 9. 47894798
Miller,
J. H. (1972) Experiments
in Molecular
Genetics,
Cold Spring
Harbor
Laboratory,
Cold Spring Harbor,
NY
Needleman.
S. B.. and Wunsch.
C. D. (1970) J. Mol. Biol. 48. 443453
Nicolet,
C. M., and Craig, E. A. (1989) Mol. Cell. Biol. 9, 3638-3646
Gzkaynak,
E., Finley,
D., Solomon,
M. J., and Varshavsky,
A. (1987)
EMBO
J. 6,1429-1439
Park, H.-O., and Craig, E. A. (1989) Mol. Cell. Biol. 9, 2025-2033
Pelham,
H. (1985) Trends Genet. 1,31-35
Perisic,
O., Xiao, H., and Lis, J. T. (1989) Cell 59, 797-806
Perler,
F., Efstratiadis,
A., Lomedico,
P., Gilbert,
W., Kolodner,
R.,
and Dodgson,
J. (1980) Cell 20,555-566
Piper, P. W., Curran,
B., Davies,
M. W., Hirst,
K., Lockheart.,
A.,
Oaden. J. E.. Stanwav.
C. A.. Kinasman.
A. J.. and Kinasman.
S.
(1988) Nucleic
AC& Rex '16, 1333-1348
Plesset,
J., Foy, J. J., Chia, L. L., and McLaughlin,
C. S. (1982) in
Interaction
of Translational
and Transcriptional
Controls
in the
Regulation
of Gene Expression
(Grunberg-Manago,
M., and Safer,

of a Yeast Heat-shock