FOODBORNE PATHOGENS AND DISEASE

Volume 8, Number 5, 2011

Mary Ann Liebert, Inc.
DOI: 10.1089=fpd.2010.0769

Detection of Shiga ToxinProducing Escherichia coli O26,

O45, O103, O111, O113, O121, O145, and O157 Serogroups
by Multiplex Polymerase Chain Reaction of the wzx Gene
of the O-Antigen Gene Cluster
Chitrita DebRoy,1 Elisabeth Roberts,1 Angela M. Valadez,2 Edward G. Dudley,2 and Catherine N. Cutter 2

Abstract

O-antigens on the surface of Escherichia coli are important virulence factors that are targets of both the innate and
adaptive immune system and play a major role in pathogenicity. O-antigens that are responsible for antigenic
specificity of the strain determine the O-serogroup. E. coli O26, O45, O103, O111, O113, O121, O145, and O157
have been the most commonly identified O-serogroups associated with Shiga toxinproducing E. coli (STEC)
implicated in outbreaks of human illness all over the world. A multiplex polymerase chain reaction assay was
developed to simultaneously detect the eight STEC O-serogroups targeting the wzx (O-antigen-flippase) genes of
all O-antigen gene clusters. The sensitivity of the multiplex polymerase chain reaction was found to be 10 colony
forming units for each O-group when enriched in broth and 100 colony forming units when enriched in artificially inoculated apple juice diluted with tryptic soy broth for 16 h at 378C. The method can be used for
detecting STEC O-groups simultaneously and may be exploited for improving the safety of food products.
Introduction

Materials and Methods

Bacterial strains

higa toxinproducing Escherichia coli (STEC) have

emerged as important food-borne pathogens and pose
serious public health concerns. STEC strains, including E. coli
O157:H7, have been implicated in diarrhea, hemorrhagic colitis, and hemolytic uremic syndrome (Karmali, 1989). Serogroups O26, O45, O103, O111, O121, and O145 have been
identified as the big six non-O157 STEC by the U.S. Centers
for Disease Control and Prevention as causative agents in
human illness (Brooks et al., 2005). Beef and dairy cattle are
known reservoirs of STEC strains (Hussein, 2007) that can
potentially contaminate beef carcasses during processing. The
overall incidence of non-O157 STEC infections is difficult to
estimate since these STEC serogroups are not routinely
screened (Bettelheim, 2007). Inability to ferment sorbitol has
been exploited to facilitate simple and rapid detection methodology for O157:H7. However, no analogous detection
procedures are yet available for non-O157 STECs. There is a
need to identify predominant STEC serogroups involved in
human infections. The objective was to develop a multiplex
polymerase chain reaction (m-PCR) assay to detect the eight
STEC O-groupsO26, O45, O103, O111, O113, O121, O145,
and O157simultaneously in a single reaction. The method
can be utilized for detecting STEC O-groups in any sample by
the food industry, regulatory agencies, and researchers.

E. coli strains O26 (H311b), O45 (K42), O91 (H307b), O103

(H515b), O111 (Stoke W), O113 (618250), O121 (39w), O145
(E1385), and O157 (A2) (rskov et al., 1977), K12, and reference
strains belonging to all designated O-groups were used. Bacillus
cereus, Citrobacter freundii, Enterobacter cloacae, Enterococcus aerogenes, Enterococcus faecalis, Hafnia alvei, Klebsiella pneumonia, Listeria monocytogenes, Pseudomonas aeroginosa, Proteus vulgaris,
Salmonella enteritidis, Serratia marcescens, Shigella boydii, Staphylococcus aureus, Vibrio cholerae, and Yersinia enterocolitica were tested.
Multiplex PCR
Genomic DNA was extracted from a bacterial colony by
resuspending in 150 mL of water, boiled at 1008C for 10 min
and centrifuged for 2 min at 13,000 g. DNA (1 mg) from E. coli
belonging to each of the serogroups O26, O45, O103, O113,
and O111; 2 mg of DNA from O121; and 4 mg from O145 and
from O157 were pooled and used as the positive control. The
wzx gene (O-antigen flippase) in the O-antigen gene cluster
was targeted for m-PCR assay.
The primer sequences for the forward (F) and reverse (R)
reactions for O-groups were as follows: O26 F, caatgggcg
gaaattttaga and O26 R, ataattttctctgccgtcgc; O45 F, tgcagt

1
E. coli Reference Center, Department of Veterinary and Biomedical Sciences and 2Department of Food Science, The Pennsylvania State
University, University Park, Pennsylvania.

651

652
aacctgcacgggcg and O45 R, agcaggcacaacagccactact; O103 F,
ttggagcgttaactggacct and O103 R, gctcccgagcacgtataaag; O111
F, tgtttcttcgatgttgcgag and O111 R, gcaagggacataagaagcca;
O113 F, tgccataattcagagggtgac and O113 R, aacaaagctaa
ttgtggccg; O121 F, tccaacaattggtcgtgaaa and O121 R, agaaag
tgtgaaatgcccgt; O145 F, ttcattgttttgcttgctcg and O145 R,
ggcaagctttggaaatgaaa; O157 F, tcgaggtacctgaatctttccttctgt and
O157 R, accagtcttggtgctgctctgaca.
Primers (2 mM each) were mixed with m-PCR reaction solution provided to a final volume of 47 mL according to Qiagens multiplex kit instructions (Qiagen, Valencia, CA).
Pooled DNA (3 mL) from E. coli belonging to all O-groups
(positive control) was mixed with the master mix (47 mL). PCR
amplification was conducted by initial denaturation at 958C
for 15 min followed by 30 cycles of denaturation at 948C for
30 sec, primer annealing at 578C for 1.5 min followed by extension at 728C for 1.5 min, and a final extension for 10 min at
728C. The amplified DNA was electrophoresed in an agarose
gel (1.5%) for 45 min at 175 V. The DNA was stained with
ethidium bromide and observed under ultraviolet light. The
gel images were captured electronically using a gel imaging
system. E. coli K12 was used as the negative control.

DEBROY ET AL.

FIG. 1. Multiplex polymerase chain reaction (m-PCR) assay

for detecting Shiga toxinproducing Escherichia coli (STEC)
O-groups. Lane 1, Molecular weight markers; Lane 2, Pooled
amplified DNA generated from eight STEC O-groups in one
m-PCR reaction; Lane 3, Negative control strain E. coli K12;
Lane 4, O26 (155 bp); Lane 5, O45 (238 bp); Lane 6, O103 (321
bp); Lane 7, O111 (438 bp); Lane 8, O113 (514 bp); Lane 9, O121
(628 bp); Lane 10, O145 (750 bp); and Lane 11, O157 (894 bp).

Sensitivity of m-PCR
All eight E. coli O-groups were grown overnight in tryptic
soy broth (TSB) at 378C. Each of the serogroups was diluted
serially and enumerated on tryptic soy agar plates and grown
for 24 h at 378C. Diluted cultures of each O-group were added
to TSB medium (15 mL) and to pasteurized apple juice diluted
with TSB (50:50; 15 mL). Each of these cultures was immediately divided into three parts of 5 mL each. One part was not
incubated, the other was incubated for 1 h at 378C, and the
third was grown overnight at 378C. Final concentrations of the
bacteria in 5 mL were calculated to be 0, 104, 105, and 106
colony forming units (CFU) for each O-group. The bacteria
were centrifuged from each of these 5 mL samples, resuspended in 1 mL sterile water, and boiled at 1008C for
10 min, and DNA was extracted as described. DNA (1 mL) was
diluted to 3 mL with water for m-PCR assays. The CFU in the
PCR mix was calculated based on the DNA (1 mL) that was
derived from 5 mL cells in enrichment media. The sensitivity
of the assay was defined as the lowest concentration of STEC
that yielded positive results reproducibly for m-PCR.
Results and Discussion
The m-PCR assay targeting the wzx gene of the O-antigen
gene clusters showed amplification of all eight STEC Ogroups (Fig. 1) but no signal was observed for K12. The primer
pairs were designed based on similar melting temperature for
all O-groups and easily distinguishable amplicon sizes. The
specificity of the m-PCR was tested against all designated Ogroups and other bacterial species. None of the other Ogroups or bacteria exhibited any positive reaction, showing
that the assay was specific for the targeted STEC O-groups.
The specificity of the m-PCR assay was evaluated in TSB and
in artificially inoculated pasteurized apple juice diluted with
TSB. The m-PCR signals for all eight O-groups could be detected in samples inoculated with 104 CFU in TSB and 105 CFU
in spiked apple juice after enrichment for 16 h at 378C and not
in samples incubated for 0 and 1 h of enrichment. Therefore, the
detection level of PCR was calculated to be 10 CFU=O-group in

TSB and 100 CFU=O-group for spiked apple juice. The experiment was repeated twice with same results. The m-PCR assay
in conjunction with established PCR targeting shiga toxin
genes (stx1 and stx2) and intimin (eae) could identify the serogroup and virulence genes in isolated colonies or enrichment
media. The method is rapid, sensitive, and specific and can be
used for screening STEC strains in different types of samples.
Disclosure Statement
No competing financial interests exist.
References
Bettelheim KA. The non-O157 Shiga-toxigenic (verocytotoxigenic) Escherichia coli; under-rated pathogens. Crit Rev Microbiol 2007;33:6787.
Brooks JT, Sowers EG, Wells JG, Greene KD, Griffin PM,
Hoekstra RM, and Strockbine NA. Non -O157 Shiga Toxin
Producing Escherichia coli Infections in the United States, 1983
2002. J Infect Dis 2005;192:14221429.
Hussein HS. Prevalence and pathogenicity of shiga toxin
producing Escherichia coli in beef cattle and their products.
J Anim Sci 2007;85:6372.
Karmali MA. Infection by Verocytotoxin-producing Escherichia
coli. Clin Microbiol Rev 1989;2:1538.
rskov I, rskov F, and Jann K. Serology, chemistry and genetics of O and K antigens of Escherichia coli. Bacteriol Rev
1977;41:667710.

Address correspondence to:

Chitrita DebRoy, Ph.D.
E. coli Reference Center
Department of Veterinary and Biomedical Sciences
The Pennsylvania State University
104 Wiley Lab
Wiley Lane
University Park, PA 16802
E-mail: rcd3@psu.edu

This article has been cited by:

1. Amanda L. Svoboda, Edward G. Dudley, Chitrita DebRoy, Edward W. Mills, Catherine N. Cutter. 2013. Presence of Shiga Toxin
Producing Escherichia coli O-Groups in Small and Very-Small Beef-Processing Plants and Resulting Ground Beef Detected by
a Multiplex Polymerase Chain Reaction Assay. Foodborne Pathogens and Disease 10:9, 789-795. [Abstract] [Full Text HTML]
[Full Text PDF] [Full Text PDF with Links]
2. Fei Wang, Qianru Yang, Julie A. Kase, Jianghong Meng, Laurie M. Clotilde, Andrew Lin, Beilei Ge. 2013. Current Trends in
Detecting Non-O157 Shiga ToxinProducing Escherichia coli in Food. Foodborne Pathogens and Disease 10:8, 665-677. [Abstract]
[Full Text HTML] [Full Text PDF] [Full Text PDF with Links]
3. Narasimha V. Hegde, Craig Praul, Andrew Gehring, Pina Fratamico, Chitrita DebRoy. 2013. Rapid O serogroup identification
of the six clinically relevant Shiga toxin-producing Escherichia coli by antibody microarray. Journal of Microbiological Methods
93:3, 273-276. [CrossRef]
4. Salim T. Islam, Joseph S. Lam. 2013. Wzx flippase-mediated membrane translocation of sugar polymer precursors in bacteria.
Environmental Microbiology 15:4, 1001-1015. [CrossRef]
5. Dilecta DCosta, Saroj N. Bhosle, R. B. Dhuri, S. P. Doijad, K. V. Poharkar, D. R. Kalorey, S. B. Barbuddhe. 2013. Prevalence,
Serogroups, Shiga-toxin Genes and Pulsed Field Gel Electrophoresis Analyses of Escherichia coli Isolated from Bovine Milk.
Proceedings of the National Academy of Sciences, India Section B: Biological Sciences . [CrossRef]
6. Narasimha V. Hegde, Rebecca Cote, Bhushan M. Jayarao, Mark Muldoon, Klaus Lindpaintner, Vivek Kapur, Chitrita DebRoy.
2012. Detection of the Top Six Non-O157 Shiga ToxinProducing Escherichia coli O Groups by ELISA. Foodborne Pathogens
and Disease 9:11, 1044-1048. [Abstract] [Full Text HTML] [Full Text PDF] [Full Text PDF with Links]
7. Jianfa Bai, Zachary D. Paddock, Xiaorong Shi, Shubo Li, Baoyan An, Tiruvoor G. Nagaraja. 2012. Applicability of a Multiplex
PCR to Detect the Seven Major Shiga ToxinProducing Escherichia coli Based on Genes That Code for Serogroup-Specific
O-Antigens and Major Virulence Factors in Cattle Feces. Foodborne Pathogens and Disease 9:6, 541-548. [Abstract] [Full Text
HTML] [Full Text PDF] [Full Text PDF with Links]
8. Chitrita DebRoy, Elisabeth Roberts, Pina M. Fratamico. 2011. Detection of O antigens in Escherichia coli. Animal Health Research
Reviews 12:02, 169-185. [CrossRef]
9. Zachary Paddock, Xiaorong Shi, Jianfa Bai, T.G. Nagaraja. 2011. Applicability of a multiplex PCR to detect O26, O45, O103,
O111, O121, O145, and O157 serogroups of Escherichia coli in cattle feces1. Veterinary Microbiology . [CrossRef]