The MOLECULES

of LIFE
Physical and Chemical Principles

Selected Solutions for Students

Prepared by James Fraser and Samuel Leachman

Chapter 13
Specificity of Macromolecular
Recognition

Problems
True/False and Multiple Choice
2. Which of the following is an attribute of the FGFFGFR
family of interactions?
a. Each FGF ligand has high specificity for an FGF
receptor.
b. Because there are 18 FGF and 4 FGFR genes, there
are 72 potential interactions.
c. Signaling specificity is enhanced through
selective expression of only a few receptors per
tissue type.
d. FGFRs are soluble serine/threonine kinases.
e. FGF proteins have highly diverse folds.
4. Most of the binding energy for SH2 domainpeptide
interactions is contributed by:
a.
b.
c.
d.

Aminoaromatic interactions.
The phosphorylation of the peptide tyrosine.
The amino acid in the peptide + 1 position.
The amino acid in the peptide + 3 position.

6. Interface residues that do not contribute greatly to

binding affinity are also generally unimportant for
specificity.
True/False

Fill in the Blank

8.

_____________ residues, identified by mutating residues

to alanine, contribute a larger than expected energy to
the interaction affinity of human growth hormone with
human growth hormone receptor.
Answer: Hot spot

10. Proteins distinguish double-helical RNA and DNA by

differences in _______ shape.
Answer: groove

12. Examining complexes of nucleic acids and their binding

proteins reveals a high _____________ in both shape and
charge.
Answer: complementarity

Quantitative/Essay
(Assume T = 300 K and RT = 2.5 kJmol1 for all questions.)
14. A scientist wants to engineer an antibody to distinguish
between two proteins (Cyclophilin A and Cyclophilin
B) with a specificity of 500 at 1 nM concentration for
each protein. Her starting material is an antibody that
binds with 10 nM KD to both proteins. She finds that
she can easily make mutations that decrease the
affinity for Cyclophilin B without affecting the affinity for
Cyclophilin A. When she achieves the desired specificity,
what is the KD for Cyclophilin B?
Answer:

= (1/(1 + KD,CypA/[L]))/(1/(1 + KD,CypB/[L]))

KD,CypB = ([L] + KD,CypA) [L]
KD,CypB = 5.5 M
16. A zinc finger protein is isolated from a yeast cell. The
value of KD for its binding site is 3 M. In the presence
of glucose, the protein dimerizes and recognizes an
inverted repeat binding site.
a. What is the expected value of KD if the binding is
additive?
b. The dimeric KD is measured at 5 nM. Why does this
value deviate from the expected KD?
Answer:
a. KD,dimer = (KD,monomer)2
= (3 106)
= 9 1012
= 9 pM

The Molecules of Life by John Kuriyan, Boyana Konforti, and David Wemmer Garland Science

Chapter 13: Specificity of Macromolecular Recognition

b. The simple additivity of free energy is probably
reduced because energy is used to induce
conformational changes in the DNA and protein to
stabilize the dimer.

18. A proteinprotein interface has a 10 nM affinity at

300 K. A series of mutants are made in which each
residue at the interface is replaced by alanine. A lysine
residue at the center of the interface is mutated, and
found to contribute 4 kJmol1 to the binding free
energy.
a. What is the new KD?
b. Explain whether or not the lysine residue is a hot
spot residue.
Answer:
a. G = 4 kJmol1 = GLys GAla = RTln(KD,Lys)
RTln(KD,Ala)
RTln(KD,Ala) = RTln(KD,Lys) 4 kJmol1 = RTln(108) + 4
kJmol1 = 42 kJmol1
KD,Ala = e(16.8) = 5.0 108 = 50 nM
b. Since the Lysine residue contributes only
4 kJmol1 of binding energy, it is likely not a hotspot
residue.
20. A proteinprotein interface comprises 22 residues at
the contact surface. From structures of the isolated
proteins, it is expected that completely burying these
residues would cause a surface area reduction of
~2000 2. However, a structure of the interface reveals
that only 1200 2 of surface area is buried. Why is there
a discrepancy between the expected and measured
surface area reductions?
Answer:
Because the shape complementarity is not perfect,
many residues are not completely buried in the bound
complex. Additionally, residues that interfacial waters,
which are important for providing hydrogen bonding
networks at interfaces, are not normally counted as
part of the buried surface area.

22. A DNA-binding domain binds the sequence

GATCGCAATATCGATCGATC with a 25 nM affinity. A
mutation of an Arg to Ala in the protein or a mutation
of the underlined T to G in the DNA sequence
both result in a 9 kJmol1 loss of binding free energy.
Simultaneous mutation of both the protein and the DNA
also results in a 9 kJmol1 loss of binding free energy.
a. What is the effect on the KD of any of these
mutations?
b. What does the double mutant result suggest about
the structural basis for the proteinDNA interaction?
Answer:
a. G = 9 kJmol1 = GArg/G/Arg+G GAla =
RTln(KD,Arg/G/Arg+G) RTln(KD,Ala)
9/2.5 = ln(2.5 108) ln(KD,Ala)
3.6 = 17.5 ln(KD,Ala)
KD,Ala = 9.1 107
b. The lack of additivity suggests that the Arg and T
might interact directly, as removing either side of the
interaction has the same effect as removing both sides.
Given that the T occurs in an AT-rich stretch of DNA
and that Arg residues can recognize such stretches
through a narrowed minor groove, it is likely that this
mechanism contributes to the specific recognition of
this stretch of DNA.
24. A complex of seven transcription factors binds a DNA
enhancer element. The binding is cooperative. What
are two molecular mechanisms that the transcription
factors might use to achieve this cooperativity?
Answer:
The transcription factors may make contact with
each other facilitating the assembly of the context.
These proteinprotein interactions would increase the
apparent cooperativity of the proteinDNA interactions.
Second, some of the transcription factors may
recognize a distorted DNA structure. If one transcription
factor stabilizes this distorted structure (and in essence
pays the energetic penalty for distorting it away from
ideal geometry) then subsequent binding events can
rely on the distorted DNA for specific interactions
without contributing energy to induce a conformational
change in the DNA.

The Molecules of Life by John Kuriyan, Boyana Konforti, and David Wemmer Garland Science