Mol Biol Rep (2012) 39:95219527

DOI 10.1007/s11033-012-1816-4

Characterization of a novel ERF transcription factor

in Artemisia annua and its induction kinetics
after hormones and stress treatments
Xu Lu Weimin Jiang Ling Zhang Fangyuan Zhang Qian Shen
Tao Wang Yunfei Chen Shaoyan Wu Zongyou Lv Erdi Gao
Bo Qiu Kexuan Tang

Received: 26 November 2011 / Accepted: 10 June 2012 / Published online: 20 June 2012
Springer Science+Business Media B.V. 2012

Abstract The full-length cDNA sequence of AaERF3

was cloned and characterized from Artemisia annua. The
bioinformatic analysis and phylogenetic tree analysis
implied that the AaERF3 encoded a putative protein of 193
amino acids which formed a closely related subgroup with
AtERF1, ERF1 and ORA59 in Arabidopsis. The result of
subcellular localization showed that AaERF3 targeted to
both of the nuclei and the cytoplasm. The qRT-PCR
analysis showed that Green young alabastrums had the
highest expression level of AaERF3 in the 5-months-old
plants. The qRT-PCR analysis also revealed that ABA,
Wound and Cold treatments significantly enhanced the
transcript expression of AaERF3. MeJA and Ethylene
treatment could also slightly induce the accumulation of
AaERF3 transcription.
Keywords Ethylene response factor  Induction kinetics 
Subcelluar localization

Xu Lu and Weimin Jiang contributed equally to this work.

The novel nucleotide sequence data published here has been
deposited in the EMBL/DDBJ/GenBank databases under accession
number JN695782.

Electronic supplementary material The online version of this

article (doi:10.1007/s11033-012-1816-4) contains supplementary
material, which is available to authorized users.
X. Lu  W. Jiang  L. Zhang  F. Zhang  Q. Shen  T. Wang 
Y. Chen  S. Wu  Z. Lv  E. Gao  B. Qiu  K. Tang (&)
Plant Biotechnology Research Center, SJTUCornell
Institute of Sustainable Agriculture and Biotechnology,
Fudan-SJTU-Nottingham Plant Biotechnology R&D Center,
School of Agriculture and Biology, Shanghai Jiao Tong
University, Shanghai 200240, Peoples Republic of China
e-mail: kxtang1@yahoo.com

Introduction
Plant hormones such as abscisic acid (ABA), jasmonic acid
(JA), and ethylene (ET) are important components in
stress-related signaling pathways [13]. The AP2/ERF
transcription factors are one of the most important families
that are involved in plant response to biotic and abiotic
stresses, and regulation of metabolism and development
processes in various plant species [4]. The AP2/ERF
superfamily is defined by the AP2/ERF domain, which
consists of about 6070 amino acids and is involved in
DNA binding. The AP2 family proteins contain two repeated AP2/ERF domains, the ERF family proteins contain a
single AP2/ERF domain, and the RAV family proteins
contain a B3 domain and a single AP2/ERF domain [5, 6].
More and more proteins in the ERF family were identified,
for instance 122 and 139 ERF family genes were identified
from Arabidopsis (Arabidopsis thaliana) and rice (Oryza
sativa), respectively, by a comprehensive computational
analysis [5].
Artemisia annua is an important source of the antimalarial drug artemisinin. Artemisinin (a sesquiterpene lactone) are extensively used in the treatment of malaria,
mostly in combination therapies [7]. However, the artemisinin content of A. annua is very low (0.011 % dry wt),
and this limits the commercialization of artemisinin
greatly. Recently, some researchers found that the treatment of ABA and JAs could significantly increase the
content of artemisinin [810]. Therefore, the ERFs of A.
annua which are responsive to the treatment of ABA and
JAs may be participating in the regulation of secondary
metabolism of Artemisinin.
The objectives of this study were: (1) to isolate a novel
ERF transcription factor of A. annua, AaERF3, and characterize the molecular and biochemical properties; (2) to

123

9522

characterize in detail the properties of the predicted

AaERF3 protein, including its subcellular localization; and
(3) to investigate the expression pattern of AaERF3 in
A. annua after treatments with hormones and stress
treatments.

Materials and methods

Plant materials
The seeds of A. annua were obtained from the School
of Life Sciences, Southwest University in Chongqing,
Peoples Republic of China. Seeds were surfaced sterilized
in 70 % ethanol for 1 min and then a 0.5 % sodium
hypochlorite solution with 0.1 % Tween 20 for 10 min.
After rinsing 5 times thoroughly with sterile distilled water,
the seeds were placed on Murashige and Skoog (MS)
medium (Sigma-Aldrich, MO, USA) with 88 mM sucrose
and 0.7 % agar (pH 5.8).
Different tissues of A. annua plants were collected
for RNA extraction using plant RNA isolation reagent
(Tiangen Biotech, Beijing) following the manufacturers
instructions. 5 plants of A. annua grown in field for
5 months, which were just during floral budding, were
pooled and collected for roots and stems (Root and Stem),
leaves (Leaf) and green young alabastrums (Bud0) samples. And white alabastrums (Bud1) and the flowers
(Flower) were collected after 7 and 14 days respectively
from the same plants.
Hormonal and stress treatments
Artemisia annua plants grown in MS medium for 2 weeks
were treated with solutions of 100 lM ABA, 100 lM
MeJA (Sigma Aldrich, USA) and 500 lM ethephon, 10
plants were transfers to new petri dishes and pooled for
each treatment respectively [11, 12].
For wound induction, the same mixed plants of A. annua
were cut some 23 mm nicks and kept at 22 C under
humidified conditions. Low temperature treatment was
given by keeping the same mixed plants of A. annua at
4 C. All of the plants with ABA, ethephon and cold
treatments were collected before treatment (0 h) and at
different time point after treatment (1, 3, 6, 12, 24 h) for
the gene expression analysis. Wound treatments added a
time point of 0.5 h.
Cloning of AaERF3 full-length cDNA
The sequence of Arabidopsis ORA59 (NM100497) was
used as a query sequence for a BLAST search on GenBank.
The search returned an A. annua EST (expression sequence

123

Mol Biol Rep (2012) 39:95219527

tags) (EZ141721) which was from the flowerbud trichome

cDNA library. Based on the sequence, a pair of primers
AaERF3-F and AaERF3-R were designed, synthesized,
and used to amplify the partial sequence of a putative ERF
gene from A. annua. Then, the 30 end sequences of the ERF
gene were obtained by RACE (rapid amplification of
cDNA end) method according to the manufacturers
instructions (Invitrogen). The cDNA synthesis was performed with the SMART technology (SMARTTM RACE
cDNA Amplification Kit) for 30 -rapid amplification of
cDNA ends (RACE, CLONTECH Laboratories, Inc.).
RNA was transcribed with the 30 -RACE CDS Primer A,
reversely (provided in the kit). Cloning of AaERF3 by
30 -RACE primers AaERF3-3-1 and AaERF3-3-2 were
designed according to the EST fragment of AaERF3 gene.
The first round of PCR was performed with primer
AaERF3-3-1 and Universal Primer A Mix (provided in the
kit). The PCR product was diluted 50-fold for a second
round of amplification with primer AaERF3-3-2 and Nested Universal Primer A (provided in the kit). The fulllength AaERF3 from A. annua was deduced from the
obtained sequences and consequently amplified by proofreading RT-PCR amplification with primers AaERF3full5
and AaERF3full3. All the primers used were listed in
Table 1.
Comparative and bioinformatic analyses
Comparative and bioinformatic analyses of AaERF3 were
carried out online at the websites, http://www.ncbi.nlm.
nih.gov and http://cn.expasy.org. Sequence analysis was
performed using DNAMAN software (Lynnon Biosoft,
USA) and Vector NTI software (Invitrogen). The phylogenetic analysis of AaERF3 protein and ERF from other
species was carried out by alignment with CLUSTAL X
(1.81) using default parameters. A phylogenetic tree was
constructed by neighbor-joining method [13] using software MEGA version 3.1 [14].
Subcellular localization of AaERF3-YFP fusion
proteins
The AaERF3 cDNAs were then recombined into pEarlyGateway104 vector by Gateway LR recombination reaction (Invitrogen) to generate pEarlyGateway104-AaERF3.
The plasmids were used for transient expression in tobacco
(Nicotiana tabacum) epidermal cells as described previously [15]. We observed and recorded the results 48 h after
transformation. The YFP fluorescence was imaged using a
Leica TCS SP5 laser scanning confocal microscope. A 209
objective was used for confocal imaging. Fluorescence was
detected at 530600 nm for YFP. Data was processed
using Photoshop software (Adobe).

Mol Biol Rep (2012) 39:95219527

Table 1 Primers used for PCR
amplication in this study

9523

Primers

Purpose

Primer sequence (50 30 )

AaERF3-F

Clone

CAAATTAATCAAATATACAAAACAT

AaERF3-R

Clone

CAAGTTAAACCAATAAATTGGCGTT

AaERF3-3-1

30 RACE

GGGGTTCTGGGACGGTTCTTAACTTTTCGG

AaERF3-3-2

30 RACE

ACGAGGAAGGGAGTTCGCCTGTTTTGG

RACE

AAGCAGTGGTATCAACGCAGAGTAC(T)30 V N

RACE

Long (0.4 lM): CTAATACGACTCACTATAGGG

30 -RACE
CDS primer A
SMART IITM A Oligo
UPM

AAGCAGTGGTATCAA CGCAGAGTACGCGGG
CAAGCA GTGGTATCAACGCAGAGT
Short (2 lM): CTAATACGACTCACTATAGGGC

NUP

RACE

AAGCAGTGGTATCAACGCAGAGT

AaERF3-gatewayF

Clone

CACCATGAATCGATTCTTTTATCCGGAAA

AaERF3-gatewayR

Clone

TCACCAACTAGAACTACTACTGTTA

AaERF3-RT-F

Q-PCR

AGGAAGGGAGTTCGCCTGTTTT

AaERF3-RT-R
Actin-F

Q-PCR
Q-PCR

AAATTGGCGTTATAAAATTACCAGGG
CCAGGCTGTTCAGTCTCTGTAT

Actin-R

Q-PCR

CGCTCGGTAAGGATCTTCATCA

Expression pattern analysis of AaERF3 by Quantitative

RT-PCR
Expression patterns of AaERF3 in response to hormones,
stress treatments and in various tissues of A. annua were
analysed using the Real-time quantitative RT-PCR
(Q-RT-PCR) method. All RNA samples were digested with
DNase I (RNase-free) prior to use. Aliquots of 0.4 lg total
RNA were employed in the reverse transcriptase reaction
using random hexamer primers for the synthesis of first
strand cDNA.
The amplification reactions of qRT-PCR were performed on an iCycler iQTM Real-Time PCR Machines
(Bio-Rad, Watford, UK) with gene-specific primers
AaERF3-RT-F and AaERF3-RT-R, Actin primers Actin-F
and Actin-R, and the SYBR ExScript RT-PCR kit (Takara,
Shiga, Japan) protocol to confirm changes in gene
expression. For each reaction, 2 ll of diluted cDNA (corresponding to 0.8 ng of total RNA), 2.5 ll of EASY
dilution, 12.5 ll of 29 SYBR Premix ExTaqTM, 0.25 lM
of forward primer, 0.25 lM of reverse primer, and
nuclease-free water were added to a final volume of 25 ll.
The thermal cycle conditions used were 1 min at 95 C
followed by 40 cycles of amplification (15 s at 95 C, 30 s
at 56 C, and 30 s at 72 C). Melt curve analysis and
agarose gel electrophoresis following each qRT-PCR were
performed to assess product specificity. Quantification of
the target gene expression was carried out with comparative CT method [16]. Average CT values for the target
gene from at least three PCRs were normalized to average
CT values for actin from the same cDNA preparations and
analysed using Microsoft Excel. The relative expression of

AaERF3 indicated the increasing fold of the gene expression over the control (0 h before treatment).

Results and discussion

Characterization of AaERF3 full-length cDNA
sequences
Using the primers AaERF3-F and AaERF3-R, a band of
721 bp was specifically amplified, and a full length ORF
was found in the sequence. Two primers were then
designed for the 30 -RACE based on the obtained sequence.
By using the method described in Materials and
methods, the full-length cDNA of AaERF3 (GenBank
accession no. JN695782) was obtained, which was subsequently confirmed by sequencing. It was 850 bp long and
contained a 582 bp ORF encoding 193 amino acid proteins.
There was a 50 -untranslated region of 74 bp upstream from
the start codon with an ATG as the transcript start. The
coding region was followed by 30 -untranslated region that
was 194 bp long downstream from the stop codon
including the poly (A).
Characterization of the deduced AaERF3 protein
By using the software pI/Mw tool at http://www.expasy.org,
the isoelectric point (pI) and molecular weight of the
deduced AaERF3 protein were predicted to be 6.14 and
22.19 kD, respectively. The results of the BLAST-Protein
(BLASTP) online (http://www.ncbi.nlm.gov/blast) showed

123

9524

Mol Biol Rep (2012) 39:95219527

that the AaERF3 protein shared a highly conserved ERF/

AP2 domain with other ERF proteins, including Arabidopsis
AtERF1, ORA59, TaERF3, LeERF1, tobacco NtERF1 and
NsERF2 (Supplement Fig. 1). This domain is divided into
two conserved segments of YRG and RAYG, in which three
b-sheets and one a-helix are predicted, all of which are
important for DNA binding [17, 18]. The ERF/AP2 domain
of AaERF3 is predicted to have such structures (Supplement
Fig. 1). Comparing with other ERFs nuclear localization
signal (NLS), we also found that some ERFs contain
an NLS, which were targeted to the nucleus (PKRRKR,
Supplement Fig. 1, marked with u) [19]. While AaERF3
does not include a putative nuclear localization signal
(PKRRKR) in the corresponding region, so we inferred that
AaERF3 may have different localization. The transient
expression experiment showed that AaERF3 protein was
targeted to both of the nuclei and the cytoplasm.
Since Arabidopsis ERF family proteins are classified
into six subclusters based on their AP2/ERF conserved
domains [20], AtERF1 and ERF1 were belonged to the B3
subcluster. From the phylogenetic tree which was constructed by NJ method, AaERF3 had closest evolutionary
relationships to AtERF1, ERF1 and ORA59 (Supplement

Fig. 2). Previous studies also indicated that B3 subcluster

genes of the AP2/ERFs might share similar functions [5].
AaERF3 should have some similar functions with AtERF1,
ERF1 and ORA59. ERF1 and ORA59 are essential integrators of the JA and ethylene signal transduction pathways
[21, 22]. The treatment of JAs could significantly increase
the content of artemisinin in A. annua [810]. The overexpression and RNAi of AaERF3 may affect the transduction of the JA and ethylene signals and the content of
artemisinin in A. annua. And this is why Arabidopsis
ORA59 was used as a query sequence for a BLAST search
on GenBank, too.

Fig. 1 Subcellular localization of AaERF3 in tobacco (Nicotiana

benthamiana) epidermal cells. Tobacco epidermal cells were transiently transformed with constructs containing either control YFP or
AaERF3: YFP under the control of the CaMV35S promoter. The YFP
fluorescence was imaged using a Leica TCS SP5 laser scanning

confocal microscope after 48 h of transiently transformation. Fluorescence images (left), bright-field images (middle), and the corresponding overlay images (right) of representative cells expressing
YFP or AaERF3: YFP fusion protein are shown

123

Targeting of AaERF3 protein to both of the nuclei

and the cytoplasm
To examine the subcellular localization of the AaERF3
protein in vivo, the fused expression vector pEarlyGateway104-AaERF3 was constructed and used to perform a
transient expression assay in Nicotiana benthamiana
epidermal cells. Ten cells of Nicotiana benthamiana epidermal segments bombarded with pEarlyGateway104AaERF3 and pEarlyGateway104 vectors were analysed,

Mol Biol Rep (2012) 39:95219527

9525

Expression profiles of AaERF3 in different organs

Fig. 2 Expression profiling analysis of AaERF3 in different organs of

A. annua in the 5-months-old plants. Total RNA was isolated
respectively from different organs of A. annua followed by qRT-PCR
analysis with Actin as an internal control. The data represent the
mean SD (standard deviation) of three repeated samples

respectively. Comparing with the vector control (YFP), no

matter in nuclei and cytoplasm, we find that the fluorescence brightnesses of AaERF3-YFP are stronger than those
of the vector control (YFP) (Fig. 1). We know that most of
the transcription factors are targeted to the nuclei, however,
some of them acts as nucleocytoplasmic shuttling proteins,
such as BZR1 [23]. In the subcellular localization of the
AaERF3 protein in vivo, the results indicated that the
AaERF3 protein was not only targeted to the nuclei, but
also to the cytoplasm. The protein of AaERF3 should be a
nucleocytoplasmic shuttling protein, just like BZR1.

Total RNAs extracted from roots (root), stems (stem), old

leaves (leaf), green young alabastrums (bud0), white alabastrums (bud1) and flowers (flower) were also subjected
to the investigation of AaERF3 expression pattern in the
5-months-old plants in field. The results showed that
AaERF3 expressed in a constitutive manner in organs, but
with different levels (Fig. 2). Green young alabastrums
(bud0) had the highest expression level of AaERF3, which
is about more than 100 fold higher than the expression in
other tissues. The glandular secretory trichomes (GSTs) are
thought to be the site of biosynthesis and storage of artemisinin in A. annua [24, 25]. The artemisinin content and
GSTs of A. annua were previously proven to be the highest
in green young alabastrums (bud0), while AaERF3 was
also found to have the highest expression level in green
young alabastrums [26]. From the above analysis, we
inferred that AaERF3 may have some important relevance
with the synthesis of artimisnin.
Expression profiling analysis of AaERF3
after hormones and stress treatments
In this study, qRT-PCR analysis was used to obtain the
expression pattern of AaERF3 after hormones and stress
treatments including MeJA (100 lM), ABA (100 lM),

Fig. 3 Expression profiles

analysis of AaERF3 under
different treatments. Total RNA
was isolated, respectively, from
A. annua leaves under different
treatments for different periods
of time (0, 0.5, 1, 3, 6, 12 and
24 h) followed by qRT-PCR
analysis with the gene-specific
primers AaERF3-RT-F and
AaERF3-RT-R. Actin was used
as internal control. The
measurement was repeated three
times. Vertical bars represent
standard deviation

123

9526

Ethylene (500 lM), Cold and Wound treatments. In

responding to the MeJA treatment, the transcript of AaERF3
in A. annua was induced in 1 h, while the transcript was
gradually decreased after the time point (Fig. 3A). The
AaERF3 mRNA was induced slightly with the duration of
time after the treatment of Ethylene (Fig. 3B). As indicated in
Fig. 3C, AaERF3 mRNA was substantially increased in the
leaves of A. annua maintained at the treatment of ABA for
1 h, while the transcript was gradually decreased after the
time point. It was reported that Wound treatment can induce
the expression of AtERF1 in Arabidopsis, while in this study
the expression of AaERF3 was induced by Wound, too
(Fig. 3D) [27]. In a short time period (0.5 h), the expression of
AaERF3 increased vigorously in Wound treated samples, up
to about 67 fold. Cold treatment did not up-regulate AtERF1
transcript levels in A. thaliana [27]. Surprisingly, our results
indicated that Cold treatment could also induce a significant
accumulation of AaERF3 transcript in 1 h (Fig. 3E). The
results showed that although AaERF3 and AtERF1 have close
evolutionary relationship, some of the transcriptional regulation of AaERF3 appears to be different.
In conclusion, the full-length cDNA sequence of
AaERF3 was cloned and characterized from A. annua. The
result of subcellular localization showed that AaERF3
targeted to both of the nuclei and the cytoplasm. The
phylogenetic tree analyses implied that the AaERF3 protein
may have similar functions with AtERF1, ERF1 and
ORA59. The qRT-PCR analyses showed that AaERF3
mRNA accumulated most abundantly in green young alabastrums. The qRT-PCR analysis also revealed that ABA,
Wound and Cold treatments significantly enhanced the
transcript expression of AaERF3. MeJA and Ethylene
treatment could also slightly induce an accumulation of
AaERF3 transcription. The cloning and characterization of
AaERF3 will be helpful for further transgenic studying in
regulating artemisinin biosynthesis in A. annua.
Acknowledgments This work was funded by China 863 Program
(grant no. 2011AA100605), China Transgenic Research Program
(grant no. 2011ZX08002001), Ministry of Education, Shanghai Science and Technology Committee (Grant no. 08391911800) and
Shanghai Leading Academic Discipline Project (Grant no. B209).

References
1. Fujita M, Fujita Y, Noutoshi Y, Takahashi F, Narusaka Y,
Yamaguchi-Shinozaki K, Shinozaki K (2006) Crosstalk between
abiotic and biotic stress responses: a current view from the points
of convergence in the stress signaling networks. Curr Opin Plant
Biol 9:436442
2. Torres MA, Dangl JL (2005) Functions of the respiratory burst
oxidase in biotic interact ions, abiotic stress and development.
Curr Opin Plant Biol 8:397403

123

Mol Biol Rep (2012) 39:95219527

3. Wasilewskaa A, Vlada F, Sirichandraa C, Redkob YL, Jammesc
F, Valona C, Freya NFD, Leung J (2008) An update on abscisic
acid signaling in plants and more. Mol Plant 1:198217
4. Agarwal PK, Agarwal P, Reddy MK, Sopory SK (2006) Role of
DREB transcription factors in abiotic and biotic stress tolerance
in plants. Plant Cell Rep 25:12631274
5. Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genomewide
analysis of the ERF gene family in Arabidopsis and rice. Plant
Physiol 140:411432
6. Chen YY, Wang LF, Dai LJ, Yang SG, Tian WM (2011) Characterization of HbEREBP1, a wound-responsivetranscription
factor gene in laticifers of Hevea brasiliensis Muell. Arg Mol
Biol Rep. doi:10.1007/s11033-011-1146-y
7. Haynes RK (2006) From artemisinin to new artemisinin antimalarials: biosynthesis, extraction old and new derivatives, stereochemistry and medicinal chemistry requirements. Curr Top
Med Chem 6:509537
8. Guo XX, Yang XQ, Yang RY, Zeng QP (2010) Salicylic acid and
methyl jasmonate but not Rose Bengal enhance artemisinin
production through invoking burst of endogenous singlet oxygen.
Plant Sci 178:390397
9. Lu X, Lin XY, Shen Q, Zhang FY, Wang YY, Chen YF, Wang T,
Wu SY, Tang KX (2011) Characterization of the Jasmonate
Biosynthetic Gene Allene Oxide Cyclase in Artemisia annua L.,
Source of the Antimalarial Drug Artemisinin. Plant Mol Bio Rep
29:489497
10. Lu X, Zhang FY, Jiang WM, Lin XY, Chen YF, Shen Q, Wang T,
Wu SY, Sun XF, Tang KX (2011) Characterization of the first
specific jasmonate biosynthetic pathway gene allene oxide synthase from Artemisia annua. Mol Biol Rep. doi:10.1007/s
11033-011-0976-y
11. Pi Y, Liao ZH, Jiang KJ, Huang BB, Deng ZX, Zhao DL, Zeng
HN, Sun XF, Tang KX (2008) Molecular cloning, characterization and expression of a jasmonate biosynthetic pathway gene
encoding allene oxide cyclase from Camptotheca acuminate.
Biosci Rep 28:349355
12. Ando S, Sato Y, Kamachi S, Sakai S (2001) Isolation of a
MADS-box gene (ERAF17) and correlation of its expression with
the induction of formation of female flowers by ethylene in
cucumber plants (Cucumis sativus L.). Planta 213:943952
13. Saitou N, Nei M (1987) The neighbor-joining method: a new
method for reconstructing phylogenetic trees. Mol Bio Evol
4:406425
14. Kumar S, Tamura K, Jakobsen IB, Nei M (2001) MEGA2:
molecular evolutionary genetics analysis software. Bioinformatics 17:12441245
15. Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced
transient expression system in plants based on suppression of
gene silencing by the p19 protein of tomato bushy stunt virus.
Plant J 33:949956
16. Livak KJ, Schmittgen TD (2001) Analysis of relative gene
expression data using real-time quantitative PCR and the
--44CT method. Methods 25:402408
17. Allen MD, Yamasaki K, Ohme-Takagi M, Tateno M, Suzuki M
(1998) A novel model of DNA recognition by a beta-sheet
revealed by the solution structure of the GCC-box binding
domain in complex with DNA. EMBO J 17:54845496
18. Mazarel M, Puthoff DP, Hart JK, Rodermel SR, Baum T (2002)
Identification and characterization of a soybean ethylene
responsive element-binding protein gene whose mRNA expression changes during soybean cyst nematode infection. Mol Plant
Microbe Interact 15:577586
19. Zhang ZY, Yao WL, Dong N, Liang HX, Liu HX, Huang RF
(2007) A novel ERF transcription activator in wheat and its
induction kinetics after pathogen and hormones treatments. J Exp
Bot 58:29933003

Mol Biol Rep (2012) 39:95219527

20. McGrath KC, Dombrecht B, Manners JM, Schenk PM, Edgar CI,
Maclean DJ, Scheible WR, Udvardi MK, Kazan K (2005)
Repressor- and activator-type ethylene response factors functioning in jasmonate signaling and disease resistance identified
via a genome-wide screen of arabidopsis transcription factor gene
expression. Plant Physiol 139:949959
21. Lorenzo O, Piqueras R, Sanchez-Serrano JJ, Solano R (2003)
ETHYLENE RESPONSE FACTOR1 integrates signals from
ethylene and jasmonate pathways in plant defense. Plant Cell
15:165178
22. Pre0 M, Atallah M, Champion A, Vos MD, Pieterse CMJ,
Memelink J (2008) The AP2/ERF domain transcription factor
ORA59 integrates jasmonic acid and ethylene signals in plant
defense. Plant Physiol 147:13471357
23. Ryu HJ, Kim KM, Cho HW, Park JH, Choe SH, Hwang I (2007)
Nucleocytoplasmic shuttling of BZR1 mediated by phosphorylation

9527

24.

25.

26.

27.

is essential in arabidopsis brassinosteroid signaling. Plant Cell

19:27492762
Covello PS, Teoh KH, Polichuk DR, Reed DW, Nowak G (2007)
Functional genomics and the biosynthesis of artemisinin. Phytochemistry 68:18641871
Olsson ME, Olofsson LM, Lindahl AL, Lundgren A, Brodelius
M, Brodelius PE (2009) Localization of enzymes of artemisinin
biosynthesis to the apical cells of glandular secretory trichomes
of Artemisia annua L. Phytochemistry 70:11231128
Abad Farooqia AH, Shuklaa A, Sharmaa S, Khana A (1996)
Effect of plant age and GA3 on artemisinin and essential oil yield
in Artemisia annua L. J Herbs Spices Med Plants 4:7380
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M
(2000) Arabidopsis ethylene-responsive element binding factors
act as transcriptional activators or repressors of GCC boxmediated gene expression. Plant Cell 12:393404

123