Plant Mol Biol Rep (2011) 29:489497

DOI 10.1007/s11105-010-0252-7

Characterization of the Jasmonate Biosynthetic Gene Allene

Oxide Cyclase in Artemisia annua L., Source
of the Antimalarial Drug Artemisinin
Xu Lu & Xiuyan Lin & Qian Shen & Fangyuan Zhang &
Yueyue Wang & Yunfei Chen & Tao Wang &
Shaoyan Wu & Kexuan Tang

Published online: 17 September 2010

# Springer-Verlag 2010

Abstract Artemisinin is currently the best therapeutic

against both drug-resistant and cerebral-malaria-causing
strains of Plasmodium falciparum. Allene oxide cyclase
(AOC) is the key enzyme in the biosynthetic pathway of
jasmonates. In this study, a full-length cDNA of AOC gene
(named as AaAOC) was cloned from Artemisia annua L.
AaAOC was 1,007 bp, containing an open reading frame
(750 bp) encoding 249 amino acids. Comparative and
bioinformatic analyses revealed that the deduced protein of
AaAOC was highly homologous to AOC from other plant
species. Phylogenetic analysis indicated that AaAOC was
clustered in a closely related subgroup with AOC of
Camptotheca acuminata. Southern blot analysis revealed
that AaAOC was a multicopy gene. Reverse transcriptasepolymerase chain reaction (RT-PCR) and QPCR analysis
showed that AaAOC mRNA accumulated most abundantly
in alabastrums, in which the content of artemisinin was
previously proven to be the highest. RT-PCR analysis revealed
that MeJA, ABA, and ethylene treatments significantly
enhanced AaAOC transcript expression. And the results of
HPLC showed that the contents of artemisinin were greatly
increased after the treatments of ABA and MeJA.
Keywords Allene oxide cyclase . Artemisia annua L. .
Jasmonate biosynthetic pathway

X. Lu : X. Lin : Q. Shen : F. Zhang : Y. Wang : Y. Chen :

T. Wang : S. Wu : K. Tang (*)
Plant Biotechnology Research Center, Fudan-SJTU-Nottingham
Plant Biotechnology R&D Center, School of Agriculture and
Biology, Shanghai Jiao Tong University,
Shanghai 200240, Peoples Republic of China
e-mail: kxtang@sjtu.edu.cn

Introduction
Malaria is a severe human disease in the tropical areas of
Africa, Southeast Asia, and Central and South America, which
threatens more than one third of the global population and kills
approximately two million people annually (Korenromp et al.
2005). Artemisinin, a sesquiterpene lactone derived from the
sweet wormwood plant Artemisia annua L., is currently the
best therapeutic against both drug-resistant and cerebralmalaria-causing strains of Plasmodium falciparum (Weathers
et al. 2006). Some researchers also find that the bioactive
derivatives of artemisinin exhibit potent anticancer effects in a
variety of human cancer cell model systems including growth
inhibition by cell cycle arrest, apoptosis, inhibition of
angiogenesis, and so on (Firestone and Sundar 2009).
However, the artemisinin content of A. annua is very
low (0.011% dry wt), and this limits the commercialization
of artemisinin greatly. Therefore, great efforts have been made
to try to increase artemisinin production. As the total synthesis
of artemisinin is difficult and costly, many other approaches
have been attempted to improve artemisinin production, such
as environmental factor manipulation for A. annua plants, a
semisynthetic microbial process for the production of
artemisinin, the fast-track breeding of A. annua and the
genetic engineering (Putalun et al. 2007; Dietrich et al. 2009;
Graham et al. 2010; Zhang et al. 2009; Hong et al. 2009).
Recently, some researchers found that the addition of
jasmonates (JAs) at optimized concentration can greatly
increase the production of artemisinin (Baldi and Dixit
2008; Wang et al. 2010; Guo et al. 2010). The JAs are
important signaling molecules in the plant kingdom and play
crucial roles in biotic/abiotic stress responses, as well as in
processes related to plant growth and development (Avanci
et al. 2010). So JA biosynthetic pathway genes are supposed

490

to be involved in the production of JAs and thus in flower

development and secondary metabolism (Jiang et al. 2009).
Allene oxide cyclase (AOC) catalyzes the formation of
OPDA and establishes naturally occurring enantiomeric form
of jasmonate (Kong et al. 2009). As it is regarded as the most
critical step in jasmonate biosynthesis, AOC is preferentially
chosen in this study. In this paper, the full-length cDNA
sequence, together with the genomic DNA sequence of AOC
gene, was isolated and characterized from A. annua for the
first time. The three-dimensional structural model, the
phylogenetic tree, and the expression profile of AaAOC
were also investigated. The successful isolation of AaAOC
gene will be helpful in exploring the jasmonate biosynthetic
pathway of A. annua, and its application may also improve
the content of artemisinin in the future.

Plant Mol Biol Rep (2011) 29:489497

from A. annua was deduced from the obtained sequences

and consequently amplified by proofreading RT-PCR
amplification with primers AOCfull5 and AOCfull3. All
the primers used in RACE were listed in Table 1.
Cloning of the Genomic Sequence Corresponding
to the AaAOC Full-Length cDNA
Total genomic DNA was extracted from A. annua leaves by
cetyltrimethylammonium bromide method and used as
template in PCR amplification with primers AOCFull5
and AOCFull3 to investigate the presence of intron(s). The
amplification reactions were denatured at 94C for 4 min,
followed by 35 cycles of amplification (94C for 30 s, 56C
for 30 s, 72C for 2 min 30 s) and 10 min at 72C. The
PCR product was purified and cloned into pMD18-T
vector, followed by sequencing.

Materials and Methods

Comparative and Bioinformatic Analyses
Plant Materials
The seeds of A. annua were obtained from the School of
Life Sciences, Southwest University in Chongqing, P.R.
China. Total RNA was extracted from young leaves of A.
annua using plant RNA isolation reagent (Tiangen Biotech,
Beijing) following the manufacturers instructions. RNA
from various tissues of A. annua was used for reverse
transcriptase-polymerase chain reaction (RT-PCR) and realtime quantitative polymerase chain reaction (RT-QPCR)
analysis.
Cloning of the Full-Length cDNA of AaAOC Gene
The cDNA synthesis was performed with the SMART
technology (SMART RACE cDNA Amplification Kit)
for 5- and 3-rapid amplification of cDNA ends (RACE,
CLONTECH Laboratories, Inc.). For 3-RACE, RNA was
reversely transcribed with the 3-RACE CDS Primer A
(provided in the kit). Cloning of AaAOC by 3-RACE
primers AOC3-1 and AOC3-2 was designed according to
the conserved regions of other AOC genes deposited in
GenBank. For 5-RACE, RNA was reversely transcribed
with the 5-RACE CDS primer and SMART II A
oligonucleotide (provided in the kit). Based on the
sequence of the 3-RACE product, the specific primers
AOC5-1 and AOC5-2 were designed and synthesized. The
first round of PCR was performed with primer AOC5-1 and
Universal Primer A Mix (provided in the kit). The PCR
product was diluted 50-fold for a second round of
amplification with primer AOC5-2 and Nested Universal
Primer A (provided in the kit). The 5- and 3-RACE were
performed essentially according to the SMART RACE
cDNA Amplification Kit user manual. The full-length AOC

Comparative and bioinformatic analyses of AaAOC were

carried out online at the websites http://www.ncbi.nlm.nih.
gov and http://cn.expasy.org. The nucleotide sequence,
deduced amino acid sequence, and open reading frame
(ORF) were analyzed, and the sequence comparison was
conducted through database search using BLAST program in
the National Center for Biotechnology Services (http://www.
ncbi.nlm.nih.gov). Three-dimensional structural prediction of
AaAOC was performed by the SOMPA (Comber et al. 2000)
server (http://bip.weizmann.ac.il/bio-tools/faq.html).
Homology-based structural modeling was performed by
using Swiss model, and WebLab ViewerLite (http://www.
accelrys.com) was used for displaying and editing the 3-D
structure. The phylogenetic analysis of AaAOC protein and
AOC from other species was carried out by alignment with
CLUSTAL X (1.81) using default parameters. A phylogenetic
tree was constructed by neighbor-joining method (Saitou and
Nei 1987) using software MEGA version 3.1 (Kumar et al.
2001).
Southern Blot Analysis
Aliquots of genomic DNA (40 g/sample) were digested
overnight at 37C with HindIII, DraI, EcoRI, and XbaI,
respectively, fractionated by 1.0% agarose gel electrophoresis
and transferred onto a positively charged Hybond-N+ nylon
membrane (Amersham Pharmacia, England). The probe was
generated by PCR with the full-length sequence of AaAOC
as the template, using primers AOC-SouthF and AOCSouthR. Probe labeling (biotin), hybridization, and signal
detection were performed using Gene Images Random Prime
Labeling Module and CDP-Star Detection Module following
the manufacturers instructions (Amersham Pharmacia,

Plant Mol Biol Rep (2011) 29:489497

Table 1 Primers for
PCR amplification in this
study

Y (C/T), R (A/G), S (C/G), M

(A/C), H (A/T/C)

491

Primers

Purpose

Primer sequence (53)

AOC3-1
AOC3-2
AOC5-1
AOC5-2
3-RACE CDS primer A

3-RACE
3-RACE
5-RACE
5-RACE
RACE

5-RACE CDS primer A

SMART II A Oligo
UPM

RACE
RACE
RACE

NUP
AOCfull5
AOCfull3
AOCRT-F

RACE
Clone
Clone
RT-PCR, QPCR

CTCGGMGATCTYGTSCC
AGCTTYTAYTTCGGHGRYTAYGG
GTGTCTTCTGTCGTGATGTATGCG
TTAGCATCTGGAGACGCTTCAACC
AAGCAGTGGTATCAACGCAGAGTAC(T)30 VN
(N=A, C, G, or T; V=A, G, or C)
(T) VN
AAGCAGTGGTATCAACGCAGAGTACGCGGG
Long (0.4 M): CTAATACGACTCACTATAGGG
CAAGCA GTGGTATCAACGCAGAGT
Short (2 M): CTAATACGACTCACTATAGGGC
AAGCAGTGGTATCAACGCAGAGT
ATGGCAGCTGCTTCA
TTAATCACTAAAGTTAGGACCAGTGG
GRCCTGCTTACCTACGGTTGGG

AOCRT-R
RPS9F
RPS9R
AOC-southF
AOC-southR

RT-PCR, QPCR
RT-PCR, QPCR
RT-PCR, QPCR
Southern
Southern

TTCTGTCGTGATGTATGCGCCT
GCGTTTGGATGCTGAGTTGAAG
GGCGCTCAAGGAAGTTCTCTAC
CGCTGATCTCAAAACAAGACTAGG
CTTAGCATCTGGAGACGCTTCAA

England). The hybridization was carried out with highstringency wash at 55C. The hybridized signals were
visualized by exposure to Fuji X-ray film at room temperature
for 4 h.
Treatment Procedures
To study the changes of gene expression under different
treatments, 2-month-old A. annua were treated with
wounding, solutions of 100 M ABA, 100 M MeJA,
and 500 M Ethephon (which can dissolve into water and
release the gas of ethylene). Concurrently, a set of control
A. annua was similarly treated with distilled water.
Gene Expression Analysis
The expression of AaAOC in different tissues as well as in
different treatments was studied through semiquantitative
RT-PCR and RT-QPCR. All RNA samples were digested
with DNase I (RNase-free) prior to use. Aliquots of 400 ng
total RNA were employed in the reverse transcriptase
reaction using random hexamer primers for the synthesis
of first-strand cDNA.
With AOCRT-F and AOCRT-R as primers, the amplification reactions of RT-PCR was denatured at 94C for
4 min, followed by 25 cycles of amplification (94C for
30 s, 56C for 30 s, 72C for 40 s) and by extension at 72C
for 10 min. The RT-PCR reaction for the housekeeping
gene (RPS9 gene) using specific primers RPS9F and

RPS9R was performed as described above in control. The

products of RT-PCR were run on 1% agarose gel
electrophoresis with ethidium bromide and showed bands
of 236 bp for AaAOC and 260 bp for RPS9 as predicted in
template sequences.
The amplification reactions of RT-QPCR were performed
on an iCycler iQTM Real-Time PCR Machines (Bio-Rad,
Watford, UK) with gene-specific primers AOCRT-F and
AOCRT-R, RPS9 primers RPS9F and RPS9R, and the SYBR
ExScript RT-PCR kit (Takara, Shiga, Japan) protocol to
confirm changes in gene expression. For each reaction, 2 l
of diluted cDNA (corresponding to 0.8 ng of total RNA),
2.5 l of EASY dilution, 12.5 l of 2SYBR Premix Ex
Taq, 0.25 M of forward primer, 0.25 M of reverse
primer, and nuclease-free water were added to a final volume
of 25 l. The thermal cycle conditions used were 1 min at 95C
followed by 40 cycles of amplification (15 s at 95C, 30 s at
56C, and 30 s at 72C). Melt curve analysis and agarose gel
electrophoresis following each RT-QPCR were performed to
assess product specificity. The expression levels of RPS9 and
AaAOC in unknown samples were quantified for three
repeats by measuring the cycle threshold values (Ct) and
extrapolation to their standard curves constructed with serial
dilution cDNA templates from leaves of known concentrations (101, 102, 103,104, 105, and 106 of the original
cDNA solution). Then the ratio of expression levels of
AaAOC/RPS9 in leaves was initiated as 1.0, so the relative
ratios of expression levels of AaAOC/RPS9 in other tissues
were determined by comparing with that in leaves.

492

Fig. 1 Sequence organization of cloned AaAOC gene (positions 1

2,056 bp) (GenBank accession no. HM189219). UTRs, exons, and
introns are indicated in gray, black, and white respectively

Quantification of Artemisinin Using HPLCELSD

Leaves of A. annua were dried at 45C and, when ground,
the dried-leaf powder (0.1 g/sample) was extracted with
ethanol (1 ml) using a Shanghai Zhisun Instrument Co. Ltd
model JYD-650 ultrasonic processor (two bursts of 15 min
each), then centrifuged for 10 min at 4,000 rpm to remove
the suspended particles. The final supernatant was filtered
through a 0.25-m-pore-size filter.
The samples were analyzed using a Waters Alliance
2695 high-performance liquid chromatography (HPLC)
Fig. 2 Multialignment of amino
acid sequences of AaAOC and
other AOCs. The aligned AOCs
are from A. thaliana
(NM113476), S. tuberosum
(AY135641), I. nil (DQ314585),
C. acuminata (AY863428), S.
lycopersicum (CAC83760), and
H. niger (AY708383). Highly
conserved residues in all the
sequences are indicated in white
with black background and only
partially conserved residues in
the AOC sequences are showed
in black with gray background.
The conserved residues that
constitutes the active site of
AaAOC were indicated with
black diamond

Plant Mol Biol Rep (2011) 29:489497

system coupled with a Waters 2420 evaporative lightscattering detection (ELSD) detector. The HPLC conditions
were as follows: column, Waters C18; mobile phase, water/
methanol (40:60, v/v); flow rate, 1 ml/min. The ELSD
conditions were optimized at a nebulizer gas pressure of
345 kPa (50 lbf/in.2) and drift-tube temperature of 45C,
and the gain was set at 7. Authentic artemisinin from Sigma
was used as the standard. For each sample, the injection
volume was 20 l, and the results were analyzed using
Empower (Waters chromatography data software). The
measurement was repeated three times.

Results and Discussion

Characterization of the Full-Length cDNA and Genomic
DNA Sequences of AaAOC Gene
Using degenerated primers AOC3-1 and AOC3-2, a band
of 472 bp was specifically amplified, and the sequence

Plant Mol Biol Rep (2011) 29:489497

493

analysis showed that it was highly homologous to AOCs

from other plant species. Two pairs of primers were then
designed for the 5-RACE based on the obtained 3-end
sequence. By using the method described in Materials and
methods, the full-length cDNA of AaAOC gene (GenBank
accession no. HM189219) was obtained, which was
subsequently confirmed by sequencing. It was 1,007 bp
long and contained a 750-bp ORF encoding a 249 amino
acid proteins. There was a 5-untranslated region of 68 bp
upstream from the start codon with an ATG as the transcript
start, and the coding region was followed by 3-untranslated
region that was 340 bp long downstream from the stop
codon including the poly(A).
The PCR for genomic sequence resulted in a clear band
of 2,056 bp, which was 1,306 bp longer than that of the
coding sequence. The comparison with the cDNA showed
that the genomic DNA and cDNA matched base to base
except that the genomic DNA contained two introns. The
lengths of three exons were 226, 117, and 407 bp,
respectively (Fig. 1). The lengths of the two introns were
99 and 950 bp, respectively. Similarly, it was found that most
of the AOC genes from plant species were composed of three
exons and two introns, such as Camptotheca acuminata (Pi et
al. 2008) and Hyoscyamus niger (Jiang et al. 2008).

Characterization of the Deduced AaAOC Protein

Fig. 3 The secondary and three-dimensional structure of the predicted

protein of the AaAOC. a The secondary structure of AaAOC protein.
-helix and extended strands were denoted as vertical long bars and

vertical short bars, respectively. b The three-dimensional structure of

AaAOC protein. The -strands of the barrel are labeled S1S8

By using the software pI/Mw tool at http://www.expasy.org,

the isoelectric point (pI) and molecular weight of the
deduced AaAOC protein were predicted to be 9.07 and
26.61 kDa, respectively. A database search with BlastP
(National Center for Biotechnology Information databases)
and the multialignment showed that the AaAOC protein
had high homology with other plant AOCs (Fig. 2). The
AaAOC protein showed 49%, 59.5%, 59.7%, 65.2%, 55.5%,
and 59.7% identities to those of Arabidopsis thaliana
(NM113476), Solanum tuberosum (AY135641), Ipomoea
nil (DQ314585), C. acuminata (AY863428), Pisum sativum
(AB095986), and H. niger (AY708383), respectively.
Secondary structural prediction of AaAOC protein was
performed using the SOMPA program (Fig. 3a). Hierarchical
neural network analysis revealed that the AaAOC protein
was composed of 16.06% -helix, 25.70% extended strand,
9.24% -turn, and 49% random coil. The extended strand
and random coil constituted interlaced domination of the
main part of the secondary structure. The amino acid sequence
of AaAOC was quite diverse in both length and composition
in the N terminus when compared with other plant AOCs.
SignalP 3.0 analysis (http://www.cbs.dtu.dk/services/SignalP/)

494

Plant Mol Biol Rep (2011) 29:489497

(Bendtsen et al. 2004) showed that the N-terminal part of

AaAOC protein was not a signal peptide.
The Three-Dimensional Structural Modeling Analysis
of AaAOC
The structure of AOC2 from A. thaliana has been
determined by X-ray crystallography independently in two
different labs. Analysis of the AOC2 structure already
suggests that the active site which is composed of P32,
N25, N53, C71, and E23 is located inside the barrel cavity
(Hofmann et al. 2006; Levin et al. 2007). All of these
residues that constitute the active site of the protein of AOC
were marked with (Fig. 2). The homology-based 3-D
structural modeling of AaAOC protein was analyzed by
Swiss modeling and displayed by WebLab ViewerLite
(Fig. 3b). The 3-D model of AaAOC was predicted to form
eight -strands of the barrel which are labeled S1S8
(Fig. 3b). The results showed high similarity to A. thaliana
AOC2 and suggested that AaAOC might have similar
functions with that of A. thaliana.
Molecular Evolution Analysis
A phylogenetic tree of AOC proteins from different
organisms was drawn using the CLUSTAL X program.
The phylogenetic tree demonstrated that AOC proteins
originated from a common ancestor and diverged into three
groups (Fig. 4). Four AOC proteins of A. thaliana diverged
earlier than other species. Oryza sativa, Zea mays, Sorghum
bicolor, and Hordeum vulgare converged into a group. The
AOC proteins from A. annua to C. acuminata form a
closely related subgroup.
Southern Blot Analysis
The number of genes encoding AOC was not the same
among diverse plant species. AOCs have been cloned as a
single-copy gene from Solanum lycopersicum (Ziegler et al.
2000) and H. vulgare (Maucher et al. 2004). However,
AOCs were also found to be multicopy genes in H. niger
(Jiang et al. 2008) and C. acuminata (Pi et al. 2008). In
order to investigate whether AaAOC was a single- or
multiple-copy gene, Southern blot analysis was performed
under high-stringency condition, and the result showed that
a few hybridizing bands were present in each lane,
indicating that AaAOC was a multiple-copy gene (Fig. 5).
Tissue-Specific Expression of AaAOC
Total RNAs extracted from roots, stems, leaves, and
alabastrums were subjected to investigation of the AaAOC
expression pattern by RT-PCR and QPCR analysis. The

Fig. 4 Phylogenetic tree of AaAOC protein with plant AOCs

generated by the neighbor-joining method. The numbers on the
branches represent bootstrap support for 1,000 replicates. The AOCs
used in the phylogenetic tree analysis were from S. tuberosum
(AY135641), A. thaliana AOC1 (NM113475), A. thaliana AOC2
(NM113476), A. thaliana AOC3 (NM113477), A. thaliana AOC4
(NM1101199), C. acuminata (AY863428), H. niger (AY708383), I.
nil (DQ314585), A. annua (HM189219), Nicotiana tabacum
(CAC83765), S. lycopersicum (CAC83760), O. sativa (AAR89017),
Z. mays (AAR33049), S. bicolor (XP002465087), and H. vulgare
(CAC83766)

results showed that AaAOC was expressed in a constitutive

manner in organs, but with different levels (Fig. 6). In
summary, stems and alabastrums had higher expression
levels of AaAOC than roots and leaves. The tissue
expression profile of AaAOC matched well with the results
Fig. 5 Southern blot analysis
of AaAOC in A. annua.
Total genomic DNA isolated
from fresh leaves of A. annua
was digested overnight at 37C
with HindIII, DraI, EcoRI, and
XbaI, respectively, followed by
hybridization with the biotinlabeled AaAOC probe

Plant Mol Biol Rep (2011) 29:489497

495

in tomato in which AOC mRNA was highly expressed in

distinct flower organs (Hause et al. 2000). Interestingly, the
expression profile of AaAOC in different tissues seemed to
be a bit similar with the content of artemisinin content in
the corresponding tissues as mentioned previously. In A.
annua, the glandular secretory trichomes (GSTs) are
thought to be the site of biosynthesis and storage of
artemisinin (Covello et al. 2007; Olsson et al. 2009). The
artemisinin content and GSTs of A. annua were previously
proven to be the highest in alabastrums, while AaAOC was
also found to have the highest expression level in
alabastrums.
Modulation of Expression and Artemisinin Content
in Response to Defense Signals

Fig. 6 Expression profiling analysis of AaAOC in various tissues of

A. annua. Total RNA was isolated, respectively, from roots, stems,
leaves, and alabastrums of A. annua followed by RT-PCR and RTQPCR analysis with RPS9 as an internal control. a RT-PCR analysis
of AaAOC in A. Annua. b Relative quantitation analysis of AaAOC in
A. annua using qPCR. The ratio of transcripts of AaAOC against that
of RPS9 in leaves was initiated as 1.0. The y-axis represents the
relative ratio of expression levels of AaAOC/RPS9 in various tissues
compared with which in leaves. The data represent the meansSD
(standard deviation) of three repeated samples

Fig. 7 Expression profile analysis of AaAOC and artemisinin content

determined by HPLCELSD analysis under different treatments. a
Total RNA was isolated, respectively, from A. annua leaves under
different treatments for six different periods of time (0, 1, 3, 6, 12, and
24 h) followed by RT-PCR analysis with the gene-specific primers
AOCRT-F and AOCRT-R (upper panels). RPS9 was used as internal

The expression of the JA biosynthesis pathway genes was

induced by various stresses and different treatments, such
as wounding and JA treatment (Browse 2009). In this study,
RT-PCR analysis was used to obtain the expression pattern
of AaAOC under different treatments including wounding,
MeJA, ABA, ethylene, and H2O control (Fig. 7a). The
expression of AaAOC slightly increased in detached leaves
under water treatment, suggesting that being excised and
soaked in water upregulated the transcription of AaAOC. It
was reported that wounding can induce expression of the
genes encoding enzymes specific for JA biosynthesis in
various plant species, while in this study the expression of

control (lower panels). b Artemisinin content analysis was performed

under different treatments for five different periods of time (0, 6, 12,
24, and 48 h) by HPLC. All the plants grew in the chamber for
2 months. The measurement was repeated three times. Vertical bars
represent standard deviation

496

AaAOC was induced by wounding, too. In the present

study, the results showed that AaAOC was expressed in a
fluctuating manner, with the highest expression found 3 h
after the treatments. At this moment, the treatments of
ABA, ethylene, and MeJA significantly enhanced AaAOC
transcript expression, compared with the water control in A.
annua (Fig. 7a).
Among the JA biosynthetic enzymes, AOC is important,
since this enzyme establishes the naturally occurring
enantiomeric form of jasmonate (Kong et al. 2009). As
we all know, the addition of JAs at optimized concentration
can greatly increase the production of artemisinin. So the
upstream expressions of AaAOC may have some relations
with the content of artemisinin in A. annua. Artemisinin
contents in all the treatments were analyzed using HPLC
ELSD. The results showed that wounding, MeJA, ABA,
and ethylene can increase the content of artemisinin in
different levels. Significantly, MeJA and ABA showed the
most prominent effect on stimulating the increasing the
content of artemisinin (Fig. 7b). Ethylene treatment showed
similar AOC transcript expression with MeJA or ABA, but
the artemisinin levels were significantly lower than in
MeJA or ABA after the treatments of 48 h (Fig. 7). From
those results, we infer that AaAOC was only a gene which
can affect the content of artemisinin. There may be a more
complicated network to regulate the content of artemisinin
in A. annua, and further research is needed in the future.
In conclusion, the full-length cDNA and genomic DNA
sequences of AOC were cloned and characterized from A.
annua for the first time. The 3-D structure modeling and
phylogenetic tree analysis imply that the AaAOC protein may
have similar functions with other AOC proteins. RT-PCR and
QPCR analyses showed that AaAOC mRNA accumulated
most abundantly in alabastrums, in which the content of
artemisinin was previously proven to be the highest. RT-PCR
analysis revealed that MeJA, ABA, and ethylene treatments
significantly enhanced AaAOC transcript expression. And the
results of HPLC showed that the contents of artemisinin were
already increased greatly by the treatments of ABA and
MeJA. The cloning and characterization of AaAOC gene will
be helpful for further transgenic studying in promoting
artemisinin content in A. annua.
Acknowledgments This work was funded by China 973 Program,
China 863 Program, Ministry of Education, Shanghai Science and
Technology Committee and Shanghai Leading Academic Discipline
Project (B209).

References
Avanci NC, Luche DD, Goldman GH, Goldman MHS (2010) Jasmonates
are phytohormones with multiple functions, including plant defense
and reproduction. Genet Mol Res 9:484505

Plant Mol Biol Rep (2011) 29:489497

Baldi A, Dixit VK (2008) Yield enhancement strategies for artemisinin
production by suspension cultures of Artemisia annua. Bioresour
Technol 99:46094614
Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004) Improved
prediction of signal peptides: signalP 3.0. J Mol Biol 340:783
795
Browse J (2009) Jasmonate passes muster: a receptor and targets for
the defense hormone. Annu Rev Plant Biol 60:183205
Comber C, Blanchet C, Geourjon C, Deleage G (2000) NPS@: network
protein sequence analysis. Trends Biochem Sci 25:147150
Covello PS, Teoh KH, Polichuk DR, Reed DW, Nowak G (2007)
Functional genomics and the biosynthesis of artemisinin.
Phytochemistry 68:18641871
Dietrich JA, Yoshikuni Y, Fisher KJ, Woolard FX, Ockey D, McPhee
DJ, Renninger NS, Chang MC, Baker D, Keasling JD (2009) A
novel semi-biosynthetic route for artemisinin production using
engineered substrate-promiscuous P450BM3. ACS Chem Biol
4:261267
Firestone GL, Sundar SN (2009) Anticancer activities of artemisinin
and its bioactive derivatives. Expert Rev Mol Med 11:e32
Graham IA, Besser K, Blumer S, Branigan CA, Czechowski T, Elias
L, Guterman I, Harvey D, Isaac PG, Khan AM, Larson TR, Li Y,
Pawson T, Penfield T, Rae AM, Rathbone DA, Reid S, Ross J,
Smallwood MF, Segura V, Townsend T, Vyas D, Winzer T,
Bowles D (2010) The genetic map of Artemisia annua L.
Identifies loci affecting yield of the antimalarial drug artemisinin.
Science 327:328331
Guo XX, Yang XQ, Yang RY, Zeng QP (2010) Salicylic acid and
methyl jasmonate but not Rose Bengal enhance artemisinin
production through invoking burst of endogenous singlet oxygen.
Plant Sci 178:390397
Hause B, Stenzel I, Miersch O, Maucher H, Kramell R, Ziegler J,
Wasternack C (2000) Tissue-specific oxylipin signature of tomato
flowers: allene oxide cyclase is highly expressed in distinct
flower organs and vascular bundles. Plant J 24:113126
Hofmann E, Zerbe P, Schaller F (2006) The crystal structure of
Arabidopsis thaliana allene oxide cyclase: insights into the
oxylipin cyclization reaction. Plant Cell 18:32013217
Hong GJ, Hu WL, Li JX, Chen XY, Wang LJ (2009) Increased
accumulation of artemisinin and anthocyanins in Artemisia
annua expressing the Arabidopsis blue light receptor CRY1.
Plant Mol Biol Rep 27:334341
Jiang KJ, Liao ZH, Pi Y, Huang ZS, Hou R, Cao Y, Wang Q, Sun XF,
Tang KX (2008) Molecular cloning and expression profile of a
jasmonate biosynthetic pathway gene for allene oxide cyclase
from Hyoscyamus niger. Mol Biol 42:381390
Jiang KJ, Pi Y, Hou R, Zeng HN, Huang ZS, Zhang Z, Sun XF, Tang
KX (2009) Molecular cloning and expression profiling of the
first specific jasmonate, biosynthetic pathway gene allene oxide
synthase from Lonicera japonica. Mol Biol Rep 36:487493
Kong FJ, Li Y, Abe J, Liu B, Schaller F, Piotrowski M, Otagaki S,
Takahashi K, Matsuura H, Yoshihara T, Nabeta K (2009)
Expression of allene oxide cyclase from Pharbitis nil upon
theobroxide treatment. Biosci Biotechnol Biochem 73(5):1007
1013
Korenromp E, Miller J, Nahlen B, Wardlaw T, Young M (2005) World
malaria report 2005. World Health Organization (WHO), Roll
Back Malaria Partnership, Geneva
Kumar S, Tamura K, Jakobsen IB, Nei M (2001) MEGA2: molecular
evolutionary genetics analysis software. Bioinformatics 17:1244
1245
Levin EJ, Kondrashov DA, Wesenberg GE, Phillips GN (2007)
Ensemble refinement of protein crystal structures: validation and
application. Structure 15:10401052
Maucher H, Stenzel I, Miersch O, Stein N, Prasad M, Zierold U,
Schweizer P, Dorer C, Hause B, Wasternack C (2004) The allene

Plant Mol Biol Rep (2011) 29:489497

oxide cyclase of barley (Hordeum vulgare L.)cloning and
organ-specific expression. Phytochemistry 65:801811
Olsson ME, Olofsson LM, Lindahl AL, Lundgren A, Brodelius M,
Brodelius PE (2009) Localization of enzymes of artemisinin
biosynthesis to the apical cells of glandular secretory trichomes
of Artemisia annua L. Phytochemistry 70:11231128
Pi Y, Liao ZH, Jiang KJ, Huang BB, Deng ZX, Zhao DL, Zeng HN,
Sun XF, Tang KX (2008) Molecular cloning, characterization and
expression of a jasmonate biosynthetic pathway gene encoding
allene oxide cyclase from Camptotheca acuminate. Biosci Rep
28:349355
Putalun W, Luealon W, De-Eknamkul W, Tanaka H, Shoyama Y
(2007) Improvement of artemisinin production by chitosan in
hairy. Biotechnol Lett 29:11431146
Saitou N, Nei M (1987) The neighbor-joining method: a new method
for reconstructing phylogenetic trees. Mol Biol Evol 4:406425

497
Wang HH, Ma CF, Li ZQ, Ma LQ, Wang H, Ye HC, Xu GW, Liu BY
(2010) Effects of exogenous methyl jasmonate on artemisinin
biosynthesis and secondary metabolites in Artemisia annua L.
Ind Crops Prod 31:214218
Weathers PJ, Elkholy S, Wobbe KK (2006) Artemisinin: the
biosynthetic pathway and its regulation in Artemisia annua, a
terpenoid-rich species. In Vitro Cell Dev Biol, Plant 42:309317
Zhang L, Jing FY, Li FP, Li MY, Wang YL, Wang GF, Sun XF, Tang
KX (2009) Development of transgenic Artemisia annua (Chinese
wormwood) plants with an enhanced content of artemisinin, an
effective anti-malarial drug, by hairpin-RNA-mediated gene
silencing. Biotechnol Appl Biochem 52:199207
Ziegler J, Stenzel I, Hause B, Maucher H, Miersch O, Hamberg M,
Grimm M, Ganal M, Wasternack C (2000) Molecular cloning of
allene oxide cyclasethe enzyme establishing the stereochemistry
of octadecanoids and jasmonates. J Biol Chem 275:1913219138