2012 International Conference on Biomedical Engineering and Biotechnology

Isoflavone synthase genes in legumes and nonleguminous plants

Isoflavone synthase

Martina Pimanov, David Honys

Radka Koblovsk, Oldich Lapk

Laboratory of Pollen Biology

Institute of Experimental Botany ASCR
Prague, Czech Republic
david@ueb.cas.cz

Department of Chemistry of Natural Compounds

Institute of Chemical Technology in Prague
Prague, Czech Republic

AbstractAmidst the vast number of diverse secondary

metabolites of plants, isoflavonoids occupy a special place due to
the wide range of their biological activities. The literature deals
extensively with the positive effect of these well-known
phytoestrogens on human health, including cancer prevention
and the mitigation of menopause symptoms, as well as with the
potential risks associated with their consumption. Isoflavonoids
have considerable importance for plants themselves, particularly
in the defense against pathogens and in the induction of rhizobial
symbiosis. A complete description of biosynthetic pathway of
these natural products and of the genetic background of this
biosynthesis, constitutes a challenge in the metabolic engineering
of isoflavonoid biosynthesis, especially in the case of crop-plants
that are not natural producers of isoflavonoids.

family, they were detected in a further 59 plant families, as far

as known to date [1].
The literature deals extensively with the positive effects of
these well-known phytoestrogens on human health, including
cancer prevention and the mitigation of menopause symptoms,
as well as with the potential risks associated with their
consumption. In addition, isoflavonoids have considerable
importance for plants themselves, particularly as phytoalexins
and chemoattractants in rhizobial symbiosis.
Isoflavone synthase is known for its outstanding ability to
catalyze both the hydroxylation of two flavanone precursors
liquiritigenin and naringenin as well as the critical migration
of the aryl group from the C2 to the C3 position on the
chromene skeleton of flavanones (Fig. 1).

Isoflavone synthase plays a key role in the biosynthesis of

isoflavonoids. The vast majority of over 1600 known isoflavone
structures were found in legumes. However, isoflavonoids have
been identified in many other species from over 60 families.
Known IFS genes belong to the CYP93C subfamily of
cytochrome P450. Due to very specific nature of the catalyzed
reaction, we hypothesised that IFS genes in other species share
high degree of homology with already cloned genes. We aimed to
identify new IFS orthologues in non-leguminous isoflavoneproducing plant species : Cannabis sativa and Humulus lupulus
(Cannabaceae), Ruta montana and Ruta graveolens (Rutaceae)
and Nicotiana tabacum (Solanaceae). IFS sequences showed high
degree of similarity, over 70% at the nucleotide level. The
phylogenetic map demonstrates the evolutionary relation of IFS
genes from congenial species and their relationship to other taxa.
Non-leguminous isoflavone producers contain close IFS
orthologues that are likely to catalyze the first step of isoflavone
biosynthesis. This finding has the potential to be exploited for the
control of isoflavone production in crop plants.
Keywordslegumes; non-leguminous
synthase; IFS; CYP93C; isoflavonoids

plants;

Figure 1. Schematic representation of the major branches of the

phenylpropanoid pathway. Enzymes involved: (1) Phenylamonium lyase
(PAL), (2) Cinnamate-4-hydroxylase (C4H), (3) 4-coumaroyl:CoA-ligase
(4CL), (4) Chalcone synthase (CHS), (5) Chalcone isomerase (CHI) [2].

isoflavone

1. INTRODUCTION
To date, over 30 individual IFS-aminoacid sequences,
displaying a homology of more than 95%, have been described.
Apart from this, the presence of two isoforms of IFS has been
reported only once, and in the case of only a single nonleguminous species, namely Beta vulgaris (Chenopodiaceae)

Amidst the vast number of cytochromes P450, isoflavone

synthase (IFS; belonging to the CYP93C subfamily) occupies a
special place due to its key role in the biosynthesis of plant
secondary metabolites, isoflavonoids. Although these phenolic
compounds are produced predominantly in the Fabaceae
978-0-7695-4706-0/12 $26.00 2012 IEEE
DOI 10.1109/iCBEB.2012.257

344

Plasmids were isolated using QIAprep Spin Miniprep Kit

(Qiagen). PCR-verified positive clones were sequenced.
Sequence alignment was performed using Vector NTI 9
software.

[3]. The knowledge about isoflavones in phylogenetically

distant taxa from Fabaceae is still limited [1,4]. The aim of
presented study was to search for IFS orthologues in nonleguminous taxa belonging to the Rutaceae [5], Cannabaceae
[6] and Solanaceae [7] families that were previously
demonstrated to be isoflavonoid producers [1].

3. RESULTS AND DISCUSSION

To identify IFS orthologues, PCR was performed with
degenerate primers (Table I.), which were designed on the
basis of the most conservative region discovered by multiple
alignment of known IFS genomic sequences and with the
genomic DNA extracted from selected plants. In most cases,
PCR yielded in the amplification of only one band with the
desired length. The size of amplified bands was not exactly the
same as in the master leguminous species. For example both
isoflavone synthase fragments isolated from Cannabaceae
species was cca 150 bp shorter than that of leguminous plants
(Fig. 3).

2. MATERIAL AND METHODS

Highly conserved regions of genes coding for isoflavone
synthase in legumes were used for the design of degenerate and
non-degenerate primers using the CODEHOP algorithm (Table
I.) [8]. Genomic DNA was isolated from previously
demonstrated isoflavone-producers (Cannabis sativa, Humulus
lupulus (Cannabaceae), Ruta graveolens, Ruta montana
(Rutaceae) and Nicotiana tabacum (Solanaceae)) using the
CTAB extraction protocol. IFS fragments were amplified by
Touchdown PCR with both degenerate and non-degenerate
primers.
TABLE I. CODEHOP PCR PRIMERS.
Primer sequence (5-3)
CGACCCTGTCGTTGAAAGGGTCATCAAGAA

consensus

F
YGAYCCTRTCRTTGAAAGGGTCATCAAGAA

degenerate

CTGATGTGGTCCTTGGTGATTTTGATCTCC

consensus

YYGRTKTGBTCYTTGGTGATTTTGATCTCC

degenerate

AATAAGAGATGCAAGAAGTGTTGCCATTCC

consensus

RAKWAKWGATGMAAGAAGTGTTGCCATTCC

degenerate

AACACAGACAAGACTATGTGCCCTTGGAAC

consensus

AACACANMYRAGACTATGTGCCCTTGGAAC

degenerate

TGCAACGCCGATCCTTGCAAGTGGAACACA

consensus

WGCDRSRCYDDBCCTTGCAAGTGGAACACA

degenerate

R1

R2

R3

Figure 3. Isoflavone synthase gene fragment amplified from Humulus lupulus

genomic DNA using F/R2 degenerate primers.

R4

We have identified a IFS sequences in genomic DNA

isolate from Cannabis sativa, Humulus lupulus (Cannabaceae),
Ruta montana, Ruta graveolens (Rutaceae) and Nicotiana
tabacum (Solanaceae).
Identities between all known legumous isoflavone synthase
genes and newly identified sequences were more than 65% in
all cases at the nucleotide level; in the case of the Ruta
graveolens and IFS gene of Pueraria montana even more than
79%. Sequence alignment of these IFS gene fragments is
demonstrated in Fig 4. The position of fragments of Ruta
graveolens, Cannabis sativa and Nicotiana tabacum is
approximately identical. The most of the length of the cloned
fragments was aligned to the cDNA of selected legume IFS
genes. However, one part of the cloned fragment (position 176260) did not match. The likely explanation is that the section
represents an intron. Accordingly, the intervening sequence
follows the general GT-AG rule characteristic for canonical
introns. The corresponding alignment with the IFS genomic
sequence of Beta vulgaris, the only non-leguminous plant
species that has been described previously [3], led to similarly
high 88% identity at the nucleotide level.

Figure 2. Expected size of isoflavone synthase PCR products amplified with

consensus and degenerate CODEHOP primers.

PCR products (~800-1050 bp; Fig. 2) were analysed by 1%

agarose gel electrophoresis. The specific bands were excised
and purified using Gel Extraction Kit (Qiagen). The purified
products were cloned into pGEM-T Easy Vector (Promega).
Chemically competent Escherichia coli DH5 cells were
transformed with plasmid DNA and blue-white selection based
on -galactosidase activity was used to identify recombinant
colonies. White colonies were used to inoculate 5 mL of liquid
LB medium containing the appropriate selective antibiotic
(ampicillin) and grown overnight in an orbital shaker at 37C.
Viable bacterial cultures were pelleted by centrifugation.

345

Figure 5. Unrooted phylogenetic tree showing the relationship among various

isoflavone synthase genes from legumous and non-legumous plant species. CsCannabis sativa, Gm-Glycine max, Hl-Humulus lupulus, Mt-Medicago
truncatula, Nt-Nicotiana tabacum, Rg-Ruta graveolens, Tp-Trifolium pratense,
Vr-Vigna radiata. Non-legumous plants are highlighted in bold.

Here, we have demonstrated the feasibility the CODEHOP

PCR primer design strategy for the identification and
characterization of previously unknown isoflavone synthase
DNA. While the focus of this study was only on few plant
species, other plant families can be easily targeted with this or
analogous approaches.
In order to confront our results with IFS from legumes and
to obtain more complete information about the functional,
structural or evolutionary relationships between isoflavone
synthase sequences, it is necessary to identify and characterize
complete gene sequences.
ACKNOWLEDGMENT
The authors gratefully acknowledge the support from
Czech Science Foundation (CSF grants no. 525/09/0994,
P501/11/1462) and Ministry of Education, Youth and Sports of
the Czech Republic (grant no. OC10054).
REFERENCES

Figure 4. Sequence alignment of IFS gene fragments from Pueraria montana

and Ruta graveolens. Matrix: EDNAFULL, Gap penalty: 10.0, Extend penalty:
0.5, Length: 769, Identity: 614/769 (79.8%), Similarity: 614/769 (79.8%),
Gaps: 91/769 (11.8%), Score: 2730.5.

[1] O. Lapk, Isoflavonoids in non-leguminous taxa: A rarity or rule?

Phytochemistry, vol. 68, pp. 22-24, 2007.
[2] M. Pimanov, Isoflavone Synthase: Presence and Activity in
Leguminous and Non-leguminous Plants M.Sc. Thesis, Charles
University in Prague, 2010.

Generally, isoflavone synthase is highly conserved gene

among various plant species. Interestingly, isoflavone synthase
gene sequences from non-leguminous plants form a distinct
branch on the unrooted phylogenetic tree (Fig. 5). However,
the positions of individual genes on this non-leguminous
branch do not reflect the taxonomy as both Cannabaceae
species are present on different sub-branches.

[3] W. Jung, O. Yu, S.-M. C. Lau, D. P. OKeefe, J. Odell, G. Fader, B.

McGonigle, Identification and expression of isoflavone synthase, the key
enzyme for biosynthesis of isoflavones in legumes Nature Biotechnology,
vol. 18, pp. 208-212, 2000.
[4] O. Lapk, D. Honys, R. Koblovsk, Z. Mackov, M. Vtkov, B. Klejdus,
Isoflavonoids are Present in Arabidospis thaliana Despite the Absence of
any Homologue to Known Isoflavonoids Synthases Plant Physiology and
Biochemistry, vol.. 44, pp. 106-114, 2006.
[5] R. Koblovsk, Z. Mackov, M. Vtkov, L. Kokoka, B. Klejdus, O.
Lapk, Isoflavonoids in the Rutaceae Family: Twenty Selected
Representatives of the Genera Citrus, Fortunella, Poncirus, Ruta and
Severinia Phytochemical analysis vol. 19, pp. 64-66, 2008.

346

[6] R. Koblovsk, L. Kokoka, B. Klejdus, O. Lapk, Isoflavonoids in the

Cannabaceae Family 54th Annual Congress on Medicinal Plant Research,
Helsinki, Finland, Planta Medica vol. 72, pp. 1027, 2006.

[8] T. M. Rose, J. G. Henikoff, S. Henikoff, CODEHOP (COnsensusDEgenerate Hybrid Oligonucleotide Primer) PCR primer design Nucleic
Acids Research vol. 31, pp. 3763-3766, 2003.

[7] R. Koblovsk, B. Klejdus, L. Kokoka, O. Lapk, Detection of

Isoflavonoids in Selected Representatives of the Solanaceae Family 54th
Annual Congress on Medicinal Plant Research, Helsinki, Finland, Planta
Medica. vol. 72, pp. 1027, 2006.

347