Vous êtes sur la page 1sur 6

Analysis of P53 mutations and their expression

in 56 colorectal cancer cell lines


Ying Liu and Walter F. Bodmer*
Cancer Research UK Cancer and Immunogenetics Laboratory, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital,
Oxford OX3 9DS, United Kingdom
Contributed by Walter F. Bodmer, November 23, 2005

A comprehensive analysis of the TP53 gene and its protein status


was carried out on a panel of 56 colorectal cancer cell lines. This
analysis was based on a combination of denaturing HPLC mutation
screening of all exons of the p53 gene, sequencing the cDNA, and
assessing the function of the p53 protein by assaying the induced
expression of phosphorylated p53 and p21 after exposing cells to
-rays. In a few cases where there was no production of p53
message nor evidence of functional p53 protein, all of the p53
exons were sequenced directly. Thirteen of the 56 cell lines had
functional p53, 21 lines had missense mutations (one of which
made no detectable protein), 4 lines produced no p53 transcripts,
and the remaining 18 lines carried truncating TP53 mutations. Thus,
our results showed a relatively high frequency of TP53 mutations
(76.8%) in our cell lines, with almost half of the mutations being
truncating mutations. This is a rather higher frequency of such
mutations than usually reported. Of the 18 cell lines with truncating mutations, 12 had detectable truncated protein based on
Western blot analysis, whereas no protein was detected in the
remaining 6 cell lines. Our data provide a valuable source of TP 53
mutations for further studies and raise the question of the extent
to which truncating mutations may have dominant negative effects, even when no truncated protein can be detected by standard
methods.
DNA damage p21 oncogenicity -ray tumorigenesis

he gene encoding p53 is found mutated in 50% of all types of


human cancers. Its most important normal function is probably
to direct cell cycle arrest at the G1 or G2 phase of the cell cycle after
certain types of DNA damage and to induce apoptosis when the
damage is too severe (1). The normal function of the p53 protein
can be assessed by its response to DNA damage, for example,
-irradiation. TP53 mutations in tumors are most probably primarily selected for, because they interfere with the apoptotic process.
To date, 75% of the TP53 mutations reported in colorectal
carcinomas (CRC) are missense mutations, which have been the
focus of in vitro and in vivo studies. The in vitro studies clearly show
that (i) many mutant p53 proteins can inhibit normal p53 function,
(ii) the mutant proteins can acquire new abnormal functions, and
(iii) different mutants vary in their oncogenicity (2). Recent in vivo
studies using mice transgenic for two mutations, R270H and
R172H, further support these findings (3, 4). These studies have
also, however, raised further questions. What are the mechanisms
that cause the variation in oncogenicity in different mutants? Could
they involve interactions between p53 and its relatives, such as p63
and p73 (5)? In the two mouse studies, the p53 mutants examined
were minimally present in normal tissues and became stabilized
only in tumors. It was therefore suggested that a key p53 regulatory
network must be altered for the mutant protein to be selected for
during tumor evolution (6). Thus, the role of mutant p53 in the
process of tumorigenesis may be much more complicated than
previously thought, involving cell-type specificity and potential
interactions with changes in other genes.
TP53 is estimated to be mutated in 4050% of CRCs (http:
www-p53.iarc.frindex.html and http:p53.free.fr). It is much
more frequently mutated in high-grade dysplastic polyps, which are

976 981 PNAS January 24, 2006 vol. 103 no. 4

thought to mark the transition from adenoma to carcinoma, than in


early adenomas. This finding implies that most TP53 mutations
probably occur before metastasis (7, 8). The mechanism of how, or
whether, p53 plays a role in the metastasis of CRC remains
unknown. In an effort to address the above questions, we have
carried out a thorough analysis of p53 status in a panel of 56
genetically well characterized CRC cell lines. The implications of
the results and comparisons with published data are discussed.
Results
TP53 Mutation Detection. Primers located at least 50 bp away from

the ends of each exon were designed to amplify exons 111 of the
TP53 gene (Table 1). All amplicons had exactly the size expected,
except in one case, namely exon 1 in cell line SW1222, where a
smaller amplicon than expected was observed. Sequencing confirmed that the anomalous amplicon was due to a 113-bp homozygous deletion. All amplicons were subjected to denaturing HPLC
(DHPLC) analysis on the WAVE machine (Transgenomic,
Omaha, NE). Samples showing abnormal patterns were subsequently sequenced. However, all of the exon 3 and 4 amplicons were
sequenced directly because they did not show clear-cut peaks in
DHPLC analysis. Based on this analysis, mutations were found in
37 cell lines (Table 2).
For the 19 cell lines in which no mutations were detected by
DHPLC analysis, RT-PCR was carried out to amplify the full length
of the p53 ORF. The complete TP53 ORF could be amplified in 11
of these cell lines. All of these ORF amplicons were sequenced
directly, and mutations were identified in two further cell lines,
CCK-81 and SNU-C2B. The p53 mRNA expression in the 8 cell
lines that had not yielded an amplified p53 ORF was subsequently
tested by using primers designed to amplify small regions of the
mRNA (see Expression of Mutant and Truncated p53).
In the 17 cell lines in which no mutations had so far been
identified, DNA damage experiments were carried out to ascertain
whether they had functional p53 protein. Each of these cell lines in
exponential growth phase was treated with 6 Gy -ray and harvested at 6 and 24 h after irradiation. The relative amounts of total
p53 and Ser-15-phosphorylated p53 were assessed by Western
blotting by using appropriate antibodies. Thirteen of these cell lines
showed obviously increased expression of phosphorylated p53, and,
in some cases total p53 (Fig. 1 and Table 3). Four cell lines, however,
showed unexpected p53 expression patterns after treatment. Thus,
in cell lines NCI-H716 and CoCM1, no total or phosphorylated p53
could be detected; in cell line RCM1, there was a smaller size p53
protein and no expression of phosphorylated p53; in cell line CC20,
there was no difference between the expression of total p53 and
phosphorylated p53 before or after DNA damage. To clarify the
cause of the abnormal expression of p53, direct sequencing of exons
Conflict of interest statement: No conflicts declared.
Freely available online through the PNAS open access option.
Abbreviations: CRC, colorectal carcinoma; DHPLC, denaturing HPLC.
*To whom correspondence should be addressed. E-mail: walter.bodmer@hertford.ox.ac.uk.
2006 by The National Academy of Sciences of the USA

www.pnas.orgcgidoi10.1073pnas.0510146103

Table 1. PCR amplification conditions for exons 111 of TP53 and their corresponding DHPLC
analysis conditions

Exon
1
2
34
56
7
89
10
11

Primer sequences
(5-3)
cacagctctggcttgcaga
agcgattttcccgagctga
agctgtctcagacactggca
gagcagaaagtcagtcccatg
agacctatggaaactgtgagtgga
gaagcctaagggtgaagagga
cgctagtgggttgcagga
cactgacaaccacccttaac
ctgcttgccacaggtctc
tggatgggtagtagtatggaag
gttgggagtagatggagcct
ggcattttgagtgttagactg
ctcaggtactgtgtatatacttac
atactacgtggaggcaagaat
tcccgttgtcccagcctt
taacccttaactgcaagaacat

PCR
product
size, bp

PCR Tm,
C

DHPLC denaturating
temperature, Cgradient
initial buffer B, %

442

66

6058, 6452

317

64*

6547

631

56*

N/A

550

64

6157, 6649

283

64

5854, 6646

455

64

5757, 6350

351

59

5755, 6546

476

58

5658, 6253

*With the addition of 0.5 Q (Qiagen PCR amplification kit).

Expression of Mutant and Truncated p53. The missense mutant p53

product in cell line NCI-H716 could not be detected at the protein


level by Western blot analysis (Fig. 1). This finding is in contrast to
previous reports that missense mutations produce stable mutant
p53 protein (810). To ascertain whether the rest of the cell lines
with missense mutations in TP53 contain detectable mutant p53
protein, Western blot analysis for p53 was carried out by using the
DO-1 antibody. The results showed that, of the 21 cell lines with
mutant p53 caused by missense mutations, only one line, NCIH716, did not show any expression of p53 protein.
Expression of p53 protein was also investigated by Western
blotting, as described above, by using antibody DO-1, in the 22 cell
lines with nonsense or frameshift mutations in TP53, which were
expected to cause truncated ORFs (Table 2). Eleven cell lines had
detectable expression of p53 by using DO-1, 9 of which showed a
single truncated p53 protein product, and 2 cell lines, HCA7 and
C70, each expressed two truncated products (Fig. 3). These double
products are presumably due to the presence of WT p53 in HCA7
and an alternative splice variant due to the splice site mutation in
Liu and Bodmer

C70. Freshly made Western blots from the remaining 11 cell lines,
in which no protein had been detected by antibody DO-1, were
hybridized with a different N-terminal antibody to p53, PAb 1801.
A single band with the expected truncated protein size was detected
in an additional cell line C80. This protein product was not
detectable by DO-1, perhaps because the relevant epitope was
obscured by the conformation of the mutant protein. All of the cell
lines with truncation mutations were also analyzed with another p53
antibody, PAb1802, with specificity for a determinant near the C
terminus of p53. As expected, they were all negative for this
C-terminal antibody (data not shown). No protein product was
detected consistently in the remaining 10 cell lines with truncation
or frameshift mutations in p53.
For all of the 11 cell lines in which no mutant or truncated p53
could be detected by Western blot analysis, RT-PCR was performed by using primers designed to amplify small regions of the
TP53 mRNA from exons 111 (Table 4, which is published as
supporting information on the PNAS web site) to ascertain whether
there was any, even relatively low, or partial expression of the
transcripts. Based on the results of this RT-PCR analysis, 7 of these
cell lines expressed TP53 mRNA, whereas 4 cell lines, namely
PCJW, T84, VACO400, and SW1222, did not show evidence of
any expression corresponding to any of the small overlapping
regions. This result was consistent with the prediction that cell lines
PCJW, VACO400, and SW1222 would have no transcripts due to
mutations in exon1. For T84, the absence of any observed transcript
could be due to the mutation at the splice site leading to the
production of a novel unstable transcript.
Discussion
An exhaustive study of a panel of 56 CRC cell lines for the presence
of TP53 mutations and the consequent expression of p53 mRNA
and protein was carried out. This study was based both on DNA and
RNA analysis, as well as functional tests. DHPLC screening detected 40 mutations, three of which were in cell lines that each
carried two mutations. Further sequencing of cDNA or genomic
DNA, from all of the lines where no mutation had been detected
by DHPLC, revealed 6 additional mutations, giving a total of 46
mutations detected in 43 of the 56 cell lines. This is a detection rate
of 86.96% by DHPLC, which is comparable with that previously
reported (11). DNA damage studies confirmed the expected function for p53 in the 13 cell lines with a normal functional TP53
sequence. Only in cell lines is it possible to do such a thorough
analysis, especially using functional assays.
PNAS January 24, 2006 vol. 103 no. 4 977

GENETICS

111 of these 4 cell lines was carried out. This sequencing revealed
that each of them carried mutations in TP53 (Table 2).
To further confirm that the phosphorylated p53 in the 13 cell
lines from the above study could indeed have an effect on its
expected target genes, the expression of p21 protein was analyzed
in those cell lines. Twelve of the 13 cell lines showed the expected
increase in p21 protein, whereas one cell line, NCI-747, did not
show any expression of p21 either before or after DNA damage
(Fig. 2 and Table 2). This finding may reflect mutation or deletion
of the p21 gene in this cell line.
Our results confirm that only one of the cell lines with mutant
p53, HCA7, also has WT p53 (Table 3). This result is in agreement
with our loss of heterozygosity (LOH) data for this region of
chromosome 17p (data can be provided on request). The two cell
lines SNU-C2B and VACO429 were each apparently heterozygous
for two different mutations. Full-length ORFs from these two lines
were amplified, cloned, and sequenced. The results revealed that
the different mutations in these two cell lines were indeed located
on different alleles (Table 2).
In summary, of the 56 cell lines analyzed, 40 have one mutation
and 3 have two mutations. The resulting 46 mutations include 22
missense mutations, 10 nonsense mutations, and 14 frameshift
mutations that are due to changes at a splice site or insertions or
deletions in the coding region (Table 2).

Table 2. TP53 mutations identified in 43 CRC cell lines


Mutation
type
Point mutation

Cell line

Location

C10
C106
C75
CaR-1
CC07
CCK-81
COLO320DM
CX-1
DLD1
HRA19
HT55
LIM1863
LS1034
LS123
NCI-H716
SNU-C2B

E7 codon 245
E4 codon 125
E7 codon 249
E8 codon 272
E7 codon 245
E8 codon 278
E7 codon 248
E8 codon 273
E7 codon 241
E8 codon 273
E6 codon 213
E7 codon 234
E7 codon 245
E5 codon 175
E6 codon 224
E8 codon 273 (hetero)

SW1116
SW480
SW837
VACO10MS
VACO5
C125-PM
C80
C84
CACO2
CC20
CoCM-1
LS411
RCM-1
SW403
VACO429

E5 codon 159
E8 codon 273
E7 codon 248
E5 codon 175
E8 codon 282
E6 codon 196
E4 codon 52
E10 codon 342
E6 codon 204
E5 codon 126
E6 codon 196
E5 codon 126
E8 codon 306
E4 codon 51
E8 codon 306
(Hetero)
E8 3 GT to GG
(1170 2T to G)
E1 3 GT to 3 AT
(223 1G to A)
E6 5 AG to 5 AT
(811 G to T)
E1 3 GT to 3 GC
(223 2T to C)
E9 codon 321
E7 codon 239
E4 codon 103
E4 codon 103
E8 codon 272
E8 codon 300 (hetero)
E1 114th of exon 1
E7 codon 238
E4 codon 117
E2 codon 58 (hetero)

C70
PC/JW
T84
VACO 400
Insertion

Deletion

COLO741
VACO4A
COLO201
COLO201
HCA46
HCA7
SW1222
SW1417
SW948
VACO429

Nucleotide
substitution

Mutation
effect

Mutation recorded in
CRCs at IARC*

P53 protein
detected

G to A (GGC to AGC)
C to T (ACG to ATG)
G to C (AGG to AGC)
G to A (GTG to ATG)
G to A (GGC to AGC)
C to A (CCT to CAT)
C to T (CGG to TGG)
G to A (CGT to CAT)
C to T (TCC to TTC)
G to A (CGT to CAT)
G to T (CGA to CTA)
T to C (TAC to CAC)
G to A (GGC to AGC)
G to A (CGC to CAC)
G to T (GAG to GAT)
C to T (CGT to TGT)
G to A (CGT to CAT)
C to A (GCC to GAC)
G to A (CGT to CAT)
C to T (CGG to TGG)
G to A (CGC to CAC)
C to T (CGG to TGG)
C to T (CGA to TGA)
C to T (CAA to TAA)
C to T (CGA to TGA)
G to T (GAG to TAG)
C to G (TAC to TAG)
C to T (CGA to TGA)
C to A (TAC to TAA)
C to T (CGA to TGA)
G to T (GAA to TAA)
C to T (CGA to TGA)

Gly to Ser
Thr to Met
Arg to Ser
Val to Met
Gly to Ser
Pro to His
Arg to Trp
Arg to His
Ser to Phe
Arg to His
Arg to Leu
Tyr to His
Gly to Ser
Arg to His
Glu to Asp
Arg to Cys
Arg to His
Ala to Asp
Arg to His
Arg to Trp
Arg to His
Arg to Trp
Arg to Stop
Gln to Stop
Arg to Stop
Glu to Stop
Tyr to Stop
Arg to Stop
Tyr to Stop
Arg to Stop
Glu to Stop
Arg to Stop

Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Not, but in other cancers
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Not, but in other cancers
Yes
Yes
Not, but in other cancers
Yes
Yes
Yes
Not, but in other cancers
Yes

T to G

Frameshift

Not, but in other cancers

G to A

Frameshift

Not

G to T

Frameshift

Yes

T to C

Frameshift

Not

AA insertion
A insertion
T insertion
25 bp deletion
2 bp TG deletion
1 bp C deletion
113 bp deletion
14 bp deletion
1 bp G deletion
1 bp T deletion

Frameshift
Frameshift
Frameshift
Frameshift
Frameshift
Frameshift
Frameshift
Frameshift
Frameshift
Frameshift

No
Yes
No
No
No
Yes
No
Yes
Yes
No

*Data from the IARC TP53 mutation database.


E means exon in all cases.
The underlined base in each case is that which is changed.
Also included with the Deletion category.
RNA message was found in all cases except where indicated by this keynote.

We have compared our data with those in the International


Agency for Research on Cancer (IARC) database (http:wwwp53.iarc.frindex.html) (12). This is one of the two most regularly
updated databases for TP53 mutations, the other one being the
Universal Mutation Database-p53 database at http:p53.free.
fr(13). The comparison of the distributions of the positions of
single base pair substitutions in our cell line data with that in the
IARC database shows them to be quite similar. In particular, it
is clear that a high proportion of the missense mutations are in
or near the p53 DNA-binding region that is between codons 102
and 292 (14). We have also found very similar positions with a
978 www.pnas.orgcgidoi10.1073pnas.0510146103

high frequency of mutational events to those found in colon


carcinomas. Thus, identical mutations at codons 245 and 273
were found in three different cell lines, identical mutations at
codons 248 and 175 in two different lines, whereas nonsense
mutations at codon 126 were also found in two different lines.
We found only one example of a cell line with both a WT and
mutant form of TP53, which is in agreement with essentially all
previous reports on data from carcinomas.
The main differences between our data and those in the
database are as follows. (i) The proportion of the cell lines with
p53 mutations, 76.8% (4356), is much higher than the average
Liu and Bodmer

Table 3. Presence of total p53, phosphorylated p53 (Ser15P), and


p21 in cell lines with WT TP53 before and after -irradiation

Cell line

Total p53
before
-irradiation

Total p53
increased
after
-irradiation

Ser15P p53
increased
after
-irradiation

P21
increased
after
-irradiation

C32
C99
COLO678
Gp2D
HCT116
LOVO
LS180
LS174T
LS513
NCI-747
RKO
SKCO-1
SW48

No
No
No
Yes
Yes
Yes
No
No
Yes
No
Yes
No
Yes

Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes

Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
Yes
No*
Yes
Yes
Yes

The data are based on western blot analysis using appropriate antibodies,
as described in Materials and Methods.
*This cell line produced no detectable p21.

of 50% usually reported for colon carcinomas (http:wwwp53.iarc.frindex.html). (ii) The proportion of missense mutations among these is significantly lower, at 47.83% (2246)
as compared with 80.22% (223278) in the IARC database
(P 0.0018) (Fig. 4 Left). A more detailed comparison of the
types of mutations we have found in the cell lines and those
reported in the IARC database is illustrated in Fig. 4 Right.
This comparison shows quite similar proportions for the
different types of point mutations. In particular, the proportion of the point mutations that are transitions at CpG sites is
37.5%, which is comparable with that in the IARC database.
The figures indicate the expected relatively high mutation rate
at CpG positions, based on the arguments of Sved and Bird
(15), and as also found for the APC gene in CRCs (16).
Among the 46 mutations identified in our cell lines, 13 have
not been identified in CRCs before, although 5 have been
reported in other types of cancers (Table 2). This result
ref lects a wider range of types of mutations we have found in
the cell lines than is reported in the IARC database. Overall,
74.42% (3243) of p53 mutant cell lines made p53 protein
product detectable by Western blots using two different antibodies. However, only 4 of the 43 lines made no TP53
transcripts, raising the question as to whether protein product
was actually made by the remaining 7 cell lines that was not
detectable by the Western blot analysis. This finding could be
Liu and Bodmer

GENETICS

Fig. 1. P53 status in CRC cell lines after -radiation. Cell lines were irradiated
with 6 Gy and harvested after 6 and 24 h. The corresponding cell extracts were
then analyzed by Western blotting with the anti-p53 antibodies DO-1 and
Ser15P as described in Materials and Methods. An increase in Ser15P-detected
activity shows that P53 was stabilized in cell lines with WT p53: HCT116, LS180,
SW48, and NCI-747. There was either no change in reactivity after irradiation,
or lack of reactivity with either antibody in cell lines with mutant p53: LS411,
NCI-H716, LS123, and VACO5. LS411 is a mutant line with truncated p53 that
cannot be detected, NCI-H716 has a missense mutation whose mutant p53
protein product cannot be detected, and LS123 and VACO5 both have a
mutant p53 that is stabilized without stimulation by DNA damage.

(i) because both the p53 antibody epitopes (DO-1 and


PAb1801) were obscured by the mutations in these cell lines or
(ii) because the turnover rate of these protein products was too
rapid for detection, or, and perhaps the least likely (iii) because
the protein product was somehow sequestered in a compartment of the cell not allowing efficient extraction. Another
distinct possibility is that other antibodies might detect protein
products associated with alternative p53 transcripts in the 7
lines that make at least some fragments of p53 message. This
suggestion is based on recent evidence for the existence of p53
isoforms even in normal tissues (17). The data presented here
are entirely consistent with a dominant negative effect for most
p53 mutations, as has often been suggested. If only lack of p53
activity were selected for, then a much higher proportion of
mutations with small deletions and insertions and complete
lack of function would be expected. Thus, as emphasized
before, TP53 is not really a tumor suppressor gene, although
loss of the normally functioning version of the gene is almost
universal after the first partially dominant mutation has been
selected. Further investigation is needed to establish whether

Fig. 2. P21 expression detected by p21 antibody in CRC cell lines after DNA
damage. Cells from each line were irradiated with a dose of 6 Gy -ray and
harvested after 6 and 24 h. Cell extracts were then analyzed by Western
blotting with an anti-p21 antibody as described in Materials and Methods. P21
expression was increased after radiation in cell lines HCT116, LS180, SW48,
C32, and LOVO, but was not detected at all in NCI-747. None of these lines
carried TP53 mutations.
PNAS January 24, 2006 vol. 103 no. 4 979

Fig. 3. Detection of truncated p53 in CRC cell lines with anti-p53 antibody
DO-1. Cell extracts were analyzed by Western blotting by using DO-1 as
described in Materials and Methods. Samples from 110 are: C70, C84,
COLO678, COLO741, Gp2d, HCA7, LS513, SW948, VACO4A, and VACO429. Cell
line LS513 (position 7) is a positive control from a line with normal TP53. C70
(position 1) and HCA7 (position 6) each showed two different products and
SW948 (position 8) lacked evidence of any product, whereas the remaining 6
lines each showed a single product.

the truncated products do indeed have dominant negative


effects.
There are three main possible reasons why the distribution of p53
mutations found in this study of cell lines is somewhat different
from that in the public database. The first, and most obvious, is that
our exhaustive approach to finding p53 mutations in the cell lines
has detected mutations that might well be missed in analysis of fresh
tumor material. This possibility is accentuated by the fact that
primary tumor material is often contaminated with normal tissue,
which makes mutation detection less efficient. There is also a bias
in screening for mutations based on expectations from previously
reported results. For example, exon 1 of TP53 has been overlooked
in nearly all of the mutation detection studies reported so far (14).
Our data emphasize the need to sequence every exon of a candidate
gene to be sure of detecting all, or at least the great majority, of the

mutations that may be present in a tumor. Such sequencing is


demanding, especially when dealing with primary tumor material.
A second possibility as to why our distribution of TP53 mutations
is different is that cell lines may grow out preferentially from
primary tumors containing a particular range of p53 mutations. It
is well known that only 1015% of colon carcinomas generally
give rise to cell lines so that there is certainly plenty of opportunity
for such selection to occur. The third, and we believe by far the least
likely, possibility is that some of the mutations have been selected
for in tissue culture. This possibility is made unlikely by the
consistency of genetic data obtained from cell lines from the same
tumor source, but which have been cultured independently for long
periods of time.
Our comprehensive study of p53 mutations in a panel of 56 cell
lines has revealed some unexpected mutations and has widened the
scope of studies needed to understand the role of p53 mutations in
the evolution of colorectal, and possibly most other, carcinomas.
Materials and Methods
Cell Lines and Cell Culture. Fifty-six different CRC cell lines were
studied. The references for these cell lines can be obtained from the
authors. A summary of the tissue culture conditions for the cell lines
is as follows: cell lines CACO2, CC07, CC20, CCK-81, COLO201,
COLO320DM, CX-1, DLD1, Gp2d, HCA7, HCT116, HT29,
HT55, LIM1863, LOVO, LS180, LS1034, LS123, LS174T, LS411,
PCJW, RCM-1, SKCO-1, SW1116, SW403, SW48, SW480,
SW837, SW948, and T84 were cultured in DMEM [provided by
Cancer Research UK (CRUK)] in 10% CO2; cell lines COLO678,
COLO741, LS513, NCI-H716, NCI-747, RKO, SNU-C2B,
SW1222, and SW1417 were cultured in RPMI medium 1640
(provided by CRUK) in 5% CO2; and cell lines C10, C106,
C125-PM, C32, C70, C75, C80, C84, C99, CaR-1, CoCM-1, HCA46,
HRA19, VACO400, VACO10MS, VACO429, VACO4A, and
VACO5 were cultured in Iscoves modified Dulbeccos medium
(Invitrogen) in 10% CO2. All of the media were used with 10% FBS
(Autogen Bioclear, Wiltshire, U.K.) and 6 mM L-glutamine

Fig. 4. Comparisons of the distributions of


types of TP53 mutations in cell lines and in
the IARC database. (Left) Overall TP53 mutation effects in 43 CRC cell lines (Upper Left)
compared with that in colon carcinomas in
the IARC database updated in July 2005
(Lower Left). (Right) Detailed distribution of
TP53 mutational events observed in 43 CRC
cell lines (Upper Right) compared with that
in CRCs in the IARC database updated in July
2005 (Lower Right).
980 www.pnas.orgcgidoi10.1073pnas.0510146103

Liu and Bodmer

Preparation of DNA, RNA, and Protein from Cell Lines. DNA and RNA

were extracted from cells by using the DNeasy Tissue Kit (Qiagen,
Crawley, U.K.) and the RNeasy Mini Kit (Qiagen), respectively,
following the manufacturers protocols. For protein extraction, cells
were rinsed with PBS and lysed in RIPA buffer [150 mM NaCl1%
(wtvol) Nonidet P-400.5% sodium deoxycholate0.1% SDS50
mM TrisCl, pH 7.5] supplemented with a protease inhibitor
mixture (Complete Mini tablets, Roche Diagnostics). For routine
quantitation of proteins, the bicinchoninic acid procedure was used,
according to the manufacturers protocol (Pierce).
PCR Amplification of Exons 111 of TP53 for Mutation Detection.

Primers were designed to amplify exons 111 of TP53 (Table 1). The
standard PCR was in a volume of 50 l containing 50 ng template
DNA, 10 pmol of each primer, 0.25 mM each dNTP, 2.5 mM
MgCl2, 5 units of AmpliTaq Gold (Applied Biosystems), 1 Taq
Gold buffer (Applied Biosystems), and the appropriate volume of
H2O. For exons that could not be amplified by using the above
condition, 0.5 Q solution (Qiagen) was used following the
manufacturers protocol (Table 1). Touchdown PCR programs
(18) were then used to amplify the exons: 1 cycle of denaturation
(12 min at 95C), 15 cycles of denaturation (95C for 30 s), annealing
temperature (Tm; 7.5C for 30 s, with 0.5C per cycle), and
extension (72C for 30 s), followed by 20 cycles of denaturation
(95C for 30 s), annealing (Tm, 30 s), and extension (72C for 30 s),
and a final extension cycle of 72C for 10 min.
Mutation Detection Using DHPLC. Each PCR amplicon amplified as
above was mixed with an equal amount of the corresponding PCR
amplicon from a known normal sample. The mixed PCR amplicons
were denatured at 95C for 4 min, followed by 1-min cycles of
decreasing temperature at a rate of 1.6C per cycle down to 15C.
After this procedure, the amplicon mixtures were analyzed by
DHPLC on a WAVE Machine (Transgenomic). A 2% per minute
increase in buffer B (as provided by the manufacturer) was used for
all of the fragments. The denaturing temperatures for each exon
and the corresponding initiating buffer B percentages are indicated
in Table 1.
RT-PCR. cDNA from each cell line was synthesized from 2 g of

denatured RNA (65C for 5 min) by incubation at 37C for 60 min


with final quantities or concentrations of 1 M of oligo(dT), 4 units
of Omniscript reverse transcriptase (Qiagen), 10 units of RNase
inhibitor (Ambion, Huntingdon, U.K.), and 0.5 mM each dNTP.
Primers used for p53 RT-PCR are summarized in Table 5, which is
published as supporting information on the PNAS web site. Primers
used for actin RT-PCR were: forward, 5-ACACCTTCTACAATGAGC-3 and reverse, 5-ACGTCACACTTCATGATG3. All RT-PCRs were carried out in a 25-l PCR containing 0.2
1. El-Deiry, W. S. (1998) Semin. Cancer Biol. 8, 345357.
2. Sigal, A. & Rotter, V. (2000) Cancer Res. 60, 67886793.
3. Lang, G. A., Iwakuma, T., Suh, Y. A., Liu, G., Rao, V. A., Parant, J. M.,
Valentin-Vega, Y. A., Terzian, T., Caldwell, L. C., Strong, L. C., et al. (2004)
Cell 119, 861872.
4. Olive, K. P., Tuveson, D. A., Ruhe, Z. C., Yin, B., Willis, N. A., Bronson, R. T.,
Crowley, D. & Jacks, T. (2004) Cell 119, 847860.
5. Melino, G., Lu, X., Gasco, M., Crook, T. & Knight, R. A. (2003) Trends Biochem. Sci.
28, 663670.
6. Van Dyke, T. (2005) Nature 434, 287288.
7. Fearon, E. R. & Vogelstein, B. (1990) Cell 61, 759767.
8. Rodrigues, N. R., Rowan, A., Smith, M. E., Kerr, I. B., Bodmer, W. F., Gannon,
J. V. & Lane, D. P. (1990) Proc. Natl. Acad. Sci. USA 87, 75557559.
9. Bartek, J., Bartkova, J., Vojtesek, B., Staskova, Z., Rejthar, A., Kovarik, J. &

Liu and Bodmer

M each primer, 2.5 units of AmpliTaq Gold, 1.5 mM MgCl2, 200


M each dNTP, and 200 g (for p53 amplification) or 100 g (for
-actin amplification) of cDNA. The cycling conditions used for
these PCRs were as follows: 95C for 10 min, 30 (for p53) or 25 (for
-actin) cycles of 95C for 30 s, the appropriate annealing temperature for p53 as shown in Table 4 and 56C (-actin) for 45 s, and
72C for 60 s, with a final extension step of 72C for 10 min.
Sequencing. PCR amplicons showing abnormal DHPLC patterns

were sequenced directly by using the appropriate PCR primers and


Big Dye Sequencing kit (Applied Biosystems) on an ABI 377
(Applied Biosystems) sequencer. Before the sequencing reaction
was performed, 20 l of the PCR was treated with 4 units of
Exonuclease I (New England Biolabs) and 1 unit of Shrimp
Alkaline Phosphatase (SAP, Amersham Pharmacia) at 37C for
1.5 h and 80C for 20 min. Approximately 100 ng of treated
amplicon was used for each sequencing reaction. RT-PCR amplicons were sequenced in a similar manner but with two additional
internal pairs of primers: forward 5-ACAGCCAAGTCTGTGACTTG-3, reverse 5-GTGATGATGGTGAGGATGG-3; forward 5-AGGTTGGCTCTGACTGTACCA-3 and reverse 5TCCTTCCACTCGGATAAGATGC-3. In two cell lines where
two mutations were identified, the corresponding p53 ORF amplicons were purified with QIAquick kit (Qiagen) and then subcloned
into TOPO TA vector (Invitrogen). At least 10 clones from each
cloning were sequenced by using vector primers and internal
primers (Table 4). Sequencing data were analyzed by using the
SEQUENCHER program (Gene Codes, Ann Arbor, MI).
Western Blotting. Protein samples were denatured, separated by

SDSPAGE gel, and transferred onto Hybond-P nitrocellulose


membrane (Amersham Pharmacia) by using the MiniPROTEAN
3 apparatus (Bio-Rad). Membranes were rinsed and blocked with
0.05% Tween 20 (Sigma) and 1% skimmed milk in PBS for 1 h with
3 changes of this blocking buffer every 20 min at room temperature.
Membranes were then incubated with primary antibodies in blocking buffer after conditions described in Table 5. After washing
membranes in blocking buffer for 1 h with a change of the buffer
every 15 min at room temperature, they were incubated for 1 h with
appropriate secondary antibody (HRP Rabbit Anti-Mouse Immunoglobulin for monoclonal primary antibody, and HRP Goat
Anti-Rabbit Immunoglobulin for polyclonal primary antibody,
DAKO) in blocking buffer for 1 h with mild shaking, and then
washed in the same fashion as that after incubation with the primary
antibody. Membranes were visualized by using ECL plus Western
blotting detection system (Amersham Pharmacia). Anti-actin
monoclonal antibody (Sigma) was hybridized to membranes to
serve as a measure of loading control.
We thank David Bicknell, Bruce Winney, and Jenny Wilding in our
group for helpful discussions. We also thank David Lane for permission
to use the P53 antibodies DO-1, PAb 1801, and PAb 1802, and the CRUK
cell culture service for providing these antibodies. Y.L. is a research
fellow sponsored by GlaxoSmithKline.
Lane, D. P. (1990) Int. J. Cancer 46, 839844.
10. Iggo, R., Gatter, K., Bartek, J., Lane, D. & Harris, A. L. (1990) Lancet 335,
675679.
11. Xiao, W. & Oefner, P. J. (2001) Hum. Mutat. 17, 439474.
12. Olivier, M., Eeles, R., Hollstein, M., Khan, M. A., Harris, C. C. & Hainaut, P.
(2002) Hum. Mutat. 19, 607614.
13. Soussi, T., Dehouche, K. & Beroud, C. (2000) Hum. Mutat. 15, 105113.
14. Soussi, T. & Beroud, C. (2001) Nat. Rev. Cancer 1, 233240.
15. Sved, J. & Bird, A. (1990) Proc. Natl. Acad. Sci. USA 87, 46924696.
16. Bodmer, W. (1999) Cytogenet. Cell Genet. 86, 99104.
17. Bourdon, J. C., Fernandes, K., Murray-Zmijewski, F., Liu, G., Diot, A., Xirodimas,
D. P., Saville, M. K. & Lane, D. P. (2005) Genes Dev. 19, 21222137.
18. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K. & Mattick, J. S. (1991)
Nucleic Acids Res. 19, 4008.

PNAS January 24, 2006 vol. 103 no. 4 981

GENETICS

(CRUK). All cultures were mycoplasma free and maintained in a


humidified atmosphere with controlled CO2 content as indicated
above.