InternationalJournalof

BiotechnologyAdvances

ISSN: 2222-5811
www.ijscience.com

Design and Evaluation of a Recombinant Flagellin-based Putative Vaccine from Salmonella

typhimurium DT104
Anwar Ali Abdulla1, Abdullkreem alkazaz2, Alice Kreikor Melconian3, A. Mahdi Saeed4
1

Department of Biology, College of Science, Babylon University, Iraq; 2,3Department of Biotechnology, College of
Science, University of Baghdad, Iraq; 4Departments of Large Animal Clinical Sciences and Epidemiology, Michigan
State University, USA
ABSTRACT
Flagellin gene (fliC) was extracted from a clinical strain of Salmonella typhimurium DT104, cloned and expressed into
Escherichia coli. Initially, DNA was extracted from the clinical isolate of Salmonella typhimurium. Primers were
designed for the specific sequences of the DNA template and the gene was amplified by polymerase chain reaction.
Copies of the gene from the amplicones were cloned into expression vector pQE30 to generate pQE30-fliC. The
maximum production of His6-tagged protein by E. coli SG13009 (pQE30-fliC) was obtained with 0.5mM IPTG
induction for 3 h at 37C. The expressed protein was purified by affinity chromatography using Ni-NTA Agarose. The
molecular weight of the purified protein was estimated to be 56 KDa by SDS-PAGE. When recombinant flagellin was
used to immunize a group of balb/C mice, protective immunity against challenge with the parent strain of Salmonella
typhimurium was demonstrated in comparison to non immunized control mice. Results suggest the value of
recombinant flagellin as a potential vaccine against Salmonella infection in humans and animals.
Keywords: Flagellin gene, Salmonella typhimurium vaccine, recombinant flagellin
Corresponding author: A. Mahdi Saeed. Departments of Large Animal Clinical Sciences and Epidemiology,
Michigan State University, USA
Murthy et al. (2004) demonstrated that flagellin is
implicated as a powerful stimulus of eukaryotic proinflammatory gene expression, at a low nano-molar
concentration, flagellin activates eukaryotic cells such as
macrophages, monocytes, intestinal and pulmonary
epithelial cells, to release a broad range of proinflammatory mediators in vitro and in vivo, including,
TNF-, IL-6 and IL-10. The pro-inflammatory and
immunogenic sites of flagellin are concentrated in
conserved parts of the molecule (McSorley et al., 2000;
Strindelius et al., 2004).
In this study, we attempted the cloning and
expression of Salmonella typhimurium DT104 flagellin
gene (fliC) in Escherichia coli and the purification of the
recombinant flagellin.

INTRODUCTION
Salmonella typhimurium is a Gram-negative
bacterium which is among the most common enteric
bacterial pathogens associated with a number of different
human and animal diseases syndromes, e.g.,
gastroenteritis, bacteremia, enteric fever and focal
infections (Foley et al., 2007). Classically, the members
of the genus Salmonella are motile by peritrichous flagella
except Salmonella gallinarum, which lack flagella
(Powsey, 2002). Bacterial flagella are filamentous
appendages on the cell surface that mediate bacterial
motility. The filament of the flagellum is composed of
approximately 20.000 flagellin subunits (Sun et al., 2007).
The component of the flagellum responsible for eliciting
host immune responses is the filament protein flagellin
(Lee et al., 1999) .There is a great deal of variation in the
central portion of the flagellin genes, while the NH2 and
COOH termini are highly conserved. This variation is
used to define specific flagellar antigens, which are used
in the Kauffmann-White scheme to serotype Salmonella.
It is not known whether the variations in flagellin
structure affect virulence (Fierer and Guiney, 2001;
Mortimer et al., 2004). Different systems that used
flagellins as carriers/adjuvants for recombinant fusion
proteins or with co-administered recombinant antigens
were tested in the last few years (Mizal and Bates, 2010;
Bargieri et al., 2011).

MATERIALS AND METHODS

Bacterial strains, vector and growth conditions
Luria-Bertani (LB) media for bacterial culture were
purchased from ISC Bio Express (USA). TaqDNA
polymerase enzyme, Dntp (HotstarTaq plus PCR Master
mix) restriction enzyme (Bio Labs/England), T4 DNA
ligase enzyme (Quick ligation kit) (New England Bio
Labs /England), DNA size marker was obtained from
Invitrogen (USA) and protein size marker was acquired
from BioRad (USA). The oligonucleotide primers were
1

2
synthesized by integrated technologies (IDT/USA). Ni2+nitrilotriacetate (Ni2+-NTA) agarose was obtained from
Qiagen Inc. (Valencia, CA, USA). Reagents for
polyacrylamide electrophoresis such as acrylamide, bisacrylamide, ammonium persulfate and TEMED were
obtained from Sigma/USA.
Salmonella typhimurium DT104 was selected from
the Laboratory of Professor A.M. Saeed at the National
Food Safety & Toxicology Center (NFSTC) at Michigan
State University. Plasmid pQE30 as expression vector was
purchased from Qiagen/USA. Host cells harboring
pQE30-fliC were cultured aerobically in LB medium
supplemented with 100 g/ml ampicillin and 25 g/ml
kanamycin for E. coli SG13009 strain.
Isolation of fliC gene
The genomic DNA from Salmonella typhimurium
DT104 was extracted using a genomic DNA extraction kit
(Qiagen/USA). The specific primers were designed
according to fliC sequences of S. typhimurium (1485 bp,
NCBI Accession No.: M11332). The full coding sequence
of fliC was amplified by polymerase chain reaction (PCR)
using specific primers containing BamHIand HindIII sites.
The sequence of the forward primer was
5...GAGAGGATCCCTCTGGGCACCGCTATCGA...3
and the reverse was:
5GAGAAAGCTTACGCAGTAAAGAGAGGAC
G3 amplifications were carried out in 20l volumes
containing 200nM of each primer, 2l 10x PCR buffer,
1.5Mm
MgCl2,
0.2mM
nucleotide
(dATP,dCTP,dGTP,dTTP), 1 unit of Hot star Taq plus
DNA polymerase, and 200ng genomic DNA.
Amplification was achieved in 35 cycles using a PTC-100
programmable thermal controller (MJ Research,
Inc/USA). Prior to the first cycle, DNA was denatured at
95C for 5 min. Subsequently, each cycle consisted of
denaturation at 94C for 1 min, followed by annealing at
55 for 1min. Elongation was carried out at 72C and the
extension time at 1 min. Subsequently, a final elongation
was performed at 72C for 10 min. PCR product was
separated by electrophoresis on 1% (w/v) agarose gel and
the desired fragment was recovered from the gel using
QIAquick Gel Extraction Kit (QIAGEN/USA).
Cloning and construction of expression plasmid
The purified fragment and the vector were digested
by respective restriction enzymes. The fragment was
ligated to the PQE30 vector. The ligation product was
transformed
into
competent
E.coliDH5
and
transformants were selected on LB agar plates containing
100 g ampicillin/ml (Sambrook and Russell, 2001). The
selected clones were further analyzed by restriction
enzymes and PCR and finally sequenced by Research
Technology Support Facility (RTSF) Michigan State
University /USA. DNA samples (1000 ng) in volumes of
12 l were used for sequencing. Standard T5 polymerase
primer were used, and diluted to a working concentration
of 30 Pmol/l in a volume of 12l according to the
sequencing guidelines of RTSF.
Expression and purification of fliC
For expression, the recombinant plasmid, pQE30fliC, was transformed into competent E. coli SG13009.

Inter J Biotech Adv, 2012, 1(1): 1-6.

E.coli cells harboring expression vector pQE30-fliC were
grown in LB medium supplemented with 100 g/ml
ampicillin and 25 g/ml kanamycin at 37C to an OD600 is
0.5-0.7 for induction, IPTG was added to a final
concentration of 0.5 mM and the culture was grown at
37C for 3h.
Protein methods
Sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) was carried out on 10%
acrylamide using Mini-protean3cells (Bio RAD/ USA).
Before electrophoresis, the samples were heated to 95C
for 5 min in SDS-PAGE loading buffer. Protein size
marker (10-250 KDa) (Bio RAD/USA) was used to
identify the molecular weights of the separated fragments.
Electrophoresis was carried out at 200 volts for 40 min at
room temperature. The gel was stained with coomassie
brilliant blue G-250 (Sigma/ USA). fliC protein (flagellin)
concentration was determined using Bovine Serum
Albumin (BSA) as the standard.
Mouse vaccination and challenge
After a formal application to the Institutional Animal
Care and Use Committee (IACUC), approval to use 20
BALB/c mice was obtained. Ten mice were vaccinated
and the other 10 were to be used as control. BALB/c mice
were obtained from Charles River Laboratories, Boston,
MA, USA. Mice were between 6-8 weeks of age and were
all females for better handling. The mice were marked on
the margins of their ears with numbers from 1-10. Mice
were kept at the University Laboratory Animal Resources
(ULAR) during the 9 weeks of vaccination schedule but
moved to the university infectious disease containment
facility during the challenge experiment. Michigan State
University laboratory animal housing and management
are approved by National Institute of Health (NIH) and
the United State Department of Agriculture (USDA) and
are subject to regular inspection by these federal agencies.
Preparation of the immunogene
Recombinant Flagellin (RF) was produced as
described above. Required amount was filter by passing
through 0.22U sterile filter before mixing with sterile
Complete Freuds adjuvant for the production of the
immunogene emulsion. Equal volumes of flagillin
solution in sterile saline and Complete Freund adjuvant
were emulsified using a Polytroon 3000 mixer set at
14,000 rpm in a small vial dipped into crushed ice to
minimize the heat generated by the fast prob. Intermittent
mixing was continued until true oil in water emulsion was
produced which was tested by a drop of the emulsified
product to 200 ml water in a beaker in a way that it stayed
un-dispersed when dropped into water. Volume of the
adjuvanted flagellin that contains 30 g of the flagellin
protein was adjusted to be in 100 l of the injected
material per each mouse. Three doses of the adjuvanted
flagellin were given to each mouse. To avoid severe
sensitizing reaction, we carefully observed that Complete
Freund adjuvant was only used for the first dose while the
2nd and 3rd doses were emulsified into Incomplete Freund
adjuvant and injected into the mice subcutaneously at
three weeks intervals.

Inter J Biotech Adv, 2012, 1(1): 1-6.

Blood collection for serum testing

Blood was collected from each mouse prior to the
immunization protocol as a base line. The mice were bled
from the saphenous vein after the animal was trapped into
a 50 ml centrifuge tube that has several holes to allow free
breathing by the animal. Vaseline was applied to the leg to
allow a clear site of the vein and to prevent wasting of the
flowing blood to the wrong direction. A capillary tube
was routinely used to collect the blood after a puncturing
the vein using a 23 gauge sterile needle. Blood was
collected into 2 ml microfuge tubes marked with the
number of the bled mouse.
Blood was allowed to coagulate for several hours at
37C before placing the tubes at 4C at a walking in cold
room to allow effective shrinkage of the clot before
centrifugation at 3000 rpm for three minutes to collect the
serum. Sera were kept at -20C till use for ELISA
measurement of the flwgellin-specific antibody titer.

and used for challenge via Intraperitonial inoculation. It

was computed that the overnight culture had 100x million
cfu/ml of the broth. Dilutions were made to produce the
listed levels of the LD50 doses before Intraperitonial
inoculation of the vaccinated and control mice.
After 10 days of the last vaccination dose, five
vaccinated mice and five unvaccinated controls were
challenged i.p. with 100,000 cfu of the live parent strain
of Salmonella typhimurium which approximately equals
to 100 LD50 for this serotype. Another 5 vaccinated mice
and 5 unvaccinated mice were challenged with 1000,000
cfu of the strain which is approximately 1,000 LD50 dose.
Mice were placed in specially designed cages that
minimize environmental contamination at the Infectious
Disease Containment Facility, Michigan State University.
The caged mice were observed 3 times/day for the
duration of the experiment. Dead mice were removed
from the cages as soon as they were detected.

Measurement of the serum flagillin-specific antibody

Enzyme-linked immunosorbent assay (ELISA) was
used for the measurement of flagellin-specific
immunoglobulin in serum samples obtained from the
immunized mice at three week intervals. Briefly, 0.05 M
carbonate-bicarbonate buffer (Sigma), pH 9.6 at 25C was
used to dissolve the freeze-dried flagillin to produce 2 g
per 0.1 ml of the solution that was added to each well of
the plate using a multi-channel pipette. The plate was kept
at 4C overnight before several washings with PBS-that
contains 0.05 Tween 20, as a detergent, to remove nonspecifically bound reagents using ELISA plate washer
(Nunc, Denmark). Then, 0.1 ml of a solution that had one
percent of Bovine Serum Albumin (BSA) in PBS Tween
20 was added to each well to block all exposed spots in
the plate wells that may allow non-specific binding of the
reagents to the well surface. Plates were incubated for one
hour at 37C before a similar washing cycle. A 0.1 ml of
1:100 screening dilution of the mice sera (1 volume of
serum to 99 volumes of PBS Tween 20) were added in
triplicate to each well before plates were incubated for one
hour at 37C. Plate wells were then washed as usual
before adding an alkaline phsphatase-tagged anti mouse
IgG antibody diluted as per the manufacturer instruction
(Sigma chemical company). The plates were again
incubated at 37C for one hour. Plates were then washed
with PBS Tween 20.
A solution of the alkaline phosphates substrate (Pnitrophenol, Sigma Chemical Company U.S.A.) was
prepared as per the manufacturers instruction. One tenth
milliliter was added to each well and the plate was
incubated for 15 minutes at room temperature. Reaction
was stopped by adding 50 l of 2 Molar NaOH solution to
each well. Plates were then read at 405 nm in a
Thermomax ELISA plate reader (Molecular Devices, MA,
and U.S.A). Each serum sample was tested in triplicates.

RESULTS

Challenge protocol
Challenge Salmonella typhimurium strain was the
same strain used to produce the recombinant Flagellin. It
was grown overnight in nutrient broth at 37C in an
incubator shaker set at 200 rpm. The culture was held for
24 h at 4C while viable counts were determined by
plating. Broth cultures were then diluted in sterile saline

Construction of the pQE30-fliC

Specific primers were designed to amplify fliC gene
from the Salmonella typhimurium DT104 strain. The
expected size of the PCR product, approximately 1485 bp
was obtained (Fig. 1). Existence of insert fliC in
recombinant vector, PQE30-fliC, was also detected by
digestion using BamHI and HindIII restriction enzymes
(Fig. 2) and finally the identity and orientation of fliC in
the construct were confirmed by DNA sequencing (Data
not shown).

Fig. 1: Electrophoresis of PCR product on Agarose gel (1%

w/v).Lane 1: expected band a fliC approximately
1485bp. Lane M: 1 Kb DNA size

Inter J Biotech Adv, 2012, 1(1): 1-6.

Fig. 2: Detection of recombinant vector by restriction

enzyme digestion
BamHI and HindIII on (1%)
Agarose gel for 2 hour, 100 voltages. M: Invitrogen
DNA ladder 1 Kb. Lane (1): Recombinant vector,
pQE30-fliC, digested with BamHI and HindIII

Expression and purification of recombinant flagellin

The PCR-amplified DNA fragment encoding fliC of
S. typhimurium was digested with BamHI and HindIII and
inserted into the expression vector pQE30 under the
control of T5 promoter. E. coli SG13009 competent cells
were transformed with the recombinant plasmid, pQE30fliC and the cloned gene was confirmed by restriction
analysis and DNA sequencing. The sequencing data
corresponded with the fliC gene sequence on NCBI
database.
E. coli SG13009 cells harboring pQE30-fliC were
induced with 0.5 mM IPTG after 3 h. After SDS-PAGE
75of accumulated protein
electrophoresis, a significant band
with an apparent molecular weight of approximately 56
KDa was evident (Fig. 3). Both supernatant and the pellet
of cell lysates were tested for the presence of recombinant
proteins. The majority of the expressed protein was
detected in inclusion bodies of the cell lysates. The
recombinant flagellin in the crude extract was further
purified by affinity purification using nickel column
chromatography (Fig. 4).This purification method yielded
(263 g/ml) culture of transformed E.coli cell, which
revealed high yield of recovery from the affinity
chromatography if compared with total protein
concentration of the crude lysate, which was 415 g/ml.
ELISA measurement of the flagellin-specific antibody
in sera of the vaccinated mice:
Results of the ELISA testing of the sera from the
vaccinated mice during the 9 weeks of vaccination are
depicted in (Fig. 5). The 3 points represent the mean of
the triplicate values from the 10 vaccinated mice. The
trend suggests a progressive rise in the titer of the antiflagellin antibody to a significant level by the end of the 9
weeks. This suggests that the adjuvanted flagellin injected
into the BALB/C mice has good immunogenic properties.
Sera obtained from the control mice that were injected
with the same material less the flagellin did not reveal any
significant level of the anti-flagellin antibody.

Fig.

3:

SDS-PAGE (10% w/v): test expression of

recombinant flagellin from S. Typhimurium.
Under 0.5mM of IPTG for 3 hour after
electrophoresis at 200 volts for 40 min. M: BIO
RAD protein ladder 250 KD. Lane (1): Culture
prior to induction with IPTG. Lane (2): rflagellin protein inductions with 0.5mM IPTG at
3 hour.

ELISA measurement of the flagellin-specific antibody

in sera of the vaccinated mice:
Results of the ELISA testing of the sera from the
vaccinated mice during the 9 weeks of vaccination are
depicted in (Fig. 5). The 3 points represent the mean of
the triplicate values from the 10 vaccinated mice. The
trend suggests a progressive rise in the titer of the antiflagellin antibody to a significant level by the end of the 9
weeks. This suggests that the adjuvanted flagellin injected
into the BALB/C mice has good immunogenic properties.
Sera obtained from the control mice that were
injected with the same material less the flagellin did not
reveal any significant level of the anti-flagellin antibody.
Results of the challenge experiment
Dead mice were counted among the challenged
vaccinated and control mice based on daily inspection of
the cages. Dead mice from each of the challenged groups
were recorded.
To demonstrate the significance of survival
differences between the vaccinated and control mice,
survival analysis was conducted to show the trend of
survival to the challenge between the challenged
vaccinated and control mice. It is noteworthy that all the
control mice that received the 1000 LD50 dose of the
challenge Salmonella died within 24 hours after the
challenge whereas the vaccinated mice survived the same
challenge dose of the organism for the that period of
observation (Fisher exact test, P-value+ 0.00039).
However 2 mice of the vaccinated group that were

Fig. 4: SDS- PAGE (10% w/v): profile for expression and

purification under denaturing condition of r-fliC in
E.coli SG13009 strain at 200 volts for 40 min. M:
BIO RAD protein ladder 250 KD. Lane (1): Culture
prior to induction with IPTG. Lane (2): Cell lysate
induced with IPTG .Lane (3): Flow- through. Lane
(4): Wash with buffer C. Lane (5): Eluation fraction
(purified recombinant flagellin). Lane (6): Eluation
fraction (purified recombinant flagellin).

Fig. 5: Trend of anti-Flagellin antibody titers in vaccinated

BALB/C mice. Vaccine doses were given at 3 weeks
intervals. Full circles represent mean O.D for 1:100
dilutions of sera from 10 mice at 3 week Intervals
post vaccination)

challenged by the 1000 LD50 dose have died after 48

hours. The overall survival of the vaccinated mice
compared to the control mice throughout the challenge
experiment suggest the protective value of the flagellin
among the vaccinated mice in comparison to the control
mice. Most of the reported challenge experiments used a
significantly lower challenge LD50. However, due the
limited number of mice approved by IACUC we had to
design the challenge experiment using an expectedly
higher LD50 to capture the differenced in resistance
between the vaccinated and the control mice to the
challenge.
DISCUSSION
In this study, the 1485 bp gene encoding the fliC was
successfully extracted from the genome of a clinical
isolate of Salmonella typhimurium DT104, inserted into

Inter J Biotech Adv, 2012, 1(1): 1-6.

vector pQE30, and expressed into in an E. coli.
Expression of the recombinant flagellin was regulated by
a T5 promoter. It was found to mostly insoluble as
inclusion bodies form. Additionally, the His-6-tagged
flagellin was efficiently purified in simple steps by NiNTA Agarose to produce a recombinant protein with high
purity. Some factors detection have the choice of an
expression system for the high-level production of
recombinant proteins, such as cell growth characteristics,
expression levels, intracellular and extracellular
expression, post-translational modifications and biological
activity of the protein (Olins and Lee, 1993; Hockney,
1994; Srensen and Mortensen, 2005). pQE30 vector was
used for the expression of 6x His-tagged recombinant
proteins in E. coli and the recombinant proteins was easily
purified by Ni-NTA resin. It was not necessary to remove
the short 6x His affinity tag from the recombinant protein
after purification and the function of the recombinant
protein was not affected.
In this study, the flagellin gene was isolated from S.
typhimurium by using specific primers and PCR, then
cloned in the pQE30 vector and over-expressed in E. coli
as inclusion bodies aggregates (IBs). It was loaded on the
Ni-NTA trapped column under denaturant conditions. If
proteins are purified under denaturing conditions for use
in antibody induction, there is usually no need to re-nature
before injection into the animal (Wingfield, 1995). In the
present study, the r-flagellin was approximately 56 KDa,
which is similar to the findings of Ibrahim et al. (1985).
In several studies, the efficacy of native flagellin as a
vaccine has been proved in protection and survival of
animals and humans (Arora et al., 2005; Doring et al.,
2007). Flagellin is a potent activator of a broad range of
cell types involved in innate and adaptive immunity and it
has been investigated for use as a subunit vaccine.
Results of this study open the door for recombinant
flagellin to be further evaluated for the development of a
potential vaccine against infections caused by virulent
Salmonella serotypes such as typhimurium DT104 which
is a serious pathogen in humans and animals.

REFERENCES
Arora SK, AN Neely and R Ramphal, 2005. Role of
motility and flagellin glycosylation in the
pathogenesis of Pseudomonas aeruginosa burn
wound infections. Infect Immun, 73(7):4395-4398.
Bargieri D, IS Soares, FTM Costa, CJ Braga, LCS
Ferreira and MM Rodrigues, 2011. Malaria vaccine
development: are bacterial flagellin fusion proteins
the bridge between mouse and humans? J Parasitol
Res, doi:10.1155/2011/965369.
Dring G, C Meisner and M Stern, 2007. A double-blind
randomized placebo-controlled phase III study of
Pseudomonas aeruginosa flagella vaccine in cystic
fibrosis patients.Proc.Natl Acad Sci USA,
26(104):11020-11025.
Fierer J and DG Guiney, 2001. Diverse virulence traits
underlying different clinical outcomes of Salmonella
infection. J Clin Invest, 107:775-780.
Foley SL, S Zhao and RD Walker, 2007. Comparison of
molecular typing methods for the differentiation of

6
Salmonella foodborne pathogens. Foodborne Pathog
Dis, 4:253-276.
Hockney RC, 1994. Recent developments in heterologous
protein production in Escherichia coli. Trends
Biotechnol, 12:456-463.
Ibrahim GF, GH Fleet and RA Walker, 1985. Method for
the isolation of highly purified Salmonella flagellins.
J Clin Microbiol, 22(6):1040-1044.
Lee LH, EIII Burg, S Baqar, AL Bourgeois, DH Burr, CP
Ewing, TJ Trust and P Guerry, 1999. Evaluation of a
truncated recombinant flagellin subunit vaccine
against Campylobacter jejuni. Infect Immun, 67:
5799-5805.
McSorley SJ, BT Cookson and MK Jenkins, 2000.
Characterization of CD+4 T-cell responses during
natural infection with Salmonella typhimurium. J
Immunol, 164: 986-993.
Mizel SB and Bates JT, 2010. Flagellin as an adjuvant:
cellular mechanisms and potential. J Immunol,
185(10): 5677-5682.
Mortimer CB, MP Tansy, EG Saheer, MJL Julie and A
Catherine, 2004.Towards the development of a DNAsequence based approach to serotyping of Salmonella
enterica. JBMC Microbiol, 4:31.
Murthy KGK, A Deb, S Goonesekera, C Szabo and AL
Salzman, 2004. Identification of conserved domains
in Salmonella muenchen flagellin that is essential for
its ability to activate TLR5 and to induce an

Inter J Biotech Adv, 2012, 1(1): 1-6.

inflammatory response in vitro. J Biol Chem,
279(7):5667-5675.
Olins, PO and SC Lee, 1993. Recent advances in
heterologous gene expression in Escherichia coli.
Curr Opin Biotechnol, 4:520-525.
Powsey RK, 2002. Case study in food microbiology for
food safety and quality cornwell. TJ International
Ltd. Pp. 179-190.
Sambrook J, and D Russel, 2001. Molecular cloning: a
laboratory Manual. Cold spring Harbor Laboratory
Press, Cold Spring Harbor, New York, 3rd edition.
Srensen HP and KK Mortensen, 2005. Advanced genetic
strategies for recombinant protein expression in E.
coli . J Biotechnol, 115: 113-128.
Steven B, Mizel and TB John, 2010. Flagellin as an
adjuvant: cellular Mechanisms and potential. J
Immunol, 185:5677-5682.
Strindelius L, M Filler and I Sj holm, 2004. Mucosal
immunization with purified flagellin from Salmonella
induces systemic and mucosal immune responses in
CH3/HeJ mice. Vaccine, 22:3797-3808.
Sun Yao-Hui, HG Rolan and RM Tsolis, 2007. Injection
of flagellin into the host cell cytosol by Salmonella
enterica serotype typhimurium. J Biol Chem,
282:(47):33897-33901.
Palmer I and PT Wingfield, 1995. Overview of the
purification of recombinant proteins produced in
Escherichia coli. In: current protocols in protein
science. New Yourk. 6.3.1-6.3.15.