Vous êtes sur la page 1sur 249

CURSO DE FORMACIN SOBRE

ANLISIS DE LA PRESENCIA DE
ORGANISMOS GENTICAMENTE MODIFICADOS
EN MUESTRAS DE ALIMENTOS

MANUAL DEL
PARTICIPANTE
Editado por Maddalena Querci, Marco Jermini y Guy Van den Eede
La presente publicacin tambin se encuentra on-line en la direccin siguiente:
http://mbg.jrc.ec.europa.eu/capacitybuilding/documentation.htm
ISBN: 978-92-79-04831-9
Numero de catalogo: LB-X1-07-033-ES-C

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

CURSO DE FORMACIN SOBRE


ANLISIS DE LA PRESENCIA DE
ORGANISMOS GENTICAMENTE MODIFICADOS
EN MUESTRAS DE ALIMENTOS

MANUAL DEL
PARTICIPANTE
Editado por Maddalena Querci, Marco Jermini y Guy Van den Eede
La presente publicacin tambin se encuentra on-line en la direccin siguiente:
http://mbg.jrc.ec.europa.eu/capacitybuilding/documentation.htm
ISBN: 978-92-79-04831-9
Numero de catalogo: LB-X1-07-033-ES-C

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

II
Ni la Comisin Europea ni ninguna persona que acte en su nombre se responsabilizar del
uso que pudiera hacerse de esta informacin.

Puede obtenerse informacin sobre la Unin Europea


a travs del servidor Europa
en la siguiente direccin de Internet
http://europa.eu

Luxemburgo: Oficina de Publicaciones Oficiales


de las Comunidades Europeas, 2007
ISBN-978-92-79-04831-9
Comunidades Europeas, 2007
Reproduccin autorizada, con indicacin de la fuente bibliogrfica
Printed in Italy

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

III

EDITORES
Maddalena QUERCI
Comisin Europea
Centro Comn de Investigacin
Instituto de la Salud y la Proteccin de los Consumidores
Unidad de biotecnologa y OGM
Coordinadora del rea cientfica de la biologa molecular
Direccin electrnica: maddalena.querci@jrc.ec.europa.eu
Marco JERMINI
Repubblica e Cantone Ticino http://www.ti.ch
Dipartimento della sanit e della socialit
Divisione della salute pubblica
Laboratorio Cantonale - Bellinzona
Direccin electrnica: marco.jermini@ti.ch
Guy VAN DEN EEDE
Comisin Europea
Centro Comn de Investigacin
Instituto de la Salud y la Proteccin de los Consumidores
Unidad de biotecnologa y OGM
Jefe de Unidad
Direccin electrnica: JRC-BGMO@ec.europa.eu

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

IV

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Prlogo
El Instituto de la Salud y la Proteccin de los Consumidores del Centro Comn de
Investigacin de la Comisin Europea y el Programa de Seguridad Alimentaria
dentro del Centro Europeo para el Medio Ambiente y la Salud (Divisin de Roma) de
la Organizacin Mundial de la Salud han organizado conjuntamente una serie de
cursos de formacin sobre Anlisis de la presencia de organismos genticamente
modificados en muestras de alimentos.
El Centro Comn de Investigacin presta apoyo cientfico y tcnico a las polticas
comunitarias colaborando con las direcciones generales de la Comisin Europea e
interactuando con las instituciones, organizaciones e industrias europeas mediante
la formacin de redes con laboratorios de los Estados miembros. La tarea general
del Centro Europeo para el Medio Ambiente y la Salud de la OMS es prestar ayuda
de forma completa y coordinada tanto a las autoridades como a los ciudadanos
europeos en el mbito de la salud ambiental. Estos cursos de formacin se inscriben
en la colaboracin entre ambas instituciones para fomentar aspectos relativos a la
inocuidad de los alimentos en la regin europea de la OMS, tanto dentro como fuera
de las fronteras de la propia UE, teniendo en cuenta especialmente los pases
candidatos a la adhesin a la UE, as como los pases de Europa central y oriental
con economas de transicin.
El objetivo de los cursos de formacin es ayudar al personal de los laboratorios de
control a familiarizarse con las tcnicas de deteccin molecular y a adaptar sus
instalaciones y programas de trabajo para permitir la realizacin de anlisis que se
ajusten a los actos normativos a escala mundial en el campo de la biotecnologa.
Los cursos se destinan a ensear tcnicas de deteccin molecular a personal de
laboratorio con buen nivel de conocimientos analticos, pero con poca o ninguna
experiencia en este mbito concreto.
El Centro Comn de Investigacin se ha comprometido a proporcionar formacin
sobre la deteccin y cuantificacin de los OGM y, adems de los cursos de
formacin, ofrece (y ha ofrecido en el pasado) formacin individual para

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

VI
necesidades especficas. Se ha pedido con frecuencia formacin sobre este tema
debido a su importancia ante el aumento de la necesidad de cumplir la normativa
europea, tanto vigente como en fase de elaboracin.
A lo largo de los aos, la Unidad de biotecnologa y OGM ha conseguido un
profundo conocimiento de los diferentes aspectos relativos a la deteccin y
cuantificacin de los OGM, y ha elaborado, adaptado o validado mtodos
avanzados para su deteccin y cuantificacin.
El conocimiento de estas tcnicas se ha transferido a los laboratorios colaboradores
mediante publicaciones, proyectos conjuntos, formacin individual o cursos
especficos. Tambin se han explicado detalles tcnicos a personal en formacin
mediante presentaciones verbales o breves notas escritas. La Unidad de
biotecnologa y OGM, consciente de la necesidad de disponer de una fuente
permanente de informacin, ha redactado el presente Manual, que describe algunas
de las tcnicas utilizadas en nuestro laboratorio.
A lo largo de los cursos se atiende a los siguientes temas:
-

extraccin de ADN de materias primas y productos transformados

cribado de productos alimentarios para detectar la presencia de OGM


mediante reaccin en cadena de la polimerasa, tanto simple como anidada

cuantificacin de OGM en ingredientes mediante reaccin en cadena de la


polimerasa en tiempo real

cuantificacin de OGM en ingredientes mediante prueba de inmunoabsorcin


enzimtica.

El Manual se ha preparado en el Instituto de la Salud y la Proteccin de los


Consumidores del Centro Comn de Investigacin, como informacin de base para
los participantes en los cursos y con la finalidad de proporcionar una informacin
terica y prctica sobre las metodologas y protocolos utilizados en la actualidad. La
materia abarca una amplia variedad de tcnicas de deteccin, identificacin,
caracterizacin y cuantificacin de OGM, y se incluye informacin terica que se
considera importante y bsica para quien desee introducirse y trabajar en el campo
de la deteccin de OGM.
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

VII

Esperamos que la estructura y el contenido del Manual ayuden a los participantes


en el curso (y tambin a otros usuarios) para la transmisin y difusin de las
capacidades adquiridas en el contexto de los diferentes entornos de trabajo segn
las necesidades.
No se ha intentado en ningn momento competir con la informacin disponible en
libros de texto o publicaciones peridicas. Lo que pretende el Manual es
complementar la informacin que se encuentra en la literatura especializada.
Para facilitar su difusin y consulta, esta publicacin se encuentra tambin en lnea
en la direccin: http://mbg.jrc.ec.europa.eu/capacitybuilding/documentation.htm.
Los miembros del personal del CCI que han participado en la preparacin del
Manual han sido supervisados por Maddalena Querci y se mencionan en el ndice
junto a su aportacin.
Vaya desde aqu nuestro agradecimiento especial tambin a todos los miembros del
personal de la Unidad de biotecnologa y OGM que, aunque no se mencionen uno a
uno, han contribuido al xito de la preparacin del Manual.
Manifestamos tambin nuestro agradecimiento a Margarita Aguilera-Gomez por su
colaboracin en la revisin del Manual.

Dra. Maddalena Querci


Coordinadora del curso
Junio de 2006

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

VIII

Observaciones iniciales de la Organizacin Mundial de la Salud


La Organizacin Mundial de la Salud otorga gran prioridad a la seguridad en el uso y
aplicacin de la biotecnologa moderna para la produccin y transformacin de
alimentos. Por este motivo, desde los primeros aos noventa la OMS trabaja mucho
en la organizacin de consultas con expertos sobre la inocuidad de los alimentos
derivados de la biotecnologa. En mayo de 2000, la LIII Asamblea Mundial de la
Salud adopt una resolucin en el sentido de que la OMS deba ayudar a los
Estados miembros a aportar una base cientfica para las decisiones sobre la salud
en relacin con los alimentos modificados genticamente. Asimismo, el Consejo
Ejecutivo de la OMS contempl la posibilidad de que se exploraran otras
consideraciones pertinentes en colaboracin con otros organismos.
La Comisin del Codex Alimentarius (CCA) es un organismo intergubernamental
creado para elaborar normas internacionales sobre los alimentos. Su objetivo
primario es proteger la salud de los consumidores y garantizar unas prcticas leales
en el comercio alimentario. La OMS es una de las organizaciones madre de la CCA
desde su creacin en 1963. En el marco de las actividades del Codex Alimentarius,
la OMS y su organizacin hermana dentro de la ONU, la FAO, participan en el
Grupo de accin intergubernamental especial del Codex sobre alimentos obtenidos
por medios biotecnolgicos, en el Comit del Codex sobre etiquetado de los
alimentos y en el Comit del Codex sobre mtodos de anlisis y muestreo.
El Programa de Seguridad Alimentaria en Europa de la OMS colabora con el Centro
Comn de Investigacin (CCI) de la Comisin Europea desde el ao 2000 en la
organizacin de cursos de formacin sobre tcnicas de deteccin de organismos
genticamente modificados (OGM) en alimentos. La finalidad de esta formacin es
capacitar en biotecnologa analtica al personal de los laboratorios de control de
alimentos y fomentar el uso de mtodos validados y armonizados para detectar
OGM en Europa y en el resto del mundo.
Unos mtodos adecuados de anlisis y muestreo son fundamentales para que un
etiquetado apropiado de los alimentos aumente la transparencia de los procesos de
produccin y facilite la trazabilidad, lo que redundar en la mejora de los sistemas

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

IX
de seguridad de los alimentos. Para permitir un acceso ms amplio a estos
mtodos, se ha decidido publicar en la red el Manual utilizado durante los cursos de
formacin conjuntos CCI/OMS. Los mtodos presentados en este Manual se ajustan
a los considerados por el Comit del Codex sobre mtodos de anlisis y muestreo.
El Programa de Seguridad Alimentaria de la OMS en Europa reconoce la
importancia de la colaboracin con el Centro Comn de Investigacin de la
Comisin Europea, institucin cientfica reconocida en todo el mundo en el mbito
de los OGM, y seguir fomentando las actividades de capacitacin en el mbito de
los mtodos de deteccin de OGM en los alimentos, tanto en Europa como en otras
regiones.

Dra. Cristina Tirado, veterinaria


Consejera Regional de Seguridad Alimentaria de la OMS en Europa

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

X
CURSO DE FORMACIN SOBRE
Anlisis de la Presencia de Organismos Genticamente Modificados en
Muestras de Alimentos
MANUAL DEL PARTICIPANTE
Editado por Maddalena Querci, Marco Jermini y Guy Van den Eede

ndice
Sesin

Titulo

Autores

Panorama, introduccin general sobre los


organismos genticamente modificados (OGM),
legislacin comunitaria

M. Querci, G. Van den Eede,


M. Jermini

Presentacin del Manual, mtodos de trabajo e


introduccin del curso

M. Querci

Muestras utilizadas durante el curso

M. Querci, N. Foti

Extraccin y purificacin de ADN

M. Somma

Electroforesis en gel de agarosa

M. Somma, M. Querci

Reaccin en cadena de la polimerasa (PCR)

M. Somma, M. Querci

Caractersticas de la soja Roundup Ready, del


maz MON810 y del maz Bt-176

M. Querci, M. Mazzara

Caractersticas de los sistemas cualitativos de


PCR descritos en el Manual

M. Querci, M. Mazzara

Deteccin cualitativa mediante PCR del maz


MON810, del maz Bt-176 y de la soja Roundup
Ready

M. Querci, M. Maretti,
M. Mazzara

10

PCR cuantitativa para la deteccin de OGM

F. Weighardt

11

Deteccin cuantitativa de la soja Roundup Ready


mediante PCR en tiempo real

N. Foti

12

Deteccin cuantitativa de la soja Roundup Ready


mediante ELISA

F. Eyquem

Apndice Ejemplo de programa de trabajo

M. Querci

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 1
Panorama, Introduccin General sobre los
Organismos Genticamente Modificados (OGM),
Legislacin Comunitaria
M. Querci, G. Van den Eede, M. Jermini

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

ndice
Sesin n 1
Panorama, Introduccin General sobre los Organismos
Genticamente Modificados (OGM), Legislacin Comunitaria

Introduccin

Modificacin gentica de los vegetales

Legislacin comunitaria

Inocuidad y etiquetado de alimentos obtenidos mediante la biotecnologa moderna; la


perspectiva de la OMS

13

Anexo 1. Legislacin comunitaria sobre la comercializacin de OGM, con inclusin de los


programas relacionados de etiquetado y control

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

17

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

Introduccin
Aparte del abanico de lneas vegetales modificadas genticamente desplegado por partes
de las regiones agrcolas del mundo, todos los cultivares actualmente cultivados son
producto de la domesticacin intensiva a partir de un estado silvestre original mediante la
continuidad de la seleccin y la reproduccin controlada para conseguir un producto ms
productivo, ms resistente a las plagas o de una calidad mejor o diferente respecto a las
lneas ancestrales anteriores. Tales cambios, que se llevan produciendo desde la primera
domesticacin de plantas para su explotacin por el hombre, implican el intercambio o
recombinacin de caracteres deseados, o genes, mediante el cruce continuo a lo largo del
tiempo dentro de una especie o entre grupos de especies con estrecha relacin y
compatibles sexualmente. En las ltimas dcadas se ha hecho posible producir cruces no
solo entre plantas que son compatibles en la naturaleza, sino tambin entre plantas cuyos
cruces se consideran estriles naturalmente. Como ejemplos de tcnicas que se utilizan en
tales casos pueden citarse las de recuperacin de embriones, el cultivo de embriones in
vitro o in vivo, los cultivos de vulos y ovarios, la polinizacin in vitro y la fertilizacin in vitro.
Por otra parte, pueden obtenerse cambios mutacionales, por ejemplo mediante irradiacin
de semillas.
Los procedimientos tradicionales de hibridacin y seleccin presentan una serie de
inconvenientes. Uno de los principales es que los obtentores suelen desear introducir
determinados caracteres aislados, ms que transferir y recombinar genomas enteros. Otro
consiste en que la seleccin y clasificacin de variedades genticamente estables es un
proceso lento.
Parece que estas desventajas se alivian mediante la aplicacin de tecnologas de
transformacin y recombinacin de ADN. Se ha introducido el trmino organismos
genticamente modificados (OGM) para describir a los organismos cuyo material gentico
se ha modificado de una forma que no se da en la naturaleza en condiciones normales de
hibridacin o recombinacin natural. El OGM en s debe ser una unidad biolgica capaz de
multiplicarse o transmitir material gentico. Aplicado a los vegetales, el trmino se refiere a
plantas en cuyo genoma (hospedador) se han introducido de forma estable uno o varios
genes procedentes de otras especies, mediante tcnicas de transferencia gentica y
cuando en la mayora de los casos se ha comprobado que tales genes introducidos hacen
que se obtenga un producto gnico (una protena). El proceso de introducir genes en
especies no emparentadas y conseguir que funcionen se denomina transformacin
gentica.
El anlisis de notificaciones de liberaciones experimentales en la UE pone de manifiesto
como caracteres estudiados con mayor frecuencia los siguientes: tolerancia a los
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

herbicidas, restauracin de la fertilidad o esterilidad masculina, resistencia a los insectos


derivada de Bacillus thurigiensis, resistencia a los virus, resistencia a los hongos y
alteracin

de

la

biosntesis

de

almidn

(para

ms

informacin,

vase

en

http://gmoinfo.jrc.ec.europa.eu/).

Modificacin gentica de los vegetales


Aunque hay muchas variaciones sobre el tema de la transformacin de los vegetales, son
pocos los mtodos principales de modificacin gentica de estos seres vivos. La primera de
las tecnologas, desarrollada en la dcada de 1980, utiliza una especie bacteriana
(Agrobacterium tumefaciens) para conseguir el gen que interesa introducir en el vegetal
hospedador.
Agrobacterium, microorganismo patgeno para los vegetales, se conoce desde el inicio del
siglo XX. En la naturaleza, A. tumefaciens tiene la excepcional capacidad de transferir un
segmento particular de ADN (ADN-T) de su plsmido inductor de tumores (Ti) al ncleo de
las clulas infectadas, donde se integra despus de forma estable en el genoma
hospedador y se transcribe, provocando la enfermedad de la agalla de la corona. El
fragmento ADN-T est flanqueado por repeticiones directas de 25 pares de bases, que
actan como seal de elemento cis para la maquinaria de transferencia.
Los cientficos aprovechan el fenmeno de que cualquier ADN extrao situado entre estos
extremos de ADN-T puede transferirse a clulas vegetales para desarrollar cepas de
Agrobacterium en que se ha sustituido algn gen patgeno por ADN seleccionado
especficamente.
Desde este descubrimiento se ha logrado avanzar notablemente en la comprensin del
proceso de transferencia gnica a clulas vegetales mediante Agrobacterium. No obstante,
la especie Agrobacterium tumefaciens infecta de forma natural solo a plantas
dicotiledneas, por lo que muchos vegetales de importancia econmica, como los cereales
(que son monocotiledneas), han quedado en gran medida al margen de la manipulacin
gentica. Para estos casos se han desarrollado mtodos alternativos de transformacin
directa, como la transferencia mediante polietilenglicol, la microinyeccin, los protoplastos y
la tecnologa de electroporacin de clulas intactas y lanzagenes (biolstica).
Sin embargo, la transformacin mediante Agrobacterium tiene diversas ventajas sobre los
mtodos de transformacin directa. Principalmente, reduce el nmero de ejemplares del
transgn, lo que puede hacer que se produzcan menos problemas de cosupresin e
inestabilidad de los transgenes.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

En ambos casos, las clulas (tanto las infectadas con Agrobacterium como las obtenidas
con el lanzagenes biolstico) se utilizan para regenerar plantas completas, que llevan el
nuevo gen o genes de inters. Estas plantas son objeto de pruebas, se reproducen de
forma intensiva y finalmente proporcionan semillas para una nueva generacin de lneas
vegetales modificadas genticamente.

Legislacin comunitaria1, 2
El uso de organismos genticamente modificados (su liberacin al medio ambiente, cultivo,
importacin y, en particular, su utilizacin como alimentos o ingredientes alimentarios) est
reglamentado en la Unin Europea mediante un conjunto de procedimientos estrictos. Los
primeros instrumentos jurdicos de la Comunidad (Directiva 90/220/CEE del Consejo y
Directiva 90/219/CEE del Consejo) se publicaron en 1990 con el propsito especfico de
proteger la salud humana y animal y el medio ambiente.
Actualmente, el principal instrumento jurdico comunitario, considerado como el marco
jurdico horizontal que rige el sector de la biotecnologa en la Unin Europea, es la Directiva
2001/18/CE del Parlamento Europeo y del Consejo, de 12 de marzo de 2001, sobre la
liberacin intencional en el medio ambiente de organismos genticamente modificados. La
Directiva 2001/18/CE deroga a la Directiva 90/220/CEE del Consejo y refuerza las normas
anteriores sobre la liberacin de OGM en el medio ambiente, estableciendo principios de
evaluacin del riesgo ambiental, obligaciones de seguimiento (ambiental) tras la
comercializacin, informacin al pblico, etiquetado y trazabilidad en todas las fases de
comercializacin, y la creacin de un registro molecular, entre otras medidas.
Segn la Directiva 2001/18/CE, las autorizaciones vigentes concedidas en virtud de la
Directiva 90/220/CEE del Consejo deben renovarse para evitar disparidades y tener
plenamente en cuenta las condiciones de autorizacin establecidas en la Directiva
2001/18/CE. La autorizacin (renovable) se concede por un plazo mximo de diez aos a
partir de la fecha de la autorizacin.
Tras la comercializacin de un OGM como producto o componente de un producto, el
notificador debe velar por que el seguimiento tras la comercializacin y la presentacin de
informes se lleven a cabo con arreglo a las condiciones especificadas en la autorizacin.

En el anexo 1 se encuentra una lista casi completa, aunque no exhaustiva, de los Reglamentos y Directivas de
la Unin Europea sobre OGM.
2
La situacin reflejada es la del 9 de junio de 2004.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

Cuadro 1. Vegetales modificados genticamente y autorizados para su comercializacin en


la UE segn la Directiva 90/220/CEE del Consejo

Producto

Lnea

Claveles

Claveles

Notificante

Caracteres principales

Nmero de la Decisin de la
Comisin/fecha

Florigene

Color de la flor
modificado

20.10.1998 (autorizacin del Estado

Duracin modificada de
la flor cortada

20.10.1998 (autorizacin del Estado

Color de la flor
modificado

1.12.1997 (autorizacin del Estado

Florigene

Claveles

Florigene

miembro)

miembro)

miembro)

Maz

Zea mays L.
lnea MON 810

Monsanto

Expresin del gen


cryIA(b) de Bt

98/294/CE de 22 de abril de 1998

Maz*

Zea mays L.
lnea Bt-11

Novartis

Tolerancia al glufosinato
de amonio y expresin
del gen cryIA(b) de Bt

98/292/CE de 22 de abril de 1998

Maz

Zea mays L.
T25

AgrEvo

Tolerancia al glufosinato
de amonio

98/293/CE de 22 de abril de 1998

Colza de
primavera*

Brassica napus
L. ssp. oleifera

AgrEvo

Tolerancia al glufosinato
de amonio

98/291/CE de 22 de abril de 1998

Colza

Brassica napus
L. oleifera
Metzg. MS1,
RF2

Plant
Genetic
Systems

Tolerancia al glufosinato
de amonio

97/393/CE de 6 de junio de 1997

Colza

Brassica napus
L. oleifera
Metzg. MS1,
RF1

Plant
Genetic
Systems

Tolerancia al glufosinato
de amonio

97/392/CE de 6 de junio de 1997

Maz

Zea mays L.
lnea Bt-176
(maz
Maximizer)

Ciba-Geigy

Tolerancia al glufosinato
de amonio y expresin
del gen de la endotoxina
de Bt

97/98/CE de 23 de enero de 1997

Achicoria
con
esterilidad
masculina**

Cichorium
intybus L.

Bejo-Zaden
BV

Tolerancia al glufosinato
de amonio

96/424/CE de 20 de mayo de 1996

Soja*

Glycine max L.
(Roundup
Ready)

Monsanto

Tolerancia al glifosato

96/281/CE de 3 de abril de 1996

Colza

Brassica napus
L. oleifera
Metzg. MS1Bn
x RF1Bn

Plant
Genetic
Systems

Tolerancia al glufosinato
de amonio

96/158/CE de 6 de febrero de 1996

Tabaco

Variedad ITB
1000 OX

SEITA

Tolerancia al bromoxinilo

94/385/CE de 8 de junio de 1994

* Cultivo en la UE no autorizado.

** Solo para la produccin de semillas.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

La Directiva 2001/18/CE, aplicada en cada Estado miembro mediante normas nacionales,


se refiere tanto a los ensayos de campo a pequea escala (liberaciones voluntarias con
fines experimentales, objeto de la parte B de la Directiva) como a las disposiciones de
comercializacin de los OGM (objeto de la parte C). Como se indica en el cuadro 1, se ha
autorizado un total de 18 OGM segn el antiguo procedimiento 90/220/CEE (de ellos,
quince se refieren a vegetales, tres de los cuales por autorizacin de los Estados
miembros). Hasta ahora, se han presentado ms de 25 solicitudes de comercializacin de
OGM para su autorizacin segn la Directiva 2001/18/CE (para obtener mas informacin
sobre la situacin de los expedientes en la direccin http://gmoinfo.jrc.ec.europa.eu/).
La utilizacin confinada de microorganismos genticamente modificados se regula mediante
una Directiva hermana (Directiva 98/81/CE del Consejo, de 26 de octubre de 1998, por
la que se modifica la Directiva 90/219/CEE relativa a la utilizacin confinada de
microorganismos genticamente modificados).
Adems de las Directivas antes mencionadas, a lo largo de los aos se ha ido elaborando y
aplicando una serie de instrumentos jurdicos verticales, en los que se trata ms
especficamente la aprobacin y la seguridad en el uso de los OGM destinados al consumo
humano. La comercializacin dentro de la Comunidad de nuevos alimentos y nuevos
ingredientes alimentarios era objeto hasta hace poco de un acto legislativo vertical, el
Reglamento (CE) n 258/97, que se refera especficamente a lo siguiente:
- alimentos e ingredientes alimentarios que contengan organismos genticamente
modificados con arreglo a la Directiva 90/220/CEE, o que consistan en dichos organismos;
- alimentos e ingredientes alimentarios producidos a partir de organismos genticamente
modificados, pero que no los contengan;
- alimentos e ingredientes alimentarios de estructura molecular primaria nueva o modificada
intencionadamente;
- alimentos e ingredientes alimentarios consistentes en microorganismos, hongos o algas u
obtenidos a partir de estos;
- alimentos e ingredientes alimentarios consistentes en vegetales, u obtenidos a partir de
ellos, e ingredientes alimentarios obtenidos a partir de animales, excepto los alimentos e
ingredientes alimentarios obtenidos mediante prcticas tradicionales de multiplicacin o de
seleccin y cuyo historial de uso alimentario sea seguro;
- alimentos e ingredientes alimentarios que se hayan sometido a un proceso de produccin
no utilizado habitualmente, que provoca en su composicin o estructura cambios
significativos que afectan a su valor nutritivo, a su metabolismo o a su contenido en
sustancias indeseables.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

La cuestin concreta del etiquetado de alimentos GM (modificados genticamente) es


objeto de varios instrumentos jurdicos. Los requisitos de etiquetado se mencionaban por
primera vez en el Reglamento (CE) n 258/97 (Reglamento sobre nuevos alimentos), pero
ciertas lneas GM de maz y de soja fueron sometidas posteriormente a normas de
etiquetado al entrar en vigor el Reglamento (CE) n 1139/98 del Consejo.
De hecho, como antes de que entrara en vigor el Reglamento (CE) n 258/97 ya se haban
comercializado dos OGM (la soja Roundup Ready y el maz Maximizer), en el Reglamento
(CE) n 1139/98 se establecieron a posteriori requisitos de etiquetado especficos para
ellos.
En el Reglamento (CE) n 258/97 se establecan requisitos especficos de etiquetado para
que el consumidor final estuviera informado de cualquier cambio de las caractersticas o
propiedades alimentarias, tales como la composicin, el valor nutritivo o los efectos
nutritivos, o el uso previsto del alimento, responsable de que un nuevo alimento o
ingrediente alimentario dejara de ser equivalente a un alimento o ingrediente alimentario
existente. Actualmente, se han autorizado y pueden comercializarse legalmente en la UE
productos de diecisiete modificaciones genticas (vase el cuadro 2). Una soja GM y un
maz GM fueron autorizados en virtud de la Directiva 90/220/CEE antes de la entrada en
vigor del Reglamento sobre nuevos alimentos. Los dems (alimentos transformados
derivados principalmente de siete colzas oleaginosas GM y cinco maces GM, y aceite de
dos semillas de algodn GM) se han notificado como sustancialmente equivalentes de
acuerdo con el Reglamento sobre nuevos alimentos y se han autorizado segn el
procedimiento simplificado.
El Reglamento (CE) n 1139/98 del Consejo estableca un modelo de etiquetado basado en
el principio de que un alimento o ingrediente GM deja de considerarse equivalente a uno
existente no GM si puede detectarse la presencia de ADN o de protena derivados de la
modificacin gentica. Los aditivos estaban excluidos de los requisitos de etiquetado hasta
la entrada en vigor del Reglamento (CE) n 50/2000 de la Comisin.
El Reglamento (CE) n 1139/98 fue modificado posteriormente por el denominado
Reglamento de umbrales (Reglamento (CE) n 49/2000 de la Comisin, de 10 de enero
de 2000, por el que se modifica el Reglamento (CE) n 1139/98 del Consejo), que intentaba
resolver el problema planteado por la contaminacin inadvertida e introduca el concepto de
umbral.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

Cuadro 2. Alimentos modificados genticamente autorizados en la Unin Europea3

Modificacin

GTS 40/3/2

Vegetal

Soja

Solicitante

Rasgo

Posibles usos
alimentarios

Fecha

Base
jurdica

Monsanto

Proteccin
contra
insectos y
tolerancia a
herbicidas

Alimentos de soja
incluidos bebidas,
tofu, aceite, harina
o lecitina.

3.4. 96

Dir.
90/220/CEE,
art. 13

Alimentos de maz
incluidos granos,
aceite, harina de
maz, azcar y
jarabe.

23.1. 97

Dir.
90/220/CEE,
art. 13

Bt 176

Maz

Ciba-Geigy

Proteccin
contra
insectos y
tolerancia a
herbicidas

TOPAS 19/2

Colza
oleaginosa

AgrEvo

Tolerancia a
herbicidas
Tolerancia a
herbicidas

Aceite de colza.
Entre los productos
obtenidos del
aceite de colza
pueden citarse
alimentos fritos,
productos de
panadera y
aperitivos.

24.6. 97

Reg. (CE) n
258/97, art. 5

24.6. 97

Reg. (CE) n
258/97, art. 5

24.6. 97

Reg. (CE) n
258/97, art. 5

21.11. 97

Reg. (CE) n
258/97, art. 5

6.2. 98

Reg. (CE) n
258/97, art. 5

6.2.98

Reg. (CE) n
258/97, art. 5

6.2.98

Reg. (CE) n
258/97, art. 5

23.10.98

Reg. (CE) n
258/97, art. 5

8.11.99

Reg. (CE) n
258/97, art. 5

8.11.99

Reg. (CE) n
258/97, art. 5

26.4.00

Reg. (CE) n
258/97, art. 5

19.12.02

Reg. (CE) n
258/97, art. 5

19.12. 02

Reg. (CE) n
258/97, art. 5

MS1 / RF2

Colza
oleaginosa

Plant
Genetic
Systems

MS1 / RF1

Colza
oleaginosa

Plant
Genetic
Systems

Tolerancia a
herbicidas

GT 73

Colza
oleaginosa

Monsanto

Tolerancia a
herbicidas

MON 810

Maz

Monsanto

Proteccin
contra
insectos

T 25

Maz

AgrEvo

Tolerancia a
herbicidas

Bt 11

Maz

Novartis

Proteccin
contra
insectos

10

MON 809

Maz

Pioneer

Proteccin
contra
insectos

11

Falcon GS
40/90

Colza
oleaginosa

Hoechst /
AgrEvo

Tolerancia a
herbicidas

12

Liberator L62

Colza
oleaginosa

Hoechst /
AgrEvo

Tolerancia a
herbicidas

13

MS8/RF3

Colza
oleaginosa

Plant
Genetic
Systems

Tolerancia a
herbicidas

14

1445

Algodn

Monsanto

15

531

Algodn

Monsanto

Proteccin
contra
insectos

16

pRF69/pRF93

Bacillus
subtilis

F.
Hoffmann La Roche

Riboflavina

Vitamina B2

23.3. 00

Reg. (CE) n
258/97, art. 5

17

Bt11

Maz

Syngenta

Resistencia a
insectos

Maz dulce

19.5. 04

Reg. (CE) n
258/97, art. 7

Fuente: Comisin Europea:


2010.

Tolerancia a
herbicidas

Derivados de maz
incluidos aceite de
maz, harina,
azcar y jarabe.
Entre los derivados
del maz pueden
citarse aperitivos,
productos de
panadera,
alimentos fritos,
artculos de
confitera y
refrescos.
Aceite de colza
incluidos alimentos
fritos, productos de
panadera y
aperitivos.

Aceite de semilla
de algodn, los
alimentos fritos,
productos de
panadera y
aperitivos.

http://ec.europa.eu/food/dyna/gm_register/index_en.cfm.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

ltimo acceso enero de

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

10

El Reglamento estableca que no se aplicaran a los alimentos los requisitos especficos


adicionales de etiquetado en caso de que la presencia en los ingredientes alimentarios de
material obtenido de los organismos genticamente modificados no superara la proporcin
del 1 % en cada uno de los ingredientes alimentarios.
Por otra parte, a fin de establecer que la presencia de este material era accidental, los
operadores deban aportar pruebas de que haban tomado las medidas oportunas para no
utilizar organismos genticamente modificados.
Por diversas razones, como la controvertida opinin de diferentes asociaciones de usuarios
en relacin con los OGM, las dificultades de interpretacin y aplicacin de los instrumentos
jurdicos promulgados a lo largo del tiempo o la ausencia de legislacin comunitaria
especfica sobre piensos GM, se lleg al convencimiento de que era necesario unificar,
actualizar y completar los instrumentos jurdicos en este mbito.
Finalmente, en octubre de 2003 se publicaron dos Reglamentos que, al modificar o derogar
instrumentos jurdicos anteriores, proporcionaron una gua ms completa e informativa
sobre estas cuestiones.
En concreto, se trata de los siguientes: el Reglamento (CE) n 1829/2003 del Parlamento
Europeo y del Consejo, de 22 de septiembre de 2003, sobre alimentos y piensos
modificados genticamente, y el Reglamento (CE) n 1830/2003 del Parlamento Europeo y
del Consejo, de 22 de septiembre de 2003, relativo a la trazabilidad y al etiquetado de
organismos genticamente modificados y a la trazabilidad de los alimentos y piensos
producidos a partir de stos, y por el que se modifica la Directiva 2001/18/CE.
En el Reglamento (CE) n 1829/2003 se han reforzado y ampliado las normas sobre
evaluacin de la seguridad. Mediante este Reglamento se introducen por primera vez
normas especficas sobre piensos GM y se consagran los requisitos de etiquetado de
alimentos y piensos GM, que hasta ahora eran tratados solo parcialmente en el Reglamento
(CE) n 1139/98 del Consejo y en el Reglamento (CE) n 49/2000 de la Comisin.
Como caracterstica principal, este Reglamento aplica el principio de una sola llave y una
sola puerta: una sola autorizacin permite la utilizacin tanto en alimentos como en piensos,
llenando as el vaco legal sobre la aprobacin de productos para piensos y abandonando a
la vez el procedimiento simplificado que se basaba en el concepto de la equivalencia
sustancial.
De conformidad con el Reglamento (CE) n 1829/2003 (vigente desde el 18 de abril de
2004), el solicitante debe presentar un expediente completo donde se indique un mtodo de
deteccin de la modificacin gentica concreta de que se trate. El expediente y, en
particular, sus partes sobre evaluacin del riesgo para el medio ambiente y para la
seguridad de los alimentos, han de ser evaluados por la Autoridad Europea de Seguridad

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

11

Alimentaria (creada en virtud del Reglamento (CE) n 178/2002 del Parlamento Europeo y
del Consejo, de 28 de enero de 2002). Los mtodos de deteccin indicados por el solicitante
deben ser evaluados y validados por el laboratorio comunitario de referencia (creado en
virtud del Reglamento (CE) n 1829/2003).
En el Reglamento se definen nuevos umbrales mnimos para el etiquetado. Se ha reducido
al 0,9 % el umbral del 1 % especificado en el Reglamento (CE) n 49/2000 de la Comisin
respecto a la presencia accidental de OGM autorizados. Por otra parte, se ha establecido un
umbral del 0,5 % respecto a la presencia accidental de OGM no autorizados, con carcter
transitorio, siempre que hayan sido objeto de un dictamen favorable del comit o comits
cientficos pertinentes. La UE reconoce el derecho de los consumidores a la informacin y al
etiquetado como instrumento para elegir con conocimiento de causa. Desde 1997 es
obligatorio el etiquetado para indicar la presencia de OGM como tales o formando parte de
un producto. Sin embargo, el Reglamento (CE) n 1830/2003 refuerza las normas vigentes
sobre etiquetado de alimentos GM: extiende el etiquetado obligatorio a todos los alimentos y
piensos, independientemente de la detectabilidad, y define la trazabilidad como la
capacidad de seguir la traza de los OGM y los productos producidos a partir de OGM en
todas las fases de su comercializacin a lo largo de las cadenas de produccin y
distribucin.
As pues, es necesario disponer de mtodos no solo para detectar la eventual presencia de
un OGM en una matriz alimentaria, sino tambin para identificar el OGM en concreto y
medir su cantidad en diferentes ingredientes de alimentos y piensos.
Pueden utilizarse mtodos cualitativos de deteccin en un cribado inicial de los productos
alimentarios, para investigar la presencia de compuestos especficos (ADN o protenas) de
OGM. Es posible efectuar as anlisis cualitativos de productos muestreados en las
estanteras de los supermercados, en los suministros almacenados en las existencias, o en
otros puntos remontando la cadena de distribucin.
Si los anlisis cualitativos proporcionan una indicacin de la presencia de OGM, con un
ensayo cuantitativo posterior podra obtenerse una respuesta decisiva sobre el requisito de
etiquetado.
Como se ha sealado anteriormente, se introduce en el marco normativo un nuevo
componente fundamental del procedimiento legislativo: el laboratorio comunitario de
referencia (CRL). En el contexto del Reglamento (CE) n 1829/2003, el CCI, asistido por la
Red Europea de Laboratorios OGM, ha sido nombrado laboratorio comunitario de referencia
(http://gmo-crl.jrc.ec.europa.eu/).
El CRL tiene el mandato de evaluar y validar mtodos analticos para garantizar que se
ajustan al objetivo de cumplir la normativa y de asesorar sobre aspectos cientficos y
tcnicos en caso de litigio.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

12

En la legislacin citada se exige la disponibilidad de mtodos de anlisis que sean seguros,


precisos y robustos. Esto implica una actividad de investigacin que contribuya a la
armonizacin y normalizacin del enfoque y del conjunto de procedimientos analticos y sus
caractersticas en todos los laboratorios comunitarios de ejecucin y control en relacin con
los OGM.
La armonizacin y normalizacin de los procedimientos y sus caractersticas dentro de los
laboratorios europeos de control ya lleva varios aos siendo sealada por el CCI como
elemento fundamental para el xito de cualquier instrumento legislativo de control.
Efectivamente, la Unidad de biotecnologa y OGM del Instituto de la Salud y la Proteccin
de los Consumidores del CCI propone y fomenta desde 1999 la formacin de una red de
laboratorios de ejecucin participantes en asuntos relacionados con los OGM.
La Red Europea de Laboratorios OGM se inaugur oficialmente en diciembre de 2002
(http://engl.jrc.ec.europa.eu/). La gestin y las actividades de secretara son coordinadas por
la Comisin Europea (DG Centro Comn de Investigacin CCI). Esta Red, que contaba
anteriormente con 47 laboratorios de control de los Estados miembros, ha crecido
recientemente hasta tener 71 componentes, de los que 24 proceden de los ltimos pases
adheridos a la Unin Europea. La presidencia y la secretara de la Red son responsabilidad
de la Unidad de biotecnologa y OGM del Instituto de la Salud y la Proteccin de los
Consumidores del CCI.
El objetivo de la Red Europea de Laboratorios OGM consiste en crear una plataforma nica
de expertos activos en el muestreo, deteccin, identificacin y cuantificacin de OGM en
semillas, granos, alimentos, piensos y muestras ambientales, para plantear y tratar temas
tcnicos, como:

desarrollo de mtodos para el anlisis cuali y cuantitativo;

transferencia de tecnologa, formacin y creacin de capacidad;

validacin y estudios de aptitud de mtodos adecuados para el cribado de diversas


matrices en cuanto a la presencia de OGM o para la estimacin de las cantidades de
OGM presentes;

materiales de referencia (este aspecto corresponde al Instituto de Materiales y


Medidas de Referencia del CCI);

estrategias y mtodos de muestreo de los diferentes productos GM (semillas,


granos, materias primas, productos para el consumidor final o las colectividades);

bases de datos y bioinformtica y requisitos para la identificacin inequvoca de


OGM y creacin de bases que contengan tales datos moleculares.

En el contexto de las actividades de la Red, los cursos de formacin deben considerarse


uno de los principales instrumentos para conseguir los objetivos antes citados.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

13

Inocuidad y etiquetado de alimentos obtenidos mediante la


biotecnologa moderna; perspectiva de la OMS4
La liberacin de OGM en el medio ambiente y la comercializacin de alimentos GM han
provocado un debate pblico en muchas partes del mundo. Es probable que este debate
contine en el contexto ms amplio de otros usos de la biotecnologa (p. ej., en medicina) y
sus consecuencias para la sociedad. Aunque los temas debatidos suelen ser muy similares
(costes y beneficios, aspectos relacionados con la inocuidad), el resultado del debate
cambia de un pas a otro. Actualmente no hay consenso sobre aspectos como la utilidad del
etiquetado y de la trazabilidad de los alimentos GM para disipar la inquietud de los
consumidores. Esto se ha puesto de manifiesto en los debates efectuados en la Comisin
del Codex Alimentarius a lo largo de los ltimos aos. La Comisin del Codex Alimentarius
(Codex; http://www.codexalimentarius.net/web/index_es.jsp) es el organismo conjunto
FAO/OMS encargado de compilar las normas, cdigos de prcticas, orientaciones y
recomendaciones

que

constituyen

el

Codex

Alimentarius,

el

cdigo

alimentario

internacional. A pesar de la falta de consenso sobre estos temas, se ha avanzado bastante


en la armonizacin de las opiniones sobre la evaluacin del riesgo. Sin embargo, el Codex
est a punto de adoptar principios sobre la evaluacin del riesgo antes de la
comercializacin que muestran un aumento del entendimiento a nivel internacional (vase la
prepublicacin de los Principios para el anlisis de riesgos de alimentos obtenidos por
medios

biotecnolgicos

modernos,

CAC/GL

44-2003,

en

la

direccin

ftp://ftp.fao.org/es/esn/food/princ_gmfoods_es.pdf).
Los diferentes organismos GM contienen diferentes genes insertados de formas diversas.
Esto significa que los distintos alimentos GM y su inocuidad deben evaluarse caso por caso
y que no es posible hacer declaraciones generales sobre la seguridad de todos los
alimentos GM. Segn la OMS, los alimentos GM actualmente disponibles en el mercado
internacional han sido objeto de evaluaciones del riesgo y no es probable que presenten
riesgos para la salud humana. Adems, no se han puesto de manifiesto efectos sobre la
salud humana que fueran resultado del consumo de tales alimentos por la poblacin en
general de los pases en que se han autorizado. La evaluacin de la inocuidad de los
alimentos GM debe basarse en el uso continuo de evaluaciones del riesgo segn los
principios del Codex y, en su caso, con seguimiento tras la comercializacin.

Para obtener informacin completa sobre las actividades de la OMS y de otras agencias de la ONU en relacin
con los alimentos obtenidos mediante la biotecnologa moderna, vase en la direccin
http://www.who.int/foodsafety/en/.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

14

El etiquetado de los alimentos producidos por biotecnologa puede estar relacionado o no


con la inocuidad de los alimentos per se, pero la OMS lo toma como una herramienta para
aumentar la transparencia de los procesos de produccin de alimentos.

Es posible que

este etiquetado facilite tambin el desarrollo de estrategias de trazabilidad, que podran


contribuir a mejorar los programas nacionales de inocuidad de los alimentos e
indirectamente, por tanto, la propia inocuidad de los alimentos en general. As pues, es
evidente la importancia de disponer de unos mtodos adecuados de anlisis y muestreo.
La OMS trabaja en el desarrollo de principios y recomendaciones sobre la seguridad y la
evaluacin del riesgo de alimentos obtenidos mediante biotecnologa. Los resultados
obtenidos a lo largo de diversas consultas de expertos constituyen la base de unas
orientaciones nacionales y actualmente se est en fase de incorporarlos a orientaciones
reconocidas internacionalmente. El enfoque segn el principio de la equivalencia sustancial
se elabor para evaluar la seguridad de la primera generacin de plantas modificadas
genticamente y muchos lo consideran adecuado. No obstante, esta idea es criticada
actualmente. Las actividades que se estn llevando a cabo deben tener en cuenta estos
argumentos y contribuir a la consecucin de unos ajustes y mejoras con base cientfica.
La Consulta FAO/OMS de expertos sobre aspectos relacionados con la inocuidad de los
alimentos modificados genticamente de origen vegetal, celebrada en el ao 2000, admiti
que el concepto de equivalencia sustancial puede utilizarse como enfoque comparativo
centrado en las similitudes y diferencias entre los alimentos modificados genticamente y su
contraparte convencional. Simultneamente, manifest su opinin de que el concepto de
equivalencia sustancial no es en s una evaluacin de la inocuidad ni un criterio, sino tan
solo

un

punto

de

partida

para

la

evaluacin

de

la

inocuidad

(http://www.fao.org/ag/agn/food/risk_biotech_aspects_en.stm).
La prxima generacin de alimentos GM ser la de vegetales con un valor nutritivo
mejorado, cruzando as el lmite con los alimentos funcionales y nutracuticos. Las futuras
estrategias de evaluacin de la inocuidad de los alimentos tendrn que referirse a los
cambios metablicos ms complejos causados por las modificaciones genticas dadas. Las
evaluaciones tendrn que ir considerando cada vez ms el impacto de un alimento GM
sobre la situacin nutricional general, habida cuenta de las diferentes necesidades de los
pases desarrollados y en desarrollo.
Actualmente no est implantado ningn sistema normativo internacional especfico. Sin
embargo, hay varios organismos internacionales que participan en la elaboracin de
protocolos sobre OGM. Como se ha dicho antes, el Codex est elaborando principios sobre
el anlisis del riesgo de los alimentos GM para la salud humana. La premisa de estos

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

15

principios exige una evaluacin previa a la comercializacin, efectuada caso por caso y con
inclusin de un estudio tanto de los efectos directos (del gen insertado) como de los efectos
imprevistos (que pueden producirse como consecuencia de la insercin de un nuevo gen).
Los principios se encuentran en una fase avanzada de elaboracin, pero an no se han
adoptado (vase la prepublicacin de los Principios para el anlisis de riesgos de
alimentos obtenidos por medios biotecnolgicos modernos, CAC/GL 44-2003, en la
direccin ftp://ftp.fao.org/es/esn/food/princ_gmfoods_es.pdf). Estos y otros principios del
Codex en fase de elaboracin (incluidos los Principios sobre mtodos de anlisis y
muestreo) carecen de efecto vinculante sobre la legislacin nacional, pero se citan
especficamente en el Acuerdo sobre la aplicacin de las medidas sanitarias y fitosanitarias
de la Organizacin Mundial del Comercio (Acuerdo SPS) y pueden utilizarse como
referencia en caso de litigios comerciales.
Teniendo en cuenta el trabajo efectuado entre 1999 y 2003 por el Grupo de accin
intergubernamental

especial

del

Codex

sobre

alimentos

obtenidos

por

medios

biotecnolgicos (http://www.fao.org/ag/agn/agns/biotechnology_codex_en.asp), el Comit


del Codex sobre etiquetado de los alimentos y el Comit del Codex sobre mtodos de
anlisis y muestreo, seguirn siendo objeto de atencin preferente de la OMS la elaboracin
de orientaciones aceptadas generalmente para la evaluacin de la inocuidad de los
alimentos obtenidos mediante biotecnologa, los aspectos de la comunicacin del riesgo (p.
ej., mediante el etiquetado) y, por tanto, la elaboracin de mtodos adecuados de anlisis.
Por

tanto,

la

OMS

sigue

organizando

consultas

de

expertos

(http://www.who.int/foodsafety/biotech/consult/en/index.html) para elaborar principios y


metodologas de evaluacin del riesgo, gestin del riesgo y comunicacin del riesgo en
relacin con alimentos producidos mediante biotecnologa, y coordinando la colaboracin
entre pases desarrollados y en desarrollo en el mbito de los mtodos de deteccin.
El Departamento de Inocuidad de los Alimentos, dentro de la OMS, est terminando un
estudio basado en evidencias sobre las implicaciones de la biotecnologa moderna de los
alimentos para la salud y el desarrollo humanos. El impulso para el estudio procede de una
resolucin de la LIII Asamblea Mundial de la Salud, celebrada en mayo de 2000, segn la
cual la OMS debe reforzar su capacidad de ayudar a los Estados miembros a sentar las
bases cientficas de las decisiones sobre la moderna biotecnologa alimentaria, y de velar
por la transparencia, excelencia e independencia de los dictmenes emitidos.
El

estudio

(http://www.who.int/foodsafety/biotech/who_study/en/index.html)

pretende

complementar los esfuerzos de otros organismos internacionales reuniendo la informacin


ya existente y analizndola segn corresponde al mandato de la OMS. A fin de aumentar la

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

16

transparencia del proceso, la OMS ha colaborado con la FAO y ha contado con la


participacin de una serie de interlocutores y grupos de inters. El objetivo principal es el de
crear una base de conocimiento accesible para ayudar a los Estados miembros, organismos
de normas internacionales y otros interlocutores a alcanzar un consenso transparente y
global sobre la evaluacin y la aplicacin de la biotecnologa. Finalmente, la OMS pretende
establecer unos cimientos basados en pruebas factibles para construir una evaluacin ms
holstica de la biotecnologa para el futuro.
Este estudio se diriga a poner en su contexto la contribucin general que puede aportar a la
salud y desarrollo humanos la biotecnologa moderna de los alimentos. Incluye la aplicacin
de la biotecnologa moderna de los alimentos a los microorganismos, vegetales y animales.
Se

adopt

un

planteamiento

integrado

(holstico)

para

identificar

los

aspectos

fundamentales que afectan directa o indirectamente a la salud y desarrollo humanos, y


establecer cules son las pruebas disponibles. Los principales aspectos relacionados con
las pruebas son los siguientes:
investigacin y desarrollo;
impacto sobre la salud humana (inocuidad de los alimentos y efectos ambientales);
seguridad del abastecimiento alimentario, coste y acceso a la tecnologa;
aspectos ticos, legales y sociales;
iniciativas para crear capacidad.
Se recopilaron datos procedentes de una bibliografa muy amplia, de Internet y de una
investigacin por encuesta, avalada por unas 120 respuestas a un cuestionario que se
haba planteado a una amplia gama de interlocutores y expertos en mayo de 2002. Tambin
se han incorporado las observaciones procedentes de un debate electrnico de
interlocutores, celebrado entre enero y abril de 2003.

Asimismo se han incluido las

opiniones de los participantes (entre los que haba representantes de los gobiernos, de los
consumidores, de la industria y de las organizaciones no gubernamentales (ONG), de
pases tanto desarrollados como en desarrollo) en una reunin de interlocutores celebrada
los das 5 y 6 de junio de 2003 en Ginebra.
El informe redactado como resultado de este proceso de consulta ser utilizado
directamente por la OMS para planificar sus actividades en el futuro respecto al uso y
aplicacin de la biotecnologa moderna en la salud y desarrollo humanos.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

17

Anexo 1. Legislacin comunitaria sobre la comercializacin de


OGM, con inclusin de los programas relacionados de etiquetado y
control
Directiva 90/220/CEE del Consejo, de 23 de abril de 1990, sobre la liberacin intencional en
el medio ambiente de organismos genticamente modificados (DO L 117 de 8.5.1990,
p. 15).
Derogada por:
Directiva 2001/18/CE del Parlamento Europeo y del Consejo, de 12 de marzo de 2001,
sobre la liberacin intencional en el medio ambiente de organismos genticamente
modificados y por la que se deroga la Directiva 90/220/CEE del Consejo. (DO L 106 de
17.4.2001, p. 1).
Directiva 90/219/CEE del Consejo, de 23 de abril de 1990, relativa a la utilizacin confinada
de microorganismos genticamente modificados (DO L 117 de 8.5.1990, p. 1).
Modificada por:
Directiva 98/81/CE del Consejo, de 26 de octubre de 1998, por la que se modifica la
Directiva 90/219/CEE relativa a la utilizacin confinada de microorganismos genticamente
modificados (DO L 330 de 5.12.1998, p. 13).
Reglamento (CE) n 258/97 del Parlamento Europeo y del Consejo, de 27 de enero de
1997, sobre nuevos alimentos y nuevos ingredientes alimentarios (DO L 43 de 14.2.1997,
p. 1).
Reglamento (CE) n 178/2002 del Parlamento Europeo y del Consejo, de 28 de enero de
2002, por el que se establecen los principios y los requisitos generales de la legislacin
alimentaria, se crea la Autoridad Europea de Seguridad Alimentaria y se fijan
procedimientos relativos a la seguridad alimentaria (DO L 31 de 1.2.2002, p. 1).
Reglamento (CE) n 1139/98 del Consejo, de 26 de mayo de 1998, relativo a la indicacin
obligatoria, en el etiquetado de determinados productos alimenticios fabricados a partir de
organismos genticamente modificados, de informacin distinta de la prevista en la Directiva
79/112/CEE (DO L 159 de 3.6.1998, p. 4).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

18

Directiva 97/4/CE del Parlamento Europeo y del Consejo, de 27 de enero de 1997, por la
que se modifica la Directiva 79/112/CEE del Consejo, relativa a la aproximacin de las
legislaciones de los Estados miembros en materia de etiquetado, presentacin y publicidad
de los productos alimenticios destinados al consumidor final (DO L 43 de 14.2.1997, p. 21).
Directiva 96/21/CE del Consejo, de 29 de marzo de 1996, por la que se modifica la Directiva
94/54/CE de la Comisin, relativa a la indicacin en el etiquetado de determinados
productos alimenticios de otras menciones obligatorias distintas de las previstas en la
Directiva 79/112/CEE (DO L 88 de 5.4.1996, p. 5).
Directiva 94/54/CE de la Comisin, de 18 de noviembre de 1994, relativa a la indicacin en
el etiquetado de determinados productos alimenticios de otras menciones obligatorias
distintas de las previstas en la Directiva 79/112/CEE del Consejo (DO L 300 de 23.11.1994,
p. 14).
Reglamento (CE) n 49/2000 de la Comisin, de 10 de enero de 2000, por el que se
modifica el Reglamento (CE) n 1139/98 del Consejo relativo a la indicacin obligatoria, en
el etiquetado de determinados productos alimenticios fabricados a partir de organismos
genticamente modificados, de informacin distinta de la prevista en la Directiva
79/112/CEE (DO L 6 de 11.1.2000, p. 13).
Reglamento (CE) n 50/2000 de la Comisin, de 10 de enero de 2000, relativo al etiquetado
de los productos alimenticios e ingredientes alimentarios que contienen aditivos y aromas
modificados genticamente o producidos a partir de organismos genticamente modificados
(DO L 6 de 11.1.2000, p. 15).
Directiva 89/397/CEE del Consejo, de 14 de junio de 1989, relativa al control oficial de los
productos alimenticios (DO L 186 de 30.6.1989, p. 23).
Directiva 93/99/CEE del Consejo, de 29 de octubre de 1993, sobre medidas adicionales
relativas al control oficial de los productos alimenticios (DO L 290 de 24.11.1993, p. 14).
Recomendacin de la Comisin, de 25 de enero de 2002, relativa a un programa
coordinado de control oficial de productos alimenticios para el ao 2002 (2002/66/CE) (DO L
26 de 30.1.2002, p. 8).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Panorama, Introduccin General sobre los Organismos Genticamente Modificados (OGM), Legislacin Comunitaria

19

Reglamento (CE) n 1829/2003 del Parlamento Europeo y del Consejo, de 22 de septiembre


de 2003, sobre alimentos y piensos modificados genticamente (DO L 268 de 18.10.2003,
p. 1).
Reglamento (CE) n 1830/2003 del Parlamento Europeo y del Consejo, de 22 de septiembre
de 2003, relativo a la trazabilidad y al etiquetado de organismos genticamente modificados
y a la trazabilidad de los alimentos y piensos producidos a partir de stos, y por el que se
modifica la Directiva 2001/18/CE (DO L 268 de 18.10.2003, p. 24).
Reglamento (CE) n 641/2004 de la Comisin, de 6 de abril de 2004, sobre las normas de
desarrollo del Reglamento (CE) n 1829/2003 del Parlamento Europeo y del Consejo en lo
relativo a la solicitud de autorizacin de nuevos alimentos y piensos modificados
genticamente, la notificacin de productos existentes y la presencia accidental o
tcnicamente inevitable de material modificado genticamente cuya evaluacin de riesgo
haya sido favorable (DO L 102 de 7.4.2004, p. 14).
Directiva 79/112/CEE del Consejo, de 18 de diciembre de 1978, relativa a la aproximacin
de las legislaciones de los Estados Miembros en materia de etiquetado, presentacin y
publicidad de los productos alimenticios destinados al consumidor final (DO L 33 de
8.2.1979, p. 1).
Reglamento (CE) n 65/2004 de la Comisin, de 14 de enero de 2004, por el que se
establece un sistema de creacin y asignacin de identificadores nicos a los organismos
genticamente modificados (DO L 10 de 16.1.2004, p. 6).
Reglamento (CE) n 882/2004 del Parlamento Europeo y del Consejo, de 29 de abril de
2004, sobre los controles oficiales efectuados para garantizar la verificacin del
cumplimiento de la legislacin en materia de piensos y alimentos y la normativa sobre salud
animal y bienestar de los animales (DO L 165 de 30.4.2004, p. 1/141).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 1

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 2
Presentacin del Manual, Mtodos de Trabajo e
Introduccin del Curso
M. Querci

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

ndice
Sesin n 2
Presentacin del Manual, Mtodos de Trabajo e Introduccin del
Curso

Cmo detectar OGM

Ventajas y limitaciones intrnsecas de los enfoques del ADN y de las protenas

Consideraciones generales y presentacin del Manual

Bibliografa

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

11

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

Cmo detectar OGM


Como se ha visto anteriormente, las plantas transgnicas se caracterizan por la
insercin de un nuevo gen (o de un nuevo conjunto de genes) en sus genomas. El
nuevo gen o genes se traducen y la nueva protena se expresa. Esto proporciona a
la planta una caracterstica nueva, como la resistencia a determinados insectos o la
tolerancia a ciertos herbicidas. La base de todas las tcnicas de deteccin de OGM
consiste en explotar la diferencia entre la variedad no modificada y la planta
transgnica. Esto puede hacerse detectando el nuevo ADN transgnico que se ha
insertado, o la nueva protena expresada, o (si la protena acta de enzima)
utilizando el anlisis qumico para detectar el producto de la reaccin enzimtica.
Hay dos planteamientos cientficos que se utilizan generalmente en la actualidad
para detectar modificaciones genticas en plantas como la soja, el maz, el algodn
y otras. Uno es el ELISA (ensayo de inmunoabsorcin enzimtica), con el que se
estudia la presencia de protenas especficas explotando la especificidad de la unin
entre un antgeno expresado y un anticuerpo diana; el otro es la PCR (reaccin en
cadena de la polimerasa), basada en la deteccin de secuencias nuevas de ADN
insertadas en el genoma de la planta. Estos mtodos muestran la ausencia o
presencia del OGM en la muestra, pero a veces tambin pueden dar una indicacin
cuantitativa (porcentaje) sobre la muestra estudiada.
El primer mtodo validado a nivel comunitario es uno de cribado que aplica la PCR y
es capaz de detectar la mayora de los OGM cuya comercializacin est autorizada
actualmente (Lipp et al., 1999). Este mtodo, elaborado por Pietsch et al. (1997), se
basa en la deteccin de las secuencias de control que flanquean al gen introducido,
y que son el promotor 35S y el terminador nos. La validacin fue coordinada por la
antigua Unidad de productos alimentarios y bienes de consumo del Instituto de la
Salud y la Proteccin de los Consumidores, del Centro Comn de Investigacin, y se
hizo en colaboracin con el Instituto de Medidas y Materiales de Referencia del CCI,
encargado de la produccin de los apropiados materiales de referencia certificados.
Como se seala ms arriba, tambin hay actividades de investigacin para el
desarrollo de mtodos relativos a las protenas. Se ha validado un mtodo muy
especfico para la deteccin de soja Roundup Ready utilizando ELISA (Lipp et al.,
2000)

se

han

elaborado

otros

(http://mbg.jrc.ec.europa.eu/home/ict/methodsdatabase.htm).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

Ventajas y limitaciones intrnsecas de los enfoques del ADN y de


las protenas
El enfoque del ADN
Cada vez se utilizan ms los mtodos analticos basados en la tcnica de la PCR
para la deteccin de secuencias de ADN asociadas con OGM.
La PCR permite la amplificacin selectiva de segmentos especficos de ADN
presentes con baja frecuencia en una mezcla compleja con otras secuencias de
ADN. En la PCR, los pequeos fragmentos de ADN complementario se llaman
cebadores y se utilizan por pares. Estos cebadores se disean para hibridarse con
sitios de reconocimiento de la secuencia complementaria en hebras opuestas del
gen de inters. A travs de una serie de ciclos trmicos diferenciales repetitivos, una
enzima ADN polimerasa ayuda a la replicacin y a la amplificacin exponencial de la
secuencia situada entre el par de cebadores. Finalmente, estos fragmentos
amplificados se someten a electroforesis en gel normal para poder detectar su
presencia en funcin de la determinacin de su tamao.
Se han desarrollado muchos mtodos basados en esta PCR que pueden detectar y
cuantificar los OGM presentes en plantas agrcolas utilizadas como alimentos y
piensos. Por otra parte, la determinacin de la identidad gentica permite la
segregacin y la trazabilidad (preservacin de la identidad) a lo largo de la cadena
de distribucin de las plantas GM.
Un requisito previo fundamental de la deteccin de OGM es el conocimiento del tipo
de modificacin gentica, incluida la conformacin molecular del gen introducido y
los elementos reguladores (promotores y terminadores) que lo flanqueen. Para el
anlisis es necesario disponer de una cantidad mnima de material de muestra con
ADN intacto, incluido el gen diana.
La PCR es una tcnica de laboratorio cuya realizacin exige personal formado y
material especializado.
A continuacin se indican algunas de las caractersticas clave del diagnstico por
PCR:
- Puede ser extremadamente sensible, capaz de detectar la presencia de unos
pocos ejemplares (e incluso de un solo ejemplar) de un gen o secuencia diana de
inters dentro de todo el material gentico de un organismo (genoma). Como
resultado de esta elevada sensibilidad, pueden obtenerse falsos positivos con
niveles muy bajos de contaminacin accidental. Por tanto, ha de extremarse la
atencin para evitar la contaminacin cruzada.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

- Exige poco tiempo de elaboracin de los reactivos comparando con los ensayos
inmunolgicos (sntesis de cebador frente a produccin de anticuerpos).
- Casi todos los reactivos necesarios estn disponibles en el comercio y pueden
obtenerse fcilmente de varias fuentes. Sin embargo, hace falta una autorizacin
para utilizar algunos de ellos en actividades de diagnstico comerciales.
- El anlisis de las muestras lleva un da aproximadamente.
- La PCR puede discriminar entre diferentes tipos de modificacin gentica (tambin
denominados productos transgnicos) si se efecta adecuadamente. Los mtodos
de diagnstico para identificar productos transgnicos especficos necesitan ms
tiempo de elaboracin y actividades de validacin.
El enfoque de las protenas
El mtodo de ensayo de protenas utiliza anticuerpos especficos de la protena de
inters. La tcnica ELISA detecta o mide la cantidad de protena de inters en una
muestra que puede contener otras muchas protenas diferentes. Utiliza un
anticuerpo para ligar la protena especfica, un segundo anticuerpo para amplificar la
deteccin (fase optativa) y un conjugado de anticuerpo con una enzima, cuyo
producto genera una reaccin coloreada, que es fcil de observar y cuantificar
comparando con una curva patrn de la protena de inters.
Para la ejecucin adecuada del ensayo hace falta tambin personal formado y
material especializado.
Entre las caractersticas fundamentales de los ensayos con ELISA estn las
siguientes:
- Menor sensibilidad que la PCR, por lo que es ms difcil que aparezcan falsos
positivos debidos a pequeos niveles de contaminacin.
- Elevados costes iniciales para el desarrollo del ensayo y la obtencin de
anticuerpos y patrones de protenas.
- Reducidos costes por muestra, una vez elaborados los reactivos.
- No puede discriminar entre diferentes modos y modelos de expresin de diferentes
productos transgnicos que expresan caractersticas protenicas similares.
- Los mtodos de protenas exigen un notable tiempo de preparacin de los
reactivos y del mtodo.
- Los mtodos de ensayo de protenas son prcticos y eficaces cuando se produce
una protena detectable. Sin embargo, es posible que los productos modificados
genticamente se formen solo durante ciertas fases del desarrollo o en
determinadas partes de los vegetales, por lo que resultara poco probable que tales
productos fueran detectados sin problemas por la tcnica ELISA. Por otra parte, las

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

transformaciones industriales desnaturalizan fcilmente las protenas, lo que plantea


dificultades para el uso de mtodos ELISA con fracciones de alimentos
transformados.
Teniendo todo esto en cuenta, ha de quedar claro que el ELISA y la PCR deben
considerarse mutuamente complementarios y no se excluyen entre s.

Cuadro 2. Comparacin resumida de los mtodos ELISA y PCR

Mtodo

Objeto

Duracin

ELISA

Protenas

2 - 8 horas

PCR

ADN

1 3 das

Facilidad de
utilizacin
Moderada; exige
conocimiento de las
prcticas de laboratorio;
los ensayos son
especficos de especie y
de variedad.
Escasa; requiere
formacin y material
especializados.

Resultados
Confirma una
modificacin gentica
especfica y permite la
cuantificacin.

Muy sensible; tiende a


dar falsos positivos;
confirma la presencia de
ADN GM y permite la
cuantificacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

Consideraciones generales y presentacin del Manual


La validacin del mtodo es crtica tanto para los laboratorios como para las
autoridades de control. Lo ideal es que un nmero limitado de laboratorios
capacitados verifique las caractersticas de cada mtodo en cuanto a su capacidad
de dar resultados reproducibles, sensibles y especficos. El Centro Comn de
Investigacin de la Comisin Europea fue el primero en validar los mtodos ELISA y
PCR para materias primas constituidas por soja Roundup Ready y un mtodo PCR
para maz Maximizer (Bt-176), as como un mtodo PCR tanto para soja Roundup
Ready

como

para

maz

Maximizer

(Bt-176)

en

fracciones

de

alimentos

transformados (Lipp et al., 1999, 2000 y 2001). Despus se han desarrollado y


validado algunos otros mtodos de anlisis tanto cuali como cuantitativo. Para
obtener mas informacin sobre los mtodos validados de deteccin y cuantificacin
de OGM en la direccin: http://mbg.jrc.ec.europa.eu/home/ict/methodsdatabase.htm
La preparacin de las muestras, tanto si se aplican mtodos de ADN como de
protenas, es crtica para la deteccin y la cuantificacin. Es importante saber las
limitaciones de cada procedimiento en funcin del aspecto que interese (p. ej.,
anlisis cuali o cuantitativo). Tanto el tamao de la muestra como los procedimientos
de muestreo influyen muchsimo en las conclusiones que puedan extraerse de estos
mtodos de ensayo.
Los dos tipos de mtodos dependen fundamentalmente de la disponibilidad de
materiales de referencia certificados que sean adecuados. Las muestras
utilizadas en el curso son materiales de referencia certificados producidos en el
IRMM del CCI (Trapmann et al., 2002 y 2001). Las caractersticas y los certificados
correspondientes se presentan en la sesin n 3.

Otra fase crtica, que debe

mencionarse aunque no se va a efectuar durante el curso, es la homogeneizacin


de la muestra.
La figura 1 resume las distintas fases efectuadas durante el curso. Es fundamental
optimizar la extraccin del ADN para garantizar la presencia y calidad del ADN
extrado y amplificable por PCR. Este aspecto es particularmente importante, ya que
la mayora de los productos alimentarios comercializados a base de soja o maz
estn muy transformados. Es bien sabido que el ADN puede degradarse
considerablemente durante la transformacin de los alimentos, sobre todo por
tratamiento trmico en presencia de agua. Por tanto, a medida que se transforman
ms los alimentos, puede disminuir el nmero de fragmentos de ADN que siguen
siendo suficientemente largos y conteniendo intacta la secuencia de inters para
permitir la deteccin de la presencia de OGM en alimentos transformados. Adems,
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

un mtodo verdaderamente adecuado de extraccin del ADN debe conseguir la


eliminacin de las sustancias inhibidoras que pueda haber en la muestra. Este tema
se tratar en la sesin n 4. Se han elaborado diversos mtodos de extraccin de
ADN y son muchas las empresas comerciales que producen kits especializados
listos para usarse. Durante el curso se hablar sobre las caractersticas y la validez
de los diferentes protocolos disponibles. Sin embargo, para evitar la implicacin
directa de empresas comerciales, se ha decidido efectuar la extraccin del ADN con
el denominado mtodo CTAB, protocolo validado y verstil que ha demostrado su
idoneidad para varias matrices diferentes.
Tras la extraccin del ADN, las muestras (as como los productos de la PCR) se
analizan mediante electroforesis en gel de agarosa (sesin n 5).
En la sesin n 6 se presentan los principios, ventajas y desventajas de la reaccin
en cadena de la polimerasa.
Como ya se ha indicado, la utilizacin eficaz de las tcnicas modernas para la
deteccin de OGM depende de la disponibilidad de informacin exacta. La deteccin
de OGM exige el conocimiento al menos parcial de la secuencia del gen diana y del
tipo de modificacin gentica. En la sesin n 7 se presentan las caractersticas
especficas de las lneas transgnicas de maz MON810, maz Bt-176 y soja
Roundup Ready.
Se han elaborado distintos planteamientos de PCR para la deteccin de los OGM
autorizados. La especificidad de la PCR depende de la seleccin exacta de los
cebadores. Los cebadores de la PCR pueden dirigirse a diferentes elementos
utilizados en el proceso de transformacin. Pueden obtenerse sistemas de deteccin
de PCR de banda ancha, denominados generalmente mtodos de cribado,
diseando cebadores especficos de las secuencias ms comunes utilizadas en la
transformacin. Se trata generalmente de las secuencias reguladoras (promotor y
terminador). Los vegetales modificados genticamente pueden dividirse tambin en
categoras segn el gen estructural introducido. Otra forma ms de dirigir la
especificidad de la reaccin es elegir unos cebadores especficos de las secuencias
de ADN localizadas en distintos elementos genticos (p. ej., promotor-gen
estructural, gen estructural-terminador). Finalmente, siempre que se disponga de
informacin especfica y completa sobre la secuencia, a fin de obtener mtodos
realmente especficos de un determinado vegetal modificado genticamente, pueden
elaborarse

sistemas

con

especificidad

de

lnea

(especficos

de

una

transformacin) seleccionando una combinacin nica de secuencias, presente


tan solo en esa lnea transformada concreta. Esto se consigue generalmente
diseando cebadores con hibridacin en la regin del ADN en la que se incluye el

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

empalme del sitio de integracin. El empalme entre el ADN insertado (ADN-T) y el


ADN hospedador ofrece una secuencia nucleotdica nica que constituye una diana
ideal para un ensayo muy especfico por PCR. Los mtodos realizados durante el
curso se resumen en la figura 1, y se describen con detalle en la sesin n 8. La
parte experimental de los mtodos y protocolos se encuentra en la sesin n 9.
Como se indica anteriormente, la necesidad de cuantificar el OGM presente en una
muestra hizo que se elaboraran muchos protocolos basados en la PCR, los cuales
permiten no solo una respuesta cualitativa (presencia / ausencia), sino tambin una
indicacin, ms o menos precisa (segn el mtodo elegido) de la cantidad relativa
del OGM presente en una muestra determinada. Los dos planteamientos de ADN
ms comunes son la PCR competitiva y la PCR en tiempo real (sesin n 10). La
PCR en tiempo real se efecta utilizando una instrumentacin especfica y compleja,
que por ahora solo puede adquirirse en unas pocas empresas comerciales. En la
sesin n 11 se indican los protocolos que se van a seguir durante el curso.
Finalmente, la sesin n 12 contiene una introduccin general al planteamiento
serolgico de la deteccin de organismos genticamente modificados. En concreto
se explicar la tcnica ELISA y se proporcionar el protocolo para efectuar un
ensayo ELISA especfico de Roundup Ready.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

10

Homogeneizacin de la
muestra

No se efectuar durante
el curso

Materias primas y
transformadas

Extraccin del ADN


Comprobacin de la presencia de ADN
vegetal por PCR

ADN vegetal presente

Sin ADN vegetal detectable

PCR de cribado

+
Vegetal GM

PCR-lectina para soja y


PCR-zena para maz

Deteccin de elementos reguladores


(promotor 35S y terminador nos)

Vegetal no GM

Deteccin de
OGM especficos
por PCR anidada

Deteccin de OGM
mediante ELISA

Cuantificacin del
ADN mediante
espectrofotometra

Cuantificacin del
OGM mediante PCR
en tiempo real

Figura 1. Diagrama de flujo de los mtodos utilizados durante el curso.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Presentacin del Manual, Mtodos de Trabajo e Introduccin del Curso

11

Bibliografa
Lipp, M., Anklam, E. y Stave, J.W. (2000). Validation of an immunoassay for
detection and quantification of a genetically modified soybean in food and food
fractions using reference materials: Interlaboratory study. Journal of AOAC
International 83, 919927.
Lipp, M., Bluth, A., Eyquem, F., Kruse, L., Schimmel, H., Van den Eede, G. y
Anklam, E. (2001). Validation of a method based on polymerase chain reaction
for the detection of genetically modified organisms in various processed
foodstuffs. European Food Research Technology 212, 497-504.
Lipp, M., Brodmann, P., Pietsch, K., Pauwels, J. y Anklam, E. (1999). IUPAC
collaborative trial study of a method to detect genetically modified soy beans and
maize in dried powder. Journal of AOAC International 82, 923928.
Pietsch, K., Waiblinger, H.-U., Brodmann, P. y Wurz, A. (1997). Screening-Verfahren
zur

Identifizierung

gentechnisch

vernderter

plfanzlicher

Lebensmittel.

Deutsche Lebensmittel Rundschau 93, 3538.


Trapmann. S., Catalani, P., Conneely, P., Corbisier, P., Gancberg, D., Hannes, E.,
Le Guern, L., Kramer, G. N., Prokisch, J., Robouch, P., Schimmel, H., Zeleny, R.,
Pauwels, J., Van den Eede, G., Weighardt, F., Mazzara, M. y Anklam, E. (2002).
The certification of reference materials of dry-mixed soya powder with different
mass fractions of Roundup Ready soya. Certified Reference Materials IRMM410S.
(https://irmm.jrc.ec.europa.eu/html/reference_materials_catalogue/catalogue/atta
chements/ERM-BF410_report.pdf) (ltimo acceso enero de 2010)
Trapmann, S., Le Guern, L., Prokisch, J., Robouch, P., Kramer, G. N., Schimmel, H.,
Pauwels, J., Querci, M., Van den Eede, G. y Anklam, E. (2001). The certification
of reference materials of dry mixed maize powder with different mass fractions of
MON810

maize.

Certified

Reference

Materials

IRMM-413.

(https://irmm.jrc.ec.europa.eu/html/reference_materials_catalogue/catalogue/atta
chements/ERM-BF413_report.pdf). (ltimo acceso enero de 2010)

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 2

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 3
Muestras Utilizadas durante el Curso

M. Querci, N. Foti

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU RMEGIONAL
ORGANIZACIN
UNDIAL DE
DE LA
L'ESUROPE
ALUD
OFICINA REGIONAL PARA EUROPA

Muestras Utilizadas durante el Curso

ndice
Sesin n 3
Muestras Utilizadas durante el Curso

Muestras utilizadas durante el curso

Material de Referencia Certificado

Composicin de las materias primas y procesadas distribuidas entre los participantes

Lista de muestras distribuidas durante el curso.

Resultados previstos por PCR

Bibliografa

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 3

Muestras Utilizadas durante el Curso

Muestras utilizadas durante el curso


En el curso se ensayarn distintos mtodos para detectar la presencia de maz
MON810 y soja Roundup Ready en diversas materias. Con este fin se utilizarn
mezclas de maces y sojas no GM y GM (MON810 en el caso del maz y Roundup
Ready en el de la soja) respectivamente, en distintos grados de concentracin. Se
utilizarn dos tipos de materiales:

materiales de referencia certificados

diversas materias primas y procesadas distribuidas entre los participantes.

Material de referencia certificado


Las materias primas vegetales utilizadas en el curso son los materiales de referencia
certificados IRMM-410S (soja Roundup Ready) e IRMM-413 (maz MON810). El
IRMM-410S y el IRMM-413 consisten en dos series de CRM de polvo desecado de
soja y maz, respectivamente, con distintas fracciones de masa (0; 0,1; 0,5; 1; 2; y
5 %) de polvo desecado preparado a partir de soja Roundup Ready y maz MON810
modificados genticamente. Los CRM se produjeron en el Instituto de Materiales y
Medidas de Referencia (http://irmm.jrc.ec.europa.eu/html/homepage.htm) para Fluka
Chemie AG (Buchs, Suiza) en el marco de la colaboracin con el Instituto de la
Salud y la Proteccin de los Consumidores (http://ihcp.jrc.ec.europa.eu/) del Centro
Comn de Investigacin de la Comisin Europea (Ispra, Italia) (Trapmann et al.,
2002 y 2001) y estn concebidos para la validacin de mtodos de deteccin de
alimentos modificados genticamente. Dado que la cuantificacin de ADN y/o
protenas puede variar en funcin de las variedades, las conclusiones cuantitativas
de las mediciones de muestras desconocidas deben extraerse con las debidas
precauciones.
El polvo de soja desecado con soja GM Roundup Ready se ha elaborado a partir de
semillas completas de una lnea de soja no modificada (Asgrow A1900) y la soja
modificada genticamente 40-3-2 Roundup Ready (lnea Asgrow AG5602 RR). El
polvo de maz desecado con maz GM MON810 se ha elaborado a partir de granos
completos del cultivar no modificado DK512 y el cultivar MON810 DK513.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 3

Muestras Utilizadas durante el Curso

Composicin de las materias primas y procesadas distribuidas


entre los participantes
Se comprobarn distintas materias: galletas, leche en polvo, migas de aperitivos
secos y harina.
Materias primas
Mezcla de harinas. A fin de obtener un 0,5 % de cada OGM (peso en seco total), se
puso soja RR (IRMM-410S) al 1 % junto a harina con un 1 % de MON810 (IRMM413). Se pesaron 50 GM de ambas harinas y se introdujeron directamente en tubos
de reaccin preparados para la extraccin de ADN. La harina con un 1 % de
MON810 es el material de referencia certificado IRMM-413 (con un 1 % de maz
MON810).
Migas de aperitivos secos
La muestra se extrajo de un programa de comprobacin de la idoneidad de OGM
(Programa GeMMA, ronda 06, material de ensayo GMO-06B). El material se prepar
a partir de aperitivos secos a base de soja no modificada genticamente disponibles
en el mercado y aperitivos con soja modificada genticamente.

Migas de aperitivos

1 372 g de aperitivos a base de soja no modificada genticamente y

secos

28 g de aperitivos con soja modificada genticamente

Antes de proceder a la mezcla, cada material se moli y tamiz hasta obtener un


conjunto de migas homogneo, tras lo cual se mezclaron en un tambor durante una
noche. Por ltimo, los materiales se mezclaron durante aproximadamente una hora
utilizando un mezclador giratorio y se guardaron a 20 C.
Galletas
El material se produjo en el Instituto de la Salud y la Proteccin de los Consumidores
del CCI y se utiliz para validar un mtodo de PCR para soja Roundup Ready y maz
Maximizer (Bt-176) en fracciones de alimentos transformados (Lipp et al., 2001).
Las harinas desecadas de soja y maz se pesaron y mezclaron con los otros
ingredientes en la proporcin indicada a continuacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 3

Muestras Utilizadas durante el Curso

Galletas # 1

250 g de maz (0 % OGM), 250 g de soja (0 % OGM), 300 g de trigo, 200 g de


azcar, 100 g de mantequilla, 10 g de sal, 16 g de levadura artificial con aroma
de vainilla y 2 huevos

Los ingredientes se mezclaron minuciosamente con 600 ml de agua y la masa se


homogeneiz, se extendi uniformemente en un bandeja de horno y se coci en un
horno precalentado a 180 C con recirculacin de aire durante 10 min. A
continuacin, el material se retir del horno, se cubri para evitar su contaminacin y
se dej enfriar a temperatura ambiente. Posteriormente se guard a 20 C.
Leche de soja en polvo
La muestra se extrajo de la ronda 05 del Programa GeMMA de comprobacin de la
idoneidad.
1 700 g de leche de soja en polvo de EE.UU. se mezclaron en un tambor durante
una noche con 300 g de aislado de protenas de soja Roundup Ready, tras lo cual se
repartieron distintas submuestras (10 g) en frascos de plstico taponados a rosca y
se guardaron a temperatura ambiente antes de su distribucin.
Galletas MON810
Este material se produjo en la Unidad de biotecnologa y OGM del CCI.
La harina desecada de maz se pes y mezcl con los otros ingredientes en la
proporcin indicada a continuacin.

Galletas MON810

*
200 g de harina de trigo, 100 g de harina de maz* (2 % OGM), 150 g de

azcar, 100 g de mantequilla y 1 huevo.

*La harina de maz con un 2 % de MON810 se obtuvo aadiendo harina de maz


silvestre a harina MON810 al 100 % y mezclndolas durante 30 minutos.
Los ingredientes se mezclaron minuciosamente, se extendieron uniformemente en
un bandeja de horno y se cocieron en un horno precalentado a 180 C con
recirculacin de aire durante10 min. A continuacin, el material se retir del horno,
se cubri para evitar su contaminacin y se dej enfriar a temperatura ambiente.
Posteriormente se guardaron a 4 C hasta su utilizacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 3

Muestras Utilizadas durante el Curso

Lista de muestras distribuidas durante el curso.


Caractersticas
% de OGM (ingrediente especfico)
Muestra
Soja RR

Maz MON810

0%
1%
2,2 %
8,9 %
-

0%
1%
1%
2%

Galletas # 1
Mezcla de harinas
Harina MON810
Migas de aperitivos secos
Leche de soja en polvo
Galletas MON810

Resultados previstos por PCR

MUESTRA
IRMM- 410S-0 (0 %)
IRMM- 410S-1 (0,1 %)
IRMM- 410S-2 (0,5 %)
IRMM- 410S-3 (1 %)
IRMM- 410S-4 (2 %)
IRMM- 413-0 (0 %)
IRMM- 413-1 (0,1 %)
IRMM- 413-2 (0,5 %)
IRMM- 413-3 (1 %)
IRMM- 413-4 (2 %)
Galletas # 1
Mezcla de harinas
Harina MON810
Migas
de
aperitivos
secos
Leche de soja en polvo
Galletas MON810

zena

lectina

35S

nos

E35S/hsp7
0(b)

CTP/EPSPS

+
+
+
+
+
+
+
+
-

+
+
+
+
+
+
+
+

+
+
+
+
+
+
+
+
+
+
+

+
+
+
+
+
+

+
+
+
+
+
+
-

+
+
+
+
+
+

+
-

+
+

+
-

+
-

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 3

Muestras Utilizadas durante el Curso

Bibliografa
Lipp, M., Bluth, A., Eyquem, F., Kruse, L., Schimmel, H., Van den Eede, G. y
Anklam, E. (2001). Validation of a method based on polymerase chain reaction
for the detection of genetically modified organisms in various processed
foodstuffs. European Food Research Technology 212, 497-504.
Lipp, M., Brodmann, P., Pietsch, K., Pauwels, J. y Anklam, E. (1999). IUPAC
collaborative trial study of a method to detect genetically modified soy beans and
maize in dried powder. Journal of AOAC International 82, 923928.
Trapmann. S., Catalani, P., Conneely, P., Corbisier, P., Gancberg, D., Hannes, E.,
Le Guern, L., Kramer, G. N., Prokisch, J., Robouch, P., Schimmel, H., Zeleny, R.,
Pauwels, J., Van den Eede, G., Weighardt, F., Mazzara, M. y Anklam, E. (2002).
The certification of reference materials of dry-mixed soya powder with different
mass fractions of Roundup Ready soya. Certified Reference Materials IRMM410S.
(https://irmm.jrc.ec.europa.eu/html/reference_materials_catalogue/catalogue/atta
chements/ERM-BF410_report.pdf). (ltimo acceso enero de 2010)
Trapmann, S., Le Guern, L., Prokisch, J., Robouch, P., Kramer, G. N., Schimmel, H.,
Pauwels, J., Querci, M., Van den Eede, G. y Anklam, E. (2001). The certification
of reference materials of dry-mixed maize powder with different mass fractions of
MON810

maize.

Certified

Reference

Materials

IRMM-413.

(https://irmm.jrc.ec.europa.eu/html/reference_materials_catalogue/catalogue/atta
chements/ERM-BF413_report.pdf) (ltimo acceso enero de 2010)

GeMMA Scheme-GMO analysis Round 06. GMO Proficiency Testing (octubre de


2001). Report N. GMO 06.
GeMMA Scheme-GMO analysis Round 05. GMO Proficiency Testing, (octubre de
2001). Report N. GMO 05.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 3

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 4
Extraccin y Purificacin de ADN

M. Somma

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Extraccin y Purificacin de ADN

ndice
Sesin n 4
Extraccin y Purificacin de ADN

Introduccin

Mtodos de extraccin

Mtodos de purificacin

Mtodo de extraccin y purificacin con CTAB

Cuantificacin del ADN mediante espectrofotometra

Principios de la cuantificacin de ADN por espectrofotometra

10

Determinacin de la concentracin de cidos nucleicos

11

Prctica

13

Bibliografa

17

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

Introduccin
La extraccin y purificacin de cidos nucleicos constituye la primara etapa de la
mayora de los estudios de biologa molecular y de todas las tcnicas de
recombinacin de ADN. En este caso, los mtodos de extraccin permiten obtener
cidos nucleicos purificados a partir de diversas fuentes para despus realizar
anlisis especficos de modificaciones genticas mediante la reaccin en cadena de
la polimerasa (PCR). La calidad y la pureza de los cidos nucleicos son dos de los
elementos ms importantes en ese tipo de anlisis. Si se desea obtener cidos
nucleicos muy purificados, que no contengan contaminantes inhibidores, es preciso
aplicar mtodos de extraccin adecuados. Los contaminantes capaces de inhibir el
anlisis PCR se enumeran en el cuadro 1. Con objeto de evitar los falsos negativos
debidos a la presencia de inhibidores de la PCR en la muestra, se recomienda
vivamente efectuar un experimento de control de la inhibicin de la PCR, que suele
hacerse mediante PCR especfica de vegetales (eucariotas o cloroplastos) o de la
especie.
Cuadro 1. Inhibidores de la PCR.
Inhibidor
Dodecilsulfato sdico
Fenol
Etanol
Isopropanol
Acetato de sodio
Cloruro de sodio
EDTA
Hemoglobina
Heparina
Urea
Mezcla de reaccin

Concentracin de inhibicin
> 0,005 %
> 0,2 %
>1%
>1%
> 5 mM
> 25 mM
> 0,5 mM
> 1 GM/ml
> 0,15 UI/ml
> 20 mM
> 15 %

Dada la gran variedad de mtodos de extraccin y purificacin de cidos nucleicos


existentes, la eleccin de la tcnica ms adecuada suele efectuarse conforme a los
criterios siguientes:

cido nucleico diana;

organismo fuente;

material inicial (tejido, hoja, semilla, material transformado, etc.);

resultados deseados (rendimiento, pureza, tiempo que requiere la purificacin);

uso posterior (PCR, clonacin, etiquetado, transferencia, RT-PCR, sntesis de


ADNc, etc.).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

A continuacin se recogen los principios de algunos de los mtodos de extraccin y


purificacin de cidos nucleicos que ms se emplean en la actualidad.

Mtodos de extraccin
Para extraer los cidos nucleicos del material biolgico es preciso provocar una lisis
celular, inactivar las nucleasas celulares y separar los cidos nucleicos de los restos
de clulas. El procedimiento de lisis idneo suele consistir en un equilibrio de
tcnicas y ha de ser suficientemente fuerte para romper el material inicial complejo
(un tejido, por ejemplo), pero suficientemente suave para preservar el cido nucleico
diana. Entre los procedimientos usuales de lisis figuran los siguientes:

rotura mecnica (trituracin, lisis hipotnica, etc.);

tratamiento qumico (detergentes, agentes caotrpicos, reduccin con tioles,


etc.);

digestin enzimtica (Proteinasa K, etc.).

Es posible romper la membrana celular e inactivar las nucleasas intracelulares al


mismo tiempo. Por ejemplo, una misma solucin puede contener detergentes que
solubilicen las membranas celulares y sales caotrpicas fuertes que inactiven las
enzimas intracelulares. Tras la lisis celular y la inactivacin de las nucleasas, los
restos de clulas se eliminan fcilmente por filtracin o precipitacin.

Mtodos de purificacin
Los mtodos empleados para purificar los cidos nucleicos de extractos celulares
suelen ser combinaciones de dos o ms tcnicas de las siguientes:

extraccin/precipitacin;

cromatografa;

centrifugacin;

separacin por afinidad.

En los prrafos siguientes se describen brevemente estas tcnicas (Zimmermann et


al., 1998).

Extraccin/precipitacin
A menudo se efecta una extraccin con disolventes para eliminar los
contaminantes de los cidos nucleicos. Por ejemplo, suele emplearse una
combinacin de fenol y cloroformo con objeto de eliminar las protenas. Para
concentrar los cidos nucleicos suele realizarse una precipitacin con isopropanol o
etanol. Si la cantidad de cido nucleico diana es escasa, puede aadirse a la mezcla

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

un portador inerte (como el glucgeno) para favorecer la precipitacin. Tambin


puede realizarse una precipitacin selectiva con concentraciones salinas elevadas
(precipitacin salina) o una precipitacin de las protenas mediante cambios del pH.

Cromatografa
Pueden emplearse diversas tcnicas cromatogrficas de separacin: permeacin
sobre gel, intercambio inico, adsorcin selectiva o unin por afinidad. La
permeacin sobre gel aprovecha las propiedades de las partculas porosas del gel
para tamizar molculas. Se emplea una matriz con poros de tamao definido, que
dejan pasar las molculas ms pequeas por difusin, pero no las ms grandes, que
quedan eluidas en el volumen vaco. As pues, las molculas quedan eluidas por
orden de tamao decreciente. La cromatogrfica de intercambio inico es otra
tcnica, que se basa en la interaccin electrosttica de la molcula diana con un
grupo funcional de la matriz en columna. Los cidos nucleicos (polianiones lineales
con fuerte carga negativa) pueden eluirse de las columnas de intercambio inico con
simples Tampones salinos. En la cromatografa de adsorcin, los cidos nucleicos
se fijan selectivamente en slice o vidrio, en presencia de determinadas sales (por
ejemplo, sales caotrpicas), mientras que otras molculas biolgicas no se fijan. A
continuacin, los cidos nucleicos pueden eluirse con agua o un tampn hiposalino y
se obtiene una muestra que puede emplearse directamente en las aplicaciones
posteriores.

Centrifugacin
La centrifugacin selectiva constituye un mtodo de purificacin eficaz. As, por
ejemplo, la ultracentrifugacin en gradientes autogenerados de CsCl con fuerzas g
elevadas se lleva empleando mucho tiempo para purificar plsmidos. La
centrifugacin suele asociarse a otros mtodos, como la cromatografa de columna
centrifugada, en cuyo caso se combina la permeacin sobre gel y la centrifugacin
para separar el ADN o ARN de contaminantes ms pequeos (sales, nucletidos,
etc.), intercambiar tampones o seleccionar segn el tamao. Algunos procedimientos
combinan la adsorcin selectiva en matriz cromatogrfica (vase el apartado anterior
Cromatografa) y la elucin por centrifugacin para purificar de forma selectiva un
tipo de cido nucleico.

Separacin por afinidad


En los ltimos aos, cada vez son ms los mtodos de purificacin que combinan la
inmovilizacin por afinidad de cidos nucleicos y la separacin magntica. Por
ejemplo, los ARNm poli A + pueden unirse a partculas magnticas revestidas de
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

estreptavidina mediante oligo dT marcados con biotina, y el complejo de partculas


puede eliminarse de la solucin (y de los contaminantes libres) con un imn. Esta
tcnica en fase slida simplifica la purificacin de los cidos nucleicos, pues permite
sustituir las etapas de centrifugacin, extraccin orgnica y separacin de fases por
una operacin de separacin magntica, nica y rpida.

Mtodo de extraccin y purificacin con CTAB


El protocolo del mtodo del bromuro de cetil-trimetil amonio (CTAB) fue elaborado
por Murray y Thompson en 1980 (Murray y Thompson, 1980) y publicado
posteriormente, en 1987, por Wagner y sus colaboradores (Wagner et al., 1987). El
mtodo es adecuado para extraer y purificar ADN de vegetales y alimentos
derivados de vegetales y est especialmente indicado para eliminar los polisacridos
y los compuestos polifenlicos, que, de otro modo, alteraran la pureza del ADN y,
por tanto, su calidad. Este procedimiento se ha aplicado con frecuencia en gentica
molecular de los vegetales y ha sido probado en ensayos de validacin para detectar
OGM (Lipp et al., 1999; 2001). Se han elaborado algunas variantes adicionales para
adaptar el mtodo a una amplia gama de matrices de alimentos transformados o sin
transformar (Hupfer et al., 1998; Hotzel et al., 1999; Meyer et al., 1997; Poms et al.,
2001).

Principios del mtodo del CTAB: lisis, extraccin y precipitacin


Las clulas vegetales pueden lisarse con el detergente inico bromuro de cetiltrimetil amonio (CTAB), que forma un complejo insoluble con los cidos nucleicos en
medio hiposalino. De ese modo, los polisacridos, los compuestos fenlicos y los
dems contaminantes permanecen en el sobrenadante y pueden eliminarse por
lavado. El complejo de ADN se solubiliza aumentando la concentracin salina y se
precipita con etanol o isopropanol. En esta seccin se describirn los principios de
las tres etapas principales: la lisis de la membrana celular, la extraccin del ADN
genmico y su precipitacin.
Lisis de la membrana celular: Tal como se ha mencionado anteriormente, la
primera etapa de la extraccin del ADN es la rotura de la membrana celular y
nuclear, para lo cual la muestra homogeneizada se trata primero con el tampn de
extraccin, que contiene EDTA, Tris-HCl y CTAB. Todas las membranas biolgicas
presentan la misma estructura general, integrada por molculas de lpidos y de
protenas, unidas por interacciones no covalentes.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

ADN
Membrana

nuclear

Figura 1. Representacin simplificada de las membranas celulares1.


Tal como muestra la figura 1, las molculas lipdicas estn ordenadas en una doble
capa continua, en la que las molculas protenicas estn disueltas. Las molculas
lipdicas estn formadas por extremos hidrfilos, denominados cabezas, y
extremos hidrfobos, denominados colas. En este mtodo, el detergente (CTAB)
contenido en el tampn de extraccin provoca la lisis de la membrana. Dado que la
composicin de los lpidos y del detergente es similar, el componente de CTAB del
tampn de extraccin captura los lpidos que integran la membrana celular y nuclear.
La figura 2 ilustra el mecanismo de solubilizacin de los lpidos con un detergente.

Figura 2. Solubilizacin de los lpidos.

Las ilustraciones que figuran en esta pgina y en las siguientes proceden del Genetic Science
Learning Center, Universidad de Utah, http://gslc.genetics.utah.edu.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

La figura 3 ilustra cmo se libera el ADN genmico cuando el detergente captura los
lpidos y las protenas al entrar en contacto la membrana celular y el tampn de
extraccin con CTAB. Con una concentracin salina (NaCl) determinada, el
detergente forma un complejo insoluble con los cidos nucleicos. El EDTA es un
componente quelante, que se une al magnesio, entre otros metales. El magnesio es
un cofactor de la desoxirribonucleasa. Al unir el magnesio al EDTA, la actividad de la
desoxirribonucleasa presente disminuye. El Tris-HCl confiere a la solucin la
capacidad de amortiguar el pH (un pH inferior o superior daa el ADN). Es
importante sealar que, como los cidos nucleicos se degradan fcilmente en esta
fase de la purificacin, debe reducirse al mnimo el tiempo transcurrido entre la
homogeneizacin de la muestra y la adicin de la solucin tampn con CTAB. Una
vez que se han roto las membranas de la clula y de los orgnulos (como los que se
encuentran alrededor de las mitocondrias y los cloroplastos), se purifica el ADN.

Figura 3. Rotura de la membrana celular y extraccin del ADN genmico.


Extraccin - En esta etapa, se separan los complejos formados por los cidos
nucleicos y el CTAB de los polisacridos, los compuestos fenlicos, las protenas y
los dems lisados celulares disueltos en la solucin acuosa. Es especialmente
importante eliminar los polisacridos y los compuestos fenlicos, pues pueden inhibir
numerosas reacciones enzimticas. En concentraciones hiposalinas (NaCl < 0,5 M),
los contaminantes de los complejos de cidos nucleicos no precipitan y pueden
eliminarse

extrayendo

la

solucin

acuosa

con

cloroformo.

El

cloroformo

desnaturaliza las protenas y facilita la separacin de las fases acuosa y orgnica. La


fase acuosa suele constituir la fase superior. No obstante, si dicha fase es densa
debido a la concentracin salina (> 0,5 M), formar la fase inferior. Adems, si el pH
de la solucin acuosa no se ha equilibrado debidamente (pH 7,8 8,0), los cidos
nucleicos tendern a repartirse en la fase orgnica. Si es preciso, la extraccin con

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

cloroformo se realizar dos o tres veces, con objeto de eliminar por completo las
impurezas de la capa acuosa. Para perfeccionar la extraccin de los cidos
nucleicos, puede retroextraerse la fase orgnica con una solucin acuosa, que se
aade a continuacin al extracto anterior. Una vez purificados los complejos de
cidos nucleicos, puede procederse a la precipitacin, ltima etapa del
procedimiento.
Precipitacin - En esta ltima etapa se separan los cidos nucleicos del detergente,
para lo cual la solucin acuosa se trata primero con una solucin de precipitacin
compuesta por una mezcla de CTAB y NaCl en concentracin elevada (NaCl >
0,8 M). Una alta concentracin salina es necesaria para que se forme un precipitado
de cidos nucleicos. Puede ser preferible emplear acetato de sodio en lugar de NaCl
por su capacidad tampn. En estas condiciones, el detergente, que es ms soluble
en alcohol que en agua, puede eliminarse por lavado, mientras que los cidos
nucleicos precipitan. El posterior tratamiento con etanol al 70 % permite una mayor
purificacin o elucin de los cidos nucleicos de la sal residual.

Cuantificacin del ADN mediante espectrofotometra


El ADN, el ARN, los oligonucletidos e incluso los mononucletidos pueden
cuantificarse directamente en soluciones acuosas, en forma diluida o sin diluir,
midiendo la absorbancia A (o densidad ptica, DO) de luz ultravioleta (tambin
puede hacerse en el intervalo visible). Si la muestra es pura, es decir, no contiene
cantidades significativas de contaminantes como protenas, fenol o agarosa, la
medicin espectrofotomtrica de la irradiacin ultravioleta absorbida por las bases es
sencilla y exacta. En este mtodo, los tampones acuosos con escasa concentracin
inica (por ejemplo, tampn TE) resultan idneos. La concentracin de cidos
nucleicos suele determinarse midiendo a 260 nm y comparando con un blanco. La
interferencia de contaminantes puede determinarse calculando un cociente. Dado
que las protenas absorben a 280 nm, se emplea el cociente A260/A280 para calcular
la pureza de los cidos nucleicos. Los cocientes respectivos del ADN y el ARN puros
son aproximadamente de 1,8 y 2,0. Una absorcin a 230 nm significa que la muestra
est contaminada con hidratos de carbono, pptidos, fenoles, compuestos
aromticos u otras sustancias. El cociente A260/A230 de las muestras puras es de 2,2
aproximadamente.
Cuando la cantidad disponible de cidos nucleicos es escasa, puede emplearse el
mtodo de la placa de agarosa con bromuro de etidio. Permite calcular la cantidad
de cidos nucleicos a partir de la intensidad de la fluorescencia emitida por el
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

10

bromuro de etidio irradiado con luz UV, comparndola con unos patrones de
concentracin.

Principios de la cuantificacin de ADN por espectrofotometra


El espectrofotmetro se funda en la transmisin de la luz a travs de una solucin
para determinar la concentracin de un soluto presente en la misma. El aparato
funciona conforme a un principio sencillo: se irradia una muestra con una radiacin
luminosa de longitud de onda conocida y se mide la energa luminosa transmitida
con una clula fotoelctrica situada detrs de la muestra.
Tal como muestra la figura 4, el espectrofotmetro de haz nico consta de una
fuente luminosa, un prisma, un recipiente con la muestra y una clula fotoelctrica.
Los distintos elementos estn conectados a los sistemas elctricos o mecnicos
adecuados para controlar la intensidad luminosa y la longitud de onda y para
convertir en variaciones de tensin la energa recibida en la clula fotoelctrica. Las
variaciones de tensin se miden en un contador o se registran en un ordenador para
su posterior anlisis.

F
i
g
Figura 4. Representacin esquemtica de la transmisin de la luz.
Cada molcula absorbe la energa radiante a una longitud de onda especfica, a
partir de la cual es posible extrapolar la concentracin de un soluto en una solucin.
Con arreglo a la ley de Lambert-Beer, existe una relacin lineal entre la absorbancia
A (tambin denominada densidad ptica, DO) y la concentracin de la
macromolcula, conforme a la ecuacin siguiente:
A = DO = lc

(1)

donde es el coeficiente de extincin molar, c es la concentracin y l es el paso de


luz de la cubeta. Las protenas y los cidos nucleicos absorben la luz en el intervalo

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

11

ultravioleta, a longitudes de onda comprendidas entre los 210 y los 300 nm. Tal
como se ha sealado anteriormente, la absorbancia mxima de las soluciones de
ADN y ARN corresponde a 260 nm y la de las soluciones de protenas, a 280 nm.
Dado que las soluciones de ADN y ARN absorben parcialmente la luz a 280 nm y las
que contienen protenas hacen lo propio a 260 nm, el cociente de los valores
obtenidos a 260 nm y a 280 nm (A260/A280) proporciona una estimacin del grado de
pureza de los cidos nucleicos. Los cocientes A260/A280 respectivos del ADN y el
ARN puros son aproximadamente de 1,8 y 2,0. Con un paso de luz de 10 mm y una
longitud de onda de 260 nm, una absorbancia A = 1 corresponde aproximadamente
a 50 g/ml de ADN bicatenario, 37 g/ml de ADN monocatenario, 40 g/ml de ARN o
30 g/ml de oligonucletidos. Si la muestra tambin contiene protenas, el cociente
A260/A280 ser considerablemente inferior a dichos valores y no podr determinarse
con exactitud la cantidad de cidos nucleicos. Debe precisarse que la
espectrofotometra no permite identificar de forma fiable impurezas de ARN
presentes en las soluciones de ADN. Puede emplearse la absorbancia a 325 nm
para poner de manifiesto la presencia de restos en la solucin o la suciedad de la
cubeta.

Determinacin de la concentracin de cidos nucleicos


Eleccin de la cubeta. La cantidad de solucin de cidos nucleicos necesaria para
medir la absorbancia A depende de la capacidad de la cubeta. Debe elegirse una
cubeta apropiada atendiendo al intervalo de concentracin de la muestra, el factor
de dilucin y el volumen de la muestra. En la mayor parte de los procedimientos
empleados para detectar OGM, el volumen de ADN genmico disponible vara entre
50 y 100 l. Para la cuantificacin espectroscpica de pequeos volmenes de
cidos nucleicos se emplean diversos tipos de cubetas de microvolumen, cuya
capacidad oscila entre 5 y 70 l.
Preparacin. Para calibrar el espectrofotmetro es importante:

establecer el paso de luz correcto;

establecer el factor correcto (ADN bicatenario, ADN monocatenario o ARN);

medir la solucin en blanco (establecer la referencia), que ser agua o solucin


tampn (A260 = 0);

cerciorarse de que la referencia establecida se renueva peridicamente;

medir una cantidad conocida de cidos nucleicos puros para comprobar la


fiabilidad de la referencia establecida.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

12

Medicin en una muestra desconocida. Para medir la concentracin, se utilizan


cantidades determinadas de solucin de ADN en funcin de la capacidad de la
cubeta empleada (por ejemplo, 5 l de ADN diluidos en 195 l de agua si la
capacidad de la cubeta es inferior a 0,2 ml). Despus de calibrar el
espectrofotmetro y de aadir la solucin de cidos nucleicos, se tapa la cubeta, se
mezcla la solucin y se mide la absorbancia. Con objeto de reducir los errores de
pipeteado, debe efectuarse la medicin al menos dos veces y siempre con 5 l de
solucin de ADN, como mnimo. Se desaconsejan los valores de A260 inferiores a
0,02 o comprendidos entre 1 y 1,5 (segn el instrumental empleado) por el elevado
margen de error que entraan.
La concentracin c de un cido nucleico determinado presente en una solucin se
calcula conforme a las ecuaciones siguientes:

ADN monocatenario:

c(pmol/l) = A260/0,027

ADN bicatenario:

c(pmol/l) = A260/0,020

ARN monocatenario:

c(pmol/l) = A260/0,025

Oligonucletido:

c(pmol/l) = A260100/1,5NA+0,71NC+1,20NG + 0,84NT

donde A260 es la absorbancia medida a 260 nm.


El cuadro 2 recoge un ejemplo de los valores de la absorbancia de ADN de timo de
ternera muy purificado, en suspensin en un tampn TNE 1x, considerando que el
ADN de referencia es ADN bicatenario, con una A260 = 1 a 50 g/ml, en una cubeta
cuyo paso de luz es de 10 mm. La concentracin nominal de ADN era de 25 g/ml.
Cuadro 2. Valores de la absorbancia de ADN de timo de ternera muy purificado, en
tampn TNE 1x.
Longitud de
onda
325
280
260
230

Absorbancia
0,01
0,28
0,56
0,30

A260/A280

Conc. (g/ml)

2,0
-

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

28
-

Sesin n 4

Extraccin y Purificacin de ADN

13

Prctica
Instrumental
OBSERVACIONES
Antes de utilizar todo el instrumental hay que esterilizarlo y eliminar todos los
residuos de ADN. Para evitar la contaminacin, deben usarse puntas de pipeta con
barrera protectora contra aerosoles.

Instrumental reductor (hoja de bistur estril, mortero, etc.)

Bao mara o calentador

Microcentrifuga

Micropipetas

Mezclador de torbellino

Tubos para microcentrifuga de 1,5 ml

Bandejas de pesar o equivalente

Esptulas

Balanza capaz de efectuar mediciones de 0,01 g

Asas

Soporte para tubos de microcentrifuga

Optativo: desecador en vaco para secar los sedimentos de ADN.


Reactivos
OBSERVACIONES
Todos los productos qumicos han de ser de calidad de biologa molecular. El agua
desionizada y los Tampones han de esterilizarse en autoclave antes de su
utilizacin. Ningn producto qumico debe contener ADN ni desoxirribonucleasa.

Bromuro de cetil-trimetil amonio (CTAB)

N CAS 124-03-8

Cloroformo
Isopropanol
Na2EDTA

N CAS 6381-92-6

Etanol
NaCl
Proteinasa K

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

14

Ribonucleasa A
Trometamol (Tris-HCl)
Agua desionizada esterilizada
Tampn a base de CTAB
CTAB 20 g/l

4g

NaCl 1,4 M

16,4 g

Tris-HCl 0,1 M

3,15 g

Na2EDTA 20 mM

1,5 g

Aadir 100 ml de agua desionizada;

ajustar el pH a 8,0 con NaOH 1 M;

completar hasta 200 ml y esterilizar en autoclave;

conservar el Tampon a 4C (seis meses como mximo).

Solucin de precipitacin a base de CTAB


CTAB 5 g/l

1g

NaCl 0,04 M

0,5 g

Aadir 100 ml de agua desionizada;

ajustar el pH a 8,0 con NaOH 1 M;

completar hasta 200 ml y esterilizar en autoclave;

conservar la solucin a 4C (seis meses como mximo).

NaCl 1,2 M

Disolver 7,0 g de NaCl en 100 ml de agua desionizada;

esterilizar en autoclave y conservar a temperatura ambiente.

Solucin de etanol al 70 % (v/v)


Mezclar 70 ml de etanol puro y 30 ml de agua desionizada estril.
Ribonucleasa A 10 GM/ml: conservar a 20C.
Endopeptidasa K 20 GM/ml: conservar a 20C.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

15

Procedimiento
Debe efectuarse en condiciones estriles. La contaminacin durante la preparacin
de la muestra puede evitarse empleando material desechable y soluciones de
descontaminacin y evitando la formacin de polvo.

Depositar 100 GM de muestra homognea en un tubo estril de 1,5 ml para


microcentrfuga;

aadir 300 l de agua desionizada estril y mezclar con un asa;

aadir 500 l de tampn a base de CTAB y mezclar con un asa;

aadir 20 l de proteinasa K (20 GM/ml), agitar e incubar a 65C durante 30-90


*

minutos ;

aadir 20 l de ribonucleasa A (10 GM/ml), agitar e incubar a 65C durante 5-10


*
minutos ;
centrifugar durante 10 minutos a 16 000 g aproximadamente;

trasladar el sobrenadante a un tubo de microcentrifugacin que contenga 500 l


de cloroformo y agitar durante 30 segundos;

centrifugar durante 10 minutos a 16,000 g hasta que se separen las fases;

trasladar 500 l de la capa superior a otro tubo de microcentrifugacin que


contenga 500 l de cloroformo y agitar;

centrifugar durante 5 minutos a 16 000 g;

trasladar la capa superior a otro tubo de microcentrifugacin;

aadir 2 volmenes de solucin de precipitacin a base de CTAB y mezclar


pipeteando;

incubar durante 60 minutos a temperatura ambiente;

centrifugar durante 5 minutos a 16 000 g;

desechar el sobrenadante;

disolver el precipitado en 350 l NaCl (1,2 M);

aadir 350 l de cloroformo y agitar durante 30 segundos;

centrifugar durante 10 minutos a 16,000 g hasta que se separen las fases;

trasladar la capa superior a otro tubo de microcentrifugacin;

aadir 0,6 volmenes de isopropanol y agitar;

centrifugar durante 10 minutos a 16 000 g;

Estas etapas optativas se suelen incluir ahora en el mtodo de extraccin con CTAB para
aumentar el rendimiento de la extraccin de ADN genmico de matrices muy complejas.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

16

desechar el sobrenadante;

aadir 500 l de solucin de etanol al 70 % y agitar con cuidado;

centrifugar durante 10 minutos a 16 000 g;

desechar el sobrenadante;

secar los sedimentos y volver a disolver el ADN en 100 l de agua desionizada


estril.

La solucin de ADN puede conservarse en la nevera dos semanas como mximo o


en el congelador a - 20C durante ms tiempo.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

17

Bibliografa
Hotzel, H., Mller, W. y Sachse, K. (1999). Recovery and characterization of residual
DNA from beer as a prerequisite for the detection of genetically modified
ingredients. European Food Research Technology 209, 192-196.
Hupfer, C., Hotzel, H., Sachse, K. y Engel, K.H. (1998). Detection of the genetic
modification in heat-treated products of Bt maize by polymerase chain reaction.
Zeitschrift fr Lebensmittel-Untersuchung und -Forschung A 206, 203-207.
Lipp, M., Bluth, A., Eyquem, F., Kruse, L., Schimmel, H., Van den Eede, G. y
Anklam, E. (2001). Validation of a method based on polymerase chain reaction
for the detection of genetically modified organisms in various processed
foodstuffs. European Food Research Technology 212, 497-504.
Lipp, M., Brodmann, P., Pietsch, K., Pauwels, J. y Anklam, E. (1999). IUPAC
collaborative trial study of a method to detect genetically modified soy beans and
maize in dried powder. Journal of AOAC International 82, 923928.
Meyer, R. y Jaccaud, E. (1997). Detection of genetically modified soya in processed
food products: development and validation of PCR assay for the specific
detection of glyphosate-tolerant soybeans. In Amad, R. Battaglia (Eds.).
Proceedings of the ninth European conference on food chemistry (Vol. 1).
Authenticity and adulteration of food-the analytical approach. 24-26 September
1997. Interlaken 1, 23-28. ISBN : 3-9521414-0-2.
Murray, M.G. y Thompson, W.F. (1980). Rapid isolation of high molecular weight
plant DNA. Nucleic Acids Research 8, 43214325.
Poms, R.E., Glssl, J. y Foissy, H. (2001). Increased sensitivity for detection of
specific target DNA in milk by concentration in milk fat. European Food Research
Technology 213, 361-365.
Wagner, D.B., Furnier, G.R., Saghay-Maroof, M.A., Williams, S.M., Dancik, B.P. y
Allard, R.W. (1987). Chloroplast DNA polymorphisms in lodgepole and jack pines
and their hybrids. Proceedings of the National Academy of Science USA 84,
20972100.
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Extraccin y Purificacin de ADN

18

Zimmermann, A., Lthy, J. y Pauli, U. (1998). Quantitative and qualitative evaluation


of nine different extraction methods for nucleic acids on soya bean food samples.
Zeitschrift fr Lebensmittel-Untersuchung und -Forschung A 207, 8190.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 4

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 5
Electroforesis en gel de agarosa

M. Somma, M. Querci

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Electroforesis en Gel de Agarosa

ndice
Sesin n 5
Electroforesis en Gel de Agarosa

Introduccin

Principios fsicos de la electroforesis en gel de agarosa

Componentes de la electroforesis en gel de agarosa

Prctica

Bibliografa

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

12

Sesin n 5

Electroforesis en Gel de Agarosa

Introduccin
La electroforesis en gel es un mtodo que se emplea para separar macromolculas
en funcin del tamao, la carga elctrica y otras propiedades fsicas. El trmino
electroforesis describe la migracin de las partculas cargadas bajo la influencia de
un campo elctrico. Electro se refiere a la electricidad y foresis, del griego
phoros, significa trasladar.

As pues, la electroforesis en gel es una tcnica

consistente en aplicar corriente elctrica a las molculas para que atraviesen una
placa de gel. La fuerza motriz de la electroforesis es la tensin elctrica aplicada a
los electrodos en ambos extremos del gel.

Las propiedades de una molcula

determinan la velocidad con que un campo elctrico puede desplazarla a travs de


un medio gelatinoso.
Muchas macromolculas biolgicas importantes (por ejemplo, los aminocidos, los
pptidos, las protenas, los nucletidos y los cidos nucleicos) poseen grupos
ionizables y, a un pH determinado, existen en solucin como especies cargadas
elctricamente, sean cationes (+) o aniones (-). Segn la naturaleza de la carga
neta, las partculas cargadas migrarn hacia el ctodo o hacia el nodo. As, por
ejemplo, cuando se aplica un campo elctrico a un gel con pH neutro, los grupos
fosfato del ADN cargados negativamente lo harn migrar hacia el nodo
(Westermeier, 1997).
La electroforesis en gel de agarosa es un mtodo normalizado que se utiliza para
separar, identificar y purificar fragmentos de ADN. Se trata de una tcnica sencilla y
rpida que permite diferenciar fragmentos de ADN que no pueden separarse
adecuadamente con otros procedimientos. Por otra parte, el ADN puede localizarse
en el gel tiendo con una concentracin baja de bromuro de etidio, que es un agente
intercalante fluorescente que se utiliza como colorante.
En las siguientes secciones se presentan los principios fsicos, los componentes
(matriz de gel, tampn, tampn de carga y marcador) y los procedimientos para
preparar la electroforesis en gel de agarosa (Sambrook et al., 1989).

Principios fsicos de la electroforesis en gel de agarosa


La electroforesis en gel es una tcnica que se emplea para separar los cidos
nucleicos y las protenas. La separacin de las macromolculas depende de dos
variables: carga y masa. Cuando una muestra biolgica, como por ejemplo el ADN,
se mezcla en una solucin tampn y se aplica a un gel, esas dos variables actan
conjuntamente.

La corriente elctrica de un electrodo repele las molculas, al

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

tiempo que el otro electrodo las atrae. La fuerza de friccin del material de gel acta
como tamiz molecular, separando las molculas en funcin de su tamao.
Durante la electroforesis, las macromolculas son empujadas a travs de los poros,
dependiendo su tasa de migracin por el campo elctrico de los siguientes factores:
fuerza del campo
tamao y forma de las molculas
hidrofobicidad relativa de las muestras
fuerza inica y temperatura del tampn en que se desplazan las molculas.
Para tener una idea cabal del proceso de separacin de las partculas cargadas en
la electroforesis en gel, conviene tener presentes las simples ecuaciones referidas a
esta tcnica. Cuando se aplica tensin a los electrodos se genera un gradiente de
potencial (E), que puede expresarse con la siguiente ecuacin:
E = V/d

(1)

donde V, medida en voltios, es la tensin aplicada y d, la distancia en cm entre los


electrodos.
Al aplicarse el gradiente de potencial (E) se genera una fuerza (F) en una molcula
cargada, que puede expresarse con la siguiente ecuacin:
F = Eq

(2)

donde q corresponde a la carga en culombios que lleva la molcula. Esta es la


fuerza, medida en newtons, que empuja la molcula cargada hacia el electrodo.
Existe asimismo una resistencia de friccin que ralentiza el desplazamiento de las
molculas cargadas. Esta fuerza de friccin es funcin de los siguientes factores:
tamao hidrodinmico de la molcula
forma de la molcula
tamao de poro del medio en que tiene lugar la electroforesis
viscosidad del tampn.
La velocidad v de una molcula cargada en un campo elctrico depende del
gradiente de potencial, la carga y la fuerza de friccin de la molcula, y puede
expresarse con la siguiente ecuacin:
v = Eq / f

(3)

donde f es el coeficiente de friccin.


La movilidad electrofortica (M) de un in puede entonces determinarse dividiendo la
velocidad del in por el gradiente de potencial:
M=v/E

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

(4)

Sesin n 5

Electroforesis en Gel de Agarosa

Adems, de la ecuacin (3) se infiere que la movilidad electrofortica M puede


expresarse de modo equivalente como la carga de la molcula (q) dividida por el
coeficiente de friccin (f):
M=q/f

(5)

Cuando se aplica una diferencia de potencial, las molculas que poseen distintas
cargas globales comenzarn a separarse debido a sus diferentes movilidades
electroforticas.

La movilidad electrofortica es un parmetro significativo y

caracterstico de las molculas o partculas cargadas y depende del valor de pK del


grupo cargado y del tamao de la molcula o partcula. Incluso las molculas con
cargas semejantes empezarn a separarse si sus tamaos moleculares son distintos
por cuanto estarn sometidas a fuerzas de friccin diferentes. El ADN bicatenario
lineal migra por las matrices de gel a velocidades inversamente proporcionales al
log10 del nmero de pares de bases.

Las molculas ms grandes migran ms

despacio debido a la mayor resistencia de friccin y a la menor eficacia del


desplazamiento a travs de los poros del gel.
La corriente que atraviesa la solucin entre los electrodos es conducida
principalmente por los iones del tampn, si bien una pequea proporcin lo es por
los iones de la muestra. La relacin entre intensidad I, tensin V y resistencia R se
expresa segn la ley de Ohm:
R=V/I

(6)

Esta ecuacin muestra que, para una resistencia R dada, es posible acelerar la
separacin electrofortica aumentando la tensin V aplicada, lo cual dar lugar al
correspondiente incremento de la intensidad de la corriente I. La distancia migrada
ser proporcional a la intensidad y al tiempo. Con todo, el aumento de tensin (V) y
el incremento correspondiente de intensidad e (I) ocasionara uno de los principales
problemas que plantea la mayor parte de las formas de electroforesis, a saber, la
generacin de calor. Este fenmeno queda ilustrado con la siguiente ecuacin, en la
que la potencia (W, medida en vatios) generada durante la electroforesis equivale al
producto de la resistencia multiplicado por el cuadrado de la intensidad:
W = I2R

(7)

Dado que la mayor parte de la potencia producida en el proceso electrofortico se


disipa en forma de calor, pueden producirse los siguientes efectos perjudiciales:

aumento de la tasa de difusin de los iones de la muestra y del tampn, con el


consiguiente ensanchamiento de las muestras separadas

formacin de corrientes de conveccin, con la consiguiente mezcla de las


muestras separadas

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

inestabilidad trmica de las muestras, que son bastante sensibles al calor (por
ejemplo, desnaturalizacin del ADN)

disminucin de la viscosidad del tampn y, por ende, reduccin de la resistencia


del medio.

Componentes de la electroforesis en gel de agarosa


Agarosa
La agarosa, coloide natural que se extrae de las algas, es un polisacrido lineal (con
un peso molecular medio de ~12 000 Da) formado por la repeticin de la unidad
bsica, la agarobiosa, que comprende unidades alternadas de galactosa y 3,6anhidrogalactosa. La agarosa es muy frgil y las manipulaciones pueden destruirla
con facilidad.

Los geles de agarosa poseen grandes poros y se emplean

fundamentalmente para separar las molculas grandes con un peso molecular de


ms de 200 kDa.
Los geles de agarosa permiten una electroforesis rpida, pero con una resolucin
limitada por cuanto las bandas que se forman en los geles tienen tendencia a ser
difusas y a esparcirse. Ello obedece al tamao de los poros y no puede controlarse.
Los geles de agarosa se obtienen por suspensin de agarosa seca en polvo en un
tampn acuoso, tras lo cual se hace hervir la mezcla hasta que la agarosa se funde
y se convierte en una solucin transparente. A continuacin, se vierte esta solucin
en un molde para gel y se deja enfriar a temperatura ambiente hasta que se forma
un gel rgido. Al endurecerse, la agarosa forma una matriz cuya densidad viene
determinada por su concentracin.

Tampn de electroforesis
La movilidad electrofortica del ADN se ve afectada por la composicin y la fuerza
inica del tampn de electroforesis. En ausencia de iones, la conductancia elctrica
es mnima y el ADN migra lentamente o ni siquiera se desplaza. En un tampn de
elevada fuerza inica la conductancia elctrica es muy elevada y se genera una
importante cantidad de calor. En el peor de los casos, el gel se funde y el ADN se
desnaturaliza.
Se dispone de varios tipos de tampones para la electroforesis de ADN nativo
bicatenario. Contienen EDTA (pH 8,0) y tris-acetato (TAE), tris-borato (TBE) o trisfosfato (TPE) a una concentracin de aproximadamente 50 mM (pH 7,5 7,8). Los
tampones de electroforesis suelen prepararse en forma de soluciones concentradas

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

y se conservan a temperatura ambiente. El TBE se utilizaba inicialmente a una


concentracin de trabajo de 1x en el caso de la electroforesis en gel de agarosa. No
obstante, una solucin de trabajo de 0,5x proporciona un poder ms que suficiente y
en la actualidad prcticamente todas las electroforesis en gel de agarosa se
practican utilizando esta concentracin.

Concentracin de agarosa
Un fragmento de ADN de un tamao determinado migra a diferentes velocidades a
travs de los geles segn la concentracin de agarosa.

En funcin de la

concentracin de agarosa o tampn, se pueden separar segmentos de ADN que


contengan de 20 a 50 000 pb. En los geles horizontales, la agarosa se emplea por
lo general en concentraciones comprendidas entre un 0,7 % y un 3 % (vase el
cuadro 1).
Cuadro 1. Concentracin recomendada de gel de agarosa para separar molculas de
ADN lineales.
% de agarosa

Gamas de tamaos de
ADN (pb)

0,75

10 000 15 000

1,0

500 10 000

1,25

300 5 000

1,5

200 4 000

2,0

100 2 500

2,5

50 1 000

ADN marcador
Para una tensin, un gel de agarosa y unas concentraciones de tampn
determinadas, la distancia de migracin depende del peso molecular del material
inicial.

As pues, debe cargarse un ADN marcador de tamao conocido en las

ranuras situadas en los extremos derecho e izquierdo del gel. Generalmente un


marcador contiene un nmero determinado de segmentos de ADN conocidos, lo cual
facilita la labor de determinar el tamao de los ADN desconocidos en caso de que se
produjese alguna distorsin sistemtica del gel durante la electroforesis.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

Tampn de carga
Las muestras de ADN que deben cargarse en el gel de agarosa se mezclan en
primer lugar con un tampn de carga que por lo general contiene agua, sacarosa y
un colorante (por ejemplo, cianol de xileno, azul de bromofenol, verde de
bromocresol, etc.). La cantidad mxima de ADN que puede cargarse depende del
nmero de fragmentos. La cantidad mnima de ADN que puede detectarse mediante
fotografa de los geles teidos con bromuro de etidio es de aproximadamente 2 ng
en una banda de 0,5 cm de ancho. Si una banda de este ancho contiene ms de
500 ng de ADN, la ranura estar sobrecargada y se producir emborronamiento. El
tampn de carga se emplea con tres fines:

aumentar la densidad de las muestras para que las gotas de ADN caigan
uniformemente en el pocillo

aadir color a la muestra, simplificando de este modo el proceso de carga

incorporar un colorante a la muestra que, en un campo elctrico, se desplace


hacia el nodo a una velocidad previsible.

Prctica
Advertencia: El bromuro de etidio es una sustancia mutgena/carcingena potente y
moderadamente txica.

Se debern llevar siempre guantes cuando se manipulen

soluciones y geles que contengan bromuro de etidio.


Instrumental

Unidad de electroforesis horizontal con alimentacin elctrica

Horno microondas o incubador-agitador

Micropipetas

Tubos de reaccin de 1,5 ml

Balanza que pueda pesar 0,01 g

Esptulas

Soporte para tubos de reaccin

Material de vidrio

Transiluminador (radiacin UV, 312 nm)

Instrumentos para documentacin (por ejemplo, cmara Polaroid o magnetoscopio).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

Reactivos

Agarosa adecuada para electroforesis de ADN

Tris[hidroximetil] aminometano (Tris)

cido brico

Na2EDTA

CAS 6381-92-6

Bromuro de etidio

CAS 1239-45-8

Sacarosa

Cianol de xileno FF

ADN marcadores:

CAS 77-68-1

CAS 2650-17-1

Lambda ADN EcoRI/HindIII digerido (u otros marcadores adecuados


similares)

Escalera de ADN de 100 pb.

Tampn de TBE 10x (1 litro)

Tris [hidroximetil] aminometano (Tris)

54,0 g

cido brico

27,5 g

Na2EDTA

7,44 g

Mezclar el reactivo con agua desionizada para obtener una solucin de un litro con
un pH de 8,3.

Conservar a temperatura ambiente.

Tampn de carga 6x (10 ml)

Cianol de xileno FF

0,025 g

Sacarosa

4g

Aadir sacarosa y cianol de xileno FF al agua desionizada para obtener 10 ml de


solucin.

Mezclar la solucin, pasar por autoclave y conservar a 4C.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

10

Procedimiento

Sellar los bordes de un molde de plstico limpio y seco con cinta adhesiva o de
otro modo.

Colocar el peine adecuado de modo que se formen pocillos

completos al aadir la solucin de agarosa.

Diluir tampn de TBE 10x y preparar la cantidad adecuada de tampn de TBE


0,5x para llenar la cubeta de electroforesis y preparar el gel.

Pesar la agarosa en polvo segn lo indicado en el cuadro 2 y aadirla a una


cantidad apropiada de tampn de TBE 0,5x en un matraz de Erlenmeyer con
tapa suelta (normalmente 150 ml de solucin de gel para un molde de 15 x 15
cm y 100 ml de gel para un molde de 15 x 10 cm).

0,8 - 1%
1,5%
2,0%

genmico

GM4
ADN

GM3

GM08

GM07

CRYIA4

HA-nos118-r
CRYIA3

HA-nos118-f

p35S-cf3

p35S-cr4

ZEIN4

GMO4
ZEIN3

GMO3

Cuadro 2. Concentraciones de gel de agarosa empleadas durante el curso.

X
X

X
X

Calentar la mezcla en un horno microondas o al bao mara hasta que se


disuelva la agarosa (comprobar el volumen de la solucin tras haberla
calentado).

Enfriar la mezcla a 50 - 60C y aadir bromuro de etidio (de una solucin madre
de 10 mg/ml) hasta lograr una concentracin final de 0,2 g/ml y mezclar bien.

Verter la solucin en el molde y dejar que se forme el gel. La cantidad de gel


empleado debe corresponder a un grosor de aproximadamente 3 - 5 mm.

Una vez completamente formado el gel, retirar cuidadosamente el peine y la


cinta adhesiva y colocar el gel en la cubeta de electroforesis.

Aadir tampn de TBE 0,5x a la unidad de electroforesis de modo que el gel


quede cubierto por una capa de aproximadamente 2 - 5 mm.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

11

Preparar muestras y marcador para ADN genmico del siguiente modo:


Muestra
Agua
Tampn de carga
Muestra

Marcador
3 l
2 l
5 l
10 l

Agua
Tampn de carga
ADN EcoR I / Hind III

6 l
2 l
2 l
10 l

Preparar muestras y marcador para productos de PCR del siguiente modo:


Muestra
Tampn de carga
Muestra

Marcador
2 l
8 l
10 l

Escalera de ADN de 100 pb15 l

Cargar 10 l de cada muestra en pocillos consecutivos y el ADN marcador


adecuado en las calles primera y ltima.

Cerrar la tapa de la cubeta del gel y conectar los cables elctricos para que el
ADN migre hacia el nodo y aplicar una tensin de 5 - 10 V/cm.

Hacer la electroforesis hasta que el cianol de xileno haya recorrido la distancia


adecuada a travs del gel (~ 40 - 60 minutos).

Desconectar la corriente y retirar los cables y la tapa de la cubeta. Introducir el


gel en un transiluminador UV y fotografiarlo.

Tirar el gel en el recipiente para residuos slidos destinado al bromuro de etidio


previsto a tal fin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Electroforesis en Gel de Agarosa

12

Bibliografa
Sambrook, J., Fritsch, E.F. y Maniatis, T. (1989). Gel electroforesis of DNA en:
Sambrook, J., Fritsch, E.F. y Maniatis, T. (Eds.) Molecular Cloning: a Laboratory
Manual. New York: Cold Spring Harbor Laboratory Press, Cold Spring Harbor,
NY, USA, captulo 6.
Westermeier, R. (1997). Electroforesis in Practice: a Guide to Methods and
Applications of DNA and Protein Separation, VCH, Weinheim.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 5

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 6
Reaccin en Cadena de la Polimerasa (PCR)

M. Somma, M. Querci

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE

Reaccin en Cadena de la Polimerasa (PCR)

ndice
Sesin n 6
Reaccin en Cadena de la Polimerasa (PCR)

Introduccin

Componentes, estructura y replicacin del ADN

Principios de la PCR

Instrumentacin y componentes para la PCR

12

Diseo de cebadores para la PCR

18

PCR especializada

22

La PCR en la prctica

24

Bibliografa

32

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

Introduccin
La invencin de la reaccin en cadena de la polimerasa (PCR) por K. Mullis y sus
colaboradores en 1985 ha revolucionado la biologa molecular y la medicina
molecular (Saiki et al., 1985). La reaccin en cadena de la polimerasa es una tcnica
in vitro utilizada para amplificar enzimticamente una regin determinada de ADN
situada entre dos regiones de ADN cuya secuencia se conoce. Mientras que antes
solo podan obtenerse cantidades mnimas de un gen especfico, ahora incluso un
nico ejemplar de un gen puede amplificarse con la PCR hasta un milln de
ejemplares en tan solo unas pocas horas.
Las tcnicas de PCR se han hecho indispensables para muchos procedimientos
comunes, como la clonacin de fragmentos especficos de ADN, la deteccin e
identificacin de genes para diagnstico y medicina legal, y en la investigacin de
modelos de expresin de los genes. Ms recientemente, la PCR ha permitido la
investigacin de nuevos campos, como el control de la autenticidad de los alimentos,
la presencia de ADN modificado genticamente y la contaminacin microbiolgica.
Para comprender los principios de la PCR y sus aplicaciones, debe atenderse en
primer lugar a la naturaleza de la molcula del ADN, por lo que en la seccin
siguiente se describen la estructura y la replicacin del ADN.

Componentes, estructura y replicacin del ADN


Componentes. Una molcula de ADN consta de dos cadenas en hlice,
complementarias y antiparalelas, formadas por unidades alternantes de cido
fosfrico y desoxirribosa, con uniones transversales de bases pricas y pirimidnicas,
lo que constituye una estructura helicoidal dextrgira, y lleva la informacin gentica
codificada en la secuencia de las bases. En las clulas eucariticas, la mayor parte
del ADN se encuentra en el ncleo y se conoce como ADN cromosmico. Est
separado del resto de la clula (citoplasma) por una membrana de dos capas
(membrana nuclear). Por otra parte, puede haber ADN extracromosmico en las
mitocondrias y cloroplastos.
Los elementos estructurales del ADN, llamados nucletidos, son los siguientes:

dATP, desoxiadenosina-trifosfato;

dGTP, desoxiguanosina-trifosfato;

dTTP, desoxitimidina-trifosfato;

dCTP, desoxicitidina-trifosfato.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

Para mayor facilidad, estos cuatro nucletidos se denominan dNTP (por las siglas en
ingls de desoxinuclesido-trifosfato). Un nucletido est formado por tres grandes
partes: una base prica (adenina, A, o guanina, G), o una base pirimidnica (citosina,
C, o timina, T), un azcar pentosa (desoxirribosa) y un grupo trifosfato. Como se
muestra en la figura 1, una base prica o pirimidnica est unida a un anillo de
pentosa por un enlace N-glucosdico, y un grupo fosfato est unido al tomo de
carbono 5' del azcar por un enlace dister. En el cido ribonucleico, ARN, la timina
est sustituida por el uracilo (U) y la molcula de desoxirribosa por la ribosa.

Nucletido

azcar + fosfato

Desoxiadenosina trifosfato = dATP

Desoxiguanosina trifosfato = dGTP

Desoxicitidina trifosfato : dCTP

Desoxitimidina trifosfato = dTTP

Figura 1. Componentes de los nucletidos (imagen: Andy Vierstraete, 1999).

Estructura. La figura 2 indica cmo forman los nucletidos una cadena de ADN. El
ADN se forma uniendo los nucletidos entre el grupo fosfato de un nucletido (que
se sita en el tomo de C n 5 de la molcula de azcar) y el hidroxilo del tomo de
C n 3 de la molcula de azcar del nucletido anterior. Para efectuar este enlace,
se separa un grupo difosfato, con liberacin de energa. Los nuevos nucletidos se
aaden siempre en el extremo 3 de la cadena. Como se indica en la figura 3, el
ADN es bicatenario (excepto en algunos virus) y las dos cadenas o hebras se
aparean entre s de forma muy precisa. Cada base de una cadena se aparea con un
solo tipo de base de la cadena contraria, formando un par de bases (pb): A siempre

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

se une con T mediante dos puentes de hidrgeno, y C siempre se une con G


mediante tres puentes de hidrgeno. De esta manera, las dos cadenas son
mutuamente complementarias y una de las cadenas puede servir de ADN molde
para formar la otra.

Extremo 5
Extremo 3

Figura 2. Formacin de una cadena de ADN a partir de los distintos nucletidos


(imagen: Andy Vierstraete, 1999).
Las bases forman un ncleo hidrfobo dentro de la doble hlice. Los azcares y los
grupos fosfato (en su forma aninica) constituyen la capa hidrfila exterior de la
molcula. En condiciones fisiolgicas, la hlice de ADN bicatenario es ms estable
que una hlice de ADN monocatenario.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

Genoma= total de todos los cromosomas


Mitocondria

Fragmento de cromosoma

Membrana plasmtica
Retculo endoplsmico
Aparato de Golgi
Citoesqueleto filamentoso

Cromosoma

Ncleo
Lisosoma

Gen

Pares de bases de los


nucletidos

Esqueleto de azcar y fosfato


Puente de hidrgeno
Base

Figura 3. Estructura del ADN de una clula (imagen: Andy Vierstraete, 1999).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

Replicacin. El ADN contiene toda la informacin gentica que define la estructura


y la funcin de un organismo. Hay tres procesos diferentes encargados de la
transmisin de la informacin gentica:
replicacin;
transcripcin;
traduccin.
Durante la replicacin, un cido nucleico bicatenario se duplica para formar copias
idnticas. Con este proceso se perpeta la informacin gentica. Durante la
transcripcin, un segmento de ADN que constituye un gen se lee y se transcribe en
una secuencia monocatenaria de ARN. El ARN pasa del ncleo al citoplasma.
Finalmente, durante la traduccin, la secuencia de ARN se traduce a una secuencia
de aminocidos que forman una protena (Alberts et al., 1983).
La replicacin del ADN es el proceso en que se basa la amplificacin por PCR, y se
va a describir en detalle.
Durante la replicacin, la molcula de ADN se desenrolla y cada cadena se convierte
en un ADN molde para la sntesis de una cadena complementaria nueva. Cada
molcula hija, consistente en una cadena nueva y una vieja de ADN, es una copia
exacta de la molcula madre.

Hebra original
Hebra nueva
Cebador de ARN

Hebra
retrasada

Hebra adelantada

Las flechas indican la direccin de


la replicacin del ADN
Fragmento de Okazaki

Figura 4. La horquilla de replicacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

Para desenrollar la doble hlice y sintetizar una nueva hebra de ADN hacen falta
varias enzimas. La topoisomerasa y la helicasa se encargan de desenrollar el ADN
rompiendo la estructura superenrollada y cortando una sola hebra de ADN. A
continuacin, una primasa (parte de un agregado de protenas denominado
primosoma) une un pequeo cebador de ARN al ADN monocatenario, para actuar
como extremo 3'OH a partir del cual la ADN polimerasa inicia la sntesis. Este
cebador de ARN es eliminado finalmente por la ribonucleasa H y el hueco se rellena
mediante la ADN polimerasa I. En esta fase, la ADN polimerasa avanza a lo largo de
una molcula monocatenaria de ADN (una hebra sencilla), recogiendo dNTP libres
para unirlos mediante puentes de hidrgeno a los dNTP complementarios situados
en dicha hebra sencilla de ADN (A con T y G con C), y mediante un enlace
fosfodister covalente al nucletido anterior de la propia hebra nueva. La energa
conservada en el trifosfato se utiliza para unir covalentemente cada nuevo nucletido
a la segunda hebra en crecimiento. Hay diferentes formas de ADN polimerasa, pero
es la ADN polimerasa III la que se encarga de la sntesis progresiva de nuevas
hebras de ADN. La ADN polimerasa acta solo desde el extremo 5 hacia el 3.
Como una de las hebras de la doble hlice tiene el sentido 5-3 y la otra el 3-5, la
ADN polimerasa sintetiza una segunda copia de la hebra 5-3 (hebra retrasada) a
tramos (fragmentos de Okazaki) (Ogawa y Okazaki, 1980). La sntesis de las nuevas
copias de la hebra 5-3 se muestra en la figura 4. La otra hebra, la hebra
adelantada, puede avanzar directamente con la sntesis, desde el extremo 5' al 3',
segn se va desenrollando la hlice. La ADN polimerasa no puede empezar la
sntesis ex novo a partir de una hebra sencilla desnuda, sino que necesita la
presencia de un cebador con un grupo 3OH libre al que pueda unir un dNTP.
Una ligasa cataliza la formacin de un enlace fosfodister entre un extremo 3OH y
un 5fosfato, libres y adyacentes. As puede rellenarse el hueco que queda cuando
se elimina el cebador de ARN. Ha de sealarse la importancia de la presencia de
protenas de unin a ADN monocatenario para mantener la estabilidad de la
horquilla de replicacin. El ADN monocatenario es muy lbil, o inestable, y estas
protenas se unen a l mientras es monocatenario, protegindolo as de la
degradacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

Principios de la PCR
La PCR se basa en el mecanismo de la replicacin in vivo del ADN: el ADN
bicatenario se desenrolla y pasa a ADN monocatenario, se duplica y se vuelve a
enrollar. Esta tcnica consiste en ciclos repetitivos de:

desnaturalizacin del ADN por fusin a temperatura elevada, a fin de convertir el


ADN bicatenario en ADN monocatenario;

unin (anillamiento) de dos oligonucletidos, utilizados como cebadores, al ADN


diana;

extensin de la cadena de ADN por adicin de nucletidos a partir de los


cebadores utilizando ADN polimerasa como catalizador, en presencia de iones
Mg2+.

Los oligonucletidos consisten normalmente en secuencias relativamente cortas,


que son diferentes entre s y complementarias de los sitios de reconocimiento que
flanquean el segmento de ADN diana que debe amplificarse. Las fases de
desnaturalizacin del ADN molde, anillamiento del cebador y extensin del cebador
constituyen un ciclo del mtodo de amplificacin por PCR. La figura 5 ilustra las
tres fases principales del proceso de amplificacin por PCR.

30-40 ciclos de 3 fases

Fase 1: desnaturalizacin

Fase 2: unin
Cebadores directos
e inversos

Fase 3: extensin
Slo dNTPs

Figura 5. Fases de la amplificacin por PCR (imagen: Andy Vierstraete, 1999).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

10

Tras cada ciclo, las hebras de ADN recin sintetizadas pueden servir de ADN molde
para el ciclo siguiente. Como se indica en la figura 6, el producto principal de esta
reaccin exponencial es un segmento de ADN bicatenario cuyos extremos vienen
definidos por los extremos 5 de los oligonucletidos cebadores y cuya longitud viene
dada por la distancia entre los cebadores. Los productos de una primera ronda de
amplificacin efectiva son molculas de ADN de diferentes tamaos, cuyas
longitudes pueden superar la distancia entre los sitios de unin de los dos
cebadores. En la segunda ronda, estas molculas generan hebras de ADN de
longitud definida que se acumulan de forma exponencial en rondas posteriores de
amplificacin y constituyen los productos dominantes de la reaccin. As, la
amplificacin, que es el nmero final de ejemplares de la secuencia diana, se
expresa con la siguiente ecuacin:
(2n-2n)x

(1)

donde n es el nmero de ciclos, 2n es el nmero de molculas del primer producto


obtenidas tras el primer ciclo y de los segundos productos obtenidos tras el segundo
ciclo con longitud indefinida, x es el nmero de ejemplares del ADN molde original.
Tericamente, al cabo de 20 ciclos de PCR habr una amplificacin de 220 veces,
suponiendo que cada ciclo tiene un rendimiento del 100 %. El rendimiento de una
PCR vara de un ADN molde a otra y depende del grado de optimizacin que se
haya conseguido.
En los prrafos siguientes se encuentra una descripcin pormenorizada de las tres
fases de la amplificacin por PCR (desnaturalizacin del ADN molde, anillamiento
del cebador y extensin) (Sambrook et al., 1989).

4 ciclo
gen deseado
3er ciclo
2 ciclo

1er ciclo

35 ciclo

ADN plantilla

4
8
16
32
ejemplares ejemplares ejemplares ejemplares

68000 millones de
ejemplares

Figura 6. La amplificacin exponencial del ADN mediante PCR.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

11

Desnaturalizacin del ADN molde


Durante la desnaturalizacin, la hebra doble se funde, abrindose para dar ADN
monocatenario, y se detienen todas las reacciones enzimticas (es decir, la
extensin de un ciclo anterior). Las dos cadenas complementarias se separan por el
aumento de la temperatura, lo que se denomina desnaturalizacin. Para obtener la
desnaturalizacin del ADN, la temperatura suele aumentarse hasta unos 93 - 96C.
De esta manera se rompen los fuertes puentes de H y aumenta el nmero de bases
desapareadas. La reaccin se completa cuando todo el ADN bicatenario se
convierte en monocatenario. La temperatura a la que la mitad del ADN bicatenario
ha pasado a monocatenario se denomina temperatura de fusin, Tf. El proceso de
desnaturalizacin depende del tipo de disolvente, de la concentracin salina y del pH
utilizado; por ejemplo, la temperatura de fusin desciende al bajar la concentracin
salina, al subir el pH y en presencia de disolventes orgnicos como el formaldehdo.
El valor de la Tf tambin se puede ver afectado por la concentracin de G/C y T/A.
La Tf de una estructura de ADN que contiene una elevada proporcin de G/C es ms
alta que la de un ADN ms rico en T/A. Por ejemplo, Serratia marcescens tiene
aproximadamente un 60 % de G/C y una Tf de unos 94 C, mientras que
Pneumococcus tiene aproximadamente un 40 % de G/C y una Tf de unos 85 C.
Anillamiento del cebador
La unin o rehibridacin de las hebras de ADN se efecta a una temperatura inferior
(generalmente, entre 55 y 65 C). Una vez se ha reducido la temperatura, las dos
hebras complementarias de ADN monocatenario tienden a formar de nuevo una
molcula de ADN bicatenario. En esta fase, los cebadores se mueven libremente y
es continua la formacin y la ruptura de puentes de hidrgeno entre el cebador
monocatenario y el ADN molde tambin monocatenaria. Los enlaces ms estables
duran un poco ms (los cebadores que se corresponden exactamente con el ADN
molde) y es en ese pequeo fragmento de ADN bicatenario (ADN molde con
cebador) donde puede fijarse la polimerasa y empezar a copiar el ADN molde.
Cuando se han introducido unas cuantas bases, el enlace inico entre el ADN molde
y el cebador es tan fuerte que ya no se rompe.
Extensin del cebador
En esta fase, los cebadores se extienden a lo largo de la secuencia diana utilizando
una ADN polimerasa termoestable (frecuentemente se trata de la ADN Taq
polimerasa) en presencia de dNTP, lo que produce la duplicacin del material diana

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

12

inicial. La temperatura de trabajo ideal para la ADN polimerasa Taq es de 72 C.


Cuando los cebadores se han extendido unas cuantas bases, ejercen una atraccin
inica ms fuerte sobre el ADN molde, lo que reduce la probabilidad de que se
invierta el proceso. Los cebadores que no se corresponden exactamente se vuelven
a soltar (debido a la temperatura elevada) y no dan lugar a la extensin del
fragmento. Las bases (complementarias del ADN molde) se unen al cebador en el
extremo 3 (la polimerasa aade dNTP desde 5 hacia 3, leyendo el ADN molde
desde 3 hacia 5). La duracin del tiempo necesario para las fases de extensin del
cebador puede aumentar si es larga la regin de ADN que se va a amplificar; sin
embargo, en la mayora de experimentos de PCR es suficiente un tiempo de 1 min
para conseguir una extensin completa.

Instrumentacin y componentes para la PCR


Instrumentos
El proceso de la PCR ha podido automatizarse gracias a dos importantes avances:
a) el uso de ADN polimerasas termoestables, que resisten a la inactivacin a
temperaturas elevadas; as pues, es posible que una alcuota inicial de
polimerasa se mantenga a lo largo de muchos ciclos del protocolo;
b) el desarrollo de baos termostatizados que pueden subir y bajar rpidamente su
temperatura

de

forma

automatizada

programada;

se

denominan

termocicladores o mquinas de PCR.


Se utilizan diversos diseos de termocicladores como, por ejemplo, calentamiento y
refrigeracin por fluidos, calentamiento por resistencia elctrica y refrigeracin por
fluidos, y calentamiento por resistencia elctrica y refrigeracin por semiconductores.
En la figura 7 se muestra un perfil tpico de los ciclos de temperatura de un protocolo
de tres fases.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

13

Fase 1 :
Desnaturalizacin de la ADN

Temperatura (C)

Fase 3 :
Extensin
del cebador

Un ciclo

Fase 2 :
Hibridacin del
cebador

Minutos

Figura 7. Perfil de ciclos de temperatura de la PCR.


Para que la PCR tenga xito son fundamentales los parmetros ya mencionados de
los ciclos trmicos, en sus fases de desnaturalizacin, anillamiento del cebador y
extensin del cebador, as como los componentes utilizados y el nmero de ciclos
descritos en los prrafos siguientes.

ADN diana
En principio puede efectuarse la amplificacin por PCR si est presente al menos un
ejemplar intacto del gen diana. Si el nmero de ejemplares del gen diana es mayor,
tambin lo ser la probabilidad de que tenga xito la amplificacin del ADN.
Cualquier alteracin, como una muesca en el ADN diana, puede bloquear la
amplificacin por PCR. El tamao de la secuencia diana puede variar entre < 0,1 y
unas cuantas kilobases. La cantidad total de ADN utilizada normalmente para la
PCR est entre 0,05 y 1,0 g, lo que permite la deteccin de ejemplares solos de la
secuencia diana. Aunque las muestras no tienen que estar muy purificadas, s es
necesario eliminar algunos contaminantes, como la heparina, el formol, los agentes
quelantes de Mg2+ o los detergentes, para evitar que inhiban el proceso de
amplificacin.
Cebadores
Generalmente se utilizan cebadores de 16 a 30 nucletidos de longitud, lo que
permite que la temperatura de anillamiento sea razonablemente elevada. Los
cebadores no deben tener tramos de secuencias con una polibase (p. ej., poli-dG) ni

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

14

motivos repetidos, ya que podran hibridarse de forma inadecuada con el ADN


molde. Deben evitarse las secuencias repetidas invertidas, a fin de prevenir la
formacin de estructuras secundarias del cebador, que impediran su hibridacin con
el ADN molde. Tambin deben evitarse las secuencias complementarias de otros
cebadores utilizados en la PCR, para prevenir la hibridacin entre cebadores o la
formacin de dmeros de cebadores (esto es especialmente importante en relacin
con el extremo 3 del cebador). Siempre que sea posible, conviene que el extremo 3
del cebador tenga gran proporcin de bases G y C para aumentar la hibridacin del
extremo que se quiere extender. La distancia entre cebadores debe ser inferior a 10
kb en longitud. Normalmente se observa una importante reduccin del rendimiento
cuando los cebadores se encuentran a ms de unos 3 kb de distancia entre s. La
concentracin usual de oligonucletidos para la PCR es de 1 M. Esto resulta
suficiente para al menos 30 ciclos de amplificacin. La presencia de oligonucletidos
a una concentracin superior puede provocar la amplificacin no deseada de
secuencias distintas de la diana.

Por el contrario, la PCR no es eficaz si la

concentracin del cebador es limitante.

ADN polimerasa
El mtodo original de PCR utilizaba el fragmento Klenow de la ADN polimerasa I de
E. coli (Saiki et al., 1985). Sin embargo, esta enzima se desnaturaliza a
temperaturas inferiores a las necesarias para desnaturalizar la mayora de ADN
molde bicatenario. As pues, en los primeros experimentos era necesario aadir ms
enzima a la reaccin tras cada ciclo. Por otra parte, haba que trasladar las muestras
desde un bao a una temperatura hasta otro a otra temperatura para permitir el
desarrollo de las distintas fases de desnaturalizacin, anillamiento y polimerizacin.
Evidentemente, el uso de una ADN polimerasa termorresistente ha facilitado el
proceso porque ha dejado de ser necesario aadir enzimas tras cada fase de
desnaturalizacin. En principio, las ADN polimerasas solo pueden incorporar
nucletidos al extremo 3 de un polinucletido. La primera ADN polimerasa
termoestable utilizada fue la ADN polimerasa Taq, aislada de la bacteria Thermus
aquaticus (Saiki et al., 1988). Aunque esta enzima es probablemente la ms utilizada
a efectos de la PCR, en el comercio pueden encontrarse algunas otras ADN
polimerasas. En el cuadro 1 se recogen las propiedades de algunas ADN
polimerasas termoestables que se utilizan actualmente para la PCR (Newton y
Graham, 1994).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

15

Cuadro 1. Caractersticas de algunas ADN polimerasas utilizadas para la PCR.

Fuente

Aplicacin
T de actividad
a 95 C (min)
Actividad
exonuclesica
de 5 a 3
Actividad
exonuclesica
de 3 a 5
Procesividad
Velocidad de
extensin
(nt/s)
Extremos de
ADN
resultantes
PM en kDa

Taq/
AmpliTaq

Vent

DeepVent

Pfu

Tth

UITma

Thermus
aquaticus

Thermococcus
litoralis

Pyrococcus
GB-D

Pyrococcus
furiosus

Thermus
thermophilus

Thermotoga
maritima

Taq: natural
AmpliTaq:
para
ingeniera
gentica

Para
ingeniera
gentica

Para
ingeniera
gentica

Natural

Para
ingeniera
gentica

Para
ingeniera
gentica

40

1380

400

>120

20

> 50a

No

No

No

No

No

No

50-60

30-40

75

>80

60

>33

3A

> 95 %
romos

> 95 %
romos

3A

Romos

94

92

94

70

ADN polimerasa Taq/AmpliTaq. Como ya se ha indicado, esta enzima se aisl de


la bacteria Thermus aquaticus que vive en una fuente caliente del parque nacional
de Yellowstone, de EE.UU., a temperaturas prximas a los 85 C. La temperatura
ptima de funcionamiento de esta enzima es de 70 a 80 C, a la que la bacteria
sintetiza ADN a la velocidad de 35 100 nucletidos/segundo. Se conoce como
procesividad el nmero medio de nucletidos que incorpora una enzima al ADN
antes de separarse del ADN molde. La ADN polimerasa AmpliTaq es un enzima
modificada genticamente expresada por E. coli. Como AmpliTaq es recombinante,
su pureza y reproducibilidad son superiores a las del tipo silvestre. Sin embargo, es
posible que durante la amplificacin del ADN se produzca contaminacin con
algunas secuencias homlogas de E. coli. En tal caso, se recomienda el uso de una
ADN polimerasa que no se haya expresado con E. coli como organismo hospedador.
Tanto la ADN polimerasa Taq como la AmpliTaq poseen actividad exonuclesica de
5 a 3, con lo que eliminan nucletidos por delante de la cadena en crecimiento.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

16

ADN polimerasas Vent, DeepVent, Pfu y UITma. Estas enzimas tienen actividad
exonuclesica de 3 a 5, que les permite eliminar los residuos mal apareados hasta
que se forme un extremo con bases correctamente unidas. Sin embargo, la actividad
exonuclesica de 3 a 5 puede provocar la degradacin de los cebadores. Por tanto,
la enzima solo debera aadirse una vez iniciada la reaccin, o bien habra que
utilizar cebadores modificados qumicamente.

ADN polimerasa AmpliTaqGold. Esta enzima consiste en una ADN polimerasa


AmpliTaq, inactiva a temperatura ambiente, y que solo puede activarse durante un
periodo de incubacin a 94 C. En este caso, el programa del termociclador debe
incluir un tiempo de pre-incubacin a la temperatura de 92 95 C. En caso de PCR
con liberacin gradual es posible suprimir el tiempo de pre-incubacin, pero deben
efectuarse al menos 10 ciclos ms que con la PCR clsica.

Tampones de reaccin y MgCl2 en las PCR

Adems de los reactivos que participan directamente en la reaccin, la PCR necesita


un tampn adecuado, cuya composicin depende del tipo y de las caractersticas de
la enzima utilizada. La mayora de los proveedores proporcionan normalmente un
tampn 10x para utilizarlo con la enzima respectiva. El tampn de reaccin ms
comn utilizado con la ADN polimerasa Taq/AmpliTaq contiene:

Tris 10 mM, pH 8,3

KCl 50 mM

MgCl2 1,5-2,5 mM.

En la PCR es fundamental la presencia de cationes divalentes. La concentracin de


MgCl2 en la mezcla final de reaccin suele estar entre 0,5 y 5,0 mM, y la
concentracin ptima se determina empricamente (Innis y Gelfand, 1990).
Los iones Mg2+:

forman un complejo soluble con los dNTP, lo cual es fundamental para la


incorporacin de estos;

estimulan la actividad polimersica;

aumentan la Tf de la interaccin cebador / ADN molde (con lo que estabilizan la


interaccin entre las dos cadenas).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

17

Generalmente, una concentracin baja de Mg2+ provoca un rendimiento bajo (o


incluso nulo), mientras que una concentracin elevada de Mg2+ hace que se
acumulen productos inespecficos (errores de cebado). Es importante evitar que en
la solucin de ADN molde haya una concentracin elevada de agentes quelantes,
como el EDTA, o de grupos inicos con carga negativa, como el fosfato. En la
bibliografa actual se encuentran discusiones sobre diversos tampones y
suplementos de la PCR, como el DMSO, el PEG 6000, la formamida, el glicerol, la
espermidina y los detergentes no inicos, utilizados para aumentar la especificidad o
el rendimiento de la reaccin (Roux, 1995). Efectivamente, algunas ADN
polimerasas alcanzan su nivel ptimo de actividad solo en presencia de tales
suplementos (Rolfs et al., 1992).

Desoxirribonuclesido-trifosfatos

Para la sntesis de ADN hacen falta desoxirribonuclesido-trifosfatos libres (dNTP).


La concentracin de cada uno de los dNTP para la PCR debe estar entre 20 y
200 M, y los cuatro dNTP deben utilizarse a concentraciones equivalentes para
minimizar los errores de incorporacin (Innis et al., 1988). Hay varios fabricantes que
suministran dNTP de elevada pureza, bien como soluciones madre de cada uno de
los dNTP o bien como mezcla de los cuatro dNTP. Las soluciones madre de dNTP
(generalmente 100 mM) se deben ajustar a un pH de 7,0-7,5 con Na OH 1 M para
garantizar que el pH de la reaccin final no baja de 7,1 (Sambrook et al., 1989); sin
embargo, ahora se suministran muchas soluciones madre de dNTP con el pH ya
ajustado.

Nmero de ciclos y efecto de meseta

El nmero de ciclos de amplificacin necesarios para producir una banda visible en


un gel depende mucho de la concentracin inicial del ADN diana. A fin de amplificar
50 molculas diana se recomienda hacer entre 40 y 45 ciclos, mientras que para
amplificar 3x105 molculas hasta la misma concentracin es suficiente con entre 20 y
30 ciclos (Innis y Gelfand, 1990). Esta falta de proporcionalidad se debe al efecto
denominado de meseta, que es la atenuacin de la velocidad exponencial de
acumulacin del producto en las ltimas etapas de una PCR, cuando el producto
alcanza la concentracin de 0,3-1,0 nM. Puede deberse a una degradacin de los

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

18

reactivos (dNTP, enzima), agotamiento de los reactivos (cebadores o dNTP: lo


primero con productos cortos y lo segundo con productos largos), inhibicin por el
producto final (formacin de pirofosfato), competencia por los reactivos por parte de
productos inespecficos, competencia por la unin con el cebador mediante nueva
hibridacin del producto concentrado (10 nM) (Innis y Gelfand, 1990). Si no se
obtiene el producto deseado tras 30 ciclos, debe tomarse una pequea muestra (1
l) del producto amplificado, la cual se mezclar y volver a amplificar durante 20 o
30 ciclos en una nueva mezcla de reaccin, en lugar de prolongar la tanda haciendo
ms ciclos. En algunos casos en que es limitante la concentracin del ADN molde,
esta nueva amplificacin puede proporcionar un buen producto, mientras que la
extensin de los ciclos a ms de 40 no lo hace.

Diseo de cebadores para la PCR


Es posible que el parmetro ms crtico para tener xito con la PCR sea el diseo de
los cebadores. A igualdad de todos los dems factores, un cebador mal diseado
puede hacer que fracase una PCR. La secuencia del cebador determina varios
aspectos, como la posicin y la longitud del producto, su temperatura de fusin y
finalmente el rendimiento (Innis y Gelfand, 1994). Un cebador mal diseado puede
hacer que se consiga poco producto o incluso ninguno, debido a una amplificacin
inespecfica o a la formacin de dmeros de cebador, lo que puede llegar a competir
con la formacin de producto hasta suprimirla. El objetivo de la presente nota de
aplicacin es dar normas que deben seguirse en el diseo de cebadores para la
PCR. En otras publicaciones puede encontrarse un tratamiento ms completo de
este tema (Dieffenbach et al., 1995).

Seleccin del cebador

Al disear cebadores para PCR hay que tener en cuenta diversas variables. Entre
ellas cabe destacar:

la longitud del cebador;

la temperatura de fusin (Tf);

la especificidad;

las secuencias complementarias del cebador;

el contenido de G/C y los tramos de polipirimidina (T, C) o polipurina (A, G);

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

19

la secuencia del extremo 3.

En las secciones siguientes se habla de cada uno de estos elementos crticos.

Longitud del cebador


Dado que la especificidad, la temperatura y el tiempo de hibridacin dependen en
parte de la longitud del cebador, este parmetro es crtico para que tenga xito la
PCR. En general, los oligonucletidos que tienen entre 18 y 24 bases presentan una
especificidad extrema de secuencia, siempre que la temperatura de hibridacin sea
ptima. La longitud del cebador tambin influye en la eficacia de la hibridacin. En
general, cuanto ms largo sea el cebador, menos eficaz ser la hibridacin. Al
cebarse menos ADNs moldes en cada fase, esto puede hacer que disminuya de
forma significativa la cantidad de producto amplificado. No obstante, los cebadores
tampoco deben ser demasiado cortos, salvo que la aplicacin lo exija
especficamente. Como se comenta ms abajo, el objetivo debe ser disear un
cebador con una temperatura de anillamiento de al menos 50 C.
La relacin entre temperatura de hibridacin y temperatura de fusin es una de las
cajas negras de la PCR. Una regla emprica general es utilizar una temperatura de
hibridacin inferior en 5 C a la temperatura de fusin. Con frecuencia es posible que
la temperatura de hibridacin determinada de esta forma no sea ptima y haya que
efectuar experimentos de tanteo para determinar la verdadera temperatura ptima.
La manera ms fcil de hacerlo es con un termociclador de gradiente.

Temperatura de fusin (Tf)

Es importante no olvidar que son dos los cebadores que se aaden a una PCR en
relacin con un sitio o diana. Los dos cebadores oligonucleotdicos deben disearse
de forma que tengan temperaturas de fusin similares. Si los cebadores no se
ajustan bien en cuanto a su Tf, la amplificacin ser menos eficaz o incluso podr no
darse en absoluto, ya que el cebador con la Tf ms elevada funcionar mal a
temperaturas ms bajas y es posible que el cebador con la Tf ms baja no trabaje a
temperaturas ms elevadas. La forma ms precisa de calcular las temperaturas de
fusin de los oligonucletidos es utilizar clculos termodinmicos del vecino ms
prximo con la frmula:
Tfcebador = H [S+ R ln (c/4)] -273,15C + 16,6 log 10 [K+]

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

(2)

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

20

donde H es la entalpa y S es la entropa de la formacin de la hlice, R es la


constante molar de los gases y c es la concentracin de los cebadores.
La forma ms fcil de hacerlo es con paquetes de programas informticos de
diseos

de

cebadores

Afortunadamente,

con

que
la

existen

frmula

en

el

siguiente

mercado
puede

(Sharrocks,

calcularse

1994).

una

buena

aproximacin de trabajo de este valor (vlido generalmente para oligonucletidos de


entre 18 y 24 bases):
Tf = 2(A+T) + 4(G+C)

(3)

donde A, T, G y C son las bases pricas y pirimidnicas.


El cuadro 2 muestra los valores correspondientes a cebadores de diversas
longitudes que se han calculado mediante esta ecuacin (denominada frmula de
Wallace) y suponiendo un contenido de GC del 50 % (Suggs et al., 1981).
Cuadro 2. Clculo de la longitud de los cebadores con la ecuacin de Wallace.

Longitud del
cebador

Tf = 2(A+T) + 4(G+C)

Longitud del
cebador

Tf = 2(A+T) + 4(G+C)

12C

22

66C

18C

24

72C

24C

26

78C

10

30C

28

84C

12

36C

30

90C

14

42C

32

96C

16

48C

34

102C

18

54C

36

108C

20

66C

38

114C

Las temperaturas calculadas segn la frmula de Wallace son imprecisas en los


extremos de este cuadro. Al calcular las temperaturas de fusin de los cebadores,
ha de velarse por que la temperatura de fusin del producto sea suficientemente
baja como para obtener el 100 % de fusin a 92 C. Este parmetro ayuda a

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

21

conseguir una PCR ms eficaz, aunque no siempre es necesario para que la PCR
tenga xito. En general, los productos que tienen entre 100 y 600 pares de bases se
amplifican de forma eficaz en muchas PCR. En caso de duda, la Tf del producto
puede calcularse con la frmula siguiente:
Tf =81,5 + 16,6 (log10 [K+] + 0,41 (% G+C)-675/longitud

(4)

Especificidad

Como ya se ha indicado, la especificidad del cebador depende al menos


parcialmente de su longitud. Es evidente que hay muchos ms oligonucletidos
distintos con 24 bases que con 15. Dicho esto, los cebadores han de elegirse de
forma que tengan una secuencia nica dentro del ADN molde que debe amplificarse.
Un cebador diseado con una secuencia muy repetitiva dar como resultado un
borrn al amplificar ADN genmico. Sin embargo, el mismo cebador puede dar una
sola banda si se amplifica un solo clon de una genoteca. Como la ADN polimerasa
Taq es activa en una amplia banda de temperaturas, la extensin del cebador se
producir a las temperaturas inferiores de hibridacin. Si la temperatura es
demasiado baja, podr darse un cebado inespecfico, que podr ser extendido por la
polimerasa si hay una corta homologa en el extremo 3. En general, los mejores
resultados se obtienen con una temperatura de fusin de 55 a 72 C (lo que
corresponde a una longitud del cebador de entre 18 y 24 bases, segn la regla de
Wallace).

Secuencias complementarias del cebador

Es absolutamente necesario que el diseo de los cebadores no incluya ninguna


homologa interna del cebador de ms de 3 pares de bases. Si un cebador tiene
alguna de estas zonas de auto-homologa, pueden formarse estructuras con
cambios bruscos u horquillas, parcialmente bicatenarias, capaces de interferir con la
hibridacin al ADN molde. Otro peligro relacionado es la homologa entre cebadores.
Una homologa parcial en las regiones centrales de dos cebadores puede interferir
con la hibridacin. Si la homologa se produce en el extremo 3 de cualquiera de los
cebadores, pueden formarse dmeros de cebadores, que en general impiden la
formacin del producto deseado por un mecanismo de competencia.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

22

Contenido de G/C y tramos de polipirimidina (T, C) o polipurina (A, G)

La composicin de bases de los cebadores debe ser de entre un 45 y un 55 % de


GC. La secuencia del cebador debe elegirse de forma que no haya tramos de poli-G
ni poli-C que puedan favorecer la hibridacin inespecfica. Tambin deben evitarse
los tramos de poli-A y poli-T, ya que pueden respirar y abrir tramos del complejo
cebador-ADN molde, lo que puede reducir la eficacia de la amplificacin. Tambin
deben evitarse los tramos de polipirimidina (T, C) y polipurina (A, G). Lo ideal es que
el cebador tenga una mezcla casi aleatoria de nucletidos, un contenido de GC del
50 % y una longitud aproximada de 20 bases. De esta manera, la Tf estar en la
banda de 56 62 C (Dieffenbach et al., 1995).

Secuencia del extremo 3

Se ha visto claramente que la posicin terminal 3' de los cebadores de la PCR es


fundamental para evitar errores de cebado. Ya se ha explorado el problema de las
homologas de cebadores en estas regiones. Otra variable importante es la inclusin
de un residuo de G o C en el extremo 3 de los cebadores. Este cepo de GC
contribuye a que sea correcta la unin en el extremo 3, debido a la mayor fortaleza
del puente de hidrgeno de los residuos de G/C. Esto tambin ayuda a mejorar la
eficacia de la reaccin por minimizar las eventuales aberturas que pudiera haber.

PCR especializada
Adems de la amplificacin de una secuencia diana de ADN por los procedimientos
normales de PCR que se han descrito, se han desarrollado varios tipos
especializados de PCR para aplicaciones especficas.

PCR anidada

Pueden utilizarse conjuntos anidados de cebadores para mejorar el rendimiento de


la PCR de la secuencia diana de ADN (Newton y Graham, 1994). La PCR con

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

23

cebadores anidados se efecta haciendo entre 15 y 30 ciclos con un primer conjunto


de cebadores y despus otros 15 a 30 ciclos con un segundo conjunto de cebadores
respecto a una regin interna del producto de ADN amplificado en primer lugar. As
pues, el fragmento ms largo producido en la primera ronda de PCR se utiliza como
ADN molde para la segunda PCR. El mtodo de PCR anidada puede aumentar
espectacularmente la sensibilidad y la especificidad de la amplificacin del ADN.
Mejora particularmente la especificidad porque esta tcnica elimina casi siempre los
eventuales productos de amplificacin inespecficos que perturban el proceso. Esto
se debe a que tras la primera ronda de PCR es poco probable que los eventuales
productos inespecficos sean suficientemente complementarios de los cebadores
anidados y puedan servir de ADN molde para la amplificacin posterior, y as lo que
se amplifica preferentemente es la secuencia diana. No obstante, un inconveniente
de esta extrema sensibilidad es el mayor riesgo de contaminacin, y deben
extremarse las precauciones cuando se realiza esta PCR, sobre todo en un
laboratorio de diagnstico.

PCR Mltiplex

Mientras que la PCR normal utiliza en general un solo par de cebadores para
amplificar una secuencia especfica, la PCR Mltiplex utiliza mltiples pares de
cebadores para amplificar muchas secuencias simultneamente. La presencia de
muchos cebadores de PCR en un solo tubo puede causar muchos problemas, como
el aumento de la formacin de productos de PCR con errores de cebado, dmeros de
cebadores y la discriminacin de la amplificacin de fragmentos ms largos de ADN
(Atlas y Bey, 1994).
Para este tipo de amplificacin por PCR, se eligen cebadores con temperaturas de
hibridacin similares. Las longitudes de los productos amplificados deben ser
similares; si hay grandes diferencias entre las longitudes de los ADN diana se
favorece la amplificacin de la diana ms corta respecto a la ms larga, lo que
implica diferencias en el rendimiento de los productos amplificados. Por otra parte,
los tampones de PCR Mltiplex contienen un aditivo de la polimerasa Taq, que
reduce la competencia entre amplicones y la discriminacin de fragmentos ms
largos de ADN durante la PCR Mltiplex.
Los productos de la PCR Mltiplex pueden seguir hibridndose con una sonda
especfica del gen con fines de verificacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

24

La PCR en la prctica
Como ya se ha visto en secciones anteriores, la utilizacin de la PCR est muy
difundida porque se trata de una tcnica potente de anlisis y preparacin. No
obstante, dada la naturaleza de este procedimiento, es posible que cantidades traza
de ADN contaminante sirvan de ADN molde, lo que provocara la amplificacin de un
cido nucleico distinto del diana (falsos positivos). As pues, resulta fundamental
realizar la amplificacin por PCR en un entorno libre de ADN. El riesgo de
contaminacin se reduce si se dispone de zonas de trabajo fsicamente separadas y
dotadas de su propio material. El requisito previo ms importante para reducir al
mnimo la tasa de falsos resultados positivos es el cumplimiento estricto de las
normas de descontaminacin (descontaminacin de cidos nucleicos, prevencin de
la formacin de aerosoles, etc.). La contaminacin de la PCR puede deberse a
fuentes diversas, como las siguientes:

mesas de laboratorio, equipos y pipetas, que pueden estar contaminados con


preparados anteriores de ADN, o con fragmentos de restriccin purificados;

contaminacin cruzada entre muestras;

productos de amplificaciones anteriores por PCR.

Esta seccin recoge algunas recomendaciones, con el fin de definir los requisitos
normales para el establecimiento y mantenimiento de un entorno limpio para
cualquier sistema de ensayo con PCR, independientemente del nmero de muestras
tratadas (Roth et al., 1997).

Mtodos fsicos de prevencin

Instalaciones de los laboratorios. Para evitar la contaminacin, debe disponerse


de zonas de trabajo separadas fsicamente de la forma siguiente:
1. Zona de preparacin de muestras
Esta sala consiste de una zona en que se efectan todas las fases previas a la
amplificacin del ADN molde (p. ej., aislamiento y purificacin del ADN).
2. Sala de disposicin de la PCR
Esta sala limpia se dedica a los procesos de preparacin de la PCR en s (p.
ej., mezcla maestra, diluciones de cebadores, etc.).
3. Zona post-PCR
Esta zona se reserva a la amplificacin de la secuencia del ADN diana, y a la
deteccin y anlisis de los productos de la PCR.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

25

Por otra parte, han de seguirse las normas generales siguientes:

Todas las salas deben contener su propio material (batas, guantes, reactivos y
suministros).

Los reactivos y dems material deben etiquetarse con el nombre del contenido y
la fecha de preparacin.

Ha de utilizarse un sistema de flujo unidireccional, es decir, nunca se han de


trasladar materiales, muestras ni equipos de las zonas post-PCR a lugares prePCR.

Deben utilizarse tubos de reaccin para PCR desechables, libres de


desoxirribonucleasa y de ribonucleasa.

Han de utilizarse puntas de pipeta especiales, que impidan la formacin de


aerosoles, y los juegos de pipetas sern exclusivos (se utilizarn solo para la
PCR) y, de preferencia, del tipo de desplazamiento positivo.

Siempre que sea posible, preprese la PCR en una campana extractora dotada
de luz UV. En la campana extractora hay de poner una microcentrifuga y guantes
desechables que se utilizarn exclusivamente para la PCR.

Las mesas y estantes se lavarn peridicamente con leja al 10 %, seguida de


etanol al 70 %.

Manipulacin de las muestras

Utilcense tcnicas estriles y llvense puestos guantes recientes siempre que se


trabaje en las zonas antes descritas. Hay que cambiarse de guantes con
frecuencia, sobre todo si se sospecha que se han contaminado con soluciones
que contengan ADN molde.

Para preparar los reactivos de la PCR y el ADN molde han de utilizarse siempre
materiales de vidrio, de plstico y pipetas nuevos o esterilizados.

Pasar por autoclave todos los reactivos y soluciones que puedan sufrir este
tratamiento sin que se vean afectadas sus propiedades. Por supuesto, no deben
pasar por autoclave los cebadores, los dNTP ni la ADN Taq polimerasa.

Debe disponerse de un conjunto propio de reactivos y soluciones de PCR que


solo se utilizarn con este fin, y dichos reactivos se almacenarn en pequeas
cantidades.

Cuando se pipetea el ADN, ha de evitarse la formacin de aerosoles que puedan


transportar contaminantes.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

26

Siempre han de efectuarse reacciones de control, como por ejemplo un control


negativo (sin ADN), que contenga todos los componentes de la reaccin
excepto el ADN molde, y un control positivo que se haya utilizado con xito en
PCR anteriores.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

27

Mtodos bioqumicos de prevencin

Uracil-ADN glucosilasa. La reaccin en cadena de la polimerasa (PCR) puede


amplificar una sola molcula ms de mil millones de veces. As, es posible amplificar
una cantidad incluso minscula de un contaminante, lo que dara lugar a un falso
positivo. Tales contaminantes suelen ser productos de anteriores amplificaciones por
PCR (contaminacin por arrastre). Por tanto, se han elaborado mtodos para evitar
esta contaminacin.
Una estrategia frecuente es sustituir el dTTP por dUTP durante la amplificacin por
la PCR, para formar ADN que contenga uracilo (U-ADN) (Longo et al., 1990). El UADN contaminante de la muestra se eliminar tratando las mezclas de PCR
posteriores con uracil-ADN glucosilasa (UNG) antes de la amplificacin por PCR y
descomponiendo despus los polinucletidos pirimidnicos a temperatura elevada
(95 C) en condiciones alcalinas (durante la fase de desnaturalizacin inicial) (vase
la figura 8).

UracilADN

Glucosilasa

Calor

pH alcalino

A=Adenina
U=Uracilo
G=Guanina

Figura 8. Reaccin de la uracil-ADN glucosilasa.


Por supuesto, este mtodo exige que todas las PCR del laboratorio se realicen con
dUTP en lugar de con dTTP.
Ha de tenerse en cuenta lo siguiente cuando se utilicen productos de PCR que
contengan dU en aplicaciones posteriores:

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

28

los productos de PCR que contienen dU funcionan tan bien como los que
contienen dT cuando se utilizan como dianas de hibridacin o como ADN moldes
para la tcnica del didesoxi;

los productos de PCR que contienen dU pueden clonarse directamente si se


transforman en hospedadores bacterianos UNG-;

un sustrato que contenga dU es digerido fcilmente por ciertas enzimas de


restriccin comunes (p. ej., EcoR I y BamH I), mientras que otras (p. ej., Hpa I,
Hind II, Hind III) presentan una actividad reducida sobre estos sustratos;

no se recomienda utilizar ADN con dU en estudios sobre la unin a protenas ni


sobre la interaccin del ADN con protenas.

Desoxirribonucleasa I, exonucleasa III. Otros mtodos bioqumicos se basan en el


tratamiento del ADN contaminado con desoxirribonucleasa I, exonucleasa III o con
una enzima de restriccin que contenga una secuencia de reconocimiento dentro del
ADN diana. Sin embargo, dadas las condiciones desfavorables en que debe
efectuarse la reaccin, estas enzimas presentan el inconveniente de reducir la
eficacia de la amplificacin por PCR.

Preparacin de la mezcla para la PCR (mezcla maestra)

Los reactivos fundamentales para la PCR son agua, el tampn de reaccin, una
ADN polimerasa termoestable, cebadores oligonucleotdicos, desoxinucletidos
(dNTP) y ADN molde (diana), as como iones de magnesio (Mg2+). En general, todos
los reactivos (excepto el ADN molde) se mezclan en un solo tubo, con un volumen
suficiente segn el nmero de reacciones que se vaya a realizar (mezcla maestra).
La mezcla maestra se reparte a continuacin en alcuotas en varios tubos y se
aade el ADN molde. El uso de una solucin maestra reduce el riesgo de
contaminacin y mejora el rendimiento de la PCR por los motivos siguientes:

se garantiza una calidad uniforme de la solucin respecto a todos los reactivos


para una serie de anlisis;

disminuye el riesgo de contaminacin de la solucin original y de las resultantes;

pueden pipetearse volmenes mayores;

hay menos etapas de pipeteado, con lo que se ahorra tiempo.

El xito en la amplificacin de la regin de inters depende de la cantidad y de la


calidad del ADN molde. La cantidad de ADN molde necesaria es funcin de la
complejidad de la muestra de ADN. Teniendo en cuenta que el tamao del genoma

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

29

nuclear vara segn los organismos, la concentracin de ADN debe mantenerse


constante (generalmente 10 ng/l). El cuadro 3 muestra una comparacin del
tamao del genoma de varias especies vegetales utilizadas con frecuencia en la
transformacin vegetal, as como el nmero correspondiente de ejemplares de
genoma en una cantidad definida de ADN.
Cuadro 3. Comparacin del tamao del genoma de varias especies vegetales y
nmero correspondiente de ejemplares de genoma en una cantidad definida de
ADN.
Muestra

Tamao del

Ejemplares de genoma en

Ejemplares de genoma

genoma

1 g ADN

en
1 ng ADN

Maz

5 x 109 pb

1,85 x 105

185

Soja

1,55 x 109 pb

5,98 x 105

598

Tabaco

3,8 x 109 pb

2,43 x 105

245

Arroz

4 x 10 pb

2,31 x 10

2310

Por ejemplo, en un plsmido de 4 kb con un inserto de 1 kb, la diana de inters es el


25 % del ADN aportado. A la inversa, un gen de 1 kb en el genoma del maz (5 x 109
pb) representa

alrededor

del

0,00002 %

del

ADN

aportado.

Hace

falta

aproximadamente un milln de veces ms ADN del genoma del maz para mantener
el mismo nmero de ejemplares de la diana por reaccin. Para optimizar los
resultados, deben utilizarse > 104 ejemplares de la secuencia diana como ADN
molde inicial para obtener una seal al cabo de 25 o 30 ciclos. Aunque en la prctica
es posible amplificar menos de 10 ejemplares de una secuencia diana, en este caso
podra ser necesario un nmero mayor de ciclos de PCR para detectar una seal por
electroforesis en gel. Los protocolos generales aplicados habitualmente consideran
un nmero de ciclos entre 30 y 40. Debe vigilarse un aumento del nmero de ciclos,
ya que entonces podra incrementarse la amplificacin inespecfica.

Controles

Como se sealaba en la seccin anterior, se encuentran fuentes posibles de


contaminacin por todo el laboratorio. Tanto las muestras como el personal de
laboratorio, el sistema de aire acondicionado, el equipo y los reactivos pueden ser

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

30

fuente de contaminacin. Entre los agentes contaminantes pueden citarse los


siguientes:
1. contaminacin por arrastre de ADN diana amplificado en PCR anteriores;
2. contaminacin cruzada entre muestras, lo que supone la transferencia de ADN
diana de una muestra a otra;
3. ADN genmico de preparados de muestras anteriores;
4. degradacin de productos por reacciones de descontaminacin.
Mientras que las tres primeras formas de contaminacin producen falsos positivos, el
ltimo tipo produce falsos negativos. Esta forma de contaminacin, observada en
primer lugar por Niederhauser y colaboradores en 1994, provoca la inhibicin de las
PCR (Niederhauser et al., 1994). De hecho, la descontaminacin con el mtodo
UNG favorece la formacin de complejos con los cebadores.
Para obtener resultados fiables, con las PCR siempre hay que utilizar controles tanto
positivos como negativos. El cuadro 4 indica algunos de los controles ms utilizados
para garantizar el resultado de los procedimientos de amplificacin de cido
nucleico.
Cuadro 4. Controles que deben introducirse en los ensayos con PCR.
Control

Mtodo

Contaminacin de los reactivos con


el ADN diana

Control negativo de la PCR sin ADN molde


(solo mezcla maestra)

Especificidad de la reaccin

Controles para detectar productos


secundarios e inespecficos

Desarrollo y sensibilidad de la
reaccin

Controles positivos y negativos para verificar


que se cumplen las condiciones y
rendimientos buscados

Integridad de la mezcla de PCR

PCR con control positivo de ADN

Controles positivos

Hay que comprobar mediante controles positivos la eficacia de la extraccin y


amplificacin del ADN. Lo ideal es dar lmites de deteccin en equivalentes
genmicos, lo que permitira la produccin de controles de sensibilidad definidos,
con pequeos nmeros de ejemplares. Como norma, debe disponerse de un

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

31

preparado de referencia que contenga una concentracin conocida del ADN diana
estudiado.

Controles negativos

Puede darse contaminacin (arrastre de productos amplificados o cidos nucleicos)


durante el aislamiento y la purificacin del ADN diana, as como durante la
preparacin de la mezcla de reaccin para la amplificacin. Por tanto, es necesario
introducir un control negativo con la mezcla de reaccin para la amplificacin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

32

Bibliografa
Alberts, B., Bray, D., Lewis, J., Raff, M., Roberts, K. and Watson, J.D. (1983).
Molecular biology of the cell. Garland Publishing, Inc., New York.
Atlas, R.M. and Bej, A.K. (1994). Polymerase Chain Reaction. In: Gerhardt, P.,
Murrey, R.G.E., Wood, W.A. and Krieg, N.R., (Eds.) Methods for general and
molecular bacteriology. Washington, D.C.: American Society for Microbiology, pp.
418435.
Dieffenbach, C.W., Lowe, T.M.J. and Dveksler, G.S. (1995). General Concepts for
PCR Primer Design. In: Dieffenbach, C.W, and Dveksler, G.S. (Eds.) PCR
Primer: a Laboratory Manual. New York: Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY, USA, pp. 133155.
Innis, M.A. and Gelfand, D.H. (1990). Optimization of PCRs. In: Innis, M.A., Gelfand,
D.H., Sninsky, J.J., and White, T.J. (Eds.) PCR Protocols: a Guide to Methods
and Applications. New York: Academic Press, pp. 312.
Innis, M.A., and Gelfand, D.H. (1994). Optimization of PCRs. In: Innis, M.A., Gelfand,
D.H., Sninsky, J.J., and White, T.J. (Eds.) PCR Protocols: a Guide to Methods
and Applications. London: CRC Press, pp. 511.
Innis, M.A., Myambo, K.B., Gelfand, D.H. and Brow, M.A. (1988). DNA sequencing
with Thermus aquaticus DNA polymerase and direct sequencing of polymerase
chain reaction-amplified DNA. Proceedings of the National Academy of Science
USA 85, 9436-9440.
Longo, M.C., Berninger, M.S. and Hartley, J.L. (1990). Use of uracil DNA glycosylase
to control carry-over contamination in polymerase chain reaction. Gene 93, 125
128.
Newton, C.R. and Graham, A. (1994). PCR. BIOS Scientific Publishers, Limited,
Oxford.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

33

Niederhauser, C., Hfelein, C., Wegmller, B., Lthy, J. and Candrian, U. (1994).
Reliability of PCR Decontamination Systems. PCR Methods and Applications 4,
117123.
Ogawa, T. and Okazaki, T. (1980). Discontinuous DNA replication. Annual Review of
Biochemistry 49, 421457.
Roux, K.H. (1995). Optimization and troubleshooting in PCR. PCR Methods and
Applications 4, 185-194.
Rolfs, A., Schuller, I., Finckh, U. and Weber-Rolfs, I. (1992). Substances affecting
PCR: Inhibition and enhancement, 51-58. In: PCR: Clinical diagnostics and
research, Springer.
Roth, A., Mauch, H. and Gbel, U. (1997). Nucleic Acid Amplification Techniques
Recommendations for Employing Molecular Methods in Diagnostic Routine
Microbiology Laboratories and Measures for Internal Quality Assurance. Gustav
Fischer Verlag, Stuttgart.
Saiki, R.K., Scharf, S.J., Faloona, F., Mullis, K.B., Horn, G.T., Erlich, H.A. and
Arnheim, N. (1985). Enzymatic amplification of -globin genomic sequences and
restriction site analysis for diagnosis of sickle cell anemia. Science 230, 1350.
Saiki, R.K. et al. (1988). Primer-directed enzymatic amplification of DNA with a
thermostable DNA polymerase. Science 239, 487.
Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989). In vitro Amplification of DNA by
the Polymerase Chain Reaction. In: Sambrook, J., Fritsch, E.F. and Maniatis, T.
(Eds.) Molecular Cloning: a Laboratory Manual. New York: Cold Spring Harbor
Laboratory Press, Cold Spring Harbor, NY, USA, chapter 14.
Sharrocks, A.D. (1994). The design of primers for PCR. In: Griffin, H.G. and Griffin,
A.M (Eds.) PCR Technology: Current Innovations. London: CRC Press, pp. 511.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Reaccin en Cadena de la Polimerasa (PCR)

34

Suggs, S.V., Hirose, T., Miyake, E.H., Kawashima, M.J., Johnson, K.I., and Wallace,
R.B. (1981). Using Purified Genes. In ICN-UCLA Symp. Developmental Biology,
Vol. 23, Brown, D.D. Ed., Academic Press, New York, 1981, 683.

Bibliografa complementaria
Gayer-Herkert, G., (1992). Molekularbiologische Methoden fr den Nachweis von
Mikroorganismen in Mischpopulationen eine Literaturstudie. Bioengineering 5 +
6, 5564.
Horton, H., Moran, L., Ochs, R., Rawn, J. and ScriGMeour, K., (1994). Principes de
Biochimie. De Boeck Wesmael, S.A., Bruxelles.
Knippers, R. (1995). Molekulare Genetik. Georg Thieme Verlag, Stuttgart.
Kwok, S., Kellog, D.E., McKinney, N., Spasic, D., Goda, L., Levenson, C. and
Sninsky, J.J. (1990). Effects of primer-template mismatches on the polymerase
chain reaction: Human Immunodeficiency Virus 1 model studies. Nucleic Acids
Research 18, 9991005.
Larzul, D. (1993). Le PCR: un procd de rplication in vitro. Tec & Doc-Lavoisier,
Paris.
Stryer, L. (1991). Biochemie. Spektrum Akademischer Verlag, GmbH, Heidelberg.
Watson, D.J., Hopkins, N., Roberts, J., Steitz, J. and Weiner, A. (1988). Molecular
Biology of the Gene. The Benjamin/Cummings Publishing Company, Inc., New
York.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 6

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 7
Caractersticas de la Soja Roundup Ready, del Maz
MON810 y del Maz Bt-176
M. Querci y M. Mazzara

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE

WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANIZACIN MUNDIAL DE LA SALUD


OFICINA REGIONAL PARA EUROPA

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

ndice
Sesin n 7
Caractersticas de la Soja Roundup Ready, del Maz MON810 y del
Maz Bt-176

Caractersticas de la soja Roundup Ready

Caractersticas del maz MON810

Caractersticas del maz Bt-176

11

Bibliografa

17

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

Caractersticas de la soja Roundup Ready1


Identificacin sucinta
Denominacin

GTS 40-3-2

Solicitante

Monsanto Canada Inc.

Especie vegetal

Glycine max L. (soja)

Caracteres nuevos

Nueva tolerancia al glifosato, ingrediente


activo del herbicida Roundup

Mtodo de introduccin del

Aceleracin de partculas (biolstica)

nuevo carcter gentico


Utilizacin propuesta

Produccin de soja para la alimentacin


animal (principalmente harina y copos
tostados desgrasados) y el consumo
humano (principalmente aceite, fracciones
de protenas y fibra diettica)

Informacin de base
Monsanto Canada Inc. ha desarrollado la lnea de soja GTS 40-3-2 para permitir la
utilizacin de glifosato como forma alternativa de lucha contra las malas hierbas en
la produccin de soja.
El desarrollo de GTS 40-3-2 se ha basado en la tecnologa de recombinacin de
ADN, mediante la introduccin de una forma tolerante al glifosato del gen de la
enzima 5-enolpiruvilshikimato-3-fosfato sintasa (EPSPS), aislada de la cepa CP4 de
Agrobacterium tumefaciens, en la variedad comercial de soja "A5403" (Asgrow Seed
Company).

Descripcin del nuevo carcter


Tolerancia al glifosato
El ingrediente activo de Roundup, el glifosato, es un herbicida sistmico postemergente utilizado en todo el mundo como agente de lucha contra las malas
hierbas no selectivo. El glifosato acta como inhibidor competitivo de la 5enolpiruvilshikimato-3-fosfato sintasa, enzima esencial de la ruta bioqumica del
shikimato que participa en la produccin de los aminocidos aromticos: fenilalanina,
1

Procedentes de la Agencia Canadiense de Inspeccin Alimentaria, Documento de decisin DD95-05.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

tirosina y triptfano (figura 1). La inhibicin de la EPSPS supone la interrupcin del


crecimiento y la muerte de la planta.
Esta enzima esencial presenta una amplia distribucin entre vegetales, hongos y
microorganismos, pero el gen introducido de tolerancia al glifosato codifica una
versin bacteriana (derivada de la cepa CP4 de Agrobacterium tumefaciens)
sumamente insensible al glifosato y que puede, por tanto, satisfacer las necesidades
metablicas de aminocidos aromticos de la planta.
El gen EPSPS est regulado por un fuerte promotor constitutivo del virus del
mosaico de la coliflor (P- CaMV E35S) y termina con el terminador de la nopalina
sintasa (T-nos) de Agrobacterium tumefaciens (figura 2). Se ha clonado en el
extremo 5 del gen de la tolerancia al glifosato, una secuencia de ADN derivada de
plantas que codifica un pptido de trnsito al cloroplasto (CTP4 de Petunia hibrida).
El pptido seal fusionado al gen EPSPS facilita la importacin de la enzima recin
traducida a los cloroplastos, donde se encuentran la ruta del shikimato y los sitios de
accin del glifosato. Una vez ha tenido lugar la importacin, se retira el pptido de
trnsito y se degrada rpidamente mediante una proteasa especfica.
La EPSP sintasa se encuentra abundantemente en la naturaleza y, en principio, no
es txica ni alergnica. Al someterla a anlisis comparativos con bases de datos de
secuencias de polipptidos txicos o alergnicos, la secuencia de aminocidos de la
enzima no muestra ninguna homologa significativa con ninguna toxina o alrgeno
conocido.
fosfoenolpiruvato

eritrosa-4-fosfato

shikimato-3-fosfato

fosfoenolpiruvato
glifosato (Roundup)
N-(fosfonometil)glicina
5-enolpiruvil-shikimato-3-fosfato

fenilalanina

tirosina

triptfano

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Figura 1
La EPSPS cataliza la reaccin
de
shikimato-3-fosfato
y
fosfoenolpiruvato (PEP) para
formar 5-enolpiruvilshikimato3-fosfato (EPSP) y fosfato. El
EPSP
es
un
producto
intermedio en la sntesis de los
aminocidos
aromticos.
Como consecuencia de la
inhibicin
de
esta
ruta
bioqumica, se altera la
sntesis
de
protenas,
provocando la muerte de la
planta.
La EPSPS es el nico objetivo
fisiolgico del glifosato en las
plantas, y ninguna otra enzima
que utilice PEP es inhibida por
el glifosato.

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

P-E35S

CTP4

CP4 EPSPS

T-nos

Figura 2. Representacin esquemtica del casete del gen de soja Roundup Ready
(modificado a partir de Padgette et al., 1995).

Mtodo de desarrollo
La variedad comercial de soja A5403 (Asgrow Seed Co.) se ha transformado
mediante un bombardeo de partculas de oro, con el vector plasmdico PV-GGMT04
recolectado de Escherichia coli (vase la figura 3). El plsmido PV-GGMT04
contena el gen CP4 EPSPS que codifica la tolerancia al glifosato, el gen gus de
produccin de -glucuronidasa como marcador gentico y el gen nptII de resistencia
a antibiticos (kanamicina). El transformante original seleccionado mostr dos sitios
de integracin, uno con el marcador gentico gus y otro con el gen de tolerancia al
glifosato. Esos dos sitios se segregaron posteriormente de forma independiente en la
generacin sexual siguiente, y se observ mediante anlisis que la lnea GTS 40-3-2
contena un nico sitio de insercin en el que solo estaba integrado el gen de
tolerancia al glifosato.

Figura 3. Mapa plasmdico que incluye los elementos genticos del vector PV-GGMT04
utilizado en la transformacin 40-3-2 de la soja RR, (procedente de Monsanto, 2000)

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

Estabilidad de la insercin de los caracteres introducidos


Los datos originales (Padgette et al., 1995, 1996) indicaron que GTS 40-3-2 contena
un nico casete gnico CP4 EPSPS funcional, consistente en el promotor E35S del
virus del mosaico de la coliflor (CaMV), un pptido de trnsito del cloroplasto, la
secuencia de codificacin CP4 EPSPS y la secuencia de poliadenilacin nos.
No se observaron incorporaciones de ninguna regin de codificacin desde fuera del
gen de fusin del vector plasmdico original. En las generaciones posteriores no se
observ ms segregacin del gen de fusin descrito ms arriba, lo que revelaba que
la lnea GTS 40-3-2 era homocigtica para el gen de fusin. Los anlisis del ADN
realizados en seis generaciones mostraron que la insercin era estable.
En estudios de caracterizacin ms recientes se ha comprobado que, durante la
integracin del ADN insertado, se haban producido varias modificaciones y que,
adems del inserto primario funcional, el producto 40-3-2 de la soja Roundup Ready
contiene dos pequeos segmentos no funcionales de ADN insertado de 250 pb y 72
pb, respectivamente (Monsanto, 2000; Windels et al., 2001)

Decisin de reglamentacin
La soja Roundup Ready (RR) es actualmente la nica lnea de soja transgnica cuya
comercializacin est aprobada en la UE. Tras su autorizacin en los EE. UU. en
1994, la Decisin 96/281/CE de la Comisin, de 3 de abril de 1996, permiti su
importacin a la Unin Europea. La citada Decisin autoriza la importacin de
semillas a la UE nicamente para su transformacin industrial en productos
inviables, incluidos piensos, productos alimenticios y otros productos en los que se
utilicen fracciones de soja.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

Caractersticas del maz MON8102


Identificacin sucinta
Denominacin

Maz

producto

de

la

transformacin

MON810 (nombre comercial YieldGard)


Solicitante

Monsanto Canada Inc.

Especie vegetal

Zea mays L. (maz)

Caracteres nuevos

Resistencia al piral del maz (Ostrinia


nubilalis)

Mtodo de introduccin del

Aceleracin de partculas (biolstica)

nuevo carcter gentico


Utilizacin propuesta

Produccin de Z. mays para el consumo


humano (productos de molienda hmeda
o seca o aceite de semillas) y harina y
ensilado para alimentacin del ganado.

Informacin de base
El maz producto de la transformacin MON810 (YieldGard) ha sido desarrollado por
Monsanto Canada Inc. especficamente para ser resistente al piral del maz (Ostrinia
nubilalis) y proporcionar un mtodo de lucha contra las prdidas de las cosechas
ocasionadas por la alimentacin del piral de maz en su fase de larva, sin utilizar los
plaguicidas convencionales.
La lnea MON810 se ha desarrollado utilizando la tecnologa de recombinacin del
ADN y el bombardeo con microproyectiles de clulas vegetales para introducir un
gen que codifique la produccin de una protena insecticida presente en la
naturaleza (derivada de Bacillus thuringiensis ssp. kurstaki). Esta protena es activa
contra determinadas especies de Lepidoptera, el orden de insectos al que
pertenecen las mariposas y polillas, incluido el piral del maz. Ms concretamente, la
protena expresada en la lnea MON810 es una forma truncada de una protena
insecticida, la -endotoxina CRYIA(b), y protege a las plantas de maz de los daos
causados por las larvas del piral del maz en las hojas y tallos.

Procedentes de la Agencia Canadiense de Inspeccin Alimentaria, Documento de decisin 97-19.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

Descripcin del nuevo carcter


Resistencia al piral del maz
Bacillus thuringiensis ssp. kurstaki es una bacteria que forma endosporas, grampositiva y presente en el suelo. En su fase esporognica, adems de la endospora,
produce varios cristales de protena insecticida, incluida la -endotoxina CRYIA(b),
activa contra determinados insectos lepidpteros como el piral del maz, la trtrix de
las yemas de la picea, el gusano telaraoso, la palomilla gitana, la palomilla de dorso
de diamante, la lagarta del girasol, el gusano de la yema del tabaco y la oruga de la
col. Se ha demostrado en numerosas ocasiones que la protena no es txica para los
seres humanos, para otros animales vertebrados ni para los insectos beneficiosos
(Lee et al., 1995). La lnea MON810 fue transformada con una copia del gen cryIA(b)
bajo el control del potente promotor constitutivo reforzado CaMV 35S y la secuencia
principal del intrn de HSP70 del maz (figura 4).
La secuencia de codificacin cryIA(b) de Bacillus thuringiensis ssp. kurstaki HD-1 fue
modificada para optimizar y maximizar la expresin de la -endotoxina CRYIA(b) en
las plantas. La protena resulta txica para las larvas de lepidpteros tras romperse
para dar un ncleo bioactivo y resistente a la tripsina. Se cree que la actividad
insecticida depende de la unin de los fragmentos activos a receptores especficos
presentes en clulas epiteliales del mesogastrio de insectos sensibles y de la
posterior formacin de poros, lo que altera el equilibrio osmtico y, finalmente, deriva
en lisis celular. Las plagas de lepidpteros especficas del maz, sensibles a la
protena, son el piral del maz y el gusano Helicoverpa zea.
La secuencia de aminocidos de la toxina expresada en el maz modificado result
ser idntica a la producida de forma natural y equivalente a la protena producida
como plaguicida biolgico, ampliamente utilizada por la industria alimentaria
ecolgica.

P-E35S

hsp70

cryIA(b)

T-nos

Figura 4. Representacin esquemtica de la construccin gentica cryIA(b) del


plsmido PV-ZMBK07 utilizado en la transformacin de MON810, que incluye el
promotor reforzado CaMV 35S, el intrn de hsp70 del maz y el gen sinttico de la endotoxina cryIA(b) seguido del terminador nos (modificado de BATS, 2003).
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

Mtodo de desarrollo
La lnea MON810 se obtuvo a partir del genotipo Hi-II de maz mediante
transformacin biolstica con una mezcla de ADN plasmdicos, PV-ZMBK07 y PVZGMT10. El plsmido PV-ZMBK07 contiene el gen cryIA(b) (figura 5) y el plsmido
PV-ZGMT10 contiene los genes CP4 EPSPS y gox. Ambos plsmidos contienen
tambin el gen nptII (para la seleccin bacteriana) bajo el control de un promotor
bacteriano, y un origen de replicacin de un plsmido pUC (ori-pUC) necesario para
la replicacin de los plsmidos en E. coli. Los dos vectores se introdujeron mediante
el

bombardeo

con

microproyectiles

en

clulas

vegetales

cultivadas.

Se

seleccionaron las clulas transformadas con tolerancia al glifosato y a continuacin


se cultivaron en un medio de cultivo tisular para la regeneracin de plantas
(Armstrong et al., 1991).
Los anlisis moleculares proporcionados por los autores indicaron que slo los
elementos de la construccin gentica PV-ZMBK07 se integraron en el genoma de la
lnea MON810 como un inserto nico, consistente en el promotor reforzado CaMV
35S (E35S), la secuencia principal de hsp70 y el gen truncado cryIA(b). La seal de
terminacin en 3' de nos, presente en el plsmido PV-ZMBK07, se perdi mediante
un truncamiento en 3 del casete del gen y, por consiguiente, no se integr en el
genoma hospedador (BATS, 2003).

CryIA(b)

Figura 5. Representacin esquemtica del plsmido PV-ZMBK07 utilizado en la


formacin de la lnea MON810 (procedente de Agbios Database on Essential
Biosafety).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

10

Estabilidad de insercin de los caracteres introducidos


Los datos facilitados por los autores muestran que la segregacin y la estabilidad
corresponden a un nico sitio de insercin del gen cryIA(b) en el genoma de
MON810. La estabilidad de la insercin se demostr mediante mltiples
generaciones de cruces. La lnea de maz se ha cruzado con varios genotipos de
maz diferentes durante 4 generaciones, manteniendo la proteccin contra el piral del
maz. La lnea MON810 deriva de la tercera generacin de retrocruzamiento. La
integracin estable del inserto nico se demostr a travs de las tres generaciones
mediante anlisis de transferencia de Southern.

Decisin de reglamentacin
La Agencia de Proteccin del Medio Ambiente de EE. UU. autoriz en julio de 1996
la plantacin de la lnea de maz MON810 en dicho pas. La comercializacin de esta
lnea de maz en la UE se autoriz mediante la Decisin 98/294/CE de la Comisin,
de 22 de abril de 1998.
La Agencia Canadiense de Inspeccin Alimentaria elabor el Documento de decisin
97-19 para su aprobacin en la alimentacin humana y animal. La lnea MON810
est tambin autorizada en Argentina, Australia, Japn, Sudfrica y Suiza.
Esta lnea de maz se destina al consumo humano (producto de molienda hmeda,
seca o aceite de semillas) y harina y ensilado para alimentacin del ganado.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

11

Caractersticas del maz Bt-1763


Identificacin sucinta
Denominacin

Maz producto de la transformacin 176 Bt

Solicitante

Ciba Seeds de Ciba-Geigy y Mycogen


Corporation

Especie vegetal

Zea mays L. (maz)

Caracteres nuevos

Resistencia al piral del maz (Ostrinia


nubilalis);

tolerancia

al

herbicida

glufosinato de amonio
Mtodo de introduccin del

Aceleracin de partculas (biolstica) en

nuevo carcter gentico

embriones inmaduros

Utilizacin propuesta

Para cultivo como maz en grano hbrido

Informacin de base
Ciba Seeds y Mycogen Corporation han desarrollado una lnea de maz resistente al
piral del maz. Esta lnea de maz, denominada producto Bt-176, ha sido
transformada mediante la tecnologa de recombinacin de ADN y el bombardeo con
microproyectiles de embriones para producir una protena insecticida, derivada de
Bacillus thuringiensis ssp. kurstaki, activa contra determinadas especies de
Lepidoptera, el orden de insectos al que pertenecen las mariposas y polillas, incluido
el piral del maz. Concretamente, esta protena es una forma truncada de la endotoxina CRYIA(b) y protege las plantas de maz contra los daos causados por
las larvas del piral del maz con su alimentacin. Adems, esta lnea de maz fue
cotransformada con un gen que confiere tolerancia al herbicida glufosinato de
amonio, utilizado para seleccionar las plantas transformadas en fases muy
tempranas de desarrollo.

Descripcin de los caracteres nuevos


Resistencia al piral del maz
Bacillus thuringiensis ssp. kurstaki es una bacteria que forma endosporas, grampositiva y presente en el suelo. En su fase esporognica, adems de la endospora,
produce varios cristales de protena insecticida, incluida la -endotoxina CRYIA(b),
3

Procedentes de la Agencia Canadiense de Inspeccin Alimentaria, Documento de decisin DD96-09.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

12

activa contra determinados insectos lepidpteros como el piral del maz, la trtrix de
las yemas de la picea, el gusano telaraoso, la palomilla gitana, la palomilla de dorso
de diamante, la lagarta del girasol, el gusano de la yema del tabaco y la oruga de la
col. Se ha demostrado en numerosas ocasiones que la protena no es txica para los
seres humanos, para otros animales vertebrados ni para los insectos beneficiosos
(Lee et al., 1995).
Se desarroll un gen sinttico cryIA(b), derivado de la cepa HD-1 de Bacillus
thuringiensis ssp. kurstaki, que codifica una forma truncada de la -endotoxina
CRYIA(b), y modificada para aumentar su expresin en el maz. El gen sinttico
tiene aproximadamente una homologa del 65 % en lo que respecta a los nucletidos
con el gen nativo (Koziel et al., 1993). La protena CRYIA(b) truncada contiene la
regin insecticida de la CRYIA(b) nativa. Se cree que la actividad insecticida
depende de la unin del fragmento activo a los receptores especficos presentes en
clulas epiteliales del mesogastrio de insectos sensibles y de la posterior formacin
de poros, lo que altera el equilibrio osmtico y deriva en lisis celular, interrupcin de
la alimentacin y finalmente muerte del insecto.
La lnea Bt-176 se obtuvo por transformacin con dos construccin genticas
sintticos del gen cryIA(b). Un construccin gentica est bajo control transcripcional
del promotor de la fosfoenolpiruvato carboxilasa (P-PEPC) del maz y se expresa en
tejidos verdes. El segundo construccin gentica est bajo el control del promotor de
una protena kinasa dependiente de calcio (P-CDPK) del maz y se expresa
especficamente en el polen. Ambas construcciones genticas se terminan con un
terminador extrado del virus del mosaico de la coliflor (T-CaMV 35S) y tambin
incluye el intrn 9 del gen de la fosfoenolpiruvato carboxilasa (vanse las figuras 6 y
7).
La finalidad de la expresin de la protena CRYIA(b) en los tejidos verdes es hacer la
planta resistente a la primera generacin de larvas del piral del maz, que se
alimenta de las hojas. La expresin en polen se dirige a la segunda generacin de
larvas de piral del maz, ya que stas se alimentan de polen.
La protena CRYIA(b) de las hojas del producto de transformacin Bt-176 se someti
a estudios de digestibilidad in vitro simulando condiciones gstricas de mamfero y
se demostr su degradacin como protena diettica convencional.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

13

T-35S

cryIA(b)

P-CDPK

PEPC Intr # 9
Figura 6. Representacin esquemtica del gen sinttico cryIA(b) bajo el control del
promotor CDPK (de Matsuoka et al., 2000).

PEPC Intr # 9

T-35S

cryIA(b)

P-PEPC

Figura 7. Representacin esquemtica del gen sinttico cryIA(b) bajo el control del
promotor PEPC (de Matsuoka et al., 2000).

Tolerancia al herbicida glufosinato de amonio


El gen de la tolerancia al glufosinato de amonio (gen bar), extrado de la bacteria
comn

del

suelo

Streptomyces

hygroscopicus,

codifica

una

fosfinotricina

acetiltransferasa (PAT) bajo control transcripcional del promotor constitutivo CaMV


35S, activo en todos los tejidos vegetales, excepto en el polen. La fosfinotricina, un
inhibidor de la glutamina sintetasa, es la fraccin activa del glufosinato de amonio. La
actividad herbicida de la fosfinotricina se caracteriza por la inhibicin de la glutamina
sintetasa resultante de la acumulacin de cantidades letales de amoniaco en la
planta. La PAT cataliza la acetilacin de fosfinotricina, de tal modo que elimina su
actividad herbicida.
El L- ismero de la fosfinotricina (L-PPT) es ampliamente utilizado como un agente
de amplio espectro para luchar contra las malas hierbas. El L-PPT es el ingrediente
activo del herbicida glufosinato de amonio desarrollado por Hoechst y denominado
BASTA. Este ismero es un anlogo estructural de glutamato, el sustrato de la

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

14

glutamina sintetasa (vase la comparacin entre el L-PPT y el glutamato en la


figura 8).

CH3

P CH2 CH2 C COOH


OH

HOOC CH2 CH2 C COOH

NH2

NH2

Figura 8. El L-ismero de fosfinotricina (izquierda) comparado con el glutamato


(derecha).
En un principio, el L-PPT fue aislado de Streptomyces viridochromogenes, que
sintetiza slo el L-ismero de la fosfinotricina. El glufosinato de amonio sinttico es
una mezcla equimolar y racmica de los ismeros D- y L- de la PPT (la D-PPT no
exhibe actividad herbicida). Se ha demostrado que la PAT acta especficamente
sobre la fosfinotricina, ya que no se ha observado ninguna otra actividad con otros
sustratos comunes de la acetiltransferasa, como el piruvato, la colina o la serina.
Mediante estudios de digestibilidad in vitro, simulando condiciones gstricas de
mamfero simuladas, llevados a cabo sobre la PAT expresada en E. coli, se vio que
esta protena se digiere como una protena diettica convencional.
El gen de la tolerancia al glufosinato de amonio se introdujo como un marcador
gentico que permita la identificacin de embriones transformados en un medio
selectivo para poder realizar un seguimiento de los genes introducidos durante el
cultivo de las plantas. Como ya se ha notificado (FSANZ, 2000), los datos
moleculares indican que la lnea Bt-176 contiene una sola copia del gen bar, bajo la
regulacin transcripcional del promotor 35S y el terminador 35S extrados del virus
del mosaico de la coliflor (P-CaMV 35S y T-CaMV 35S, respectivamente) (vase la
figura 9).

P-35S

bar T-35S

Figura 9. Representacin esquemtica del gen bar (extrado de Matsuoka et al.,


2000).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

15

Mtodo de desarrollo
La lnea Bt-176 se obtuvo mediante la transformacin biolstica de la lnea
endogmica de maz CG00526 (Zea mays L.) con dos plsmidos. Los dos
construccion geneticas sintticos del gen cryIA(b) se clonaron juntos en un nico
vector plasmdico (pCIB4431). Un segundo vector plasmdico (pCIB3064) contena el
gen de la tolerancia al herbicida (bar), aislado de la bacteria del suelo Streptomyces
hygroscopicus. Los dos vectores se introdujeron en la lnea de maz CG00526
mediante el bombardeo con microproyectiles de embriones inmaduros. Con anlisis
moleculares de la planta transformada se vio que en el genoma de la lnea de maz
estn integradas dos o ms copias de cada construccin gentica plasmdica. Los
resultados de ensayos y anlisis de transferencia de Northern indican que el gen de
la resistencia a la ampicilina (gen bla), regulado por un promotor bacteriano (utilizado
para la seleccin de los vectores en entornos bacterianos) no se expres en tejidos
de hojas ni en polen de la planta. Se seleccionaron dos productos transgnicos
independientes de la transformacin del maz para posteriores cruces y
caracterizaciones: el 171 y el 176 (Koziel et al., 1993).
La presencia en maz Bt-176 de los genes cryIA(b) (Koziel et al.,1993), bar y bla
(Privalle, 1994) se confirm mediante estudios de caracterizacin adicionales. Los
datos comunicados por Food Standards Australia New Zealand (FSANZ, 2000)
tambin indican que puede haber hasta seis copias de los genes cryIA(b) y bla
presentes en Bt-176, y al menos dos del gen bar (junto con el promotor 35S), tal
como determin el anlisis de Southern frente al ADN del maz Bt-176 (Privalle,
1994).

Estabilidad de insercin de los caracteres


Segn la informacin comunicada (FSANZ, 2000), se determin que la produccin
de las protenas CRYIA(b) y PAT en hojas y polen de plantas cultivadas en
invernadero era estable tras cuatro generaciones sucesivas de retrocruzamientos.
Los anlisis de segregacin indicaron que los caracteres de resistencia al piral del
maz y tolerancia al herbicida se segregan como caracteres mendelianos vinculados.
Un estudio realizado con 3 240 plantas indic que solo cinco plantas (el 0,15 %) se
consideraron con tolerancia al glufosinato de amonio pero susceptibles de ser
daadas por larvas de piral del maz.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

16

Decisin de reglamentacin
En agosto de 1995, la Agencia de Proteccin del Medio Ambiente de los Estados
Unidos aprob con reservas la comercializacin de maz de campo derivado del
producto de transformacin 176 hasta el ao 2000.
La comercializacin de esta lnea de maz se autoriz en la UE mediante la Decisin
97/98/CE de la Comisin, de 23 de enero de 1997. Esta lnea de maz se destina al
cultivo, produccin de semillas y produccin de ensilado y grano para la alimentacin
animal y grano para la transformacin industrial (Decisin 97/98/CE de la Comisin).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

17

Bibliografa
Agbios database on Essential Biosafety. Molecular Characterization of MON810
inserted DNA. http://www.agbios.com/main.php (ltimo acceso enero de 2010)
Armstrong, C. L., Green, C. E. y Phillips, R.L. (1991). Development and availability of
germplasm with high type II culture formation response. Maize Genetics
Cooperation NewsLetter 65, 92-93.
BATS (2003). Genetically Modified (GM) Crops: molecular and regulatory details.
http://www.bats.ch/gmo-watch/index.php (ltimo acceso enero de 2010)
Canadian Food Inspection Agency, Plant Products Directorate, Plant Biosafety
Office. Decision Document DD96-09: Determination of Environmental Safety of
Event 176 Bt Corn (Zea mays L.) Developed by Ciba Seeds and Mycogen
Corporation.

http://www.inspection.gc.ca/english/plaveg/bio/dd/dd9609e.shtml

(ltimo acceso enero de 2010)


Canadian Food Inspection Agency, Plant Products Directorate, Plant Biosafety
Office. Decision Document DD95-05: Determination of Environmental Safety of
Monsanto Canada Inc.'s Glyphosate Tolerant Soybean (Glycine max L.) Line GTS
40-3-2. http://www.inspection.gc.ca/english/plaveg/bio/dd/dd9505e.shtml (ltimo
acceso enero de 2010)
Canadian Food Inspection Agency, Plant Products Directorate, Plant Biosafety
Office. Decision Document 97-19: Determination of the Safety of Monsanto
Canada Inc.'s YieldgardTM Insect Resistant Corn (Zea mays L.) Line MON810.
http://www.inspection.gc.ca/english/plaveg/bio/dd/dd9719e.shtml (ltimo acceso
enero de 2010)
Decisin 97/98/CE de la Comisin, de 23 de enero de 1997, relativa a la
comercializacin de maz (Zea mays L.) modificado genticamente con una
alteracin de las propiedades insecticidas conferidas por el gen de la endotoxina
Bt, combinada con una mayor resistencia al herbicida glufosinato de amonio, con
arreglo a la Directiva 90/220/CEE del Consejo. (DO L 31 de 1.2.1997, p. 69).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

18

Decisin 96/281/CE de la Comisin, de 3 de abril de 1996, relativa a la


comercializacin de semillas de soja (Glycine max L.) modificada genticamente
con una mayor resistencia al herbicida glifosato, de conformidad con la Directiva
90/220/CEE del Consejo. (DO L 107 de 30.4.1996, p. 10).
Decisin 98/294/CE de la Comisin, de 22 de abril de 1998, relativa a la
comercializacin de maz (Zea mays L. lnea MON 810) modificado
genticamente con arreglo a la Directiva 90/220/CEE del Consejo. (DO L 131 de
5.5.1998, p. 33).
Food Standards Australia New Zealand FSANZ (formerly Australia New Zealand
Food Authority - ANZFA) (2000). Draft risk analysis report. Food produced from
insect-protected Bt-176 corn. Application 385.
http://www.foodstandards.gov.au/_srcfiles/A385%20FA.pdf (ltimo acceso enero
de 2010)
Koziel, M.G. et al. (1993). Field performance of elite transgenic maize plants
expressing

an

insecticidal

protein

derived

from

Bacillus

thuringiensis.

BIO/Technology 11, 194200.


Lee, T.C., Zeng, J., Bailey, M., Sims, S.R., Sanders, P.R. y Fuchs, R.L. (1995).
Assessment of equivalence of insect protected corn- and E. coli-produced B.t.k.
HD-1 protein. Plant Physiol. Suppl. 108, 151.
Matsuoka, T., Kawashima, Y., Akiyama, H., Miura, H., Goda, Y., Kusakabe, Y.,
Isshiki, K., Toyota, M., y Hino, A. (2000). A method of detecting Recombinant
DNAs from four lines of genetically modified maize. Journal of Food Hygienic
Society of Japan 41, 137-143.
Monsanto Company (2000). Updated Molecular Characterization and Safety
Assessment of Roundup Ready Soybean Event 40-3-2. Monsanto Report,
Product Safety Centre.
Padgette, S.R., Kolacz, K.H., Delannay, X., Re, D.B., LaVallee, B.J., Tinius, C.N.,
Rhodes, W.K., Otero, Y.I., Barry, G.F., Eichholtz, D.A., Peschke, V.M., Nida, D.L.,
Taylor,

N.B.

Kishore,

G.M.

(1995). Development,

identification,

and

characterization of a glyphosate-tolerant soybean line. Crop Science 35, 1451


1461.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Caractersticas de la Soja Roundup Ready, del Maz MON810 y del Maz Bt-176

19

Padgette, S.R., Re, D.B., Barry, G.F., Eicholtz, D.E., Delannay, X., Fuchs, R.L.,
Kishore, G.M., y Fraley, R.T. (1996). New weed control opportunities:
Development of soybeans with a Roundup Ready gene. In Duke, S.O. (ed.)
Herbicide-Resistant Crops. Agricultrual, Economic, Regulatory and Technical
Aspects. CRC Lewis Publishers., pp 53-84.
Privalle, L. (1994). Quantification of Cry1A(b) and PAT proteins in Bt corn (corn)
tissues, whole plants and silage. Performing laboratory: Ciba Seeds Agricultural
Biotechnology Research Unit, Ciba-Geigy Corporation, Research Triangle Park,
NC, USA. Study No CAB-009-94
Windels, P., Taverniers, I., Depicker, A., Van Bockstaele, E. y De Loose, M. (2001).
Characterisation of the Roundup Ready soybean insert. European Food
Research Technology 213, 107-112.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 7

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 8
Caractersticas de los Sistemas Cualitativos de PCR
Descritos en el Manual
M. Querci y M. Mazzara

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

ndice
Sesin n 8
Caractersticas de los Sistemas Cualitativos de PCR Descritos en el
Manual

Caractersticas de los sistemas cualitativos de PCR descritos en el Manual

PCR especfica de plantas

Deteccin del gen de la lectina

Deteccin del gen de la zena

Mtodo de cribado: deteccin del promotor CaMV 35S y del terminador nos

Deteccin del promotor CaMV 35S

Deteccin del terminador nos

PCR especfica de OGM

Deteccin especfica del casete gnico CTP/EPSPS en la soja Roundup Ready

Deteccin del gen cryIA(b) sinttico del maz Bt-176

Deteccin especfica del casete del promotor E35S / exn-intrn de hsp70 del maz
MON810

Bibliografa

11

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

Caractersticas de los sistemas cualitativos de PCR descritos en el


Manual
En este curso se utilizarn diferentes sistemas de deteccin: 1) se emplearn
cebadores especficos de plantas para confirmar la presencia y la calidad (capacidad
de amplificacin) del ADN extrado de las muestras; 2) el denominado mtodo de
cribado, basado en la deteccin especfica de las secuencias reguladoras ms
comunes, el promotor 35S y el terminador nos. Esos dos mtodos se efectuarn con
arreglo a un protocolo de PCR simple. Por ltimo, se utilizarn cebadores
especficos de OGM en PCR anidada para la deteccin selectiva y la identificacin
de las diferentes lneas transgnicas. El presente captulo incluye una introduccin
sucinta de los diferentes sistemas utilizados para la deteccin y caracterizacin de la
soja Roundup Ready, del maz MON810 y del gen cryIA(b) del maz Bt-176. Para
ms informacin sobre las secuencias y la composicin de los cebadores, vase la
Sesin n 9.

PCR especfica de plantas


Deteccin del gen de la lectina
Para la identificacin del ADN de la soja, se utilizarn los cebadores GMO3 y GMO4
(Meyer et al., 1996), que amplifican un fragmento del gen de la lectina (Le1),
especfico de la soja.
Como se ha indicado anteriormente, el objetivo es confirmar la presencia y la calidad
del ADN extrado de las muestras que contienen soja, entendindose aqu por
calidad del ADN su capacidad de amplificacin por la PCR. Los cebadores GMO3 y
GMO4 se utilizan como PCR anidada para la segunda PCR-soja notificada por
Meyer y Jaccaud (1997) sobre el ADN extrado de alimentos transformados.

El

producto previsto es un amplicn de 118 pb.

Deteccin del gen de la zena

Los cebadores ZEIN3 y ZEIN4 (Studer et al., 1997) especficos del gen de la zena
en el caso del maz (Ze1, codificacin de una protena de 10 kb) se utilizarn para
confirmar la presencia y la calidad del ADN extrado de muestras que contienen

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

maz. Por lo que respecta al gen de la lectina, los cebadores ZEIN3 y ZEIN4 se
disearon en principio como cebadores internos (segunda ronda de PCR) en un
sistema de PCR anidada para la deteccin de ADN de maz extrado de alimentos
transformados. Si el ADN diana extrado est presente, intacto y es amplificable, se
prev la amplificacin de una banda de 277 pb.

Mtodo de cribado: deteccin del promotor CaMV 35S y del


terminador nos
La deteccin del promotor 35S y del terminador nos por PCR constituye el
denominado mtodo de cribado para la identificacin de productos alimenticios
derivados de plantas modificadas genticamente. El uso del promotor 35S y del
terminador nos como secuencias diana permite la deteccin de la mayora de los
productos alimenticios modificados genticamente, ya que hasta ahora estn
presentes en casi todos los vegetales modificados genticamente autorizados por la
UE (Hemmer, 1997). Las caractersticas de algunas lneas de maz cuya
comercializacin est autorizada en la UE figuran, a modo de ejemplo, en el
cuadro 1. Los cebadores especficos del promotor 35S y del terminador nos
empleados durante el curso se utilizaron para validar un mtodo de PCR para la
deteccin de la soja Roundup Ready y del maz Maximizer (Bt-176) en fracciones de
alimentos transformados (Lipp et al., 2001).
Cuadro 1. Caractersticas de algunas lneas de maz transgnico cuya
comercializacin est autorizada en la UE.

Lnea Bt 176

CibaGeigy

Bt, bar

PEPC
CDPK

Gen o genes
introducidos
bar
cryIA(b)/int.9 PEPC
cryIA(b)/int.9 PEPC

Lnea Bt-11

Novartis

Bt, pat

35S

cryIA(b)/int. IVS6

nos

Lnea T25

AgrEvo

pat

35S

pat

35S

Lnea MON810

Monsanto

Bt

E35S
E35S

cryIA(b)/int.hsp70
cryIA(b)/int.hsp70

Denominacin

Empresa

Carcter

Promotor

35S

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Terminador
35S
35S
35S

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

Deteccin del promotor CaMV 35S

Este promotor regula la expresin de los genes de numerosas plantas transgnicas,


como la soja Roundup Ready y la lnea de maz Bt-176. Para su deteccin
especfica, se utilizarn los cebadores p35S-cf3 y p35S-cr4 (Lipp et al., 2001). El
amplicn previsto es un fragmento de 123 pb, como se indica en la figura 1 que
viene a continuacin, en el que los cebadores p35S-cf3 y p35S-cr4 se han colocado
en la regin correspondiente de la secuencia del promotor CaMV 35S.

ID
AC
FT
FT
FT

A18053_3; parent: A18053


A18053;
promoter
396..1779
/note="35S3 promoter sequence derived from cauliflower
mosaic virus isolate CabbB-JI

SQ

Sequence 1384 bp;

1140
1200

nnnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnn

nnnnnnnnn

ctgccgacag tggtcccaaa gatggacccc cacccacgag gagcatcgtg gaaaaagaag

acgttccaac cacgtcttca aagcaagtgg attgatgtga catctccact gacgtaaggg


p35S-cf3
atgacgcaca atcccactat ccttcgcaag acccttcctc tatataagga agttcatttc
1320
p35S-cr4
atttggagag gacacgctga aatcaccagt ctctctctat aaatctatct ctctctctat
1380
aacc
1384
//
1260

Figura 1. Secuencia parcial del promotor 35S derivado del virus del mosaico de la
coliflor (CaMV) y sitios de hibridacin de los cebadores p35S-cf3 y p35S-cr4.

Deteccin del terminador nos

Los cebadores HA-nos118-f y HA-nos118-r (Lipp et al., 2001) se utilizan para la


deteccin del terminador nos, que est presente en la soja Roundup Ready y en
otras lneas de plantas transgnicas (p. ej., la lnea de maz Bt-11). La amplificacin
del terminador nos dar lugar a la produccin de un fragmento de ADN de 118 pb.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

En la figura 2, los cebadores HA-nos118-f y HA-nos118-r se han colocado dentro de


la secuencia de la parte transgnica de la soja Roundup Ready.

151

HA-nos118-r >
nnnnnnnnnn nnnnnnnnga tccccgatct agtaacatag atgacaccgc

251

gcgcgataat ttatcctagt ttgcgcgcta tattttgttt tctatcgcgt


< HA-nos118-f
attaaatgta taattgcggg actctaatca taaaaaccca tctcataaat

301

aacgtcatgc attacatgtt aattattaca tgcttaacgt aattcaacag

351

aaattatatg ataatcatcg caagaccggc aacaggattc aatcttaaga

201

/ /
1601

gatccaggtg tcgccttcct tacggatcct ggcgcccatg gcctgcatgg

1651
1701

ccttgcccgt attgatgacg tcctcgcctt ccagaaggcc ggtgatgcgc


GM09 >
gtttcaccgc tcgcgagacc gccgaacatg aaggaccggt gggagatcga

1751

cttgtcgccg ggaatgcgga cggttccgga aaggccagag gatttgcggg

1801

cggttgcggg ccggctgctt gcaccgtgaa gcatgcaggc tgtagccact

1851

gatgctgaaa tcctaaagga acaaaacttt tgcataaaaa ttgaatcttt

1901

tttcaaaacc aacatagaat ttgctgaatt tttcagtttt ttagatccaa


GM08 >
aaacaagaaa acttgaagat ttaggaactt ggggtttatg gaaattggaa

1951
2001

2151

ttgggattaa gggtttgtat cccttgagcc atgttgttaa tttgtgccat


p35S-cr4 >
tcttgaaaga tctgctagag tcagcttgtc agcgtgtcct ctccaaatga
< GM07
aatgaacttc cttatataga ggaagggtct tgcgaaggat agtgggattg
< GM05
< p35S-cf3
tgcgtcatcc cttacgtcag tggagatatc acatcaatcc acttgctttg

2201

aagacgtggt tggaacgtct tctttttcca cgatgctcct cgtgggtggg

2251

ggtccatctt tgggaccact gtcggcagag gcatcttcaa cgatggcctt

2301

tcctttatcg caatgatggc atttgtagga gccaccttcc ttttccacta

2351

tcttcacaat aaagtgacag atagctgggc aatggaatcc gaggaggttt

2401

ccggatatta ccctttgttg aaaagtctca catcg

2051
2101

Figura 2. Secuencia de la parte transgnica de la soja Roundup Ready de Monsanto


con arreglo a la patente WO 92/04449.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

PCR especfica de OGM


Los cebadores de amplificacin utilizados para la identificacin de la soja Roundup
Ready, el maz Bt-176 y el maz MON810 se eligieron por su capacidad para
detectar, de manera especfica, la estructura gentica insertada en los genomas de
la soja Roundup Ready y de los maces Bt-176 y MON810, respectivamente.

Deteccin especfica del casete gnico CTP/EPSPS en la soja Roundup Ready

Las parejas de cebadores GMO9/GMO5 y GMO8/GMO7 se disearon para la


deteccin especfica del transgn de la soja Roundup Ready por PCR anidada
(Meyer y Jaccaud, 1997). Los cebadores externos GMO9 and GMO5 son
complementarios de la secuencia de ADN correspondiente al gen CP4 EPSPS y al
promotor CaMV 35S. La amplificacin del ADN con esos dos cebadores da lugar a
un amplicn de 447 pb. Los cebadores internos, GMO8 y GMO7, son
complementarios del gen epsps de la petunia y del promotor CaMV 35S. La
amplificacin del ADN con esos cebadores internos da lugar a un fragmento de
169 pb, como se indica en la figura 2.

Deteccin del gen cryIA(b) sinttico del maz Bt-176

Las parejas de cebadores CRYIA1/CRYIA2 y CRYIA3/CRYIA4 se concibieron para


la deteccin especfica del gen cryIA(b) sinttico mediante PCR anidada (Studer et
al., 1997). Los cebadores externos, CRYIA1 y CRYIA2, y los internos, CRYIA3 y
CRYIA4, son complementarios de la secuencia de ADN del gen cryIA(b). Como se
indica en la figura 3, los dos cebadores externos (CRYIA1/CRYIA2) delimitan un
fragmento de 420 pb, mientras que el par CRYIA3/CRYIA4 produce un fragmento
de 189 pb.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

ID
I41419
standard; ADN; UNC; 1947 bp.
AC
I41419;

DE
Sequence 3 from patent US 5625136.

RA
Koziel M.G., Desai N.M., Lewis K.S., Kramer V.C., Warren G.W., Evola
S.V.,
RA
Crossland L.D., Wright M.S., Merlin E.J., Launis K.L., Rothstein S.J.,
RA
Bowman C.G., Dawson J.L., Dunder E.M., Pace G.M., Suttie J.L.;
RT
"Synthetic DNA sequence having enhanced insecticidal activity in
maize";
RL
Patent number US5625136-A/3, 29-APR-1997.

FT
source
1..1947
FT
/db_xref="taxon:12908"
FT
/organism="unclassified"
SQ
60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020

Sequence 1947 bp; 412 A; 729 C; 528 G; 278 T; 0 other;


atggacaaca accccaacat caacgagtgc atcccctaca actgcctgag caaccccgag
gtggaggtgc tgggcggcga gcgcatcgag accggctaca cccccatcga catcagcctg
agcctgaccc agttcctgct gagcgagttc gtgcccggcg ccggcttcgt gctgggcctg
gtggacatca tctggggcat cttcggcccc agccagtggg acgccttcct ggtgcagatc
gagcagctga tcaaccagcg catcgaggag ttcgcccgca accaggccat cagccgcctg
gagggcctga gcaacctgta ccaaatctac gccgagagct tccgcgagtg ggaggccgac
cccaccaacc ccgccctgcg cgaggagatg cgcatccagt tcaacgacat gaacagcgcc
ctgaccaccg ccatccccct gttcgccgtg cagaactacc aggtgcccct gctgagcgtg
tacgtgcagg ccgccaacct gcacctgagc gtgctgcgcg acgtcagcgt gttcggccag
cgctggggct tcgacgccgc caccatcaac agccgctaca acgacctgac ccgcctgatc
ggcaactaca ccgaccacgc cgtgcgctgg tacaacaccg gcctggagcg cgtgtggggt
cccgacagcc gcgactggat caggtacaac cagttccgcc gcgagctgac cctgaccgtg
ctggacatcg tgagcctgtt ccccaactac gacagccgca cctaccccat ccgcaccgtg
agccagctga cccgcgagat ttacaccaac cccgtgctgg agaacttcga cggcagcttc
cgcggcagcg cccagggcat cgagggcagc atccgcagcc cccacctgat ggacatcctg
aacagcatca ccatctacac cgacgcccac cgcggcgagt actactggag cggccaccag
atcatggcca gccccgtcgg cttcagcggc cccgagttca ccttccccct gtacggcacc
cebador directo CRYIA1 en la PCR externa
atgggcaacg ctgcacctca gcagcgcatc gtggcacagc tgggccaggg agtgtaccgc

1080

accctgagca gcaccctgta ccgtcgacct ttcaacatcg gcatcaacaa ccagcagctg


1140 cebador directo CRYIA3 en la PCR interna (anidada)
agcgtgctgg acggcaccga gttcgcctac ggcaccagca gcaacctgcc cagcgccgtg
1200

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

taccgcaaga gcggcaccgt ggacagcctg gacgagatcc cccctcagaa caacaacgtg


1260
cebador inverso CRYIA4 en la PCR interna
(anidada)
ccacctcgac agggcttcag ccaccgtctg agccacgtga gcatgttccg cagtggcttc
1320
agcaacagca gcgtgagcat catccgtgca cctatgttca gctggattca ccgcagtgcc
1380
gagttcaaca acatcatccc cagcagccaa atcacccaga tccccctgac caagagcacc
1440 cebador inverso CRYIA2 en la PCR externa
aacctgggca gcggcaccag cgtggtgaag ggccccggct tcaccggcgg cgacatcctg
1500
cgccgcacca gccccggcca gatcagcacc ctgcgcgtga acatcaccgc ccccctgagc
1560
cagcgctacc gcgtccgcat ccgctacgcc agcaccacca acctgcagtt ccacaccagc
1620
atcgacggcc gccccatcaa ccagggcaac ttcagcgcca ccatgagcag cggcagcaac
1680
ctgcagagcg gcagcttccg caccgtgggc ttcaccaccc ccttcaactt cagcaacggc
1740
agcagcgtgt tcaccctgag cgcccacgtg ttcaacagcg gcaacgaggt gtacatcgac
1800
cgcatcgagt tcgtgcccgc cgaggtgacc ttcgaggccg agtacgacct ggagagggct
1860
cagaaggccg tgaacgagct gttcaccagc agcaaccaga tcggcctgaa gaccgacgtg
1920
accgactacc acatcgatca ggtgtag

Figura 3. Gen cryIA(b) optimizado insertado en maz Bt-176: secuencia del gen
cryIA(b) SEQ ID No. 3 con arreglo a la patente estadounidense n 5625136 y a
Genebank Accession n 141419.

Deteccin especfica del casete del promotor E35S / exn-intrn de hsp70 del
maz MON810

Las parejas de cebadores GM1/GM2 y GM3/GM4 fueron diseadas para la


deteccin especfica del casete del promotor E35S / exn-intrn 1 de hsp70
mediante PCR anidada (Zimmermann et al., 1998). Esta construccin gnica es
especfica del maz MON810. Los cebadores externos, GM1 y GM2, se hibridan con
la secuencia del promotor E35S y con la regin del intrn 1 de hsp70,
respectivamente, mientras los cebadores internos son complementarios de la
secuencia de ADN del promotor E35S y de la regin del exn 1 de hsp70,
respectivamente. Como se indica en la figura 4, los dos cebadores externos
(GM1/GM2) producen un fragmento de 401 pb, mientras que el par GM3/GM4
produce un fragmento de 149 pb.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

10

intrn de hsp70
exn 1 de hsp70

Plant P-E35S
DNA

intrn 1 de hsp70

exn 2 de hsp70

401 pb
GM1

149 pb
GM3

GM2
GM4

Figura 4. Representacin esquemtica de parte del casete de maz MON810, que incluye
el promotor reforzado CaMV 35S y el intrn de hsp70 del maz, y la posicin relativa de los
cebadores GM1, GM2, GM3 y GM4 (modificado de Zimmermann et al., 1998).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Caractersticas de los Sistemas Cualitativos de PCR Descritos en el Manual

11

Bibliografa
Hemmer, W. (1997). Foods Derived from Genetically Modified Organisms and
Detection Methods. Biosafety Research and Assessment of Technology Impacts
of the Swiss Priority Program Biotechnology Report 2/97, 61 pages.
http://www.bats.ch/bats/publikationen/1997-2_gmo/index.php

(ltimo acceso

enero de 2010)
Lipp, M., Bluth, A., Eyquem, F., Kruse, L., Schimmel, H., Van den Eede, G. y
Anklam, E. (2001). Validation of a method based on polymerase chain reaction
for the detection of genetically modified organisms in various processed
foodstuffs. European Food Research Technology 212, 497-504.
Meyer, R., Chardonnens, F., Hubner, P. y Luthy, J. (1996). Polymerase chain
reaction (PCR) in the quality and safety assurance of food: detection of soya in
processed meat products. Zeitschrift fr Lebensmittel-Untersuchung und Forschung A 203, 339-344.
Meyer, R. y Jaccaud, E. (1997). Detection of genetically modified soya in processed
food products: development and validation of a PCR assay for the specific
detection of Glyphosate-Tolerant Soybeans. Proceedings of the EURO FOOD
CHEM IX Conference, Interlaken, Switzerland, Event No. 220 1, 2328.
Studer, E., Dahinden, I., Lthy, J. y Hbner, P. (1997). Nachweis des gentechnisch
vernderten Maximizer"-Mais mittels der Polymerase-Kettenreaktion (PCR).
Mitteilungen aus dem Gebiet der Lebensmittel und Hygiene 88, 515524.
Zimmermann, A., Liniger, M., Lthy, J. y Pauli, U. (1998). A sensitive detection
method for genetically modified MaisGardTM corn using a nested-PCR system.
Lebensm.-Wiss. U.-Technol. 31, 664-667.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 8

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 9
Deteccin Cualitativa mediante PCR del Maz
MON810, del Maz Bt-176 y de la Soja Roundup
Ready
M. Querci, M. Maretti, M. Mazzara

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

ndice
Sesin n 9
Deteccin Cualitativa mediante PCR del Maz MON810, del Maz
Bt-176 y de la Soja Roundup Ready

Prctica

Introduccin

PCR especfica de plantas: gen de la lectina de soja

PCR especfica de plantas: gen de la zena de maz

Mtodo de cribado para detectar vegetales genticamente modificados

12

Deteccin del promotor 35S

12

Deteccin del terminador nos

14

Deteccin especfica mediante PCR anidada del maz MON810, del maz Bt-176 y de la
soja Roundup Ready

17

Deteccin del maz MON810

17

Deteccin del maz Bt-176

22

Deteccin de la soja Roundup Ready

26

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Prctica
Introduccin
Los protocolos siguientes son mtodos basados en la PCR que permiten el cribado de OGM
(mediante el promotor 35S y el terminador nos) y la deteccin de OGM especficos (soja
Roundup Ready, maz MON810 y maz Bt-176) en material bruto y transformado por
comparacin con muestras correspondientes no modificadas genticamente (soja y maz).
Los mtodos que siguen slo permiten obtener resultados cualitativos con una indicacin de
la presencia o ausencia de la secuencia diana en la muestra.
Instrumental

Micropipetas

Termociclador

Microcentrfuga

Mezclador de torbellino

Soporte para tubos de reaccin

Tubos de reaccin para PCR de 0,2 ml

Tubos para microcentrfuga de 1,5 ml

Sala estril aparte con campana ultravioleta

OBSERVACIONES
Todo el instrumental debe estar libre de ADN y, cuando sea posible, esterilizarse antes de
su uso.
Para evitar la contaminacin, deben usarse puntas de pipeta con barrera, protegidas contra
la formacin de aerosoles.
Reactivos

dATP

CAS1923-31-7

dCTP

CAS102783-51-7

dGTP

CAS93919-41-6

dTTP

CAS18423-43-3

Tampones de PCR concentrados 10 veces (normalmente distribuidos por el


proveedor de ADN polimerasa Taq).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

MgCl2 25 mM

ADN polimerasa Taq

Oligonucletidos de uso anterior y posterior

Aceite mineral (necesario si se utiliza un termociclador sin tapa caliente)

Agua libre de nucleasa

Solucin madre de dNTP 4 mM

Los dNTP puede suministrarse en soluciones madre recombinadas (con dATP,


dCTP, dGTP, dTTP en la misma concentracin) o separados en distintas soluciones
madre. Si se utilizan soluciones separadas, los distintos dNTP deben disolverse en
agua desionizada esterilizada para obtener una solucin madre final de dNTP 4 mM.

Dividir en alcuotas y guardar a 20 C. Los dNTP se mantienen estables durante


varios meses.

Solucin de cebador 20 M
Los oligonucletidos del cebador suelen suministrarse liofilizados, por lo que debe diluirse
hasta alcanzar una concentracin de 20 M.

Preparar una solucin de cebador 20 M siguiendo las instrucciones del proveedor.


- 1 M = 1 pmol/l, por tanto 20 M = 20 pmol/l.
- X nmol de cebador + 10 X l de agua esterilizada = 100 pmol/l = 100 M.
- Incubar 5 min a 65 C, agitar e incubar durante otros 3 min a 65C.
- Dilucin 1:5. Preparar 1 tubo de microcentrfuga con 400 l de agua esterilizada y
aadir 100 l de la solucin de cebador (100 M). Concentracin final: 20 M.

Dividir en alcuotas pequeas y guardar a 20 C. Las alcuotas guardadas a 20 C


se mantienen estables durante al 6 meses. los cebadores liofilizados se mantienen
estables a 20 C durante un mximo de tres aos.

Tampn PCR 10x

El tampn para PCR 10x, con KCl 500 mM, Tris-HCI 100 mM (pH 9,0 a 25 C) y
Tritn X-100 al 1 % suele suministrarse junto con la ADN polimerasa Taq y est listo
para su uso. El tampn debe mezclarse y centrifugarse brevemente antes de cada
uso.

Las alcuotas se guardan a 20 C y se mantienen estables durante varios meses.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Solucin de MgCl2 25 mM
La solucin de MgCl2 de grado PCR suele suministrarse junto con la ADN Taq polimerasa
y lista para su uso. La solucin debe mezclarse (mezclador de torbellino) antes de cada uso
y centrifugarse brevemente (para destruir el gradiente de concentracin que puede formarse
en caso de conservacin prolongada). Guardar a 20 C.
Alcuotas de agua libre de nucleasa
Se preparan alcuotas de agua desionizada, esterilizada y libre de nucleasa para la mezcla
maestra y para la dilucin del ADN. En cada serie de anlisis debe utilizarse una alcuota
distinta.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

PCR especfica de plantas: gen de la lectina de soja


La identificacin del ADN de la soja se realiza con el gen lectina como diana.
La presencia de ADN amplificable de soja en la muestra se determina mediante PCR con
los cebadores GMO3 y GMO4.
Caractersticas de los cebadores GMO3 y GMO4

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

GMO3
GCCCTCTACTCCACCCCCATCC
22
6471,6
65,1

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

GMO4
GCCCATCTGCAAGCCTTTTTGTG
23
6981,1
59,6

*Suponiendo que la [Na+] sea de 50 mM.


Controles
Es importante realizar ensayos de control con cada anlisis por PCR. Los controles
negativos estn diseados para comprobar si los reactivos de la PCR estn contaminados
con ADN. Los controles positivos con muestras caracterizadas tambin son crticos para
determinar la eficacia y la especificidad de la PCR.
Al realizar anlisis con PCR deben incluirse los siguientes controles:

Control positivo: ADN puro, aislado de la soja convencional

Control negativo: ADN puro, aislado de otras especies y libre del gen lectina

Control sin plantilla: control negativo de la mezcla maestra, utilizando agua en


vez de ADN.

Preparacin de la mezcla maestra


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 1.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

El procedimiento se aplica a una muestra con 48 l de mezcla maestra de GMO3 y GMO4 y


2 l de solucin de ADN. Durante la preparacin de la mezcla maestra todas las soluciones
se guardan en hielo.
Cuadro 1. Mezcla maestra GMO3-GMO4
Concentracin
final

Mezcla maestra
para una muestra

Mezcla maestra para


10 muestras

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

32,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

48 l

480 l

Agua desionizada esterilizada


Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido GMO3 20 M
Oligonucletido GMO4 20 M
ADN polimerasa Taq
TOTAL

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 1

Agitar suavemente la mezcla maestra de GMO3 y GMO4 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador

Programa PCR* (GMO3/GMO4)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
63 C
72 C
40

30 s
30 s
30 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin inicial

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


* Nota: En el curso se utilizarn termocicladores Perkin Elmer Gene Amp PCR system
9600, ABI 9700. La utilizacin de modelos o marcas de termocicladores distintos
producir los mismos resultados siempre que se los programas de PCR se adapten y
comprueben en consecuencia1.
Anlisis de los productos de la PCR
Tras la amplificacin de la secuencia diana, se analizan los productos de la PCR mediante
electroforesis en gel de agarosa en presencia de bromuro de etidio. Se mezclan 8 l de una
reaccin de PCR con 2 l de tampn de carga, tras lo cual se cargan las muestras en el gel
de agarosa (1,5 %). Se realiza una migracin a 100 V durante 1 hora. Se someten a
electroforesis marcadores de tamao (15 l de una escalera de 100 pb) en pocillos
adyacentes del gel, de forma que pueda determinarse con precisin el tamao de los
amplicones. Completado el ciclo, el ADN del gel puede visualizarse mediante
transiluminacin ultravioleta. Para llevar un registro fiel del resultado del ensayo, puede
fotografiarse el gel.
Interpretacin de los resultados
El sistema se comprueba utilizando la pareja de cebadores GMO3-GMO4 para detectar el
gen de la lectina sin modificar; la calidad de amplificacin del ADN extrado se ve
confirmada por una banda de 118 pb, especfica del gen lectina.
El control positivo amplificar una banda de 118 pb. Los controles negativo y sin plantilla no
deben arrojar una banda visible.
Si los controles positivo o negativo no dan los resultados esperados, el anlisis por PCR de
las muestras seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra no presenta una banda a
118 pb, significa que la muestra no contiene ADN de soja amplificable. Conviene observar
que ste (como otros protocolos de esta sesin) es un mtodo cualitativo que slo permite
obtener un resultado cualitativo (disyuntiva s-no).

El CCI y la OMS no promocionan ningn instrumento utilizado en los cursos de formacin


o mencionado en el presente manual. Los anlisis realizados en nuestros laboratorios
deberan reproducirse fcilmente utilizando otros instrumentos, siempre que se tengan en
cuenta las caractersticas divergentes del sistema usado.
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

PCR especfica de plantas: gen de la zena de maz


La identificacin del ADN del maz se realiza con el gen zena como diana.
La presencia en la muestra de ADN adecuadamente amplificable de maz se determina
mediante PCR con los cebadores ZEIN3 y ZEIN4.
Caractersticas de los cebadores ZEIN3 y ZEIN4

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

ZEIN3
AGTGCGACCCATATTCCAG
19
5772,3
55,2

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

ZEIN4
GACATTGTGGCATCATCATTT
21
6410,9
51,7

*Suponiendo que la [Na+] sea de 50 mM.


Controles

Control positivo: ADN puro, aislado del maz convencional

Control negativo: ADN puro, aislado de otras especies y libre del gen zena

Control sin plantilla: control negativo de la mezcla maestra, utilizando agua en


vez de ADN.

Preparacin de la mezcla maestra


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 2.
El procedimiento se aplica a una muestra con 48 l de mezcla maestra de ZEIN3 y ZEIN4 y
2 l de solucin de ADN. Durante la preparacin de la mezcla maestra todas las soluciones
se guardan en hielo.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

10

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Cuadro 2. Mezcla maestra ZEIN3-ZEIN4


Concentracin Mezcla Mezcla maestra
final
maestra
para 10
para una
muestras
muestra
Agua desionizada esterilizada
Tampn de PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido ZEIN3 20 M
Oligonucletido ZEIN4 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

TOTAL

32,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

48 l

480 l

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 2

Agitar suavemente la mezcla maestra de ZEIN3 y ZEIN4 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador.

Programa PCR (ZEIN3/ZEIN4)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento/Extensin
Nmero de ciclos

96 C
60 C
40

1 min
1 min

Extensin final

72 C
4 C

3 min

Desnaturalizacin inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

11

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Anlisis de los productos de la PCR


Tras la amplificacin del ADN, se analizan los productos de la PCR mediante electroforesis
en gel de agarosa en presencia de bromuro de etidio. Se mezclan 8 l de la solucin con
2 l de tampn de carga, tras lo cual se carga la mezcla en el gel de agarosa (1,5 %). Se
realiza una migracin a 100 V durante 1 hora. Se someten a electroforesis marcadores de
tamao (15 l de una escalera de 100 pb) en pocillos adyacentes del gel, de forma que
pueda determinarse con precisin el tamao de los amplicones. Completado el ciclo, el ADN
del gel puede visualizarse mediante transiluminacin ultravioleta. Para llevar un registro fiel
del resultado del ensayo, puede fotografiarse el gel.
Interpretacin de los resultados
La calidad de amplificacin del ADN extrado se comprueba utilizando la pareja de
cebadores ZEIN3-ZEIN4 para detectar el gen de la zena del maz sin modificar. Si el ADN
extrado tiene suficiente calidad de amplificacin, se observar en el gel una banda
especfica del gen de la zena de 277 pb.
El control positivo debera tambin amplificar una banda de 277 pb.
Los controles negativo y sin ADN molde no deben arrojar una banda visible.
Si los controles positivo o negativo no dan los resultados esperados, el anlisis por PCR de
las muestras seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra no presenta una banda a
277 pb, significa que la muestra no contiene ADN de maz amplificable.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

12

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Mtodo

de

cribado

para

detectar

vegetales

genticamente

modificados
Los genes estn sometidos a la regulacin de promotores y terminadores. Las secuencias
ms utilizadas para la regulacin de un transgn son el promotor 35S (derivado del virus del
mosaico de la coliflor) y el terminador nos (derivado de Agrobacterium tumefaciens). La
deteccin de una de estas secuencias reguladoras en una muestra con soja o maz indica la
presencia de OGM. En la soja Roundup Ready, pueden detectarse tanto el promotor 35S
como el terminador nos, mientras que en las lneas de maz Bt-176 y MON810 slo se da la
presencia del promotor 35S.

Deteccin del promotor 35S


Caractersticas de los cebadores p35S-cf3 y p35S-cr4

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

p35S-cf3
CCACGTCTTCAAAGCAAGTGG
21
6414.5
57,4

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

p35S-cr4
TCCTCTCCAAATGAAATGAACTTCC
25
7544,2
56,3

*Suponiendo que la [Na+] sea de 50 mM.


Controles

Control positivo: ADN del material de referencia (maz del que un 0,5 % es GM)

Control negativo: ADN del material de referencia (maz del que un 0 % es GM)

Control sin ADN molde: control negativo de la mezcla maestra, utilizando agua
en vez de ADN.

Preparacin de la mezcla maestra


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 3.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

13

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

El procedimiento se aplica a una muestra con 48 l de mezcla maestra de p35S-cf3 y p35Scr4 y 2 l de solucin de ADN. Durante la preparacin de la mezcla maestra todas las
soluciones se guardan en hielo.
Cuadro 3: Mezcla maestra de p35S-cf3 y p35S-cr4
Concentracin Mezcla maestra Mezcla maestra
final
para una
para 10 muestras
muestra
Agua desionizada esterilizada
Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido p35S-cf3 20 M
Oligonucletido p35S-cr4 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

TOTAL

32,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

48 l

480 l

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 3

Agitar suavemente la mezcla maestra de p35S-cf3 y p35S-cr4 por pipeteado y


centrifugar brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador.

Programa PCR (p35S-cf3 y p35S-cr4)

Desnaturalizacin inicial

Temperatura Tiempo
95 C
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
62 C
72 C
50

25 s
30 s
45 s

Extensin final

72 C
4 C

7 min

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

14

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Anlisis de los productos de la PCR
Tras la amplificacin, se analizan los productos de la PCR mediante electroforesis en gel de
agarosa en presencia de bromuro de etidio. Se mezclan 8 l de la solucin con 2 l de
tampn de carga, tras lo cual se carga la solucin en el gel de agarosa (2,5 %). Se realiza
una migracin a 100 V durante 1 hora. Se someten a electroforesis marcadores de tamao
(15 l de una escalera de 100 pb) en pocillos adyacentes del gel, de forma que pueda
determinarse con precisin el tamao de los amplicones. Completado el ciclo, el ADN del
gel puede visualizarse mediante transiluminacin ultravioleta. Para llevar un registro fiel del
resultado del ensayo, puede fotografiarse el gel.
Interpretacin de los resultados
Para la deteccin del promotor 35S del virus del mosaico de la coliflor se utiliza el par de
cebadores p35S-cf3/p35S-cr4, que rinde un fragmento de 123 pb. Este promotor regula la
expresin de los genes de numerosas plantas transgnicas, como la soja Roundup Ready y
la lnea de maz Bt-176. El control positivo amplificar una banda de 123 pb. Los controles
negativo y sin plantilla no deben arrojar una banda visible. Si los controles positivo o
negativo no dan los resultados esperados, el anlisis por PCR de las muestras
seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra presenta una banda de
123 pb, significa que la muestra contiene ADN modificado.

Deteccin del terminador nos


Caractersticas de los cebadores HA-nos 118-f y HA-nos 118-r

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

HA-nos 118-f
GCATGACGTTATTTATGAGATGGG
24
7462,8
56,2

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

HA-nos 118-r
GACACCGCGCGCGATAATTTATCC
24
7296,9
61,2

*Suponiendo que la [Na+] sea de 50 mM.


Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

15

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Controles

Control positivo: ADN del material de referencia (soja de la que un 0,5 % es GM


[soja Roundup Ready])

Control negativo: ADN del material de referencia (soja de la que un 0 % es GM)

Control sin ADN molde: control negativo de la mezcla maestra, utilizando agua
en vez de ADN.

Preparacin de la mezcla maestra


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 4.
El procedimiento se aplica a una muestra con 48 l de mezcla maestra de HA-nos118-f y
HA-nos118-r y 2 l de solucin de ADN. Durante la preparacin de la mezcla maestra todas
las soluciones se guardan en hielo.
Cuadro 4. Mezcla maestra de HA-nos118-f y HA-nos118-r
Concentracin
final

Agua desionizada esterilizada


Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido HA-nos118-f 20 M
Oligonucletido HA-nos118-r 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

TOTAL

Mezcla Mezcla maestra


maestra
para 10
para una
muestras
muestra
32,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

48 l

480 l

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 4

Agitar suavemente la mezcla maestra de HA-nos118-f y HA-nos118-r por pipeteado y


centrifugar brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

16

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Colocar los tubos de reaccin de PCR en el termociclador.

Programa PCR (HA-nos118-f/HA-nos118-r)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
62 C
72 C
50

25 s
30 s
45 s

Extensin final

72 C
4 C

7 min

Desnaturalizacin
inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Anlisis de los productos de la PCR
Tras la amplificacin, se analizan los productos de la PCR mediante electroforesis en gel de
agarosa en presencia de bromuro de etidio. Se mezclan 8 l de la solucin con 2 l de
tampn de carga, tras lo cual se carga la solucin en el gel de agarosa (2,5 %). Se realiza
una migracin a 100 V durante 1 hora. Se someten a electroforesis marcadores de tamao
(15 l de una escalera de 100 pb) en pocillos adyacentes del gel, de forma que pueda
determinarse con precisin el tamao de los amplicones. Completado el ciclo, el ADN del
gel puede visualizarse mediante transiluminacin ultravioleta. Para llevar un registro fiel del
resultado del ensayo, puede fotografiarse el gel.
Interpretacin de los resultados
Para la deteccin del terminador nos se utiliza el par de cebadores HA-nos118-f/HAnos118-r, que rinde un fragmento de 118 pb. El terminador nos est presente en la soja
Roundup Ready y en otras lneas de plantas transgnicas (p. ej., la lnea de maz Bt-11).
El control positivo amplificar una banda de 118 pb. Los controles negativo y sin plantilla no
deben arrojar una banda visible. Si los controles positivo o negativo no dan los resultados
esperados, el anlisis por PCR de las muestras seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra presenta una banda de
118 pb, significa que la muestra contiene ADN modificado.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

17

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Deteccin especfica mediante PCR anidada del maz MON810, del


maz Bt-176 y de la soja Roundup Ready

Deteccin del maz MON810


El sistema de deteccin es especfico del maz MON810. Los elementos diana son el
promotor 35S del virus del mosaico de la coliflor y la regin de hsp70 exn1-intrn1, que
son respectivamente una secuencia reguladora constitutiva y un gen de una protena de
choque trmico que produce un mayor nivel de transcripcin.
Caractersticas de los cebadores GM1, GM2, GM3 y GM4

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM1
TATCTCCACTGACGTAAGGGATGAC
25
7665,1
59,6

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM2
TGCCCTATAACACCAACATGTGCTT
25
7560.2
57.9

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM3
ACTATCCTTCGCAAGACCCTTCCTC
25
7472,2
61,2

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM4
GCATTCAGAGAAACGTGGCAGTAAC
25
7722,9
59,6

*Suponiendo que la [Na+] sea de 50 mM.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

18

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Controles

Control positivo: ADN del material de referencia (maz del que un 0,1 % es GM
[MON810])

Control negativo: ADN del material de referencia (maz del que un 0 % es GM)

Control sin ADN molde: control negativo de la mezcla maestra, utilizando agua
en vez de ADN.

Preparacin de la mezcla maestra 1


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 5.
El procedimiento se aplica a una muestra con 48 l de mezcla maestra de GM1 y GM2 y 2
l de solucin de ADN. Durante la preparacin de la mezcla maestra todas las soluciones
se guardan en hielo.
Cuadro 5. Mezcla maestra GM1-GM2
Concentracin
final

Agua desionizada esterilizada


Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido mg1 20 M
Oligonucletido mg2 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0.5 M
0,5 M
0,025 U/l

TOTAL

Mezcla
maestra
para una
muestra

Mezcla maestra
para 10
muestras

32,75 l
5 l
5 l
2,5 l
1.25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12.5 l
12,5 l
2,5 l

48 l

480 l

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 5

Agitar suavemente la mezcla maestra de GM1 y GM2 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

19

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Colocar los tubos de reaccin de PCR en el termociclador

Programa PCR (mg1/mg2)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
60 C
72 C
35

45 s
50 s
50 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin
inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Preparacin de la mezcla maestra 2
Los reactivos necesarios para una serie de 10 muestras se mezclan siguiendo las
instrucciones indicadas en el cuadro 6. El procedimiento se aplica a una muestra con 49 l
de mezcla maestra de GM3 y GM4 y 1 l de solucin de ADN preamplificado de la primera
PCR. Durante la preparacin de la mezcla maestra todas las soluciones se guardan en
hielo.
Cuadro 6. Mezcla maestra GM3-GM4
Concentracin
final

Agua desionizada esterilizada


Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido mg3 20 M
Oligonucletido mg4 20 M
ADN polimerasa Taq
TOTAL

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

Mezcla
maestra
para una
muestra

Mezcla
maestra
para 10
muestras

33,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

337,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

49 l

490 l

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

20

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 6

Agitar suavemente la mezcla maestra de GM3 y GM4 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 49 l en tubos de reaccin de PCR de 0,2 ml

Aadir 1 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador

Programa de la PCR anidada (mg3-mg4)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
60 C
72 C
40

45 s
50 s
50 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin
inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Anlisis de los productos de la PCR
Tras la amplificacin, se analizan los productos de la PCR mediante electroforesis en gel de
agarosa en presencia de bromuro de etidio. Se mezclan 8 l de la solucin con 2 l de
tampn de carga, tras lo cual se carga la solucin en el gel de agarosa (2,5 %). Se realiza
una migracin a 100 V durante 1 hora. Se emplean marcadores de tamao (15 l de una
escalera de 100 pb) en pocillos adyacentes del gel, de forma que pueda determinarse con
precisin el tamao de los amplicones. Completado el ciclo, el ADN del gel puede
visualizarse mediante transiluminacin ultravioleta. Para llevar un registro fiel del resultado
del ensayo, puede fotografiarse el gel.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

21

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Interpretacin de los resultados


Las parejas de cebadores mg1-mg2 y mg3-mg4 se disearon para la deteccin especfica
de la transformacin MON810 mediante PCR anidada, que rinde un fragmento final de PCR
anidada de 149 pb. La especificidad viene dada por el hecho de que los cebadores estn
diseados en la regin que comprende el promotor E-35S y el gen exn/intrn de hsp70. El
control positivo amplificar una banda de 189 pb. Los controles negativo y sin plantilla no
deben arrojar una banda visible.
Si los controles positivo o negativo no dan los resultados esperados, el anlisis por PCR de
las muestras seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra presenta una banda de
149 pb, significa que la muestra contiene ADN de maz MON810.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

22

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Deteccin del maz Bt-176


El gen diana es el gen cryIA(b), que protege la planta de insectos como el piral del maz.
Caractersticas de los cebadores CRYIA1, CRYIA2, CRYIA3 y CRYIA4

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

CRYIA1
CGGCCCCGAGTTCACCTT
18
5394,6
59,5

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

CRYIA2
CTGCTGGGGATGATGTTGTTG
21
6519,2
57,6

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

CRYIA3
CCGCACCCTGAGCAGCAC
18
5397,6
61,7

Secuencia
Longitud
Peso molecular (g/mol)
Punto de fusin * (G/C)

CRYIA4
GGTGGCACGTTGTTGTTCTGA
21
6479,2
57,6

*Suponiendo que la [Na+] sea de 50 mM.


Controles

Control positivo: ADN del material de referencia (maz del que un 0,1% es GM
[Bt-176])

Control negativo: ADN del material de referencia (maz del que un 0 % es GM)

Control sin ADN molde: control negativo de la mezcla maestra, utilizando agua
en vez de ADN.

Preparacin de la mezcla maestra 1


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 7. El

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

23

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

procedimiento se aplica a una muestra con 48 l de mezcla maestra de CRYIA1 y CRYIA2 y


2 l de solucin de ADN. Durante la preparacin de la mezcla maestra todas las soluciones
se guardan en hielo.
Cuadro 7. Mezcla maestra CRYIA1-CRYIA2
Concentracin Mezcla maestra
Mezcla maestra
final
para una muestra para 10 muestras
Agua desionizada esterilizada
Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido CRYIA1 20 M
Oligonucletido CRYIA2 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

TOTAL

32,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

48 l

480 l

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 5

Agitar suavemente la mezcla maestra de CRYIA1 y CRYIA2 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador.

Programa PCR (CRYIA1-CRYIA2)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
60 C
72 C
25

40 s
40 s
40 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

24

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Preparacin de la mezcla maestra 2


Los reactivos necesarios para una serie de 10 muestras se mezclan siguiendo las
instrucciones indicadas en el cuadro 8.
El procedimiento se aplica a una muestra con 49 l de mezcla maestra de CRYIA3 y
CRYIA4 y 1 l de solucin de ADN preamplificado de la primera PCR. Durante la
preparacin de la mezcla maestra todas las soluciones se guardan en hielo.
Cuadro 8. Mezcla maestra CRYIA3-CRYIA4
Concentracin
final

Agua desionizada esterilizada


Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido CRYIA3 20 M
Oligonucletido CRYIA4 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

Mezcla
maestra
para una
muestra

Mezcla
maestra
para 10
muestras

33,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

337,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

49 l

490 l

TOTAL

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 6

Agitar suavemente la mezcla maestra de CRYIA3 y CRYIA4 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 49 l en tubos de reaccin de PCR de 0,2 ml

Aadir 1 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

25

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Programa de la PCR anidada (CRYIA3/CRYIA4)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
60 C
72 C
35

40 s
40 s
40 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Anlisis de los productos de la PCR
Tras la amplificacin, se analizan los productos de la PCR mediante electroforesis en gel de
agarosa en presencia de bromuro de etidio. Se mezclan 8 l de la solucin con 2 l de
tampn de carga, tras lo cual se carga la solucin en el gel de agarosa (2,5 %). Se realiza
una migracin a 100 V durante 1 hora. Se someten a electroforesis marcadores de tamao
(15 l de una escalera de 100 pb) en pocillos adyacentes del gel, de forma que pueda
determinarse con precisin el tamao de los amplicones. Completado el ciclo, el ADN del
gel puede visualizarse mediante transiluminacin ultravioleta. Para llevar un registro fiel del
resultado del ensayo, puede fotografiarse el gel.
Interpretacin de los resultados
Las parejas de cebadores CRYIA1-CRYIA2 y CRYIA3-CRYIA4 se disearon para la
deteccin especfica del gen sinttico cryIA(b) mediante PCR anidada, que rinde un
fragmento final de PCR anidada de 149 pb. Este gen est presente en la lnea del maz Bt176 y en otras lneas (p. ej., la lnea del maz Bt-11).
El control positivo amplificar una banda de 189 pb.
Los controles negativo y sin plantilla no deben arrojar una banda visible.
Si los controles positivo o negativo no dan los resultados esperados, el anlisis por PCR de
las muestras seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra presenta una banda de
189 pb, significa que la muestra contiene ADN de maz Bt-176.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

26

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Deteccin de la soja Roundup Ready


La diana es el gen CP4 EPSPS, que confiere resistencia al herbicida Roundup.
Caractersticas de los cebadores GMO5, GMO9, GMO7 y GMO8

Secuencia
Longitud (pb)
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM05
CCACTGACGTAAGGGATGACG
21
6479,4
59,5

Secuencia
Longitud (pb)
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM09
CATGAAGGACCGGTGGGAGAT
21
6559,4
59,5

Secuencia
Longitud (pb)
Peso molecular (g/mol)
Punto de fusin * (G/C)

GMO7
ATCCCACTATCCTTCGCAAGA
21
6309,6
55,8

Secuencia
Longitud (pb)
Peso molecular (g/mol)
Punto de fusin * (G/C)

GM08
TGGGGTTTATGGAAATTGGAA
21
6579,8
51,7

*Suponiendo que la [Na+] sea de 50 mM.


Controles

Control positivo: ADN del material de referencia (soja de la que un 0,1% es GM


[soja Roundup Ready])

Control negativo: ADN del material de referencia (soja de la que un 0 % es GM)

Control sin plantilla: control negativo de la mezcla maestra, utilizando agua en


vez de ADN.

Preparacin de la mezcla maestra 1


Los reactivos necesarios para una serie de 10 muestras (con controles positivos, negativos
y sin plantilla) se mezclan siguiendo las instrucciones indicadas en el cuadro 9.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

27

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

El procedimiento se aplica a una muestra con 48 l de mezcla maestra de GMO5 y GMO9 y


2 l de solucin de ADN. Durante la preparacin de la mezcla maestra todas las soluciones
se guardan en hielo.
Cuadro 9. Mezcla maestra GMO5-GMO9
Concentracin Mezcla maestra Mezcla maestra
final
para una muestra para 10 muestras
Agua desionizada esterilizada
Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido GMO5 20 M
Oligonucletido GMO9 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

TOTAL

32,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

327,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

48 l

480 l

Preparar un tubo para microcentrfuga de 1,5 ml

Aadir los reactivos siguiendo el orden indicado en el cuadro 7

Agitar suavemente la mezcla maestra de GMO5 y GMO9 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 48 l en tubos de reaccin de PCR de 0,2 ml

Aadir 2 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

28

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Programa PCR (GMO5-GMO9)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
60 C
72 C
25

30 s
30 s
40 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin
inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Preparacin de la mezcla maestra 2
Los reactivos necesarios para una serie de 10 muestras se mezclan siguiendo las
instrucciones indicadas en el cuadro 10.
El procedimiento se aplica a una muestra con 49 l de mezcla maestra de GMO7 y GMO8 y
1 l de solucin de ADN preamplificado de la primera PCR. Durante la preparacin de la
mezcla maestra todas las soluciones se guardan en hielo.
Cuadro 10. Mezcla maestra GMO7-GMO8
Concentracin
final

Agua desionizada esterilizada


Tampn para PCR 10x
MgCl2 25 mM
dNTP 4 mM
Oligonucletido GMO7 20 M
Oligonucletido GMO8 20 M
ADN polimerasa Taq

1x
2,5 mM
0,2 mM
0,5 M
0,5 M
0,025 U/l

TOTAL

Mezcla
maestra
para una
muestra

Mezcla
maestra
para 10
muestras

33,75 l
5 l
5 l
2,5 l
1,25 l
1,25 l
0,25 l

337,5 l
50 l
50 l
25 l
12,5 l
12,5 l
2,5 l

49 l

490 l

Preparar un tubo para microcentrifuga de 1,5 ml

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

29

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

Aadir los reactivos siguiendo el orden indicado en el cuadro 8

Agitar suavemente la mezcla maestra de GMO7 y GMO8 por pipeteado y centrifugar


brevemente

Dividir la mezcla maestra en alcuotas de 49 l en tubos de reaccin de PCR de 0,2 ml

Aadir 1 l de la solucin de ADN a dichas alcuotas

Agitar suavemente y centrifugar brevemente

Colocar los tubos de reaccin de PCR en el termociclador.

Programa de la PCR anidada (GMO7-GMO8)


Temperatura
95 C

Tiempo
3 min

Desnaturalizacin
Anillamiento
Extensin
Nmero de ciclos

95 C
60 C
72 C
35

30 s
30 s
40 s

Extensin final

72 C
4 C

3 min

Desnaturalizacin
inicial

Tras la amplificacin, las muestras se centrifugan brevemente y se colocan en hielo.


Anlisis de los productos de la PCR
Tras la amplificacin, se analizan los productos de la PCR mediante electroforesis en gel de
agarosa en presencia de bromuro de etidio. Se mezclan 8 l de la solucin con 2 l de
tampn de carga, tras lo cual se carga la solucin en el gel de agarosa (2,5 %). Se realiza
una migracin a 100 V durante 1 hora. Se someten a electroforesis marcadores de tamao
(15 l de una escalera de 100 pb) en pocillos adyacentes del gel, de forma que pueda
determinarse con precisin el tamao de los amplicones. Completado el ciclo, el ADN del
gel puede visualizarse mediante transiluminacin ultravioleta. Para llevar un registro fiel del
resultado del ensayo, puede fotografiarse el gel.
Interpretacin de los resultados
Las parejas de cebadores GMO5-GMO9 y GMO7-GMO8 se disearon para la deteccin
especfica de la construccin gentica de la soja Roundup Ready mediante PCR anidada,

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

30

Qualitative Detection of MON810 Maize, Bt-176 Maize and Roundup Ready Soybean by PCR

que rinde un fragmento de PCR anidada de 169 pb. Los cebadores GMO5 y GMO7 son
complementarios del promotor 35S del virus del mosaico de la coliflor; el GM09 se hibrida
con el gen CP4 EPSPS de Agrobacterium sp., cepa CP4, y el GMO8 con el gen CTP
EPSPS.
El control positivo amplificar una banda de 169 pb.
Los controles negativo y sin plantilla no deben arrojar una banda visible. Si los controles
positivo o negativo no dan los resultados esperados, el anlisis por PCR de las muestras
seleccionadas no es vlido.
Si los controles arrojan los resultados esperados y la muestra presenta una banda de
169 pb, significa que la muestra contiene ADN de la soja Roundup Ready.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin 9

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 10
PCR Cuantitativa para la Deteccin de OGM

F. Weighardt

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

PCR Cuantitativa para la Deteccin de OGM

ndice
Sesin n 10
PCR Cuantitativa para la Deteccin de OGM

Introduccin

Mtodos de cuantificacin basados en la PCR

Historia de las tcnicas de PCR en tiempo real

Principios de la PCR en tiempo real

Principios de cuantificacin con la PCR en tiempo real

13

Bibliografa

20

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

Introduccin
Una vez comprobado que un producto alimenticio ha dado positivo en relacin con
una o ms modificaciones genticas (soja Roundup Ready, maz Bt-176, maz Bt-11,
maz MON810 y maz T25), los pasos analticos posteriores consisten en determinar
si se cumple la legislacin vigente (Reglamento (CE) n 1829/2003 y Reglamento
(CE) n 1830/2003) midiendo la cantidad de cada OGM presente en cada ingrediente
(figura 1).
Los Reglamentos mencionados disponen que todos los productos que contengan
OGM, consistan en OGM o estn producidos a partir de OGM deben ir etiquetados
como tales.
No es exigible el etiquetado de los productos que incluyan materiales que contengan
OGM, consistan en OGM o estn producidos a partir de OGM en proporcin no
superior al 0,9% de los ingredientes alimenticios individualmente considerados,
siempre que esta presencia sea accidental o tcnicamente inevitable.
Todos los ingredientes (harina, smola, aceite, etc.) derivados de una misma
especie (p. ej., maz, soja, colza, etc.) se consideran colectivamente un solo
ingrediente (p. ej., maz).

Maz GM
0,6%
Soja no GM
99,4%
Maz no GM
99,4%
Soja GM
0,6%

Figura 1. No se exige etiquetado. La cantidad tanto de soja GM como de maz GM


est por debajo del umbral legal.

Si, por ejemplo, un ingrediente derivado exclusivamente del maz contiene menos de
un 0,9 % de maz GM, no es necesario etiquetar el alimento obtenido a partir de l.
Por el contrario, si contiene ms de un 0,9 % de maz GM, es obligado etiquetar los
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

productos alimenticios derivados. Esto es as incluso si en el producto final,


considerando la suma de todos los ingredientes derivados de especies distintas (p.
ej., soja y maz), la cantidad relativa de maz GM desciende por debajo del 0,9 %. Si
estn presentes dos o ms variedades distintas de maz GM, habr que sumar sus
concentraciones y utilizar el porcentaje total para determinar si es necesario o no
etiquetar (figura 2). Si la suma resultante est por debajo del umbral del 0,9 %, no
ser obligado etiquetar.

Maz Bt 176
0,6%
Soja no GM
100%
Maz no GM
98,8%
Maz Bt 11
0,6%

Figura 2. Es necesario etiquetar en razn del ingrediente maz. La suma de las


modificaciones Bt-11 (0,6 %) y Bt-176 (0,6 %) rebasa el umbral del 0,9 % exigido
para el etiquetado.

El contenido relativo de OGM (porcentaje) se determina normalizando la cantidad de


secuencias especficas del OGM con respecto a la cantidad de un gen especfico de
la planta (p. ej., el de la lectina en el caso de la soja y los de la invertasa o la zena
en el del maz). El porcentaje de OGM resultante se expresa, por lo tanto, as: OGM
(%)= ADN-GM/ADN-referencia x 100.

Mtodos de cuantificacin basados en la PCR


Un grave inconveniente de la PCR convencional es la ausencia de informacin
cuantitativa exacta debido a la eficiencia de la amplificacin. Si la eficiencia de la
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

reaccin permaneciera constante para cada ciclo de amplificacin, la concentracin


de ADN posterior a la PCR sera directamente proporcional a la cantidad de ADN
diana inicial. Lamentablemente, la eficiencia de la amplificacin vara de una
reaccin a otra, as como en ciclos sucesivos de una misma reaccin. En particular,
en los ltimos ciclos de la PCR los productos de la amplificacin se forman de
manera no exponencial y a una velocidad de reaccin desconocida.
La cuantificacin del ADN basada en la PCR convencional se apoya en la medicin
en el punto final, a fin de conseguir la sensibilidad mxima, cuando la amplificacin
alcanza el rendimiento mximo (la denominada fase meseta). En esta etapa la
reaccin ha superado la fase exponencial, a causa fundamentalmente del
agotamiento de los reactivos y de la inactivacin trmica gradual de la polimerasa
utilizada. Por ello, la correlacin resultante entre la concentracin del producto final y
el nmero de molculas diana iniciales es limitada.
Para superar este problema se han desarrollado tcnicas como la PCR competitiva
cuantitativa (PCR-CC) y la PCR en tiempo real, que se proponen establecer una
relacin entre la concentracin de ADN diana y la cantidad de producto de la PCR
generada por la amplificacin.

PCR competitiva cuantitativa


Uno de los primeros mtodos de PCR cuantitativa desarrollados es la PCR
competitiva cuantitativa (Giacca et al., 1994; Studer et al., 1998; Hardegger et al.,
1999). Este mtodo se basa en la coamplificacin de la plantilla de ADN diana y
cantidades definidas de un patrn de ADN interno (competidor) que portan los
mismos sitios de unin del cebador. Dado que se conoce la cantidad de competidor
inicial y que la eficiencia de la amplificacin es la misma en los ADN competidor y
diana, la proporcin de las cantidades de los dos productos de la PCR, determinada
por ejemplo mediante electroforesis en gel, es representativa de la proporcin de los
ADN diana y competidor presentes en la mezcla de reaccin antes de la
amplificacin.
Normalmente un competidor es un plsmido linearizado que lleva la misma
secuencia de nucletidos que el ADN diana, salvo una supresin o insercin que
permite, una vez coamplificado, obtener dos bandas de distinto tamao tras una
electroforesis de geles estndar.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

ADN amplificado de la diana


ADN amplificado del competidor

Figura 3. Coamplificacin de una cantidad fija de ADN diana con distintas


cantidades de ADN competidor.
La PCR competitiva se ha utilizado con xito para cuantificar tanto el ADN como en
ARN, pero su intervalo dinmico se limita a una proporcin diana/competidor
comprendida entre aproximadamente 1:10 y 10:1. De hecho, la mxima exactitud se
obtiene

encontrando el

punto de

equivalencia

en el

que

la proporcin

diana/competidor es 1:1 (figura 3). Para conseguir una proporcin adecuada, habr
que ensayar varias diluciones.
Otro inconveniente de este mtodo es la necesidad de construir y caracterizar un
competidor diferente para cada diana que se vaya a cuantificar. En realidad, incluso
diferencias pequeas en la eficiencia de la amplificacin pueden comprometer
gravemente la exactitud de la cuantificacin mediante la PCR competitiva
cuantitativa. Por ltimo, al final de la reaccin, la PCR competitiva exige una
cuantificacin adecuada de los amplicones de la diana y del competidor, lo que suele
exigir un laborioso tratamiento ulterior.
La PCR competitiva es un mtodo semicuantitativo que comporta la comparacin de
un patrn (el competidor) con la muestra. Los resultados solo pueden indicar un
valor inferior, igual o superior a una concentracin patrn definida.
No obstante, el sistema de la PCR competitiva tiene la ventaja de que los
laboratorios no necesitan adquirir equipos especializados, ya que puede aplicarse
con el instrumental habitual de un laboratorio de biologa molecular y PCR.

PCR en tiempo real


La PCR en tiempo real representa una metodologa de la PCR ms exacta y ms
utilizada actualmente. Al contrario que en el caso de las determinaciones en el punto
final, los sistemas de PCR en tiempo real monitorizan la reaccin a medida que tiene
lugar. En este tipo de sistema, la PCR se acopla a la emisin de una seal
fluorescente proporcional a la cantidad de producto de la PCR producido en ciclos
posteriores. Esta seal se intensifica proporcionalmente a la cantidad de producto de

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

la PCR generado en cada ciclo de reaccin sucesivo. Registrando la cantidad de


emisin fluorescente en cada ciclo, es posible monitorizar la PCR durante su fase
exponencial. El primer incremento significativo de la fluorescencia se correlaciona
con la cantidad inicial de plantilla diana (Ahmed, 2002).

Historia de las tcnicas de PCR en tiempo real


Higuchi et al. (1992,1993) fueron los pioneros del anlisis de la cintica de la PCR al
disear un sistema capaz de detectar los productos de la PCR a medida que se
acumulan. Este sistema de tiempo real inclua la molcula intercalante de bromuro
de etidio en cada mezcla de reaccin. Para llevar a cabo las rondas se utilizaba un
termociclador adaptado para irradiar las muestras con luz ultravioleta y capaz de
detectar la fluorescencia resultante con una cmara CCD (dispositivo de
acoplamiento de cargas) controlada por ordenador y refrigerada. A medida que
tena lugar la amplificacin, se producan cantidades crecientes de ADN bicatenario,
con bromuro de etidio intercalado, que inducan un aumento de la fluorescencia. Al
representar grficamente la emisin de luz fluorescente frente al nmero de ciclo, el
sistema produca grficos de la amplificacin que daban una imagen ms completa
del proceso de la PCR que el estudio de la acumulacin del producto tras un nmero
de ciclos fijo.

Principios de la PCR en tiempo real


La especificidad del mtodo de la PCR en tiempo real depende de las sustancias
utilizadas para generar y monitorizar la reaccin de amplificacin y del instrumento
utilizado para monitorizar la seal. Se han desarrollado varias sustancias al efecto:
colorantes de intercalacin (bromuro de etidio, SYBR Green I) y sondas de
hibridacin (sondas TaqMan, sondas FRET, balizas moleculares, Scorpions y
sondas TaqMan Minor Groove Binder).

PCR en tiempo real con uso del colorante SYBR Green I


La primera aplicacin de la PCR en tiempo real deriv directamente de los
experimentos de Higuchi et al. (1992, 1993), sin ms que sustituir el bromuro de
etidio por un agente intercalante del ADN bicatenario, fluorescente, menos txico y
ms especfico y sensible (entre 10 y 25 veces), el SYBR Green I (Haugland, 2002).
El colorante SYBR Green I se une al surco menor del ADN bicatenario, pero no al
ADN monocatenario. A consecuencia de esta unin, se potencia enormemente

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

(entre 800 y 1 000 veces) la fluorescencia (excitacin aprox. a 488 nm y 254 nm;
emisin aprox. a 560 nm). Al iniciarse la PCR, el aumento de la cantidad de ADN
recin sintetizado produce un incremento de la seal fluorescente (Figura 4). No
obstante, el sistema de deteccin de secuencias basado en el SYBR Green I
presenta una limitacin, que es la falta de especificidad de su modo de
reconocimiento del ADN. Por este motivo, se cuantifican todas las molculas de ADN
bicatenario presentes en una PCR, incluidos los productos de la PCR no especficos
y los dmeros de los cebadores. Para resolver este problema y sustraer el
componente de la cuantificacin debido a los ADN no especficos y a los dmeros de
cebadores en algunos dispositivos, es posible realizar un anlisis de la curva de
fusin. Tras la fase final de la PCR, los productos se funden lentamente y se recogen
los datos de fluorescencia. Toda vez que cada ADN bicatenario tiene una
temperatura de fusin especfica, es posible cuantificar los componentes que tienen
temperaturas de fusin diferentes en una nica mezcla de reaccin, eliminando as
de la cuantificacin los componentes no especficos.

Mtodos de la PCR en tiempo real basados en sondas especficas para una


secuencia
El problema de la especificidad de la deteccin por fluorescencia del amplicn se ha
resuelto utilizando sondas especficas para una secuencia con un marcado
fluorescente diseado en el interior del par de cebadores de la PCR. El proceso de
hibridacin (y degradacin final) de la sonda no suele interferir con la acumulacin
exponencial del producto de la PCR. Se utilizan ahora unos pocos principios
diferentes para conseguir reacciones de cuantificacin basadas en la PCR en tiempo
real especficas.

Sondas FRET (transferencia de energa de resonancia fluorescente)


La FRET se basa en la transferencia de energa de un fluorforo donador a un
fluorforo aceptor (figura 4) (Haugland, 2002). Las condiciones bsicas de la FRET
son:

Las molculas del donador y del aceptor deben estar muy prximas (habitualmente
10100 ).

El espectro de absorcin del aceptor debe solaparse con el espectro de emisin de


fluorescencia del donador.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

Las orientaciones de los dipolos de transicin del donador y el aceptor deben ser
aproximadamente paralelas.
Si los fluorforos donador y aceptor estn muy prximos, la excitacin del donador
por la luz azul desencadena una transferencia de energa al aceptor, que entonces
puede emitir luz de una longitud de onda mayor. La formacin de productos de la
PCR

puede

monitorizase

utilizando

dos

sondas

de

oligonucletidos

con

especficidad de secuencia con una marca fluorescente, denominadas sondas de


hibridacin, adems de los cebadores de la PCR. Las sondas de hibridacin se
disean como pares en los que una sonda se marca con el colorante donador (3fluorescina) y la otra con el aceptor (5- Red 640 o 5-Red 705). Dado que la FRET
disminuye con la sexta potencia de la distancia, es necesario disear las sondas de
hibridacin de manera que se hibriden a regiones adyacentes de la plantilla de ADN
(usualmente estn separadas por una distancia de 1-5 nucletidos). Si se hibridan
ambas sondas, los dos colorantes se aproximan mucho y la FRET al colorante
aceptor produce una seal mensurable mediante fluorometra.

Sondas de degradacin (principio TaqMan)


El ensayo TaqMan aprovecha la actividad exonuclesica 5' - 3' de la ADN
polimerasa Taq

para dividir una sonda de degradacin durante la PCR (Lie y

Petropoulos, 1998). La sonda de degradacin, o TaqMan, suele ser un


oligonucletido de 20-30 bases de longitud (usualmente con una Tf 10 C superior a
la Tf de los cebadores) que contiene un colorante delator fluorescente en el extremo
5' y un colorante inhibidor en el 3' (figura 4). Al estar bloqueado el extremo 3', la
sonda no puede extenderse como un cebador. Durante la PCR, en presencia de una
diana, la sonda se hibrida especficamente entre los sitios de los cebadores directo e
inverso. Cuando la sonda est intacta, la proximidad del colorante delator al
colorante inhibidor produce la supresin de la fluorescencia delatora principalmente
por transferencia de energa de tipo Forster (Forster, 1948; Lakowicz, 1983). Durante
la reaccin, la actividad exonuclesica 5-3 de la ADN polimerasa Taq degrada la
sonda entre los colorantes delator e inhibidor solamente si la sonda se hibrida con la
diana. De esta manera, la fluorescencia aumenta a medida que progresa la
amplificacin. La acumulacin de producto de la PCR se detecta monitorizando el
incremento de la fluorescencia del colorante delator. Este proceso tiene lugar en
cada ciclo y no interfiere con la acumulacin exponencial del producto. Las sondas
de degradacin, a diferencia de las FRET, liberan fluorocromos en cada ciclo,
aadiendo ms colorante al previamente liberado. En consecuencia, la seal

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

10

fluorescente se potencia considerablemente en cada ciclo. El ensayo TaqMan utiliza


unos parmetros de los ciclos trmicos y unas condiciones de la PCR que son
universales. Las sondas fluorognicas exigen, eso s, que no haya G en el extremo
5'. Una G adyacente al colorante delator inhibe la fluorescencia incluso tras la
divisin.

I. SYBR Green
Figura 4.
Diferentes
principios de la
PCR en tiempo

II. Sondas de hibridacin

real.
I. SYBR green I.
II. Sondas FRET
(transferencia de
energa de

III. Sondas TaqMan

resonancia
fluorescente).
III. Sondas

de

degradacin
TaqMan 5`

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

11

Balizas moleculares
Las balizas moleculares son sondas de ADN diseadas para contener una estructura
en forma de piruleta. La secuencia del abultamiento de la piruleta es complementaria
de la diana especfica de la sonda y las secuencias del estrechamiento se disean
de manera que sean mutuamente complementarias (figura 5) (Tyagi y Kramer,
1996). Los extremos 5 y 3 de la sonda se unen covalentemente a un fluorforo y a
un inhibidor. Cuando se cierra la estructura de piruleta, el fluorforo y el inhibidor se
aproximan. En este caso, todos los fotones emitidos por el fluorforo son absorbidos
por el inhibidor. En presencia de una secuencia complementaria, la sonda se
despliega y se hibrida con la diana. El fluorforo se ve desplazado del inhibidor y la
sonda inicia su fluorescencia.

Figura 5. Principio de las balizas moleculares.

Scorpions
Otra posibilidad es la que ofrece la familia de sondas denominadas Scorpions. Un
Scorpion consiste en una secuencia de sonda especfica con estructura de piruleta
(figura 6) (Thelwell et al., 2000).
Se une un fluorforo al extremo 5' y la seal fluorescente que da es inhibida en la
estructura de piruleta por una fraccin unida al extremo 3'. La piruleta se une al
extremo 5' de un cebador. Tras la extensin del cebador del Scorpion, durante la
amplificacin, la secuencia de sonda especfica puede unirse a su complemento
dentro de la misma hebra de ADN. Esta hibridacin abre el abultamiento de la

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

12

piruleta de manera que deja de inhibirse la fluorescencia y puede observarse un


incremento de la seal. Un bloqueante de la PCR situado entre el cebador y la
secuencia del estrechamiento evita que pase a leerse el abultamiento de la piruleta,
lo que podra ocasionar su apertura en ausencia de la secuencia diana especfica. El
carcter unimolecular de la hibridacin presenta ciertas ventajas con respecto a los
sistemas de sonda homognea. A diferencia de los ensayos con balizas
moleculares, TaqMan o FRET, los ensayos con Scorpion no requieren una sonda
independiente aparte de los cebadores.

Cebador

Desnaturalizacin

Hibridacin

Extensin

Figura 6. Principio de las sondas Scorpion.

Sondas TaqMan MGB


Un MGB (enlazante al surco menor) es una pequea molcula en forma de media
luna que encaja muy bien en el surco menor del ADN bicatenario (Kutyavin et al.,
2000). En las sondas TaqMan, el grupo MGB est unido al extremo 3' junto con el
colorante inhibidor (figura 7). Cuando la sonda TaqMan se hibrida, el MGB estabiliza
el apareamiento incorporndose al surco menor del ADN bicatenario creado entre la
sonda y la secuencia diana. La estabilizacin es mucho ms eficaz cuando las

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

13

secuencias coinciden perfectamente (es decir, no hay desparejamiento). Adems del


superior potencial discriminador, la mayor estabilidad hace que las sondas TaqMan
MGB sean muy cortas (normalmente de 13 a 20 bases) en comparacin con las
sondas TaqMan estndar (de 18 a 40 bases), sin detrimento del respeto de las
directrices de diseo. Las sondas TaqMan MGB presentan varias ventajas para la
PCR cuantitativa, especialmente para los ensayos Mltiples. El mejor rendimiento
espectral hace posible una precisin y una coherencia superiores entre los distintos
ensayos, y la mayor especificidad de la hibridacin permite una discriminacin ms
precisa de las dianas. Adems, al ser la sonda ms pequea se facilita el diseo de
ensayos, pues las sondas se pueden encajar en regiones diana ms cortas, tales
como ventanas de consenso entre conservacin o divergencia de la secuencia. El
tamao del amplicn puede reducirse al mnimo utilizando sondas MGB ms cortas
que pueden contribuir a mejorar la coherencia entre ensayos.

Figura 7. Principio de las sondas MGB.

Principios de cuantificacin con la PCR en tiempo real


Cuantificacin relativa
El contenido en OGM de una muestra puede expresarse como la cantidad de
material modificado genticamente en la cantidad total de material. Para determinar
este valor en un sistema basado en la PCR en tiempo real es necesario medir el
nmero de secuencias de ADN de un gen de referencia endgeno (para usarlo como
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

14

normalizador), as como el nmero de secuencias de ADN diana especficas del


OGM. El gen de referencia debe escogerse de manera que sea especfico de la
especie, presente en una sola copia por genoma haploide, representado como tal de
manera estable en lneas diferentes de la misma especie y tan amplificable como los
caracteres GM en el anlisis (aunque esto se deba ms a un buen diseo de
cebadores-sonda). En la cuantificacin relativa se plantea un problema debido a la
interpretacin del porcentaje de contenido de OGM, que no se especifica en la
legislacin; por consiguiente, puede entenderse como contenido en OGM (en
porcentaje) el peso del ingrediente modificado puro en relacin con el peso total del
ingrediente puro (p. ej., peso de maz GM con respecto al peso total del maz
contenido en la muestra). Desde un punto de vista analtico, es conveniente calcular
el porcentaje de OGM como el nmero de secuencias de ADN diana por secuencia
especfica de taxn diana, pero esta definicin no incorpora algunas caractersticas
importantes de las lneas de OGM; por este motivo, es preciso sopesar
cuidadosamente los siguientes parmetros en la interpretacin de los resultados:
a) La ploida de la transformacin. Es posible que la modificacin gentica tenga una
ploida diferente de la de la transformacin wt (p. ej., tetraploide en vez de diploide).
b) La cigosidad del evento. El carcter GM podra ser homocigtico o heterocigtico.
c) El nmero de inserciones por genoma haploide de una nica construccin
gentica artificial. Un construccin gentica se puede insertar en una nica copia por
genoma haploide o en varias copias.
El punto c) puede obviarse diseando el sistema cebador-sonda en la frontera de la
insercin de la construccin gentica en el genoma. Como las secuencias de
frontera son nicas, el sistema as construido presentar la doble ventaja de ser
especfico de la transformacin y excluir de la cuantificacin las inserciones mltiples
de la misma construccin gentica. Los puntos a) y b) se resuelven empricamente
utilizando materiales de referencia que sean homogneos con la muestra (p. ej.,
material de referencia de harina de maz para cuantificar la harina de maz).
Alternativamente, pueden calibrarse patrones de cuantificacin diferentes de los
materiales de referencia certificados (p. ej., secuencias de ADN clonadas o mezclas
de ADN genmico) utilizando materiales de referencia certificados a fin de corregir
las discrepancias moleculares en la cuantificacin. Una manera ampliamente
aceptada de solventar los problemas relacionados con los puntos a) y b) es expresar
el porcentaje de OGM en trminos de genomas haploides.
En cualquier caso, es preciso tener en cuenta este aspecto de la cuantificacin al
desarrollar el mtodo, dado que el lmite de deteccin (LOD) y el lmite de

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

15

cuantificacin (LOQ) se ven influidos por el nmero real de copias que se


cuantifican.

Diseo de un experimento de cuantificacin de OGM en tiempo real


El diseo de un anlisis de la PCR en tiempo real debe incluir los siguientes
componentes:
- Un sistema de PCR diseado para detectar una secuencia de ADN diana
especfica de un OGM.
- Un segundo sistema de PCR diseado para detectar una secuencia de referencia
endgena, posiblemente especfica de la especie, pero que se pueda utilizar como
normalizador en los clculos de la concentracin o las concentraciones relativas
de OGM.
- Curvas patrn para la diana y la referencia endgena. Para cada muestra
experimental, se determina la cantidad de diana y de referencia endgena a partir de
la curva patrn adecuada. La cantidad de diana se normaliza con la cantidad de
referencia endgena para obtener la concentracin relativa de la diana. Para
satisfacer los requisitos estadsticos, las curvas patrn deben incluir por lo menos 4
puntos de concentracin distintos. Cada punto de la curva patrn, as como la
muestra, debe cargarse al menos por triplicado.
Adems, habr que aadir un control negativo (NTC o control sin ADN molde) tanto
respecto al gen de referencia como a las cuantificaciones de OGM. Pueden utilizarse
tambin otros controles (p. ej., control negativo de la diana de ADN y control positivo
de la diana de ADN).
Por ltimo, la cuantificacin del gen de referencia y de la secuencia especfica del
OGM debe tener lugar en el mismo ciclo de PCR (coamplificacin), no en ciclos
diferentes, para evitar una posible fluctuacin estadstica entre experimentos
distintos.

PCR en tiempo real Mltiplex


Dependiendo de las sustancias y del instrumental utilizados en la cuantificacin, es
posible disear PCR en tiempo real para llevar a cabo la cuantificacin de las
secuencias de referencia y OGM por separado en tubos distintos o en los mismos
tubos en tanto que reaccin Mltiplex.
Ambas posibilidades tienen sus ventajas y sus inconvenientes. Con las reacciones
mltiples se ahorran tiempo y reactivos (es posible analizar el doble de muestras en
un nico experimento) y se evitan los errores de configuracin entre la medida del

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

16

gen de referencia y del gen diana del OGM, al producirse en el mismo tubo, pero
resultan menos sensibles (en trminos de LOQ) a causa de la interferencia entre las
dos reacciones y del distinto consumo de reactivos en ambas. El uso de reacciones
separadas para medir el gen de referencia y el gen diana del OGM, por su parte,
permite obtener mayor sensibilidad en trminos de LOQ, pero exige disponer del
doble de reactivos y de pocillos en el equipo de PCR en tiempo real, y es mayor el
riesgo que suponen, p. ej., los errores de pipeteado, al medir una muestra. La
disponibilidad de mltiples colorantes delatores para las sondas TaqMan permite
detectar la amplificacin de ms de una diana en el mismo tubo. El colorante delator
(FAM) puede distinguirse del otro (VIC) gracias a las diferentes longitudes de onda
de sus mximos de emisin. As por ejemplo, la disponibilidad de mltiples
colorantes con distintas longitudes de onda de emisin (FAM, TET, VIC y JOE)
permite realizar ensayos TaqMan Mltiplex. El colorante TAMRA se usa como
inhibidor en la sonda y el ROX como referencia pasiva en la mezcla de reaccin. Se
recomienda la combinacin de FAM (diana) y VIC (control endgeno) para obtener
los mejores resultados, ya que la diferencia entre sus mximos de emisin es la ms
amplia. Por el contrario, JOE y VIC nunca deben combinarse. La realizacin de
ensayos TaqMan Mltiplex en los sistemas de deteccin de secuencias ABI PRISM
7700, 7900, 7500, 7300 y 7000 es posible gracias a su capacidad para detectar
colorantes mltiples con longitudes de onda de emisin distintas.

Anlisis grfico de los datos de una PCR en tiempo real


A medida que progresa la PCR, se recogen datos sobre fluorescencia (valores Rn)
para construir un grfico de la cantidad de seal frente al nmero de ciclo (es decir,
el tiempo). Habitualmente el grfico se construye a escala semilogartmica. En la
PCR en tiempo real es posible distinguir tres fases distintas: una primera fase de
latencia con ligeras fluctuaciones en los valores correspondientes a la seal de
fondo; una segunda fase exponencial, con valores que se incrementan en paralelo, y
una tercera fase en la que los valores tienden a situarse en una meseta (figura 8).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

17

Fase
exponencial

Intervalo
meseta

Valor umbral

Fluorescencia de
fondo

Figura 8. Grfico de la PCR en tiempo real. Se sealan las fases tpicas de una PCR
en tiempo real.

Si la PCR en tiempo real constituye una herramienta potente, esto se debe a que la
cuantificacin no se produce en la fase final de la reaccin (la meseta), sino en la
fase en que el crecimiento exponencial de la cantidad de ADN amplificado (Rn)
alcanza un valor significativamente superior a la seal de fondo. Al medir de esta
manera, mejora considerablemente la exactitud de la cuantificacin, ya que existe
una correlacin directa entre la cantidad de plantilla inicial y la fase en la que la
amplificacin empieza a ser exponencial. En la PCR en tiempo real, se define
experimentalmente como ciclo umbral (CT) aquel ciclo en que la seal de
fluorescencia alcanza el valor medio de las seales de fluorescencia medidas entre
el ciclo tercero y el decimoquinto incrementado en diez desviaciones estndar.
Cuanto mayor es la cantidad inicial de ADN genmico, antes se detecta el producto
acumulado en el proceso de la PCR, y ms bajo es el valor CT. En la prctica, a
menudo es el operador el que elige la lnea umbral que determina el valor CT, lo que
constituye uno de los elementos subjetivos de la PCR en tiempo real. La lnea
umbral debe situarse por encima de cualquier actividad basal y dentro de la fase de
crecimiento exponencial, que adquiere forma lineal en la transformacin logartmica
(todas las lneas son paralelas). Debe situarse siempre en el nivel en que empiezan
a coincidir ms los grficos de las rplicas. A veces las rplicas presentan, al

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

18

comienzo de la fase exponencial, una ligera divergencia que se atena o desaparece


segn progresa la reaccin.

Clculo del contenido en OGM


El resultado de una PCR en tiempo real es un valor Rn, diferencia entre Rn+ (seal
de fluorescencia que incluye todos los componentes) y Rn- (seal de fondo de la
reaccin lnea de base de la lectura de una muestra de control sin plantilla).
El contenido de OGM de una muestra se puede determinar de dos maneras:
1. Se trazan dos curvas patrn, basadas en cantidades distintas de ADN:
- la primera con un sistema de cuantificacin especfico para el gen de referencia;
- la segunda con un sistema de cuantificacin especfico para la diana GM.
Para cada muestra, se determinan mediante interpolacin con la curva patrn las
cantidades correspondientes a la diana especfica y al gen de referencia. Luego se
calcula el contenido (porcentaje) de ADN GM como el cociente entre la cantidad de
la secuencia diana GM y la cantidad de la secuencia del gen de referencia
(GM/referencia * 100).
Conviene tener presente que, necesariamente, las muestras analizadas deben estar
situadas entre los lmites inferior y superior de ambas curvas patrn. Es preciso
excluir los valores atpicos, ya que suelen relacionarse con errores de cuantificacin.
2. Mtodo de comparacin de CT (CT): En este mtodo no se usan cantidades
conocidas de patrones, sino que se compara la cantidad relativa de la secuencia
diana del OGM con la secuencia del gen de referencia. La curva patrn se obtiene
cargando una serie de muestras con concentraciones diferentes y conocidas del
OGM (p. ej., materiales de referencia certificados del IRMM). El resultado es una
curva patrn de valores CT (CT = CT gen de referencia - CT

OGM).

El contenido de OGM

se obtiene calculando el valor CT de la muestra y comparndolo con los valores


obtenidos con los patrones.
Para que este mtodo d buenos resultados, es preciso que las eficiencias de
amplificacin de los sistemas de PCR diana y de referencia sean similares. Una
manera sensible de controlarlo es fijarse en cmo vara CT (la diferencia entre los
dos valores CT de dos PCR correspondientes a la misma cantidad inicial de plantilla)
con la dilucin de la plantilla. Si las eficiencias de los dos amplicones son
aproximadamente iguales, la representacin grfica del logaritmo de la cantidad
frente a CT ser una lnea casi horizontal (pendiente <0,10). Esto significa que
ambas PCR tienen la misma eficiencia en el intervalo de cantidades de plantilla
iniciales. Si el grfico pone de manifiesto que la eficiencia es desigual, deber
aplicarse el mtodo de la curva patrn para cuantificar los OGM. Debe determinarse

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

19

el intervalo dinmico para: 1) las concentraciones mnima y mxima de las dianas


para las que los resultados son exactos y 2) las razones mnima y mxima de dos
cantidades de gen para las que los resultados son exactos. En la PCR en tiempo
real competitiva convencional, el intervalo dinmico se limita a una proporcin
diana/competidor de aproximadamente 10:1 a 1:10 (la mxima exactitud se obtiene
para una proporcin 1:1). La PCR en tiempo real puede conseguir un intervalo
dinmico mucho ms amplio.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

20

Bibliografa
Reglamento (CE) n 1829/2003 del Parlamento Europeo y del Consejo, de 22 de
septiembre de 2003, sobre alimentos y piensos modificados genticamente, DO L
268 de 18.10.2003, pp. 1-23.
Reglamento (CE) n 1830/2003 del Parlamento Europeo y del Consejo, de 22 de
septiembre de 2003, relativo a la trazabilidad y al etiquetado de organismos
genticamente modificados y a la trazabilidad de los alimentos y piensos producidos
a partir de stos, y por el que se modifica la Directiva 2001/18/CE, DO L 268 de
18.10.2003, pp. 24-28.
Ahmed, F.E. (2002). Detection of genetically modified organisms in foods.
Trends in Biotechnology 5, 215-23.
Forster, T. (1948). Zwischenmolekulare Energiewanderung und Fluoreszenz. Ann
Phys (Leipzig) 2, 55-75.
Giacca, M., Zentilin, L., Norio, P., Diviacco, S., Dimitrova, D., Contreas, G., Biamonti,
G., Perini, G., Weighardt, F., Riva, S. y Falaschi, A. (1994). Fine mapping of a
replication origin of human DNA. Proceedings of the National Academy of Science
USA 91, 7119-23.
Hardegger, M., Brodmann, P. y Hermann, A. (1999). Quantitative detection of the
35S promoter and the nos terminator using quantitative competitive PCR. European
Food Research Technology 209, 8387.
Haugland, R.P. (2002). The Handbook of Fluorescent Probes and Research
Products,

Ninth

Edition.

Molecular

Probes,

Inc.

http://www.invitrogen.com/site/us/en/home/References/Molecular-Probes-TheHandbook.html (ltimo acceso enero de 2010)


Higuchi, R., Dollinger, G., Walsh, P.S. y Griffith, R. (1992). Simultaneous
amplification and detection of specific DNA sequences. Biotechnology 10, 413417.
Higuchi, R., Fockler, C., Dollinger, G. y Watson, R. (1993). Kinetic PCR: Real-time
monitoring of DNA amplification reactions. Biotechnology 11, 10261030.
Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

PCR Cuantitativa para la Deteccin de OGM

21

Kutyavin, I.V., Afonina, I.A., Mills, A., Gorn, V.V., Lukhtanov, E.A., Belousov, E.S.,
Singer, M.J., Walburger, D.K., Lokhov, S.G., Gall, A.A., Dempcy, R., Reed, M.W.,
Meyer, R.B. y Hedgpeth, J. (2000). 3'-minor groove binder-DNA probes increase
sequence specificity at PCR extension temperatures. Nucleic Acids Research 28,
655-61.
Lakowicz, J.R. (1983). Principles of Fluorescence Spectroscopy, Plenum Press, New
York, chapter 2.
Lie, Y. S. y Petropoulos, C. J. (1998). Advances in quantitative PCR technology: 5'
nuclease assays. Current Opinion Biotechnol 9, 43-48.
Studer, E., Rhyner, C., Lthy, J. y Hbner, P. (1998). Quantitative competitive PCR
for the detection of genetically modified soybean and maize. Zeitschrift fr
Lebensmittel-Untersuchung und -Forschung A 207, 207213.
Thelwell, N., Millington, S., Solinas, A., Booth, J. y Brown, T. (2000). Mode of action
and application of Scorpion primers to mutation detection. Nucleic Acids Research
28, 3752-3761.
Tyagi, S. y Kramer, F.R. (1996). Molecular Beacons: Probes that fluoresce upon
hybridisation. Nature Biotechnology 14, 303-308.
Vatilingom, M., Pijnenburg, H., Gendre, F. y Brignon, P. (1999). Real-time
quantitative PCR detection of genetically modified Maximizer maize and Roundup
Ready soybean in some representative foods. Journal of Agricultural Food Chemistry
47, 52615266.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 10

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 11
Deteccin Cuantitativa de la Soja Roundup Ready
mediante PCR en Tiempo Real
N. Foti

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

ndice
Sesin n 11
Deteccin Cuantitativa de la Soja Roundup Ready mediante PCR en
Tiempo Real

Prctica

Introduccin

PCR en tiempo real utilizando el ABI PRISM 7700

PCR en tiempo real utilizando el lightcycler (Roche)

Bibliografa

15

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

Prctica
Introduccin
Los protocolos siguientes son mtodos basados en la PCR en tiempo real para la
cuantificacin de una lnea de soja GM especfica (soja Roundup Ready) en material
bruto y transformado. Las cuantificaciones de la PCR en tiempo real se llevan a
cabo con dos termocicladores de PCR distintos equipados para detectar la
amplificacin en tiempo real midiendo la fluorescencia: el ABI PRISM 7700 SDS
(Applied Biosystems) y el LightCycler (Roche).
La PCR en tiempo real se utiliza para amplificar una secuencia de ADN diana de
referencia endgena (particular de la soja), ms una secuencia de ADN diana que
indica la presencia de soja genticamente modificada (soja Roundup Ready).
Ambos ensayos comprenden dos sistemas de PCR independientes, cada uno de
ellos con sus propios cebadores de ADN y sondas marcadas por colorantes. Un
sistema de PCR detecta una secuencia de ADN diana especfica del OGM y el otro
es un sistema de referencia endgeno que acta como referencia cuantitativa para
detectar soja GM y no GM.
Nota: Los protocolos que figuran en el presente Manual se han seleccionado por su
valor didctico y deben considerarse ejemplos bsicos de cuantificacin de OGM
mediante el mtodo de la PCR en tiempo real. Recomendamos la consulta peridica
de las fuentes y la bibliografa pertinentes para conocer los protocolos desarrollados
y validados ms recientemente. Ntese adems que estos protocolos se han
seleccionado en funcin del instrumental disponible en nuestro laboratorio. Ni el CCI
ni la OMS promueven en modo alguno el uso exclusivo de una marca comercial
concreta.

PCR en tiempo real utilizando el ABI PRISM 7700


Protocolo de la PCR en tiempo real especfica de la soja RR: mtodo de PCR
Mltiplex

Este mtodo consiste en una amplificacin/cuantificacin del gen de referencia de la


lectina y una parte del casete insertado de soja RR utilizando un ensayo de PCR
Mltiplex (dos PCR en el mismo tubo) (Foti et al., 2006). Las sondas TaqMan de
lectina y RR se marcan con los colorantes VIC y FAM respectivamente, lo que

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

permite detectar la amplificacin de ms de una diana en el mismo tubo. El colorante


delator (FAM) puede distinguirse del VIC gracias a las diferentes longitudes de
onda de sus mximos de emisin. El ABI PRISM 7700 SDS es capaz de detectar
mltiples colorantes con longitudes de onda de emisin distintas.
La cantidad de colorante de la soja RR (FAM) se normaliza con la cantidad de
colorante de la materia vegetal (VIC) detectada en cada muestra. Se obtiene as un
valor CT para cada muestra replicada, que se promedia. Estos valores se comparan
con una curva de calibracin obtenida del CT de los patrones con concentracin
conocida de soja RR (mtodo CT comparativo o CT).
Este procedimiento ha sido aplicado con xito a varias materias primas, ingredientes
y alimentos que contienen soja (p. ej., piensos, bebidas de soja, yogures, harinas,
lecitina, etc.).
El rendimiento analtico del mtodo ha sido comprobado satisfactoriamente durante
varios procedimientos de ensayo de la aptitud (p. ej., FAPAS, GIPSA).

Instrumental y reactivos

Sistema detector de secuencias ABI PRISM 7700 (Applied Biosystems)

Placas de reaccin de 96 pocillos MicroAmp Optical (N Cat. N801-0560)

Tapas MicroAmp Optical (N Cat. N801-0935)

Mezcla maestra de PCR universal TaqMan (N Cat. 4304437) 2X con el siguiente


contenido:

ADN polimerasa AmpliTaq Gold en Tampn TaqMan 2x (5U/l),

AmpErase UNG (1U/ml), dNTP 200 M con dUTP, Referencia pasiva 1

Microcentrfuga

Centrifugadora refrigerada para tubos cnicos de 15 ml

Micropipetas

Mezclador de torbellino

Soporte para tubos de reaccin

Tubos para microcentrfuga de 1,5 ml

Tubos de centrifugacin cnicos de polipropileno de 15 ml

Agua sin nucleasa

Cebadores especficos (Le-F y Le-R) y sonda (Le-Probe) del gen de referencia

Cebadores especficos (RR-F y RR-R) y sonda (RR-Probe) del transgn.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

Caractersticas de los cebadores y la sonda del gen de referencia

Secuencia
Longitud (pb)
Peso molecular

Secuencia
Longitud (pb)
Peso molecular

Secuencia
Longitud (pb)
Peso molecular

Le-F
TCC ACC CCC ATC CAC ATT T
19
5586,0

Le-R
GGC ATA GAA GGT GAA GTT GAA GGA
24
7532
Le-Probe
5-(VIC)-AAC CGG TAG CGT TGC CAG CTT
CG-(TAMRA)-3'
23
7019,0

Caractersticas de los cebadores y la sonda del transgn

Secuencia
Longitud (pb)
Peso molecular

RR-F
GCC ATG TTG TTA ATT TGT GCC AT
23
7014

Secuencia
Longitud (pb)
Peso molecular

RR-R
GAA GTT CAT TTC ATT TGG AGA GGA C
25
7712

Secuencia
Longitud (pb)
Peso molecular

RR-Probe
5-(FAM)-CTT GAA AGA TCT GCT AGA
GTC AGC TTG TCA GCG-(TAMRA)-3'
33
10137

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

Preparacin de la mezcla maestra

Descongelar, agitar suavemente y centrifugar la cantidad de componentes que exige


la reaccin. Los reactivos descongelados deben mantenerse en hielo.

A uno de los tubos de centrifugacin de 15 ml mantenido en hielo, aadir los


siguientes componentes en el orden en que se mencionan (salvo el ADN) para
preparar las mezclas maestras. Cada extracto de ADN se analizar por triplicado.
Ntese que se preparan cuatro mezclas de reaccin ms para ayudar a calcular los
errores de pipeteado debidos a la viscosidad de la solucin.

Cuadro 1. Preparacin de la mezcla maestra para una placa de ensayo de PCR Mltiplex.
Concentracin en la
PCR
Agua desionizada estril
Mezcla maestra universal
TaqMan 2X
Cebador Le-F (20 M)

Mezcla
Mezcla maestra Mezcla maestra
maestra
para una
para una placa
(32+4 muestras)
para el
muestra
recipiente (3 repeticiones)
de reaccin
(l)
18,3
54,9
1976,4

1x

25

75

2700

40 nM

0,1

0,3

10,8

Cebador Le-R (20 M)


Cebador RR-F (20 M)

40 nM

0,1

0,3

10,8

100 nM

0,25

0,75

27

Cebador RR-R (20 M)

100 nM

0,25

0,75

27

Sonda Le-Probe (10 M)

100 nM

0,5

1,5

54

Sonda RR-Probe (10 M)

100 nM
50-250 ng

0,5

1,5

54

15

50

150

ADN
TOTAL

Agitar suavemente y centrifugar brevemente.

Preparar un tubo de microcentrifugacin de 1,5 ml para cada muestra de ADN que


se vaya a someter a ensayo: muestras de curvas patrn (soja RRCRM al 0,1, 0,5,
1, 2, y 5 %) muestras desconocidas y muestras de control (0 % de soja RR, ADN de
soja RR y control sin plantilla o NTC).

Aadir a cada tubo de microcentrifugacin la cantidad de mezcla maestra necesaria


para 3 repeticiones (135 l de mezcla maestra). Aadir a cada tubo la cantidad de
ADN necesaria para 3 repeticiones (es decir, 15 l de ADN). Agitar en el mezclador
de torbellino al menos tres veces durante aproximadamente 10 segundos. Este paso

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

es muy importante, ya que contribuye a reducir al mnimo la variabilidad entre las


cuatro rplicas de cada muestra.

Pasar brevemente por una microcentrfuga. Colocar la placa de reaccin de 96


pocillos sobre una base y verter una alcuota de 50 l en cada pocillo
horizontalmente de izquierda a derecha. Tras aadir las mezclas maestras a una fila
vertical de pocillos, cubrirlos con tapas pticas utilizando el instrumento
correspondiente.
Nota: no debe escribirse en la placa ptica ni tocar la tapa.

Cerciorarse de que las alcuotas de mezcla maestra cargadas estn en el fondo de


los pocillos, sin que haya salpicaduras ni burbujas en los lados o las tapas.

Colocar la placa en el instrumento ABI PRISM 7700; abrir una nueva ventana de
configuracin de placa para asignar el tipo de muestra a cada pocillo: el tipo de
muestra de control interno (IPC) est asociado al colorante VIC y la incgnita
(UNKN) a la capa de colorante FAM.

Someter las muestras a los ciclos descritos en el cuadro 2.

Cuadro 2. Programa de ciclos del ensayo Mltiplex de la soja RR en el SDS ABI PRISM
7700.
Seleccionar: Modo PCR en tiempo real
Volumen de reaccin de 50 l
Paso:
1
2
3
4

Fase
UNG
Desnaturalizacin inicial
Amplificacin
Desnaturalizacin
Hibridacin y
extensin

T C
50o C
95o C
95o C
60o C

Tiempo
120 s
600 s
15 s
60 s

Adquisicin
No
No
No
Medida

Ciclos
1x
1x
45x

Anlisis de los datos e interpretacin de los resultados


Una vez completada la ronda, se analizan los datos usando el software del SDS ABI
PRISM 7700, obtenindose los valores CT de cada colorante delator para cada
muestra.
Es importante numerar correctamente las muestras en la ventana Plate Setup del
software del SDS. Cada pocillo debe recibir un nmero nico en el campo Replicate;
las rplicas de la misma muestra deben recibir el mismo nmero.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

Se analiza la ronda seleccionando analyse en el men de anlisis para acceder


automticamente a la ventana de grfico de amplificacin; se ajusta el valor umbral
para las capas FAM y VIC.
Tras el anlisis, se exportan los resultados de la ronda en un archivo excel. Al abrir
el archivo de resultados exportado en Microsoft Excel, aparecer un cuadro que
contendr dos conjuntos de datos correspondientes a las capas de colorante FAM y
VIC con los valores CT de cada pocillo.
Se calculan los promedios CT (FAM) y CT (VIC) de cada grupo de rplicas para
calcular los valores CT (CT FAM CT VIC).
Para cada muestra, se calcula el porcentaje de OGM analizando el CT de la
muestra, comparndolo con el conjunto de valores log (% OGM) y CT obtenidos del
conjunto de patrones de concentracin.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

PCR en tiempo real utilizando el LightCycler (Roche)


Protocolo de la PCR en tiempo real especfica de la soja RR
Este mtodo consiste en una amplificacin/cuantificacin del gen de referencia
lectina y una parte del casete insertado de soja RR, realizadas en dos reacciones
PCR independientes (BgVV, EU Tender Report, 2000). Los dos sistemas de PCR
utilizan sondas marcadas con FAM.
Para cada muestra, se determina la cantidad de secuencias especficas de soja GM
y la secuencia del gen de referencia (lectina) a partir de las adecuadas curvas patrn
preparadas, tanto para el transgn, como para el gen de referencia. El contenido de
soja GM se divide por la cantidad de gen de referencia, obtenindose as un valor
normalizado de soja GM.

Instrumental y reactivos

Sistema Roche LightCycler

Capilares para muestras LightCycler, Roche, N Cat. 1909339

Adaptador de capilares LightCycler, Roche, N Cat. 1909312

Sondas de hibridacin FastStart DNA Master para LightCycler,

Roche, N Cat.

3003248 con ADN polimerasa Taq FastStart, mezcla de dNTP (con dUTP en lugar
de dTTP) y Tampon de reaccin, conc. 10x; agua esterilizada de grado PCR

Seroalbmina

bovina

(SAB),

sin

nucleasa

(libre

de

ribonucleasa

dexosirribonucleasa) p. ej., Promega N Cat. R9461 (1 g/l)

ADN polimerasa Taq Platinum 5U/l (junto con el Tampon original 10x y MgCl2 50
mM), Invitrogen Life Technologies N Cat. 10966026

Microcentrfuga

Micropipetas

Mezclador de torbellino

Soporte para tubos de reaccin

Tubos para microcentrfuga de 1,5 ml

Agua sin nucleasa

Cebadores especficos (GM1-F y GM1-R) y sonda (GM1-Probe) del gen de


referencia

Cebadores especficos (GM2F, GM2-R) y sonda (GM2-Probe) del transgn.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

10

Caractersticas de los cebadores y la sonda del gen de referencia


GM1-F
5'-CCA GCT TCG CCG CTT CCT TC-3'

Secuencia

GM1-R
5'-GAA GGC AAG CCC ATC TGC AAG CC-3'

Secuencia

Secuencia

GM1-Probe
5'-(FAM)-CTT CAC CTT CTA TGC CCC TGA CAC -(TAMRA)-3'

Caractersticas de los cebadores y la sonda del transgn

Secuencia

GM2-F
5'-CAT TTG GAG AGG ACA CGC TGA-3'

Secuencia

GM2-R
5'-GAG CCA TGT TGT TAA TTT GTG CC-3'

Secuencia

GM2-Probe
5'-(FAM)-CAA GCT GAC TCT AGC AGA TCT TTC (TAMRA)-3'

Curvas patrn
En cada ronda se generan las dos curvas patrn con 5 diluciones patrn de ADN
diferentes. Se efectan reacciones simples con cada ADN patrn de calibracin con
ambas mezclas maestras.
Se construyen curvas patrn para la cuantificacin del ADN de soja total y de la
secuencia GM con soluciones de ADN patrn a valores de concentracin
decrecientes comenzando con el 2 % de ADN de soja RR con Tampon TE (0,1 M,
pH 8,0). Se utilizarn aproximadamente 100 ng de ADN para el primer punto de las
curvas patrn. Las diluciones y concentraciones de las curvas patrn se resumen en
el cuadro 3.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

11

Cuadro 3. Cantidad de ADN y diluciones de las curvas patrn.

PTR 1
PTR 2
PTR 3
PTR 4
PTR 5

Cantidad de ADN
(ng)/reaccin

% de
ADN de
soja

% de ADN
GM

Factor de
dilucin

100
50
25
12,5
6,25

100
50
25
12,5
6,25

2
1
0,5
0,25
0,125

1:2
1:4
1:8
1:16

Preparacin de la mezcla maestra

Descongelar, agitar suavemente y centrifugar la cantidad de componentes requerida


para la ronda. Los reactivos descongelados deben mantenerse en hielo.

Para cada sistema, aadir los siguientes componentes en el orden en que se


mencionan (salvo el ADN) a un tubo de centrifugacin de 1,5 ml mantenido en hielo
para preparar las mezclas maestras. Ntese que las dos mezclas de reaccin llevan
un exceso de volumen para tener en cuenta los errores de pipeteado debidos a la
viscosidad de la solucin.

Cuadro 4. Preparacin de la mezcla maestra para el sistema GM1.

Componente
Tampn pol.asa Taq Platinum 10x
MgCl2 (50 mM)
dATP, dGTP, dCTP,dTTP (4 mM)
Cebador GM1-F (20 M)
Cebador GM1-R (20 M)
GM1-Probe (10 M)
SAB sin nucleasa (1 g/l)
Polimerasa Taq Platinum (5 U/l)
Agua sin nucleasa
ADN
Volumen total:

Concentracin
en la PCR
1x
4 mM
0,8 mM
500 mM
500 nM
200 nM
0,1 mg/ml
0,8 U
#

l/reaccin

Total l
(para 18
reacciones)

2
1,6
4
0,5
0,5
0,4
2
0,16
6,85
2

36
28,8
72
9
9
7,2
36
2,9
123,5

18 l+2 l
ADN

324,2 l
(sin ADN)

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

12

Cuadro 5. Preparacin de la mezcla maestra para el sistema GM2.

Componente

Concentracin
en la PCR

Tampn pol.asa Taq Platinum 10x


MgCl2 (50 mM)
dATP, dGTP, dCTP,dTTP (4 mM)
Cebador GM2-F (20 M)
Cebador GM2-R (20 M)
GM2-Probe (10 M)
SAB sin nucleasa (1 g/l)
Polimerasa Taq Platinum (5 U/l)
Agua sin nucleasa
ADN

1x
4 mM
0,8 mM
500 mM
500 nM
200 nM
0,1 mg/ml
0,8 U
#

Volumen total:

l/reaccin

Total l
(para 18
reacciones)

2
1,6
4
0,5
0,5
0,4
2
0,16
6,85
2

36
28,8
72
9
9
7,2
36
2,9
123,5

18 l+2 l
ADN

324,2 l
(sin ADN)

Agitar suavemente y centrifugar brevemente.

Preparar dos (uno para el sistema GM1 y otra para el GM2) tubos de reaccin de 0,5
ml para cada muestra de ADN que se vaya a someter a ensayo (muestras de curva
patrn y muestras desconocidas).

Aadir a cada tubo la cantidad de mezcla maestra necesaria para 2 repeticiones (36
l de mezcla maestra). Aadir a cada tubo la cantidad de ADN adecuada para 2
repeticiones (es decir, 4 l de ADN). Agitar en el mezclador de torbellino al menos
tres veces durante aproximadamente 10 segundos. Este paso es muy importante
para reducir al mnimo la variabilidad entre las rplicas de cada muestra.

Colocar los capilares en el adaptador de centrifugacin preenfriado.

Pipetear 20 l de mezcla maestra a cada capilar segn el esquema facilitado. (vase


el cuadro 6 Configuracin de las placas orden de carga - carrusel LightCycler
estndar).

Pasar brevemente por una microcentrfuga a baja velocidad (aprox. 1 150 rpm). Esta
etapa garantiza la concentracin de todo el volumen de la mezcla de reaccin en la
punta del capilar.

Transferir los capilares al carrusel LightCycler (Roche).

Someter las muestras a los ciclos descritos en el cuadro 7.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

13

Cuadro 6. Configuracin de las placas orden de carga del carrusel LightCycler: posiciones
1 a 16 = sistema GM1, posiciones 17 a 32 = sistema GM2. Cada muestra de ADN por
duplicado para los sistemas del gen de referencia y del transgn (OGM)
Posici
n

Muestra
(%)

Posici
n

Muestra
(%)

Posici
n

Muestra
(%)

PTR (100)

13

U2

25

PTR (0,125)

PTR (100)

14

U2

26

PTR (0,125)

PTR (50)

15

NTC

27

U1

PTR (50)

16

NTC

28

U1

PTR (25)

17

PTR (2)

29

U2

PTR (25)

18

PTR (2)

30

U2

PTR (12,5)

19

PTR (1)

31

NTC

PTR (12,5)

20

PTR (1)

32

NTC

PTR (6,25)

21

PTR (0,5)

10

PTR (6,25)

22

PTR (0,5)

11

U1

23

PTR (0,25)

12

U1

24

PTR (0,25)

Cuadro 7. Programa de ciclos para el sistema LightCycler


Seleccionar: pendiente 20 C/s en todos los pasos.
Modo pantalla fluorescente: F1/1
Desnaturalizacin:
Ciclos:

Tipo:

Ninguno

N
de Temp.
segmento
1

96 C

Modo pantalla fluorescente

F1/1

Tiempo

Pendiente

Temp.
2
diana

Incremento

Demora del
incremento
(ciclos)

Modo de
adquisicin

120 s

20 C/s

0 C

0 C

Ninguno

Ciclos:
Ciclos:

45

Tipo:

Cuantificacin

N
de Temp.
segmento

Modo pantalla fluorescente

Tiempo Pendiente

F1/1

Temp.
2
diana

Incremento

Demora del
incremento
(ciclos)

Modo de
adquisicin
Ninguno

95 C

5s

20 C/s

0 C

0 C

60 C

15 s

20 C/s

0 C

0 C

Sencillo

72 C

15 s

20 C/s

0 C

0 C

Ninguno

Refrigeracin:
Ciclos:

Tipo:

Ninguno

N
de Temp.
segmento
1

40 C

Modo pantalla fluorescente

F1/1

Tiempo

Pendiente

Temp.
2
diana

Incremento

Demora del
incremento
(ciclos)

Modo de
adquisicin

30 s

20 C/s

0 C

0 C

Ninguno

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

14

Durante la ronda, hacer clic en el botn EDIT SAMPLE e introducir los nombres de las
muestras en la pantalla de carga. Definir todas las posiciones (incluido el ADN calibrador)
como Unknowns.

Anlisis de los datos e interpretacin de los resultados

Para analizar los datos, seleccionar Fluorescence F1/F2 en la ventana frontal de


anlisis de datos.

Para cuantificar, hacer clic en el botn de cuantificacin.

El software de LightCycler ofrece dos mtodos de cuantificacin distintos: el mtodo


del mximo de la segunda derivada y el mtodo de los puntos de ajuste. Para la
cuantificacin con el kit de deteccin de ADN de soja RR es preferible utilizar el
segundo mtodo. Seleccionar lo siguiente: ajuste de la lnea base = Proportional;
nmero de puntos = 2.

Realzar

la

curva

patrn

junto

con

todas

las

reacciones

desconocidas

correspondientes.

Abrir la carpeta Step 2: Noise Band.

Llevar la banda de ruido a una posicin de 0,1. Dicha banda puede desplazarse
manualmente utilizando el ratn o presionando el botn que se encuentra debajo del
botn Chance Graph Settings. Al pulsar este botn, aparece la ventana Manual
Cursor Adjustment y es posible definir el valor del cursor como 0,1.

Abrir la carpeta Step 3: Analysis.

En Step 3: Analysis se calculan los puntos de corte y las correspondientes


concentraciones de los patrones de calibracin y las plantillas de ADN
desconocidas.

Controlar el valor de r de la curva patrn. Son aceptables los valores de r -0,98,


siendo ptimo el valor r = -1.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Deteccin Cuantitativa de la Soja Roundup Ready mediante la PCR en Tiempo Real

15

Bibliografa
EU Tender Report. (2000). Development of qualitative as as well quantitative
detection methods to identify a genetic modification in soybean and maize
products. Report of the EU tender n. XXIV/98/A3/001.
LightCycler Operators Manual, version 3.0 (Roche Molecular Biochemicals).
User Bullettin #2. Relative quantitation of gene expression. ABI PRISM 7700
Sequence Detection System. PE Applied Biosystems, 1997.
User Bullettin #5. Mltiplex PCR with TaqM VIC probes .ABI PRISM 7700 Sequence
Detection System. PE Applied Biosystems, 1998.
Foti, N., Onori, R., Donnarumma, E., De Sanctis, B., and Miraglia, M. (2006). RealTime PCR multiplex method for the quantification of Roundup Ready soybean in
raw material and processed food. European Food Research and Technology
Journal 222, 209-216.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 11

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Sesin n 12
Deteccin Cuantitativa de la Soja Roundup Ready
mediante ELISA
F. Eyquem

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

ndice
Sesin n 12
Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

Introduccin

La tcnica ELISA

Prctica

12

Diagrama de flujo

21

Bibliografa

22

Bibliografa complementaria

22

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

Introduccin
La deteccin inmunolgica especfica de una protena nueva sintetizada por un gen
introducido durante la transformacin constituye un mtodo alternativo de
identificacin de plantas modificadas genticamente. Hay que tener presente, no
obstante, que la modificacin gentica no siempre tiene por finalidad especfica la
produccin de una protena nueva y no siempre se traduce en unos niveles de
expresin de la protena tiles para la deteccin. Adems, algunas protenas se
expresan solo en determinadas partes de la planta (estn utilizndose ya promotores
con especificidad tisular para fines concretos) o se expresan a niveles diferentes en
partes distintas o durante fases distintas del desarrollo fisiolgico.
Se ha comunicado que los niveles de expresin de los productos transgnicos en las
plantas se sitan entre el 0 y el 2 % de la protena soluble total, incluso con
utilizacin de potentes promotores constitutivos para activar la expresin (Longstaff,
1995). En la mayor parte de los casos, no obstante, los niveles de expresin
comunicados (p. ej., en cultivos GM aprobados) se sitan por debajo del lmite
superior del 2 % (Hemmer, 1997).
Los inmunoensayos son sistemas de medicin analtica que utilizan anticuerpos
como reactivos de ensayo. Los anticuerpos son protenas especficas aisladas a
partir del suero de animales que solo se unen fsicamente a la sustancia que ha
provocado su produccin. Los anticuerpos se fabrican inyectando la sustancia que
se quiere detectar (p. ej., CP4 EPSPS, la protena que confiere resistencia al
herbicida Roundup) a animales como el conejo o el ratn, cuyas clulas somticas
reconocen la sustancia como extraa y responden produciendo anticuerpos contra
ella. Despus se purifican los anticuerpos, se acoplan a un marcador detectable y se
utilizan como reactivos para detectar la sustancia de inters.
Un requisito previo para el desarrollo de mtodos inmunolgicos de deteccin es
disponer de anticuerpos especficos dirigidos contra la protena nueva que se quiere
detectar. Adems, es necesario que la muestra o las protenas de inters no se
degraden significativamente.
Los anticuerpos son un instrumento precioso para el bilogo en la deteccin y
cuantificacin de antgenos en mezclas complejas. Todos los inmunoensayos se
basan en la unin especfica del anticuerpo al antgeno.

Interacciones anticuerpo-antgeno
Al describir las propiedades de los anticuerpos en tanto que protenas, la mayora de
los inmunlogos citar la capacidad de estas molculas para precipitar los antgenos

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

de una solucin, aun cuando la precipitacin de anticuerpos apenas se utilice ya


para aislar o detectar antgenos experimentalmente y los anticuerpos raramente
precipitan antgenos in vivo, salvo en el caso de algunas enfermedades
autoinmunes. El valor pedaggico de la reaccin de precipitacin por anticuerpos,
ilustrada en la figura 1, es que refleja ntidamente muchas de las propiedades
fundamentales y universales de las molculas de anticuerpo. Esta tcnica
demuestra, entre otras cosas, que:

los anticuerpos (lgG) sricos son bivalentes en sus reacciones con antgenos y
tienen la capacidad de entrecruzar antgenos;

los antgenos son a menudo multivalentes en sus interacciones con los


anticuerpos;

los anticuerpos sricos suelen ser policlonales en la naturaleza, y

los anticuerpos son sumamente especficos en lo que se refiere a las estructuras


que reconocen en las molculas antignicas.

Cuadro 1. Curva de precipitacin de un sistema de un antgeno y sus anticuerpos.

ANTISUERO POLICLONAL

Mioglobina

Zona de exceso de
anticuerpos

Zona de
equivalencia

Zona de exceso de
antgeno

Sobrenadantes: Exceso de Ac
Exceso de Ag
ANTICUERPO MONOCLONAL

Anticuerpo precipitado

Antgeno aadido

En la representacin grfica de la cantidad de anticuerpo precipitada frente a la


concentracin de antgeno (siendo constante el total de anticuerpo) se distinguen
tres zonas:

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

- una zona de exceso de anticuerpo en la que queda inhibida la precipitacin y


puede detectarse un exceso de anticuerpo en el sobrenadante;
- una zona de equivalencia de precipitacin mxima, en la que anticuerpos y
antgenos forman grandes complejos insolubles (de tonos azules) y no se puede
detectar en el sobrenadante ni el antgeno ni el anticuerpo;
- una zona de exceso de antgeno en la que queda inhibida la precipitacin y
puede detectarse un exceso de antgeno en el sobrenadante.
Aun cuando la reaccin de precipitacin se presta magnficamente a la
caracterizacin de las interacciones entre anticuerpos policlonales y antgenos
multivalentes, no suele resultar muy til para caracterizar las interacciones entre
antgenos y anticuerpos monoclonales, salvo en caso de que los antgenos exhiban
mltiples eptopos idnticos (como las estructuras repetitivas de hidratos de carbono
que se encuentran en los polisacridos, por ejemplo).

Solo entonces podr un

anticuerpo monoclonal monoespecfico entrecruzar y precipitar antgeno. Sin


embargo, habitualmente los anticuerpos monoclonales se pueden caracterizar
mediante tipos de medicin ms refinados que aportan detalles sobre la interaccin
entre anticuerpo y antgeno, tales como la constante de equilibrio y las tasas
cinticas de asociacin y disociacin.
Nunca se insistir bastante en la utilidad de los anticuerpos para la deteccin y
aislamiento de antgenos, dado el amplio espectro de aplicaciones extremadamente
potentes de los anticuerpos que se ha ido desarrollando a lo largo de los aos. La
utilidad de los anticuerpos se ve adems reforzada por su estabilidad relativa en
varias reacciones de modificacin qumica, que alteran la estructura del anticuerpo
sin destruir su capacidad para unirse a antgenos. Los anticuerpos han sido
marcados qumicamente con compuestos fluorescentes, magnticos, radiactivos y
de otros tipos a fin de facilitar la deteccin o aislamiento de antgenos en
condiciones experimentales diversas.

Preparacin de anticuerpos monoclonales


El sistema inmunitario de un organismo es capaz de reconocer como invasoras las
sustancias extraas al mismo, como las bacterias y los virus patgenos y otros
agentes infecciosos, denominadas antgenos. Nuestras defensas naturales contra
estos agentes infecciosos son los anticuerpos, protenas que buscan los antgenos y
ayudan a destruirlos.
Los anticuerpos presentan dos caractersticas de gran utilidad. En primer lugar, son
extremadamente especficos, es decir, cada anticuerpo se une a un antgeno

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

particular para atacarlo. En segundo lugar, algunos anticuerpos, una vez activados
por la presencia de una enfermedad, siguen confiriendo resistencia a ella.
Esta segunda caracterstica es la que permite desarrollar vacunas. Una vacuna es
un preparado de bacterias o virus muertos o debilitados que, al ser introducido en el
organismo, estimula la produccin de los anticuerpos correspondientes a los
antgenos que contiene.
La primera caracterstica de los anticuerpos, su especificidad, es la responsable de
que la tecnologa de anticuerpos monoclonales sea tan valiosa. Los anticuerpos no
solo pueden utilizarse con fines teraputicos, para proteger de la enfermedad, sino
tambin en el diagnstico de una amplia variedad de enfermedades y en la
deteccin de la presencia en la sangre de medicamentos, de productos vricos y
bacterianos y de otras sustancias inusuales o anormales.
Dado que estas sustancias de lucha contra la enfermedad tienen usos muy diversos,
se ha investigado durante mucho tiempo su produccin en cantidades puras. El
mtodo convencional era inyectar el antgeno a un animal de laboratorio y luego, una
vez formados los anticuerpos, recogerlos del suero sanguneo (el suero sanguneo
que contiene anticuerpos se llama antisuero). Este mtodo, sin embargo, presenta
dos problemas: produce antisuero que contiene sustancias no deseadas y produce
una cantidad muy pequea de anticuerpos utilizables.
La tecnologa de anticuerpos monoclonales permite producir grandes cantidades de
anticuerpos puros utilizando clulas que producen anticuerpos de forma natural y
una clase de clulas que puede crecer continuamente en cultivo. Si formamos un
hbrido que combine la caracterstica de la inmortalidad con la capacidad de
producir la sustancia deseada disponemos, desde luego, de una fbrica de
anticuerpos en funcionamiento permanente.
En la tecnologa de anticuerpos monoclonales se fusionan clulas tumorales
capaces de replicarse indefinidamente con clulas de mamfero que producen un
anticuerpo. El resultado de esta fusin celular es un hibridoma que produce
anticuerpos continuamente. Estos anticuerpos se llaman monoclonales porque
proceden de un nico tipo de clula, el hibridoma, mientras que los producidos por
mtodos convencionales derivan de preparados que contienen muchos tipos de
clulas, por lo que se denominan policlonales. Se da a continuacin un ejemplo de la
obtencin de anticuerpos monoclonales.

Produccin de anticuerpos monoclonales


Un mieloma es un tumor de la mdula sea que puede adaptarse para que crezca
permanentemente en un cultivo. Al fusionar clulas de mieloma con clulas de bazo

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

de mamfero productoras de anticuerpos, se hall que las clulas hbridas


resultantes,

hibridomas,

producan

grandes

cantidades

de

anticuerpos

monoclonales. Este producto de una fusin celular combinaba las cualidades


deseadas de los dos tipos de clulas diferentes, a saber, la capacidad de
crecimiento continuo y la de producir grandes cantidades de anticuerpo puro.
Como las clulas hbridas seleccionadas producen un solo anticuerpo especfico,
son ms puros que los anticuerpos policlonales producidos mediante tcnicas
convencionales

pueden

resultar

ms

efectivos

que

los

medicamentos

convencionales para combatir la enfermedad, ya que estos no solamente atacan a la


sustancia extraa, sino tambin a las clulas del propio organismo, produciendo a
veces efectos secundarios no deseados tales como reacciones alrgicas. Los
anticuerpos monoclonales atacan a la molcula diana y solo a ella, y sus efectos
secundarios son mnimos o inexistentes.

Produccin de anticuerpos monoclonales


Inmunizacin de un ratn
para estimular la
produccin de anticuerpos

Se cultivan clulas tumorales


en un cultivo tisular
Se aislan clulas formadoras de
anticuerpos a partir del bazo

Las clulas formadoras de anticuerpos se funden


con clulas tumorales cultivadas para formar
hibridomas

Seleccin de hibridomas para la


produccin de anticuerpos

Hibridomas productores de
anticuerpos clonados

Anticuerpos monoclonales
aislados para su cultivo

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

La tcnica ELISA
Definicin
Un ensayo de inmunosorcin enzimtica (Enzyme-Linked ImmunoSorbent Assay)
es cualquier inmunoensayo enzimtico que utilice un inmunorreactivo (antgeno o
anticuerpo) marcado con una enzima y un inmunosorbente (antgeno o anticuerpo
unido a un soporte slido). Para medir una concentracin desconocida pueden
usarse diversos mtodos (p. ej., unin competitiva entre el reactivo marcado y el
elemento desconocido sin marcar).
ELISA (Clark y Adams, 1977) se basa en interacciones especficas entre anticuerpos
y antgenos. Los reactivos clave en ELISA son los anticuerpos, que son protenas
solubles producidas por el sistema inmunitario en respuesta a una infeccin por una
sustancia extraa (llamada antgeno). En caso de la deteccin de OGM, el
antgeno puede ser la nueva protena sintetizada.
Esta tcnica se aplica en la evaluacin, en fase experimental, del nivel de expresin
de la(s) protena(s) sintetizada(s) por el nuevo gen introducido. Por ello, es posible
encontrar informacin sobre la produccin y el uso de anticuerpos especficos en
muchos artculos que describen la creacin de plantas transgnicas (Mohapatra et
al., 1999).
Solo se dispone comercialmente de unos cuantos anticuerpos especficos dirigidos
contra protenas que son producto de los transgenes utilizados en cultivos
modificados genticamente aprobados: sirvan de ejemplo los anticuerpos contra el
producto del gen nptII, NPTII, o APH(3')II y contra el producto del gen gus.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

Existen tres mtodos distintos de realizar el ensayo ELISA:

a) ELISA indirecto

lavado

Pocillo
revestido
de antgeno

Aadir
anticuerpo
especfico

Aadir
anticuerpo
secundario
conjugado
con enzima

b) ELISA sndwich

lavado

lavado

Pocillo
revestido de
anticuerpo

Aadir
antgeno

lavado

Aadir
sustrato y
medir
color

lavado

lavado

Aadir (Ag-Ac)
al pocillo
revestido de
antgeno

Aadir
sustrato (s)
y medir
color

Aadir
anticuerpo
secundario
conjugado
con enzima

c) ELISA competitivo

Incubar
anticuerpo
con antgeno

lavado

lavado

Aadir
anticuerpo
secundario
conjugado
con enzima

Aadir
sustrato
sin color

Un mtodo de deteccin especfica de la soja Roundup Ready basado en ELISA fue


desarrollado, sometido a prueba y validado por Lipp et al. (2000).
El mtodo se basa en el uso de anticuerpos especficos dirigidos contra la protena
CP4 EPSPS (5-enolpiruvilshikimato-3-fosfato sintasa, enzima procedente de
Agrobacterium sp., cepa CP4) (Padgette et al., 1995), que es la protena que
confiere la tolerancia frente al herbicida Roundup en la soja Roundup Ready. Los
resultados preliminares indican que este mtodo (que se aplica utilizando un kit
comercia de ELISA) es capaz de detectar la presencia de OGM en material de soja
bruto en concentraciones que se sitan entre el 0,3 % y el 5 %.

Principio
Para la deteccin de la protena CP4 EPSPS se utiliza

un ensayo de

inmunoadsorcin enzimtica (ELISA) directo de tipo sndwich, segn se muestra en


las siguientes figuras:

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

10

Y Anticuerpo monoclonal

Superficie
revestida

Se reviste la superficie de una placa de microvaloracin con un anticuerpo de


captura monoclonal especfico.

Antgeno
Superficie revestida

Cuando se aade la muestra de inters, el anticuerpo de captura se une al antgeno.


Los componentes de la muestra que no se han unido se eliminan mediante lavado.

HRP

Anticuerpo detector
Superfic. revestida

Tras el lavado, se aade un anticuerpo policlonal, unido covalentemente a la


peroxidasa de rbano (HRP), que es especfica para un segundo sitio antignico en
la protena CP4 EPSPS unida.
TM

TM

Superfic. revestida

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

11

Tras otro lavado, se aade el cromgeno tetrametilbencidina de la peroxidasa de


rbano. La peroxidasa de rbano genera una seal de color que es proporcional a la
concentracin de antgeno en un intervalo lineal. Para detener el desarrollo del color
se aade una solucin de parada. El nivel de color producido se mide a una longitud
de onda de 450 nm.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

12

Prctica
(GMO Food Ingredient Testing, Soya kit Users Guide (1999). Strategic Diagnostics,
1

Inc., Rev. 052099, Vers. 1.8.)

Introduccin
El siguiente protocolo especifica un mtodo ELISA para la determinacin de la
protena CP4 EPSPS expresada en la soja Roundup Ready en productos agrcolas
brutos y elaborados como las harinas de soja y las protenas aisladas de soja.
El mtodo es aplicable a muestras que han sido poco o en absoluto tratadas, por lo
que la protena CP4 EPSPS no est desnaturalizada. Por ejemplo, la temperatura a
la que se transforman los ingredientes de los alimentos puede repercutir en las
posibilidades de deteccin de la protena. Segn los datos, las temperaturas de
transformacin de no ms de 65 C durante no ms de 60 minutos permiten una
deteccin fiable.
El mtodo ha sido validado para la deteccin de la protena CP4 EPSPS y puede
usarse para determinar la concentracin de la protena en la muestra en el intervalo
del 0,3 % al 5 % (p/p) usando material de referencia especfico. El kit puede
emplearse igualmente a niveles de deteccin ms bajos (0,05 % a 0,3 %) con
modificaciones en el protocolo.

Instrumental

Tubos de centrifugacin cnicos de polipropileno de 15 ml

Tubos de ensayo de vidrio de 12 X 75 mm

Hojas de plstico o aluminio para envolver

Cinta de plstico o lavador de placas manual

Frascos lavadores, p. ej. de 500 ml

Pipetas de precisin capaces de transferir de 20 l a 500 l

Mezclador de torbellino

Bandejas de pesar o equivalentes

Esptulas

Balanza capaz de efectuar mediciones de 0,01 g

El kit que se describe en esta sesin era el nico protocolo validado disponible en el comercio en el
momento en que se organizaron los cursos y se prepar el presente Manual. El CCI y la OMS no
promocionan ninguna marca concreta de kits disponibles en el comercio.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

13

Centrifugadora que pueda trabajar a 5 000 - 10 000 rpm

Lector de placas de microvaloracin capaz de leer una absorbancia a 450 nm

Horno de incubacin capaz de mantener 37 C

Tamiz de 450 m de abertura o equivalente

Tamiz de 150 m de abertura (malla 100) o equivalente

Pipeta multicanal, p. ej., de 50 l a 300 l (opcional)

Depsitos de reactivo para distribucin multicanal (opcional)

Lavador de placas automtico (opcional)

Soporte para tubos de centrifugacin de 15 ml (opcional).

Reactivos
Generalidades
Durante los anlisis, y a menos que se indique otra cosa, se utilizarn solamente
reactivos de grado analtico y agua desionizada o destilada.
Cualquier desviacin de los criterios de rendimiento definidos podra indicar una
merma de la estabilidad de un reactivo. En caso de que los componentes del
sustrato hayan ya virado de transparente a azul, deber descartarse el reactivo. No
debern usarse soluciones tampn turbias.
Todos los componentes del kit debern almacenarse a una temperatura de entre
2 C y 8 C. El perodo de validez de los componentes del kit viene indicado por su
fecha de caducidad. Sobre la base de ensayos de estabilidad acelerados, la fecha
de caducidad del kit de ensayo se ha fijado en 9 meses a una temperatura de entre
2 C y 8 C.
La solucin madre conjugado de soja de conjugado de anticuerpo y la solucin de
trabajo de conjugado de anticuerpo debern almacenarse a una temperatura de
entre 2 C y 8 C hasta la fecha de caducidad del kit. El tampn de lavado de trabajo
diluido deber almacenarse a una temperatura de entre 2 C y 8 C sin sobrepasar
la fecha de caducidad del kit.
Reactivos que suelen facilitarse con el kit de ensayo

Tampn de extraccin de soja, tampn de borato de sodio, pH 7,5

Tampn de extraccin de soja, PBS, Tween 20, seroalbmina bovina, pH 7,4

Pocillos en tiras revestidas (12 tiras de 8 pocillos cada una revestidas con los
anticuerpos de captura monoclonales y un portatiras)

Conjugado de soja, protena anti-CP4 EPSPS de conejo, liofilizada

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

14

Diluyente del conjugado de soja, suero de ratn inactivado por calor al 10 %

Sustrato cromognico, K-Blue, tetrametilbencidina (TMB), perxido de


hidrgeno, dimetilformamida al 5 % como disolvente de base

Solucin de parada, cido sulfrico al 0,5 %

Tampn de lavado concentrado diez veces, PBS, Tween 20, pH 7,1

Patrones de referencia negativos y positivos.

Procedimiento
Limitacin del procedimiento
Este sistema de ensayo de la modificacin gentica mediante ELISA solo es vlido
para muestras en las que la expresin de la protena CP4 EPSPS se pueda
correlacionar con el nivel de material modificado genticamente presente en los
patrones de referencia utilizados.
El kit de ELISA ha sido diseado para ofrecer un rendimiento ptimo a una
temperatura ambiente de 15 C a 30 C. La absorbancia del patrn de referencia
ms elevado debe ser superior a 0,8 y no estar fuera del intervalo lineal del
espectrmetro (el lmite superior vara segn el aparato). Es importante tener
presente que los valores de la densidad ptica aumentan ms deprisa a
temperaturas superiores a 30 C. En consecuencia, si la temperatura es elevada,
ser necesario acortar el tiempo de incubacin del sustrato. A temperaturas bajas
(inferiores a 15 C), por el contrario, habr que alargar dicho tiempo.
Medidas encaminadas a evitar la contaminacin durante la preparacin de la muestra
Generalidades. El sistema ELISA de ensayo de OGM es una tcnica
extremadamente sensible capaz de detectar cantidades muy pequeas de
contaminantes GM. Por este motivo, es imperativo que todo el instrumental utilizado
para procesar las muestras de soja sea limpiado a fondo entre dos lotes de
muestras. Los procedimientos que se mencionan a continuacin incluyen un primer
paso de eliminacin fsica de cuantas partculas sea posible. El segundo paso, un
lavado con alcohol, tiene por finalidad desnaturalizar la muestra de manera que no
reaccione durante el ensayo con ninguna protena GM que pueda haber quedado en
el instrumental.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

15

Limpieza del triturador o batidora. Cepillar con un cepillo de cerdas suave. Lavar
el cepillo peridicamente y remojarlo en una solucin de alcohol. Secar el cepillo
antes de volver a usarlo. Enjugar con una bayeta suave o un pao de laboratorio.
Lavar con alcohol, que puede tenerse almacenado para su uso en una botella con
pulverizador o pitorro. Se recomiendan dos lavados o pulverizaciones. Luego, se
enjuagar a fondo con agua. Secar al aire o, si es preciso reutilizar enseguida el
instrumento, con un secador de pelo comercial.
Limpieza del tamiz. El polvo de soja suele endurecerse, atascando el tamiz.
Sacudir bruscamente el tamiz contra una superficie dura para desprender el material
endurecido.
Cepillar con un cepillo de cerdas suave y limpio. Lavar el cepillo peridicamente y
remojarlo en una solucin de alcohol durante al menos un minuto. Secar el cepillo
antes de volver a usarlo. Enjugar con una bayeta suave.
Remojar en alcohol durante al menos cinco minutos y luego enjuagar a fondo con
agua. Secar al aire o, si es preciso reutilizarlo enseguida, con un secador de pelo
comercial.
Una alternativa sera el uso de un bao de ultrasonidos seguido de un secado al
aire.
Limpieza de la zona de trabajo. Tambin es importante la limpieza de la zona de
trabajo. Dado que el ensayo es muy sensible, una ligersima contaminacin por
polvo GM del tubo de ensayo podra conducir a un falso positivo. Hay que evitar la
contaminacin por polvo de soja en la zona de trabajo. No debe permitirse que el
polvo de soja de un proceso contamine el instrumental que se usar en un proceso
posterior. Lo ideal es realizar el ensayo en un espacio separado de la instalacin en
la que se efecta el triturado y la preparacin de la muestra, a fin de evitar la posible
contaminacin por polvo.
Preparacin de la muestra
Debe tomarse de la muestra de laboratorio una submuestra incremental homognea.
Si la muestra es de semillas de soja en bruto, se colocarn al menos 500 g en una
batidora adecuada y se triturarn durante 3 minutos aproximadamente, o hasta que
sea suficientemente fina para atravesar los tamices. Para anlisis cuantitativos,
deber obtenerse un tamao de partcula inferior a 150 m, y para anlisis
cualitativos, inferior a 450 m. En la fase de tamizado debe ponerse cuidado en
evitar la contaminacin, as como en evitar el calentamiento excesivo. La batidora

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

permitir

mezclar

triturar

la

muestra.

16

Se

tomar

una

submuestra

de

aproximadamente 100 g de material triturado, que se pasar a travs de un tamiz


con un tamao de poro de 450 m (malla 40). Al menos el 90 % de esta submuestra
deber atravesar el tamiz de 450 m. Puede usarse este material directamente si se
trata de un ensayo cualitativo, pero si es cuantitativo debe volverse a pasar por un
tamiz con tamao de poro de 150 m. Como se ha demostrado que el material que
atraviesa el tamiz de 450 m es homogneo, basta hacer pasar por el tamiz de
150 m suficiente material para obtener la muestra final.
Otros tipos de muestras deben recibir un tratamiento semejante, aunque puedan
utilizarse tamaos de muestra ms pequeos.

Procedimiento de ensayo
Todos los reactivos deben estar a temperatura ambiente antes de usarlos.
Se sacan las tiras revestidas y el portatiras de la bolsa de papel de aluminio. Tras
extraer el nmero de tiras adecuado, hay que volver a cerrar siempre la bolsa.
Hacen falta diez pocillos para los patrones de referencia y los blancos de ensayo.
Cada placa debe tener sus propios patrones y controles. Si se utiliza un lavado
manual, pegar con cinta de plstico los bordes de todas las tiras necesarias para un
ciclo al portatiras, a fin de evitar que caigan accidentalmente de este durante el
lavado.
Preparacin del conjugado de anticuerpo
Solucin madre de conjugado de anticuerpo. Pipetear 1 ml de diluyente de
conjugado de soja procedente de la botella de diluyente de conjugado de soja en el
frasco de conjugado de soja. Agitar en el mezclador de torbellino durante 10 s
aproximadamente.

Solucin de trabajo de conjugado de anticuerpo. Volver a poner 240 l de


conjugado de soja reconstituido en la botella de diluyente de conjugado de soja.
Marcar la botella con la fecha del da y mezclar invirtindola 20 veces.
Preparacin del tampn de lavado
Dejar que el tampn de lavado concentrado diez veces alcance la temperatura
ambiente.
Diluir dicho tampn concentrado en agua desionizada para preparar el tampn de
lavado de trabajo (p. ej., 50 ml de tampn de lavado concentrado diez veces en 450
ml de agua desionizada).

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

17

Aadir al lavador de placas automtico o al frasco lavador.


Extraccin de muestras y patrones de referencia
Se extraen las muestras y los patrones de referencia negativos y positivos en las
mismas condiciones y por duplicado, segn se describe a continuacin.
Cuando vayan a pesarse las muestras, pesar cada patrn de referencia por orden de
concentracin creciente y luego las muestras.
Pesar 0,5 g 0,01 g de cada patrn de referencia y de la muestra en distintos tubos
de centrifugacin de polipropileno de 15 ml. Para evitar la contaminacin, limpiar la
esptula entre cada pesada.
Aadir 4,5 ml de tampn de extraccin de soja en cada uno de los tubos que
contienen una muestra de 0,5 g y agitar en un mezclador de torbellino durante 10 s.
Centrifugar las mezclas a aproximadamente 5000 rpm durante 15 minutos.
Utilizando una pipeta de transferencia, retirar cuidadosamente el sobrenadante sin
aspirar material slido y colocarlo en un tubo de centrifugacin de 15 ml limpio y
etiquetado.
Antes de comenzar el ensayo, diluir los extractos de la muestra y los extractos del
patrn de referencia con tampn de ensayo de soja con arreglo a lo indicado en el
cuadro 1.
Los extractos de protena deben almacenarse a entre 2 C y 8 C, pero no durante
ms de un da de trabajo.
Cuadro 1. Intervalos de dilucin en funcin de la matriz
Matriz

Dilucin

Semillas de soja
Harina de soja
Harina de soja desgrasada
Aislado de protenas

1:300
1:300
1:300
1:10

Dilucin de extractos de muestras


Para el control negativo extrado, para cada referencia positiva extrada y para cada
muestra, se precisan dos tubos de ensayo de 12 X 75 mm para realizar la dilucin.
Pipetear 280 l del tampn de ensayo de soja en uno de los dos tubos de ensayo de
12 x 75 mm.
Pipetear 380 l del tampn de ensayo de soja en el otro tubo de ensayo de 12 x 75
mm. Marcar el tubo de 280 l con la inscripcin 1:15 y el de 380 l con 1:300.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

18

Pipetear 20 l de cada extracto de muestra en el tubo 1:15 y agitar en el


mezclador de torbellino.
Transferir 20 l del tubo 1:15 agitado al tubo 1:300 y agitar en el mezclador de
torbellino.
Repetir los mismos pasos para el control negativo, para cada referencia positiva y
para los extractos de muestra.

Procedimiento de inmunoensayo ELISA


Generalidades
El kit de ensayo ELISA puede utilizarse en distintos formatos con cualquier nmero
de bandas de 8 pocillos. Se recomienda seguir un sistema de carga aleatorio.
Todos los pocillos de reaccin deben emplearse por duplicado, calculndose el valor
medio de absorbancia de cada pocillo. Cada ciclo est integrado por el blanco del
tampn de ensayo, el control negativo y la referencia positiva.
Una vez iniciado un ensayo, deben completarse todas sus etapas sin interrupcin.
Adicin de la muestra
Aadir 100 l de extractos diluidos y el blanco de ensayo a los pocillos oportunos.
Usar puntas desechables distintas en cada etapa de pipeteo para evitar la
contaminacin cruzada. Cubrir la placa con hoja de aluminio o de plstico para evitar
la contaminacin y la evaporacin.
Incubacin de la muestra
Incubar la placa de microvaloracin a 37 C durante 1 hora.
Lavado
Lavar 3 veces con 300 l de tampn de lavado.
Lavado manual. Vaciar los pocillos invirtindolos sobre un fregadero o un
contenedor de residuos adecuado. Utilizando un frasco lavador de 500 ml que
contenga solucin de lavado de trabajo, llenar cada pocillo hasta el borde, dejar
reposar 60 s, y luego vaciar la placa como se acaba de indicar. Repetir el lavado un
total de 3 veces. Eliminar el lquido y las burbujas residuales sacudiendo boca abajo
la placa sobre varias capas de toallas de papel.
Se impedir que las tiras caigan del marco sujetndolas con cinta adhesiva.
Lavado automtico. Al final del perodo de incubacin, aspirar el contenido de
todos los pocillos utilizando un lavador de micropocillos, y luego llenarlos con
tampn de lavado de trabajo. Repetir la aspiracin y el llenado un total de 3 veces.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

19

Por ltimo, aspirar todos los pocillos mediante el lavador de micropocillos y sacudir
la placa invertida sobre una pila de toallas de papel para eliminar las gotitas
residuales de tampn de lavado y las burbujas.
No hay que dejar que los pocillos se evaporen, ya que esto podra afectar al
rendimiento del ensayo.
Un lavado inadecuado puede ocasionar resultados errneos. Tanto si se utiliza un
lavador manual como automtico, es importante cerciorarse de que todos los
pocillos de ensayo se lavan con idnticos volmenes.
Adicin del conjugado de anticuerpo
Aadir 100 l de solucin de trabajo de conjugado de anticuerpo a cada pocillo.
Cubrir la placa para evitar la contaminacin y la evaporacin.
Incubacin
Incubar la placa de microvaloracin a 37 C durante 1 hora.
Lavado
Concluido el perodo de incubacin, repetir el lavado segn lo anteriormente
descrito.
Adicin del sustrato
Aadir 100 l de la solucin de color a cada pocillo.
Agitar suavemente la placa e incubar durante 10 minutos a temperatura ambiente.
La adicin de sustancia cromognica debe efectuarse sin interrupciones. Mantener
la misma secuencia e intervalo de tiempo durante el pipeteo. Proteger la placa de
microvaloracin de la luz del da, para evitar que se altere la intensidad del color.
Adicin de la solucin de parada
Al final del perodo de incubacin, aadir 100 l de solucin de parada a cada
pocillo, pipetendola en la misma secuencia en que se haya aadido el reactivo de
color.
La adicin de solucin de parada debe efectuarse sin interrupciones. Proteger la
placa de microvaloracin de la luz del da, para evitar que se altere la intensidad del
color.
Lectura de la absorbancia
Utilizando un lector de microplacas equipado del filtro adecuado para efectuar
lecturas a 450 nm, medir la absorbancia de cada pocillo de ensayo.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

20

Todas las lecturas deben efectuarse dentro de los 30 minutos siguientes a la adicin
de la solucin de parada.
Tomar nota de los resultados obtenidos y calcular los valores medios de
absorbancia, o recurrir a un programa informtico.
Evaluacin
Deben usarse los valores de los patrones para desarrollar una curva patrn. El valor
del blanco de ensayo deber sustraerse de todos los valores de las muestras y
patrones de referencia. Se utilizarn los valores medios corregidos correspondientes
a cada punto de referencia duplicado para crear una curva patrn. Luego se
utilizarn los datos promedio de cada muestra duplicada para interpolar una
concentracin a partir de dicha curva.
Criterios de aceptacin o rechazo de un ciclo
Para tener validez, cada ciclo deber satisfacer los criterios de aceptacin o rechazo
del procedimiento. Un ciclo consistir en lo siguiente: el blanco de ensayo, la
extraccin de cada patrn GM de referencia positiva, el control negativo y cada
muestra desconocida. Todos los extractos de protena y el blanco de ensayo se
utilizarn en duplicados. Si un ciclo no satisface los criterios de aceptacin del
ensayo, deber repetirse ntegramente.
Ciclo

Criterios

Blanco de tampn de ensayo

A450nm < 0,30

Patrn 0 % GM

A450nm < 0,30

Referencia 2,5 %

A450nm > 0,8

Todos los patrones positivos

CV de los duplicados < 15 %

Muestras desconocidas

CV de los duplicados < 20 %

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

21

Diagrama de flujo
Diagrama de la extraccin de la muestra y del patrn de referencia

Procedimiento

Volumen/peso

Descripcin

Pesada

0,5 g

Pesar muestras, blanco de ensayo y patrones de


referencia

Adicin

4,5 ml

Aadir el tampn de extraccin

Mezclado

Mezclar la muestra con el tampn de extraccin


hasta que quede homognea

Centrifugado

5000 rpm

Centrifugar la muestra a 5000 rpm durante 15


minutos
Eliminar el sobrenadante y pasarlo a un tubo
limpio

Dilucin

1:300 o 1:10 segn Diluir las muestras y patrones de referencia


el material
investigado

Diagrama del procedimiento de inmunoensayo ELISA

Procedimiento

Volumen

Descripcin

Adicin

100 l

Pipetear los extractos diluidos de muestras, patrones


de referencia y blanco tampn de ensayo en los
correspondientes pocillos

Incubacin

Incubar 1 h a 37 C

Lavado

Lavar 3 veces con tampn de lavado

Adicin

100 l

Incubacin

Distribuir el conjugado de anticuerpo en cada pocillo


de ensayo
Incubar 1 h a 37 C

Lavado

Lavar 3 veces con tampn de lavado

Adicin

100 l

Incubacin

Incubar durante 10 minutos a temperatura ambiente.

Adicin
Medida de
absorbancia

Distribuir la solucin de color en cada pocillo

100 l
la

Distribuir la solucin de parada en cada pocillo de


ensayo
Medir el valor de la absorbancia de cada pocillo en un
lector de placas a 450 nm

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

22

Bibliografa
Clark, M.F. y Adams, A.N. (1977).

Characteristics of the microplate method of

enzyme-linked immunosorbent assay for the detection of plant viruses. Journal of


General Virology 34, 475483.
Hemmer, W. (1997). Foods Derived from Genetically Modified Organisms and
Detection Methods. Biosafety Research and Assessment of Technology Impacts
of the Swiss Priority Program Biotechnology Report 2/97, 61 pages.
http://www.bats.ch/bats/publikationen/1997-2_gmo/index.php

(ltimo

acceso

enero de 2010)
Lipp, M., Anklam, E. y Stave, J.W. (2000). Validation of an immunoassay for
detection and quantification of a genetically modified soybean in food and food
fractions using reference materials. Journal of AOAC International 83, 919927.
Longstaff, M., Edmonds, H.S. y Newell, C.A. (1995). An improved method for the
detection and quantification of recombinant protein in transgenic plants. Plant
Molecular Biology Reporter 13, 363368.
Mohapatra, U., Mccabe, M.S., Power, J.B., Schepers, F., Vanderarend, A. y Davey,
M.R. (1999). Expression of the bar gene confers herbicide resistance in
transgenic lettuce. Transgenic Research 8, 3344.
Padgette, S.R., Kolacz, K.H., Delannay, X., Re, D.B., LaVallee, B.J., Tinius, C.N.,
Rhodes, W.K., Otero, Y.I., Barry, G.F., Eichholtz, D.A., Peschke, V.M., Nida, D.L.,
Taylor, N.B. y Kishore, G.M.

(1995). Development, identification, and

characterization of a glyphosate-tolerant soybean line. Crop Science 35, 1451


1461.

Bibliografa complementaria
Brett, G.M., Chambers, S.J., Huang, L. y Morgan, M.R.A. (1999). Design and
development of immunoassays for detection of proteins. Food Control 10, 401
406.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Deteccin Cuantitativa de la Soja Roundup Ready mediante ELISA

23

Directiva 79/700/CEE de la Comisin, de 24 de julio de 1979, por la que se


establecen los mtodos comunitarios de toma de muestras para el control oficial
de los residuos de plaguicidas en las frutas y hortalizas. DO L 239 de 22.9.1979,
p. 24.
Rogan, G.J. Dudin, Y.A., Lee, T.C., Magin, K.M., Astwood, J.D., Bhakta, N.S., Leach,
J.N., Sanders, P.R. y Fuchs, R.L. (1999). Immunodiagnostic methods for
detection of 5-enolpyruvylshikimate-3-phosphate synthase in Roundup Ready
soybeans. Food Control 10, 407414.
Stave, J. W. (1999). Detection of new or modified proteins in novel foods derived
from GMO - future needs. Food Control 10, 367374.
Van der Hoeven, C., Dietz, A. y Landsmann, J. (1994). Variability of organ-specific
gene expression in transgenic tobacco plants. Transgenic Research 3, 159165.

Anlisis de la Presencia de Organismos Genticamente Modificados en Muestras de Alimentos

Sesin n 12

Anlisis de la Presencia de Organismos


Genticamente Modificados en Muestras de
Alimentos

Apndice
Ejemplo de programa de trabajo
(Base metodolgica para un curso de una semana)

M. Querci

WORLD HEALTH ORGANIZATION


REGIONAL OFFICE FOR EUROPE
WELTGESUNDHEITSORGANISATION
REGIONALBRO FR EUROPA

ORGANISATION MONDIALE DE LA SANTE


BUREAU REGIONAL DE L'EUROPE
ORGANIZACIN MUNDIAL DE LA SALUD
OFICINA REGIONAL PARA EUROPA

Ejemplo de programa de trabajo

PRIMER DA: LUNES


9:00

Introduccin del curso, presentacin de los organizadores y participantes

9:30

Teora: Introduccin sobre los procedimientos generales para la deteccin de


OGM y contenido del curso
PREPARACIN DE LAS MUESTRAS: EXTRACCIN DE ADN

10:00

Prctica: Extraccin de ADN por el mtodo del bromuro de cetil-trimetil


amonio (CTAB) (1 parte)

10:30

Descanso

11.:00

Teora: Electroforesis en gel para anlisis de cidos nucleicos


Prctica: Preparacin de geles de agarosa

12:00

Prctica: Extraccin de ADN por el mtodo del CTAB (2 parte)

13:00

Almuerzo

14:00

Prctica: Extraccin de ADN por el mtodo del CTAB (3 parte)

15:15

Prctica: Aplicacin de la muestra en geles de agarosa

16:00

Descanso

16:20

Teora: Consideraciones generales sobre la organizacin de un laboratorio


de reaccin en cadena de la polimerasa (PCR) Resolucin de problemas, etc.

17:20

Prctica: Interpretacin de geles de agarosa

Anlisis de la presencia de organismos genticamente modificados en muestras de alimentos

Apndice

Ejemplo de programa de trabajo

SEGUNDO DA: MARTES


PCR CUALITATIVA
9:00

Teora: Introduccin y utilizacin de la PCR para la deteccin de soja y maz


transgnicos

9:30

Prctica: PCR para los productos transgnicos maz MON810 y soja


Roundup Ready

Con especificidad de los vegetales: deteccin de los genes de la zena y


de la lectina

10:15

Descanso

10:40

Preparacin de geles de agarosa

11:00

Seminario: Muestreo y validacin: conceptos bsicos

12:30

Almuerzo

14:00

Aplicacin de la muestra en geles de agarosa

14:30

Teora: Caractersticas de la soja Roundup Ready y del maz MON810 e


introduccin de la PCR anidada especfica de OGM

15:15

Interpretacin de los geles de agarosa (PCR especfica de zena y lectina)

16:00

Descanso

16:15

Prctica: PCR para los productos transgnicos maz MON810 y soja


Roundup Ready

Con especificidad de los OGM: deteccin del promotor 35S y del


terminador nos

17:00

Seminario: Introduccin a la legislacin europea sobre OGM

Anlisis de la presencia de organismos genticamente modificados en muestras de alimentos

Apndice

Ejemplo de programa de trabajo

TERCER DA: MIRCOLES


PCR CUALITATIVA
9:00

Prctica: PCR anidada para la deteccin especfica de los productos


transgnicos maz MON810 y soja Roundup Ready (primera PCR)

10:00

Preparacin de geles de agarosa

10:30

Descanso

11:00

Seminario: Ensayo de OGM y garanta de calidad analtica

12:00

Aplicacin de las muestras en geles de agarosa (PCR del promotor 35S y del
terminador nos)

12:30

Almuerzo

13:30

Prctica: PCR anidada para la deteccin especfica de los productos


transgnicos maz MON810 y soja Roundup Ready (segunda PCR)

14:00

Interpretacin de los geles de agarosa (PCR del promotor 35S y del


terminador nos)

15:00

Prctica: Preparacin de geles de agarosa

15:30

Descanso

15:45

Prctica: Aplicacin de las muestras de geles de agarosa (PCR anidada)

16:00

Teora: Introduccin de la PCR en tiempo real (RT-PCR) para la deteccin y


cuantificacin de OGM

17:30

Prctica: Interpretacin de geles de agarosa (PCR especfica de los


productos transgnicos maz MON810 y soja Roundup Ready)

Anlisis de la presencia de organismos genticamente modificados en muestras de alimentos

Apndice

Ejemplo de programa de trabajo

CUARTO DA: JUEVES


PCR EN TIEMPO REAL (RT-PCR) CUANTITATIVA
9:00

Prctica: Cuantificacin del ADN y preparacin de muestras para la PCR en


tiempo real (RT-PCR)

9:30

Prctica: PCR en tiempo real (RT-PCR) para la deteccin especfica de la


soja transgnica Roundup Ready utilizando:

el analizador LightCycler (de Roche) (Grupo 1)

el secuenciador ABI PRISM 7700 (de Applied Biosystems) (Grupo 2)

Descanso
13:00

Almuerzo

14:00

Prctica: PCR en tiempo real (RT-PCR) para la deteccin especfica de la


soja Roundup Ready utilizando:

el analizador LightCycler (de Roche) (Grupo 2)

el secuenciador ABI PRISM 7700 (de Applied Biosystems) (Grupo 1)

15:30

Teora: Anlisis de datos: introduccin a varios medios estadsticos

16:30

Descanso

17:00

Prctica: Continuacin de la PCR en tiempo real (RT-PCR) para la deteccin


especfica de la soja transgnica Roundup Ready

Anlisis de la presencia de organismos genticamente modificados en muestras de alimentos

Apndice

Ejemplo de programa de trabajo

QUINTO DA: VIERNES


DETECCIN CUANTITATIVA DE SOJA ROUNDUP READY MEDIANTE ELISA
9:00

Teora: Enfoque serolgico de la deteccin de OGM

9:20

Prctica: ELISA, primera parte

10:00

Descanso

10:30

Seminario: Enfoque serolgico de la deteccin de OGM

11:30

Prctica: ELISA, segunda parte

12:00

Almuerzo

13:00

Prctica: ELISA tercera parte

14:00

Interpretacin de los resultados

15:00

Seminario: mbitos de negociaciones internacionales sobre la seguridad del


uso de organismos genticamente modificados

16:00

Debate general y conclusiones

Anlisis de la presencia de organismos genticamente modificados en muestras de alimentos

Apndice

Comisin Europea
DG Centro Comn de Investigacin, Instituto de la Salud y la Proteccin de los Consumidores
Titulo: Curso de Formacin Sobre Anlisis de La Presencia de Organismos Genticamente
Modificados en Muestras de Alimentos - Manual del Participante
Editado por M. Querci, M. Jermini y G. Van den Eede
Luxemburgo: Oficina de Publicaciones Oficiales de las Comunidades Europeas
2007 238 pp. 21 x 29,7cm
ISBN 978-92-79-04831-9
Resumen
El Instituto de la Salud y la Proteccin de los Consumidores del Centro Comn de Investigacin de la
Comisin Europea y el Programa de Seguridad Alimentaria dentro del Centro Europeo para el Medio
Ambiente y la Salud (Divisin de Roma) de la Organizacin Mundial de la Salud han organizado
conjuntamente una serie de cursos de formacin sobre Anlisis de la presencia de organismos
genticamente modificados en muestras de alimentos.
El Centro Comn de Investigacin presta apoyo cientfico y tcnico a las polticas comunitarias
colaborando con las direcciones generales de la Comisin Europea e interactuando con las
instituciones, organizaciones e industrias europeas mediante la formacin de redes con laboratorios
de los Estados miembros. La tarea general del Centro Europeo para el Medio Ambiente y la Salud de
la OMS es prestar ayuda de forma completa y coordinada tanto a las autoridades como a los
ciudadanos europeos en el mbito de la salud ambiental. Estos cursos de formacin se inscriben en
la colaboracin entre ambas instituciones para fomentar aspectos relativos a la inocuidad de los
alimentos en la regin europea de la OMS, tanto dentro como fuera de las fronteras de la propia UE,
teniendo en cuenta especialmente los pases candidatos a la adhesin a la UE, as como los pases
de Europa central y oriental con economas de transicin.
El objetivo de los cursos de formacin es ayudar al personal de los laboratorios de control a
familiarizarse con las tcnicas de deteccin molecular y a adaptar sus instalaciones y programas de
trabajo para permitir la realizacin de anlisis que se ajusten a los actos normativos a escala mundial
en el campo de la biotecnologa. Los cursos se destinan a ensear tcnicas de deteccin molecular a
personal de laboratorio con buen nivel de conocimientos analticos, pero con poca o ninguna
experiencia en este mbito concreto.
El Centro Comn de Investigacin se ha comprometido a proporcionar formacin sobre la deteccin y
cuantificacin de los OGM y, adems de los cursos de formacin, ofrece (y ha ofrecido en el pasado)
formacin individual para necesidades especficas. Se ha pedido con frecuencia formacin sobre este
tema debido a su importancia ante el aumento de la necesidad de cumplir la normativa europea, tanto
vigente como en fase de elaboracin.
A lo largo de los aos, la Unidad de biotecnologa y OGM ha conseguido un profundo conocimiento
de los diferentes aspectos relativos a la deteccin y cuantificacin de los OGM, y ha elaborado,
adaptado o validado mtodos avanzados para su deteccin y cuantificacin.
El conocimiento de estas tcnicas se ha transferido a los laboratorios colaboradores mediante
publicaciones, proyectos conjuntos, formacin individual o cursos especficos. Tambin se han
explicado detalles tcnicos a personal en formacin mediante presentaciones verbales o breves notas
escritas. La Unidad de biotecnologa y OGM, consciente de la necesidad de disponer de una fuente
permanente de informacin, ha redactado el presente Manual, que describe algunas de las tcnicas
utilizadas en nuestro laboratorio.
A lo largo de los cursos se atiende a los siguientes temas:
extraccin de ADN de materias primas y productos transformados
cribado de productos alimentarios para detectar la presencia de OGM mediante reaccin en
cadena de la polimerasa, tanto simple como anidada
cuantificacin de OGM en ingredientes mediante reaccin en cadena de la polimerasa en
tiempo real
cuantificacin de OGM en ingredientes mediante prueba de inmunoabsorcin enzimtica.
El Manual se ha preparado en el Instituto de la Salud y la Proteccin de los Consumidores del Centro
Comn de Investigacin, como informacin de base para los participantes en los cursos y con la
finalidad de proporcionar una informacin terica y prctica sobre las metodologas y protocolos
utilizados en la actualidad. La materia abarca una amplia variedad de tcnicas de deteccin,
identificacin, caracterizacin y cuantificacin de OGM, y se incluye informacin terica que se
considera importante y bsica para quien desee introducirse y trabajar en el campo de la deteccin de
OGM.

La misin del Centro Comn de Investigacin consiste en proporcionar apoyo cientfico y


tcnico para la elaboracin, el desarrollo, la aplicacin y la supervisin de las polticas de la
Unin Europea, en funcin de su propia demanda. Siendo un servicio de la Comisin
Europea, el CCI funciona como centro de referencia en materia cientfica y tecnolgica
para la Unin. Encontrndose prximo al proceso de elaboracin de polticas, sirve al
inters comn de los Estados Miembros, al tiempo que se mantiene independiente de
intereses particulares, ya sean privados o nacionales.

LB-X1-07-033-ES-C

Misin del CCI