DOI:http://dx.doi.org/10.7314/APJCP.2015.16.3.

1145
GSTM1, GSTT1 and CYP1A1 Gene Variants and Oral Cancer Risk in Pashtun Population of Pakistan.

RESEARCH ARTICLE
Genetic Susceptibility to Oral Cancer due to Combined
Effects of GSTT1, GSTM1 and CYP1A1 Gene Variants in
Tobacco Addicted Patients of Pashtun Ethnicity of Khyber
Pakhtunkhwa Province of Pakistan
Zakiullah1&*, Ahmadullah2&, Muhammad Khisroon2, Muhammad Saeed1*, Ajmal
Khan2, Fazli Khuda1, Sajid Ali3, Nabila Javed4, Muhammad Ovais6, Nosheen
Masood5, Nasir Khan Khalil1, Mohammad Ismail1
Abstract
Associations of GSTT1, GSTM1 and CYP1A1 gene variants with risk of developing oral cancer were evaluated
in this study. A case-control study was conducted in Pashtun population of Khyber Pakhtunkhwa province of
Pakistan in which 200 hospital based oral cancer cases and 151 population based healthy controls exposed to
similar environmental conditions were included. Sociodemographic data were obtained and blood samples were
collected with informed consent for analysis. GSTM1 and GSTT1 were analysed through conventional PCR
method while specific RT-PCR method was used to detect CYP1A1 polymorphisms. Results were analyzed for
conditional logistic regression model by SPSS version 20. The study shows that patients with either GSTM1 or
GSTT1 null genotypes have significantly higher risk of oral cancer (adjusted odds (OR): (3.019 (1.861-4.898)
and 3.011(1.865-4.862), respectively), which further increased when either one or both null genes were present in
combination (adjusted odds (OR): (3.627 (1.981-6.642 and 9.261 (4.495-19.079), respectively). CYP1A1 rs4646903
gene variants individually showed weak association OR: 1.121 (0.717-1.752); however, in the presence of GSTM1
and/or GSTT1 null genotypes further increasing the association (adjusted odds (ORs): 4.576 (2.038-10.273), 5.593
(2.530-12.362) and 16.10 (3.854-67.260 for GSTM/GSTT null and CYP1A1 wild type, GSTM/GSTT either null
and CYP1A1 variant alleles, and all 3 gene polymorphisms combinations, respectively). Our findings suggest
that presence of GSTM1 and/or GSTT1 null genotypes along with variant alleles of CYP1A1 may be the risk
alleles for oral cancer susceptibility in Pashtun population.
Keywords: Oral cancer risk - GSTT1 - GSTM1 and CYP1A1 gene variants - Pashtun population - Pakistan
Asian Pac J Cancer Prev, 16 (3), 1145-1150

Introduction
Oral cancer is the fourth most common cancer in the
world (Amtha et al., 2009; Gupta and Johnson, 2014).
It is estimated that over 400,000 cases occur annually
with a wide variation in global burden. Its incidence in
South and South East Asia is amongst the highest in the
world. Incidence is also on the rise in Western and Eastern
Europe, Latin America and Pacific regions (Ariyawardana
and Johnson, 2013). In Pakistan oral cancer is the second
most common malignancy after breast cancer and is
significantly higher than other member states of the World
Health Organizations Eastern Mediterranean (WHOEMRO) Region (Bile et al., 2010).
Tobacco use and alcohol drinking are the main
independent risk factors for the development of head

and neck area cancers, especially that of the oral cavity

(Warnakulasuriya et al., 2005; Amtha et al., 2009). In
Pakistan, about 50% tumors in males and 25% those of
in females are associated with consumption of tobacco
products (Warnakulasuriya et al., 2005; Bhurgri et al.,
2006). In Bangladesh and India, about one-third of all
cancers are tobacco-related. High incidence of oral and
pharyngeal cancers has been reported in South Asia, even
among female population, for which smokeless tobacco
products are considered to be the most prominent risk
factor (Moore et al., 2000; Gupta and Johnson, 2014).
Association of oropharyngeal cancer with smokeless
tobacco products is reportedly four times higher relative to
no history of tobacco use after adjusting for confounding
factors (Merchant 2000; Bile et al., 2010). Similarly pan
with or without tobacco has been associated with oral

Department of Pharmacy, 2Department of Zoology, 4Institute of Radiotherapy & Nuclear Medicine,6Centre of Biotechnology &
Microbiology, University of Peshawar, Peshawar, 3Department of Biotechnology, Abdul Wali Khan, University Mardan, 5Fatima
Jinnah Women University, Rawalpindi, Pakistan *For correspondence: saeedrph@upesh.edu.pk; zakiullah@upesh.edu.pk
1

Asian Pacific Journal of Cancer Prevention, Vol 16, 2015

1145

Zakiullah et al

cancer (Merchant et al., 2000). Several studies from

India and Pakistan have provided sufficient evidence that
use of tobacco mixed with lime and chewing betel quid
containing tobacco were carcinogenic to humans with
significant dose-response relationships for frequency of
chewing per day and for duration of tobacco consumption
(Rao and Desai, 1998; Nandakumar et al., 1990; Dikshit
and Kanhere, 2000; Balaram et al., 2002; Znaor et al.,
2003).
Tobacco products contain more than 30 carcinogens.
However, studies on the mechanism of their carcinogenesis
suggest that three classes among them are of major
importance i.e., Tobacco Specific Nitrosamines (TSNAs),
Poly Aromatic Hydrocarbons (PAHs) and aromatic amines
(Rickert et al., 2009). These compounds are actually
procarcinogens and are metabolized by Xenobiotic
metabolizing enzymes, namely Cytochrome P450 (CYPs)
and Glutathione-S-transferases (GSTs). The former is
involved in their activation to carcinogenic species; while
the latter is involved in their detoxification and excretion
from the body (Zakiullah et al., 2014). Various isoforms
of CYPs including CYP1A1 are reportedly involved in
activation process (DErrico et al., 1996; Olshan et al.,
2000). Similarly among GSTs, M1 (GSTM1) and T1
(GSTT1) enzymes are more important in detoxification
(Nair et al., 1999).
However, the expression of these enzymes differs
in individuals resulting in differences in the metabolic
processing of carcinogens. Certain individuals are
genetically more susceptible to cancer when exposed
to carcinogens owing to their genotype for enzymes
responsible for their activation or detoxification (Abbas et
al., 2014). This is evident from the general observation that
only a small number of individuals among those exposed
to tobacco or alcohol under the same environmental
conditions develop cancer in their life time. Allelic
variants influencing the enzyme activity of CYP1A1
along with environmental factors such as tobacco use play
key roles in making individuals susceptible to different
types of cancers (Xia et al., 2013). The CYP1A1 gene
located on chromosome 15q22-q24 encodes an enzyme
with aryl hydrocarbon hydroxylase activity that plays
important role in the metabolism of polycyclic aromatic
hydrocarbons (PAH) and nitrosamines from tobacco, and
inherited differences in metabolic capacity are considered
to contribute significantly in carcinogenesis (Sabitha et
al., 2010). Certain allelic variations in the CYP1A1 gene
and prolonged exposure to tobacco products could lead
to higher levels of reactive metabolites, thereby causing
DNA damage in addition to other contributing factors
(Prokopczyk et al., 1997; Velema et al., 2002). Similarly
deletion of genes responsible for GSTs results in a lack
of enzyme activity and consequently a decrease in the
elimination of carcinogenic species. Two of the GSTs i.e.,
GSTT1 and GSTM1 have been extensively explored in
relation to several types of cancers (Amtha et al., 2009;
Nosheen et al., 2014). They both detoxify major tobacco
related carcinogens and their absences increase the risk
of a variety of cancers of different areas including that of
the mouth, lung, bladder and breast (Nosheen et al., 2014).
Loss of GSTM1 enzymatic activity due to homozygous

1146

Asian Pacific Journal of Cancer Prevention, Vol 16, 2015

null genotype reportedly occurs in about 50% of Asians

and Caucasians (Amtha et al., 2009, Nosheen et al.,
2014). Previous studies on the association of oral cancer
with polymorphism in these genes have shown varying
results. Some studies have shown the association of
polymorphisms in CYP1A1 and GSTM1 genes with oral
cancer (Tanimoto et al., 1999; Wogan et al., 2004), while
some studies have reported a lack of association (Park
et al., 2000; Olshan et al., 2000; Sreelekha et al., 2001;
Sharma et al., 2006; Cha et al., 2007). These seemingly
conflicting observations are due to geographic and ethnic
variations in the distribution of genotype frequencies of
both CYP and GST alleles along with other environmental
factors. A recent study has emphasized on the inclusion of
country of study, source of population, specific ethnicity
and characteristics of general demographic variables in
future studies to deduce conclusive and more reliable
results (Nosheen et al., 2014).
Association of genetic polymorphisms of the above
mentioned genes with oral cancer has not been so far
reported in Pashtun population of Khyber Pakhtunkhwa
province of Pakistan. Therefore, a case-control study was
carried out to evaluate the potential role of CYP1A1 (T>C,
rs4646903), GSTM1 and GSTT1 gene polymorphisms
in the susceptibility to oral cancer in Pashtun population
of Khyber Pakhtunkhwa province of Pakistan. This will
help to adopt pro-active approaches for early detection and
preventive life style modification strategies to decrease the
incidence of the disease in the target population.

Materials and Methods

Sample collection
Study sample comprised of 200 oral cancer patients
and 151 healthy control subjects between 30 and 70 years
of age as per exclusion/inclusion criteria. Patients were
registered at the Institute of Radiotherapy and Nuclear
Medicine (IRNUM), Peshawar, Khyber Pakhtunkhwa;
while eligible control samples were collected from various
districts of the same province. The study period was from
July, 2012- July, 2013. All the patients were having histopathologically confirmed oral cancer.
Inclusion criteria (patients): Histo-pathologically
proven oral cancer patients having age between 30 and
70 years with Pashtun ethnicity, and not less than 20
years of tobacco exposure in any form. Exclusion criteria
(patients): Patients with non-Pashtun ethnicity and/or
having more than 70 years of age. Criteria for selection of
control subjects: Normal healthy age-matched subjects of
similar ethnicity with not less than 20 years of exposure
to tobacco in any form, and free from cancer.
Study was approved from the Ethical Committee of
the Department of Pharmacy, University of Peshawar (No.
440, dated 17.12.2011). Informed consent and thorough
interview was taken by expert in the relevant field before
blood collection on a carefully designed proforma that
contained information regarding age, place, occupation,
socioeconomic status, cancer type and tobacco use habits
etc. Three milliliters of whole blood was collected from
all subjects in properly labelled EDTA tubes and genomic
DNA was subsequently extracted by using standard DNA

DOI:http://dx.doi.org/10.7314/APJCP.2015.16.3.1145
GSTM1, GSTT1 and CYP1A1 Gene Variants and Oral Cancer Risk in Pashtun Population of Pakistan.

Figure 1. Representative Melting Peaks of RT-PCR of CYP1A1 rs4646903 polymorphism: Pink peaks represent
CYP1A1 wild type (T/T), while blue peaks show variant alleles (T/C and C/C)

Isolation kit (Purelink Genomic DNA kit Invitrogen,

USA) as per manufacturers recommendations. The DNA
quality and quantity were determined using a double
beam spectrophotometer (Perkin Elmer series 200 system,
Norwalk, USA).
Genotyping of CYP1A1 (T>C, rs4646903)
The CYP1A1 (T>C, rs4646903) polymorphisms were
analyzed using a highly specific Real Time Polymerase
Chain Reaction (RT-PCR). Light SNiP rs4646903 (primers
and probes) and FastStart DNA Master Hyprobe kit
were purchased from Tib-Molbiol (Germany) and Roche
Diagnostics (Germany), respectively. Reaction was
performed as per suppliers recommendation as follows.
Reaction mix comprised of Reagent Mix (1l), FastStart
DNA Master (2 l), Magnesium chloride (25mm, 1.6 l),
and water (14.4l). Finally, DNA (1l, 100-150 ng) was
added to the reaction mix to make the final volume 20 l.
Thermocycler (MiniOpticon Model CFB-3120EDUUSA)
conditions were as follows: Denaturation at 95 C for 10
minutes; Cycling for 45 cycles of 95C for 10 seconds,
45C for 60 seconds and 72C for 15 seconds; followed
by melting curves analysis at 95C for 10 seconds, 40C
for 2 minutes through 75C for 0 seconds. Duplicate
samples were used as control. Melting peaks at 51-52 C
represented wild type (T/T) allele; the one at 59-60 C
represented variant (C/C) allele, while samples giving
two peaks at 51C and 59C were heterozygous (T/C)
allele (Figure 1).
Genotyping assay for GSTM1 and GSTT1
For the determination of homozygous null
polymorphisms of GSTM1 and GSTT1 new conventional
PCR methods were developed and optimized for individual
genes. Primer sets (designed through Primer3Plus online
software) used was 5- CATGTGACAGTATTCTTATTTC3, 5- ACTCAATCTCAGCATCACAGC- 3 and
5 - AT C T G T G G T C C C C A A AT C A G - 3 , 5 GGGGGTTGTCTTTTGCATAG-3, for GSTM1 and
GSTT1 respectively. Duplicate samples were used as
positive control for both genes. PCR was separately
performed for both genes in a 25 l reaction mixture
containing 20 mM Tris-HCl pH 9.0, 50 mM KCl, 2
mM MgCl2, 200 M dNTPs (Promega, USA), primers
(Macrogen, South Korea) 10 pmol of each set individually,
0.5 units of Taq DNA polymerase (Bio-Labs, UK), and 50-

100 ng of genomic DNA. PCR was individually performed

in the GeneAmp PCR system 9700 (Applied Biosystems,
USA). After an initial denaturation at 95C for 4 minutes,
amplification was carried out for 40 cycles at 95C for 30
seconds, 52C for 45 seconds and 72C for 1 minute for
GSTM1 and 55C for 45 seconds and 72C for 1 minute
for GSTT1, followed by final elongation at 72C for 10
minutes. The PCR products were electrophoresed in a 1
% agarose gel for analysis. GSTM1 and GSTT1 genotype
were identified by the presence of a band at 298 and 632
bp respectively (Figures 2 and 3).

Figure 2. A Representative image of PCR analysis of

GSTM1 Polymorphisms. L is molecular weight marker
(1kb). N is negative control. Cal to Ca32 are oral cancer samples.
Duplicate sample Ca4 was used as positive control (shown in
square). GSTM1 wild type was shown at 298bp as indicated by
vertical arrow, whereas GSTM1 Null has been shown in circles

Figure 3. A Representative Image of PCR analysis

of GSTT1 Polymorphisms. L is molecular weight marker
(100bp) N is negative control. Cal to Ca31 are oral cancer
samples. Duplicate sample Ca7 was used as positive control
(shown in square). GSTT1 wild type was shown at 632 bp as
indicated by vertical arrow, whereas GSTT1 Null has Been
shown in circles

Asian Pacific Journal of Cancer Prevention, Vol 16, 2015

1147

Zakiullah et al

Statistical analysis
Chi-square (2) test was used to detect whether there
were significant (=0.05) differences in frequencies of
genes. Odds Ratios (OR) for each polymorphism using
binary logistic regression model were estimated with 95%
confidence intervals (CIs), and the difference in genotype
prevalence and association between case and control
group were assessed independently as well as adjusted
for confounding factors. Age, gender, place of residence,
tobacco type used, amount of tobacco used per day and
age at first exposure were included as covariates as well
as all the possible genotypes studied. GSTM1 and GSTT1
were categorized on the basis of presence and absence
(null genotype) of the gene, while CYP1A1 rs4646903
polymorphism was classified into homozygous wild type
and variant allele containing genotypes. Wild type was
used as reference group to assess the effects of the different
alleles. Analyses were performed by SPSS (Version 20.0).

Results
Subject characteristics
Demographic and other subject characteristics are
shown in Table 1. Mean age of healthy subjects (controls)
and esophageal cancer patients was 56.1407.91 and
54.889.83 years, respectively (t test p value=0.931).
Table 1. Demographic Characteristics of the Subjects
Variables

Controls

Cases

p-value

Geographic Area (district)

Tribal
45 (29.8)
36 (18.0)
Charsadda
15 (9.9)
40 (20.0)
Bannu DI Khan
13 (8.6)
26 (13.0)
Nowshera
11 (7.3)
14 (7.0)
Peshawar
19 (12.6)
24 (12.0)
Swabi
9 (6.0)
24 (12.0)
Malakand
10 (6.6)
14 (7.0)
Mardan
15 (9.9)
10 (5.0)
Kohat
1 (0.7)
12 (6.0)
Dir Chitral etc.
13 (8.6)
-
Age (yrs)
20-40
24 (15.9)
14 (7.0)
41-50
42 (27.8)
68 (34.0)
51-60
41 (27.2)
68 (34.0)
60+
44 (29.1)
50 (25.0)
Occupation
Driver
9 (6.0)
14 (7.0)
Farmer
45 (29.8)
77 (38.5)
Labour
39 (25.8)
34 (17.0)
Odd jobs
44 (29.1)
37 (18.5)
Farmer/labour
14 (9.3)
38 (19.0)
Tobacco type used
Naswar
142 (94.0)
200 (100.0)
Cigarettes
55 (36.4)
61 (30.5)
Other types
46 (30.5)
40 (20.0)
Age at 1st exposure (yrs)
15
66 (43.7)
74 (37.0)
16-20
57 (37.7)
114 (57.0)
21-25
11 (7.3)
-
25+
17 (11.3)
12 (6.0)
Daily use
Mild
54 (35.8)
142 (71.0)
Moderate
62 (41.1)
33 (16.5)
Heavy
9 (6.0)
13 (6.5)

1148

0.304

0.931

0.786

0.853

0.45

0.931

Asian Pacific Journal of Cancer Prevention, Vol 16, 2015

Thirty four percent (34%) of patients were in the age

range of 41-50 years; same percentage (34%) was in
the age range of 51-60 years, while 25% of the patients
were in the range of 60+ years of age. Highest incidence
(20%) of oral cancer was observed in district Charsadda,
followed by Tribal areas (18%), Southern districts (Bannu
and DI Khan) (13%), Swabi and Peshawar (12% each).
To estimate the socioeconomic status and occupational
exposure profession of the subjects was noted. Almost all
the patients were having hard jobs like driving, farming
and other laborious jobs. Highest incidence (57.5%) was
observed in farmers of which 19% were those involved
in tobacco farming or working labor in local tobacco
industry. Several aspects of tobacco use habit were noted
including type of tobacco product used, age at 1st exposure
and amount of tobacco used per day. Cases and control
were having similar tobacco habits (t test p values=0.853,
0.45 and 0.931 for types of tobacco used (naswar, both
cigarrete along with naswar, and other types), age at
first exposure, and amount of tobacco used respectively.
All the patients were naswar addicts, while 30.5% were
using cigarretes along with naswar. Twenty percent of the
patients were using other tobacco products such as chillum
(huqqa) and charas/cannabis filled cigarettes. 37% patients
started tobacco at the age of 10-15 years, while 57% started
at the age of between 16-20 years, with mean age of 17
years. Subjects were divided into three categories on the
basis of amount of tobacco used per day. Mild users were
those taking less than 0.5 packs to 1.5 packs of either
naswar or cigarettes alone or in combination. Moderate
users were those taking more than 1.5 packs to 3 packs of
either naswar or cigarettes alone or in combination. Heavy
users were those using more than 4 packs of either naswar
or cigarettes alone or in combination. Majority (71%) of
the patients were mild users followed by moderate users
(16.5%). Only about 7% were heavy users.
Association with susceptibility to esophageal cancer
The allele frequencies and genotypes of GSTs and
CYP1A1 rs4646903 polymorphism of both control and
oral cancer cases are given in Table 2. The distribution of
GSTM1 and GSTT1 genotypes were significantly different
between the cases and controls groups (Pearson chi Square
2 0.05, 2=0.000, p>0.05), while it was not significant in
case of CYP1A1 rs4646903 (p=0.762). When analyzed
for individual genes the prevalence of null genotypes
of GSTM1 and GSTT1 was more in cases (79.5% and
47.5% respectively) when compared to controls (57%
and 23.2% respectively). Null genotypes of both GST
genes were having almost 3-fold increased risk of oral
cancer compared with wild type, which slightly increased
when OR were adjusted for confounding factors such as
tobacco use habits, age and area of residence etc. The
prevalence of CYP1A1 rs4646903 gene was more in
cases (N=76) as compared to control (N=55). However
the association was weak and non-significant (OR=1.07,
p-value 0.762), with little effect of confounding factors
when adjusted for them (Table 2). Similarly when analyzed
for two GST gene combinations the association further
increased to (3.422 (1.890-6.194), p-value=0.000) and
(8.986 (4.424-18.253), p-value 0.000) for GSTM/GSTT

DOI:http://dx.doi.org/10.7314/APJCP.2015.16.3.1145
GSTM1, GSTT1 and CYP1A1 Gene Variants and Oral Cancer Risk in Pashtun Population of Pakistan.

Table 2. Crude and Adjusted Odds Ratios (OR) of GSTs and CYP1A1 and Oral Cancer
Genotype/allele
Genetic polymorphism

Cases N Control N
(%)
(%)

GSTM1
Wild type
41 (20.5) 65 (43.0)
Null
159 (79.5) 86 (57.0)
GSTT1
Wild type
105 (52.5) 116 (76.8)
Null
95 (47.5) 35 (23.2)
CYP1A1
Wild type
124 (62.0) 96 (63.6)
Polymorphism
76 (38.0) 55 (36.4)
Combinations 2 genes
GSTM/GSTT both wild type
20 (10.0) 51 (33.8)
GSTM/GSTT either1 expressed
124 (62.0) 79 (52.3)
GSTM/GSTT both null
76 (38.0) 21 (13.9)
Combination 3 genes
GTSM/GSTT/ CYP1A1 wild type
9 (4.5) 27 (17.9)
GSTM/GSTT null and CYP1A1 wild type 69 (34.5) 53 (35.09)
GSTM/GSTT either null and CYP1A1
103 (51.5) 64 (42.4)
All 3 gene polymorphisms
19 (9.5)
7 (4.6)

either one expressed or GSTM/GSTT both null genotypes,

respectively. This association further strengthened when
adjusted for confounding factors; with 2-fold increase for
GSTM/GSTT both null genotype. When all three genes
were analyzed in combination the association further
strengthened, with individuals possessing all three gene
variant alleles showing a 16-fold increased risk of oral
cancer as compared to control, in the presence of other
confounding risk factors.

Discussion
It is well recognized fact that some individuals are
more susceptible to certain types of cancers within similar
environmental conditions. Different factors are involved
in the initiation of carcinogenesis. These include but
not limited to polymorphisms in genes responsible for
the expression of carcinogen metabolizing enzymes,
environmental exposure (such as tobacco use and alcohol
consumption) and dietary and life style habits of the
individuals. GSTs and CYP1A1 are among the most
important enzymes involved in the processing of tobacco
related carcinogens. However, polymorphisms in GSTM1,
GSTT1 and CYP1A1 genes and their association with
oral cancer have shown varying results (Nosheen et al.,
2014). Association has been reported in Asians but not in
Caucasian population in several meta-analysis studies.
These observations have shown the importance of ethnic
differences among the study population (Hirschhorn, 2002,
Gupta and Johnson, 2014). Our study has thrown light on
the involvement of genetic, ethnic and demographic factor
differences in the incidence of oral cancer. Present data
shows that genetic polymorphisms in GSTM1, GSTT1 and
CYP1A1 genes have important contribution towards the
occurrence of oral cancer in Pashtun population. GSTM1
and GSTT1 have shown a 3-fold independent association,
while CYP1A1 is weakly involved (see table 1).
Combined effects of both GSTs alone, and in combination
with CYP1A1, further increase the association. The risk

Crude OR
p-value
(95% CI)

Adjusted OR
(95% CI)

p-value

Ref.
2.931 (1.831-4.693) 0
3.019 (1.861-4.898) 0
Ref.
2.999 (1.876-4.793) 0
3.011 (1.865-4.862) 0
Ref.
1.070 (0.691-1.657) 0.762 1.121 (0.717-1.752) 0.617
Ref.
3.422 (1.890-6.194
0
3.627 (1.981-6.642) 0
8.986 (4.424-18.253) 0
9.261 (4.495-19.079) 0
Ref.
4.145 (1.871-9.183) 0
4.576 (2.038-10.273) 0
5.182 (2.382-11.273) 0
5.593 (2.530-12.362) 0
8.143 (2.647-25.054) 0
16.10 (3.854-67.260) 0

is 8-fold high in those patients that have variant alleles of

all three genes (OR=8.143 (2.647-25.054)), showing the
importance of CYP1A1 gene. Similarly when adjusted
for age, gender, place of residence, occupation, tobacco
type used, amount of tobacco used per day and age at
first exposure the risk further increased showing the
importance of these environmental and demographic
factors. The risk of oral cancer doubled (OR=16.10
(3.854-67.260)), when these factors were adjusted in
individuals that have variant alleles of all three genes.
The occurrence of oral cancer increases with age, with
incidence rates peaking at 70 years. In this study almost
70% of the patients were in the age range of 40-60 years.
Regarding tobacco habits it was observed that hundred
percent were exposed to naswar. About 87% were mild
to moderate users, while mean age at first exposure was
17 years. This shows that majority of the patients were
exposed for more than 30 years to tobacco carcinogens.
Area of residence showed that Tribal belt, Charsadda,
Peshawar and Swabi districts were having more cases of
oral cancer as compared to other districts. This observation
is consistent with increased exposure to tobacco in these
districts due to tobacco farming (especially in Charsadda
and Swabi) and naswar consumption. Similarly, undernutrition associated with low socioeconomic status has
been an established risk factor for various types of cancers
including that of oral cavity, and our data showed that
almost 100% were having laborious low paid jobs. All
these findings are consistent with previous studies that
have shown association of GSTM1, GSTT1 and CYP1A1
genes, tobacco consumption (like naswar and cigarettes)
and other risk factors with oral cancer. In conclusion, our
study shows that the GSTM1, GSTT1 and CYP1A1 genes
may be associated with the risk of oral cancer, especially
in the presence of tobacco (naswar) use.
In conclusion, based on above mentioned findings,
reducing consumption of tobacco (especially naswar in
Pashtun population) and elevating the socioeconomic
status must be regarded as the primary preventive strategies

Asian Pacific Journal of Cancer Prevention, Vol 16, 2015

1149

for the control of oral cancer in Khyber Pakhtunkhwa

province. Similarly, projects should be designed by
governmental agencies to screen for genetically susceptible
individuals and awareness campaigns regarding genetic
susceptibility and environmental risk factors be initiated
in general public.

Acknowledgements
We acknowledge Institute of Radiotherapy and
Nuclear Medicine (IRNUM), Peshawar for supply of
blood samples. We also wish to thank Mr. Zahid Ali, Mr.
Zahir Shah and Mr. Waheed-ur-Rahman, who facilitated
the collection of control blood samples from different
districts of Khyber Pakhtunkhwa. We also acknowledge
Department of Zoology, University of Peshawar for
provision of some of the laboratory facilities available
at their end.

References
Abbas M, Srivastava K, Imran M, Banerjee M (2014).
Association of CYP1A1 gene variants rs4646903 (T>C)
and rs1048943 (A>G) with cervical cancer in a North Indian
population. Eur J Obstet Gynecol Reprod Biol, 176, 68-74.
Amtha R, Ching CS, Zain R, et al (2009). GSTM1, GSTT1 and
CYP1A1 polymorphisms and risk of oral cancer: a casecontrol study in Jakarta, Indonesia. Asian Pacific J Cancer
Prev, 10, 21-26.
Ariyawardana A, Johnson NW (2013). Trends of lip, oral cavity
and oropharyngeal cancers in Australia 1982-2008: overall
good news but with rising rates in the oropharynx. BMC
Cancer, 13, 333.
Balaram P, Sridhar H, Rajkumar T et al (2002). Oral cancer in
southern India: the influence of smoking, drinking, paanchewing and oral hygiene. Int J Cancer, 98, 440-5.
Bhurgri Y, Bhurgri A, Nishter S, et al (2006). Pakistan - country
profile of cancer and cancer control 1995-2004. J Pak Med
Assoc, 56, 124-30.
Bile KM, Shaikh JA, Afridi HU, Khan Y (2010). Smokeless
tobacco use in Pakistan and its association with oropharyngeal
cancer. East Mediterr Health J, 16, 24-30.
Cha In-Ho, Park JY, Chung WY, et al (2007). Polymorphisms
of CYP1A1 and GSTM1 genes and susceptibility to oral
cancer. Yonsei Med J, 48, 233-9.
DErrico A, Taioli E, Xhen X, et al (1996). Genetic metabolic
polymorphisms and the risk of cancer: a review of the
literature. Biomark, 1, 149-73.
Dikshit RP, Kanhere S (2000). Tobacco habits and risk of lung,
oropharyngeal and oral cavity cancer: a population- based
case-control study in Bhopal, India. Int J Epidemiol, 29,
609-14.
Gupta B, Johnson NW (2014). Emerging and established global
life-style risk factors for cancer of the upper aero-digestive
tract. Asian Pac J Cancer Prev, 15, 5983-91.
Hirschhorn JN, Lohmueller K, Byrne E, (2002). A comprehensive
review of genetic association studies. Genet Med, 4, 45-61.
Masood N, Yasmin A, Kayani MA, (2013). Genetic deletions
of GSTM1 and GSTT1 in head and neck cancer: review of
the literature from 2000 to 2012. Asian Pac J Cancer Prev,
14, 3535-9.
Merchant A, Husain SS, Hosain M et al (2000). Paan without
tobacco: an independent risk factor for oral cancer. Int J
Cancer, 86, 128-31.
Moore SR, Johnson NW, Pierce AM, Wilson DF (2000). The

1150

Asian Pacific Journal of Cancer Prevention, Vol 16, 2015

epidemiology of mouth cancer: a review of global incidence.

Oral Dis, 6, 65-74.
Nair UJ, Nair J, Mathew B, Bartsch M (1999). Glutathione
S-transferase M1 and T1 null genotypes as risk factors for
oral leukoplakia in ethnic Indian betel quid/tobacco chewers.
Carcinogenesis, 20, 743-48.
Nandakumar A, Thimmasetty KT, Sreeramareddy NM et al
(1990). A population-based case-control investigation on
cancers of the oral cavity in Bangalore, India. Br J Cancer,
62, 847-51.
Olshan AF, Weissler MC, Bell DA (2000). GSTM1, GSTT1,
GSTP1, CYP1A1, and NAT1 polymorphisms, tobacco use,
100.0
and the risk of head and neck cancer. Cancer Epidemiol
Biomark Prev, 9, 185-91.
Park JY, Muscat JE, Kaur T, et al (2000). Comparison of GSTM
polymorphisms and risk of oral cancer between African-75.0
American and Caucasians. Pharmacogenetics, 10, 123-31.
Prokopczyk B, Cox JE, Hoffmann D, et al (1997). Identification
of tobacco specific carcinogen in the cervical mucus of
smokers and non-smokers. J Natl Cancer Inst, 89, 868-73.50.0
Rao DN, Desai PB (1998). Risk assessment of tobacco, alcohol
and diet in cancers of base tongue and oral tongue-a case
control study. Indian J Cancer, 35, 65-72.
Rickert WS, Joza PJ, Trivedi AH et al (2009). Chemical and25.0
toxicological characterization of commercial smokeless
tobacco products available on the canadian market. Regul
Toxicol Pharmaco, 53, 121-33.
0
Sabitha K, Reddy MV, Jamil K (2010). Smoking related risk
involved in individuals carrying genetic variants of CYP1A1
gene in head and neck cancer. Cancer Epidemiol, 34, 587-92.
Sharma A, Mishra A, Das BC, Sardana S, Sharma JK (2006).
Genetic polymorphism at GSTM1 and GSTT1 gene loci
and susceptibility to oral cancer. Neoplasma, 53, 309-15.
Sreelekha TT, Ramadas K, Pandey M, et al (2001). Genetic
polymorphism of CYP1A1, GSTM1 and GSTT1 genes in
Indian oral cancer. Oral Oncol, 37, 593-8.
Tanimoto K, Hayashi S, Yoshiga K, Ichikawa T (1999).
Polymorphisms of the CYP 1A1 and GSTM1 gene involved
in oral squamous cell carcinoma in association with a
cigarette dose. Oral Oncol, 35, 191-6.
Velema JP, Ferrera A, Figueroa M, et al (2002). Burning wood
in the kitchen increases the risk of cervical neoplasia in
HPV-infected women in Honduras. Int J Cancer, 97, 536-41.
Warnakulasuriya S, Sutherland G, Scully C (2005). Tobacco,
oral cancer, and treatment of dependence. Oral Oncol, 41,
244-60.
Wogan GN, Hecht SS, Felton JS, Conney AH, Loeb LA (2004).
Environmental and chemical carcinogenesis. Semin Cancer
Biol, 14, 473-86.
Xia L, Gao J, Liu Y, et al (2013). Significant association between
CYP1A1 T3801C polymorphism and cervical neoplasia
risk: a systematic review and meta-analysis. Tumor Biol,
34, 223-30.
Znaor A, Brennan P, Gajalakshmi V et al (2003). Independent and
combined effects of tobacco smoking, chewing and alcohol
drinking on the risk of oral, pharyngeal and esophageal
cancers in Indian men. Int J Cancer, 105, 681-6.
Zakiullah, Saeed M, Ali S et al (2014). Genetic susceptibility to
esophageal cancer due to CYP1A1 gene variant rs4646903 in
tobacco addicted patients of Pashtun ethnicity: a case control
study in Khyber Pakhtunkhwa province of Pakistan. Asian
Pac J Cancer Prev, 15, 6715-20.

6.3

56.3

31.3

Newly diagnosed without treatment

Zakiullah et al