Vous êtes sur la page 1sur 316

9782100544141-Laberche-00-PL.fm Page I Dimanche, 16.

mai 2010 5:55 17

BIOLOGIE
VGTALE
Jean-Claude Laberche
Professeur des universits lIUT dAmiens

3e dition

9782100544141-Laberche-00-PL.fm Page II Dimanche, 16. mai 2010 5:55 17

Illustration de couverture : 2001 Brand X Pictures

Dunod, Paris, 1999, 2004, 2010


ISBN 978-2-10-054840-8

9782100544141-Laberche.fm Page V Jeudi, 4. fvrier 2010 3:47 15

TABLE

DES MATIRES

Avant-propos de la troisime dition


Introduction. Quest-ce quun vgtal ?

Chapitre 1 Les cheminements de la connaissance en biologie vgtale

1.1 Lacquisition des connaissances biologiques

3
8
8
9

1.2 Les thories de lvolution et la biologie vgtale

1.2.1 Le fixisme dAristote


1.2.2 Le transformisme de Lamarck et de Darwin
Chapitre 2 Savoir dcrire un vgtal

12

2.1 La description dune plante cormus

13
14
20
22
23
29
31
34

2.1.1
2.1.2
2.1.3
2.1.4
2.1.5
2.1.6
2.1.7

La tige et lappareil caulinaire


La feuille
La racine et lappareil racinaire
La fleur
Les inflorescences
Les graines
Les fruits

2.2 Les plantes thalle

2.2.1 Organisation des thalles des algues


2.2.2 Organisation du thalle des champignons
2.2.3 Organisation des lichens
Dunod La photocopie non autorise est un dlit.

IX

Chapitre 3 Comment sappelle cette plante? Quelle est sa parent?


Quelle est son histoire?
3.1 La classication des plantes en Europe jusqu Linn
3.2 La hirarchie botanique et sa nomenclature

3.2.1
3.2.2
3.2.3
3.2.4
3.2.5
3.2.6

Lindividu
Lespce
Le genre
La famille
Les catgories suprieures
Le taxon

3.3 La nomenclature binaire de Linn

40
40
42
43
45

45
46
46
46
47
48
48
49
49
V

9782100544141-Laberche.fm Page VI Jeudi, 4. fvrier 2010 3:47 15

Table des matires

3.5 Lhistoire des vgtaux

50
51
54
65

Chapitre 4 Lorganisation cellulaire

69

4.1 La cellule bactrienne

71
74
74
79
83
83
84
85
91

3.4 Les classications vgtales

3.4.1 Les classifications naturelles


3.4.2 Les classifications phylogntiques

4.2 La cellule eucaryotique vgtale

4.2.1
4.2.2
4.2.3
4.2.4
4.2.5
4.2.6
4.2.7

Les membranes cellulaires


Le noyau
Le cytosol
Le rticulum endoplasmique et les plasmodesmes
Les ribosomes
Les organites cellulaires
La paroi cellulaire

Chapitre 5 Lorganisation tissulaire de la plante

5.7 Structure et importance des tissus conducteurs


Chapitre 6 La reproduction

120

6.1 La miose

121
121
122
123
124
124
126
132

5.2 Les diffrents tissus primaires


5.3 Le fonctionnement des mristmes chez les Angiospermes

5.3.1 Le fonctionnement du mristme caulinaire


5.3.2 La transformation du mristme apical en mristme floral
5.3.3 Le fonctionnement du mristme racinaire
5.4 La structure primaire des organes vgtatifs
5.5 La structure des organes jeunes chez les Spermaphytes

5.5.1 La structure de la racine


5.5.2 La structure de la tige
5.5.3 La structure de la feuille
5.6 Les formations secondaires

5.6.1 Les mristmes secondaires


5.6.2 Les tissus secondaires

6.1.1 La division rductionnelle


6.1.2 La division quationnelle
6.2 La formation du zygote
6.3 La reproduction sexue chez les Thallophytes

6.3.1 La reproduction sexue chez les algues


6.3.2 La reproduction sexue chez les champignons
6.4 La reproduction sexue chez les Cormophytes

6.4.1 La reproduction chez une Bryophyte : le polytric


Polytrichum juniperinum Hedw, Polytrichaceae
VI

95

95
97
99
99
102
103
104
105
106
107
108
110
110
113
116

5.1 Les mristmes primaires

132

9782100544141-Laberche.fm Page VII Jeudi, 4. fvrier 2010 3:47 15

Table des matires

6.4.2 La reproduction chez une Ptridophyte :


le polypode, Polypodium vulgare L., Polypodiaceae
6.4.3 La reproduction chez les Gymnospermes
6.4.4 La reproduction sexue chez les Angiospermes

6.6 La dissmination des graines

134
136
142
153
153
155
156

Chapitre 7 La nutrition de la plante

158

7.1 La nutrition hydrique

158
158
162
165
173
173
175
178
180
182
182
190
199
200
200
202

6.5 Lapomixie ou reproduction asexue

6.5.1 La multiplication vgtative


6.5.2 Lagamospermie

7.1.1 Les rservoirs deau


7.1.2 Les mouvements de leau dans le systme sol-plante-atmosphre
7.1.3 Lmission de leau : la transpiration
7.2 La nutrition minrale des plantes

7.2.1
7.2.2
7.2.3
7.2.4

La composition minrale des plantes


Les ions absorbs
Labsorption des lments minraux
Lutilisation de ces connaissances

7.3 Le cycle vital du carbone et de lnergie

7.3.1 La photosynthse
7.3.2 La respiration des cellules vgtales
7.3.3 La photorespiration
7.4 La circulation de la sve brute et de la sve labore

Dunod La photocopie non autorise est un dlit.

7.4.1 Lensemble transporteur : xylme et phlome


7.4.2 Le transport des assimilats
Chapitre 8 La plante dans son milieu environnant

205

8.1 Les plantes et le rythme des saisons

205
205
207
210
212
215
219
221
221
221
222
223
223
225
225
226
228

8.1.1
8.1.2
8.1.3
8.1.4
8.1.5
8.1.6

Les types biologiques


La diapause et la dormance des graines
La dormance des bourgeons
Les conditions de la germination
Les conditions de mise fleurs
La rsistance des plantes la scheresse

8.2 Les plantes dans leur environnement daphique

8.2.1 Les plantes nitrophiles


8.2.2 Les plantes calcicoles et les plantes calcifuges
8.2.3 Les plantes halophiles
8.3 Les plantes et les organismes qui les entourent

8.3.1
8.3.2
8.3.3
8.3.4
8.3.5

Le parasitisme
Les symbioses dans la rhizosphre
Les mycorhizes
La fixation symbiotique de lazote
Les dfenses contre les organismes pathognes

VII

9782100544141-Laberche.fm Page VIII Jeudi, 4. fvrier 2010 3:47 15

Table des matires

8.4 Les plantes dans la biosphre

8.4.1
8.4.2
8.4.3
8.4.4
8.4.5

La biomasse et la productivit primaire


Chanes alimentaires et pyramides cologiques
Les plantes dans le cycle du carbone
Les plantes dans le cycle de loxygne
Les plantes dans le cycle de lazote

Chapitre 9 Lhomme et les plantes

239

9.1 Les mcanismes naturels de lvolution chez les vgtaux

239
239
241
243

9.1.1
9.1.2
9.1.3
9.1.4

Les notions de base


Lexpression de la variation
Les mcanismes
Un exemple dapparition spontane dune espce nouvelle :
Spartina townsendii Groves

9.2 La cration de plantes cultives

9.2.1 La slection massale


9.2.2 Lutilisation des ressources gntiques
9.3 Les cultures in vitro

9.3.1 Les rgulateurs de croissance


9.3.2 Lutilisation des cultures in vitro

VIII

231
232
233
234
236
236

247
249
251
251
259
260
263

Glossaire

275

Index

295

9782100544141-Laberche.fm Page IX Jeudi, 4. fvrier 2010 3:47 15

Sarah et Antoinette C. en hommage aux merveilleux propos


quelles tenaient sur les tagettes, les berclures
et autres salades tondre de leur carreau aux Pendants.

9782100544141-Laberche.fm Page X Jeudi, 4. fvrier 2010 3:47 15

9782100544141-Laberche.fm Page XI Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

AVANT-PROPOS

Prs de dix ans aprs sa parution, larrive de cette troisime dition est loccasion
de complter et poursuivre la rvision entame lors de la deuxime.
Larchitecture mme du livre na pas t modifie afin de conserver une approche
simple et facile des grandes notions de biologie vgtale. Ainsi, scartant des traits
de botanique ou de biologie vgtale traditionnels, nous proposons ltudiant de
premires annes dtudes suprieures, quil soit en licence, en IUT ou en BTS ou
en classe prparatoire, daborder progressivement la richesse du monde vgtal puis
de dcouvrir les rgles gnrales de la classification avant denvisager les grandes
lignes de lorganisation et de la nutrition des plantes.
loccasion de cette nouvelle dition ont t corriges des maladresses qui
avaient trouv le moyen de passer au travers des mailles des diffrentes relectures.
Mais ce fut surtout loccasion de reprendre plusieurs chapitres qui ont t remanis.
Nous avons tenu compte, la fois, des avances des Sciences et des souhaits exprims
par nos collgues utilisateurs de cet ouvrage. Cest le cas, en particulier, du chapitre
deux o plusieurs notions de biologie florale ont t prcises et compltes et du
chapitre sept o un paragraphe traitant de la respiration vgtale a t ajout. Entre
le dsir de rester court et concis et les souhaits dtre le plus complet possible, il
nous a fallu souvent trancher. Lavis de nos collgues franais mais aussi trangers,
puisquau fil des ans ce livre se trouve aussi bien dans les bibliothques africaines,
amricaines quasiatiques, a t souvent dterminant.
Cette nouvelle dition a t aussi loccasion de retravailler compltement le glossaire
en prcisant le plus souvent les dfinitions. Le rsultat final doit beaucoup notre
collgue et collaboratrice, Madame Josiane Par, Docteur es Sciences de lUniversit
de Picardie Jules Verne, qui nous a suggr bon nombre de modifications et complments. Quelle en soit ici grandement remercie.
Dj initie dans les prcdentes ditions lintroduction dencarts prsentant des
exemples intressants, des anecdotes, des lments de rflexion, est cette fois dveloppe de manire significative. Ceci rend cet ouvrage moins austre, mais cest surtout
loccasion pour le lecteur de remarquer que la biologie vgtale nest pas une science
dispense par des universitaires pour des universitaires, mais quau contraire, elle
est prsente dans tous les actes de la vie courante. Ces encarts permettront aussi au
lecteur de rflchir aux rles dans notre environnement de ces organismes apparemment immobiles et dapprhender les actions que lHomme peut avoir sur les plantes.
Enfin, un index est introduit. Il sera, nous nen doutons pas, apprci des lecteurs.
XI

9782100544141-Laberche.fm Page XII Jeudi, 4. fvrier 2010 3:47 15

Avant-propos

Ddition en dition, la mise en page change. Grce la comptence des ditions


Dunod la prsentation gnrale samliore. En effet, des schmas sont agrandis,
dautres, au contraire, diminus, des titres sont renforcs et des remarques mieux
prcises. Tout ceci devrait faciliter la lecture de ce livre que nous avons voulu la
fois simple mais complet, prcis mais non sotrique.
Amiens, octobre 2009

XII

9782100544141-Laberche.fm Page 1 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

INTRODUCTION.
QUEST-CE QUUN VGTAL ?

Pour rpondre cette question apparemment trs simple, les tudiants de premier
cycle universitaire qui abordent la biologie vgtale sont parfois dconcerts.
Rapidement pourtant ils rpondent quun vgtal :
1. ce nest pas un animal,
2. cest un tre vivant,
gnralement chlorophyllien,
immobile,
compos de cellules, constituant des organes,
capable de se reproduire de diffrentes faons,
se nourrissant dlments minraux simples.
Comme exemple de vgtal, ils citent dabord les plantes fleurs, puis les arbres,
enfin indistinctement les champignons, les mousses, les fougres et, beaucoup plus
rarement, les algues.
Cest queffectivement toutes les plantes ne se ressemblent pas. Certaines comme
les arbres sont trs grandes, dautres comme les algues des mares sont toutes petites.
Limmense majorit arbore une couleur verte car chlorophyllienne, dautres comme
les algues peuvent tre rouges, brunes, dores ou bleues. Les champignons, quant
eux, sont gnralement blanchtres et pourtant tout notre hritage culturel nous
invite les considrer comme des plantes.
Sagit-il bien chaque fois de plantes ?
Pour intressant et neuf que soit ce problme pour un tudiant de premier cycle
universitaire, il doit savoir que des gnrations de botanistes se sont penches sur la
question et ce depuis la plus haute antiquit. Il est apparu rapidement que devant la
diversit du monde vgtal (il y a plus de 250 000 espces de plantes fleurs dans le
monde actuel), il fallait dabord savoir donner un nom chaque plante et les classer
mme grossirement, afin de rassembler celles qui se ressemblent. Partant la
dcouverte de ce monde, ltudiant dcouvrira lorganisation cellulaire du vgtal
avant de voir que ces cellules forment des tissus et des organes permettant la plante
de se dvelopper et de se reproduire. Pour ces tres gnralement immobiles qui
subissent continuellement les contraintes de lenvironnement, les solutions adoptes
pour survivre ne manquent pas doriginalit.
1

9782100544141-Laberche.fm Page 2 Jeudi, 4. fvrier 2010 3:47 15

Introduction. Quest-ce quun vgtal ?

Pour se dvelopper le vgtal doit se nourrir. Trois des grandes fonctions physiologiques seront prsentes dans cet ouvrage : la nutrition hydrique, la nutrition minrale
et enfin la nutrition carbone.
Mais les plantes font partie des grands cycles cologiques. lments importants
de lenvironnement naturel, culturel et social de lhomme, les vgtaux constituent
aussi une grande part de sa nourriture mais aussi de sa pharmacope. Lhomme
depuis les temps immmoriaux exerce son action sur les vgtaux en slectionnant
des plantes qui satisfont ses ambitions.
Enfin, mme si les vgtaux nous semblent immuables dans leur forme et leur
comportement, la vrit est quen ralit ils voluent. lre primaire (donc il y a
plus de 500 millions dannes), les algues constituaient limmense majorit des
vgtaux et si le secondaire fut le temps des conifres, ce nest que depuis le dbut
du tertiaire (il y a 65 millions dannes) que les plantes fleurs sont apparues.
Quelle passionnante gageure que celle de comprendre comment cela a pu se faire !

9782100544141-Laberche.fm Page 3 Jeudi, 4. fvrier 2010 3:47 15

LES

CHEMINEMENTS
DE LA CONNAISSANCE
EN BIOLOGIE VGTALE

laube du troisime millnaire, au moment o les mdias, pratiquement chaque jour,


nous parlent dorganismes gntiquement modifis (OGM), de clonages animaux
(voire humains), de cultures biologiques avec des varits anciennes, (toujours bien
meilleures que les produits actuels !), on ne se rend que partiellement compte des
progrs extraordinaires que la biologie a fait depuis quelques annes.
Mais ces progrs sont le rsultat dune longue progression des connaissances et
de la pense biologique. Il est extraordinaire de constater que si, au fil des temps, le
dveloppement de la biologie dans notre civilisation occidentale sest montr hsitant,
les conclusions et les concepts biologiques qui sen dgageaient ont t le point de
dpart de rflexions philosophiques. Luvre de la plupart des grands philosophes
tmoigne de leur vif intrt pour les disciplines biologiques.
Mme si actuellement, aprs un cheminement commun, biologie et philosophie
voluent de manire indpendante, ceci ne veut pas dire, heureusement quelles
signorent. Il existe un parallle entre des aspects de la biologie et les systmes
philosophiques.
Cest ce que nous dcouvrirons dans les paragraphes suivants.

Dunod La photocopie non autorise est un dlit.

1.1 LACQUISITION
DES CONNAISSANCES BIOLOGIQUES
Le mot biologie a tout juste deux cents ans. Il a t utilis la premire fois peuttre par Roose en 1797, certainement par Lamarck en 1802. Ltude de la vie avait,
cependant, fait lobjet dobservations et dcrits depuis de nombreux sicles. Les
donnes les plus anciennes que lon puisse retrouver dans les premires civilisations
de notre monde sont lies lutilisation des plantes par lhomme pour assurer sa
subsistance par la cueillette, mais aussi comme moyen de dfense contre les maladies
(les simples ). Ultrieurement, lhomme dveloppera la culture et llevage. Mais
dans notre monde occidental, cest la Grce que lon doit les premiers traits
dobservations et de rflexions sur la vie.

9782100544141-Laberche.fm Page 4 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 1 Les cheminements de la connaissance en biologie vgtale

La biologie a plus de 3 000ans


Dj une priode trs recule (plus de trois millnaires avant notre re), il est sr
que les Chinois avaient des connaissances importantes en biologie, particulirement
sur llevage du ver soie. De mme de nombreux animaux taient domestiqus
et tout un cortge de plantes taient reconnues pour leurs proprits thrapeutiques.
Les Indiens aussi, depuis des temps immmoriaux matrisaient les animaux domestiques. Plus prs de nous les Msopotamiens avec les jardins suspendus de Babylone
connaissaient bien lagronomie et des terres cuites qui nous sont parvenues
montrent quils pratiquaient les dissections animales. Les apports gyptiens sont
beaucoup plus limits, ce qui parat toujours trs surprenant. Apparemment, ils
avaient des connaissances dans lanatomie humaine, mais ntaient gure ports
vers ltude des animaux et encore moins des vgtaux.

LEmpire romain, quant lui, ne nous pas lgu grand-chose dans ce domaine. De
lAntiquit au XVIIIe sicle, les progrs sont particulirement lents. Limpossibilit
par notre il de voir linfiniment petit en est techniquement la cause. Linvention du
microscope par Hoocke en 1655 lve ce handicap. Les sciences de la vie deviennent
exprimentales. Simultanment se prcisent les grandes rflexions concernant lvolution. La formulation de la thorie cellulaire fait de la cellule lunit de la vie. De nos
jours les perfectionnements des microscopes, ainsi que la biochimie repoussent cette
unit lchelle molculaire. Dans le cadre de cet ouvrage, il ne saurait tre question de
prsenter toute lhistoire de la biologie (les 3 tomes de LHistoire du dveloppement
de la biologie de Hendrick C.D. De Wit aux ditions polytechniques et universitaires
romandes, ny suffisent dj pas). Seuls quelques points de repres seront donns.
Plutt quun long discours, sont runis dans les tableaux 1a, 1b et 1c quelques grands
noms de la biologie. Certains, plus mdecins ou plus observateurs du monde animal
que botanistes sont prsents en caractres typographiques plus petits.
Dans ces tableaux, dans lesquels beaucoup dautres lignes auraient pu tre rajoutes
et qui essaient, seulement, de rsumer la suite des dcouvertes en biologie depuis
2 500 ans, il est surprenant de voir que des notions aussi simples, aussi videntes,
pour nous tous, que la sexualit des plantes, ont peine 250 ans, que la thorie de la
gnration spontane na t abandonne que grce Pasteur voici tout juste un peu
plus dun sicle. Rien dtonnant alors que des concepts soient encore en discussion.
La nutrition minrale, donc lautotrophie des plantes nest pas admise encore par
tous. Quelques (rares) partisans de la culture biologique pensent que les plantes se
nourrissent en partie de substances prleves dans lhumus du sol. Ils reviennent en
cela, aux ides dAristote. Pourtant depuis Bernard de Palissy, Lavoisier, Boussingault
et Gautheret, on a tout lieu de penser que ce sont bien des ions minraux prlevs
dans le sol, qui servent daliments aux plantes. Pourtant, elles peuvent aussi absorber
des molcules organiques produites par les champignons qui entourent lextrmit des
racines (dans les mycorhizes) et quelles sont incapables de synthtiser. Dans ce cas,
peut-on vraiment dire que les vgtaux sont autotrophes ?
Buffon, le transformiste, dans ses crits sopposait Linn, le fixiste. Mais ctait
surtout sa nomenclature binaire quil sen prenait. Pour lui la nature na pas rang
les plantes par tas. Beaucoup plus rcemment Gorenflot, dans ses cours et ses crits,
4

9782100544141-Laberche.fm Page 5 Jeudi, 4. fvrier 2010 3:47 15

1.1 Lacquisition des connaissances biologiques

Tableau1.1a Quelques grandes tapes des dcouvertes en biologie


jusqu la fin du Moyen ge.
Grands
concepts

Ouvrages
principaux

Acquisition
des connaissances

Ides
philosophiques

Corpus hippocratique

Anatomie,
physiologie, mdecine

Les tres vivants sont


soumis des lois
immuables

Classications
animales et vgtales.
Notions de genre
et despce.
Les plantes se
nourrissent de
substances toutes
labores quelles
prlvent dans
lhumus du sol.

La vie est un principe


immatriel animant la
matire et la nature par
une intelligence en vue
dun but suprme.
Cette conception
a inuenc lglise
durant des sicles.

Dates

GRCE
Hippocrate

Genre
Espce

459-377
av. J.-C.

Aristote

384-342
av. J.-C.

Histoire des animaux


De la gnration
des animaux,
De lme.
Trait de botanique
(perdu)

Thophraste

370-285
av. J.-C.

Deux traits
de botanique

Classications

Gnration spontane

Grand nombre
douvrages mdicaux

Dcrit de nombreux
organes observs lors
de dissections. Il voit
une communication
entre les 2 ventricules
cardiaques, seule
possibilit pour lui
dexpliquer la
circulation sanguine

Partisan de la nalit
absolue des choses.
Diste

Crationnisme

Classication

ANTIQUE

Galien

131-201

LEMPIRE
Pline
lAncien

Historia Naturalis
(37 volumes)

23-29

MOYEN

Dunod La photocopie non autorise est un dlit.

ROMAIN

GE

Compilation de
donnes provenant
des auteurs grecs

(de 500 1453)

Albert
le Grand

1193-1270

Summa de creaturis

Observations
chez les animaux

Frdric II
de Sicile

1272-1337

De Artevenandi
cum avibus

Observations
chez les oiseaux.
Dissection humaine

Ibn-al-Nas

1210-1288

Fixisme

Circulation pulmonaire
chez lhomme

dit quil ne faut pas chercher mettre la nature dans des petites botes. Effectivement,
rien nest jamais absolu, rien nest jamais conforme au modle dcrit et quand on
aborde la biologie, il faut comme dans toutes les sciences savoir tre observateur et
ne pas essayer, cote que cote, de faire concider thorie prtablie et observation
des faits. En cela, nous ne faisons que suivre les enseignements de Descartes. Certainement parce quelle aborde le problme de la vie, plus que toute autre science, la
biologie, aussi bien vgtale quanimale a servi de terreau de nombreuses rflexions
philosophiques particulirement sur lapparition et lvolution des organismes sur la
terre. Cette question fut lobjet de discussions homriques lAcadmie des Sciences
de Paris au XIXe sicle. Avec plus de calme et de tolrance, elle sera trs rapidement
rsume dans le paragraphe suivant.
5

9782100544141-Laberche.fm Page 6 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 1 Les cheminements de la connaissance en biologie vgtale

Tableau 1.1b Quelques grandes tapes des dcouvertes en biologie


jusqu la fin du XVIIIe sicle.
Grands
concepts

Dates

Ouvrages
principaux

Acquisition des
connaissances

Ides
philosophiques

LA RENAISSANCE (1453-1600)
Lonard
de Vinci

1452-1519

Nutrition minrale
des plantes

Bernard
de Palissy

1510-1589

Mycologie

Charles
de lcluse

1526-1609

Fungorum Historia

Agronomie

Tolrance et indulgence

Taxonomie

Cesalpino

1519-1603

De plantis libri XVI

Introduction
la physiologie
vgtale

Primaut de la forme
sur la fonction

Nombreux dessins

Physiologie humaine
Les plantes
se nourrissent de sels.

XVIIIe SICLE

Observations
et expriences

Francis
Bacon

1561-1626

Novum organum

Classication base
sur la distinction
des facults

La connaissance
scientique permet de
connatre la cause des faits

Rgles
de la recherche
scientique

Descartes

1596-1650

Discours
de la Mthode

Loi de loptique,
physiologie

Nadmettre dans les


sciences que la raison

La cellule

Hoocke

1635-1703

Micrographia

Observation
de cellules

Les tissus
vgtaux

Grew

1641-1712

Anatomia Plantarum

Les tissus
vgtaux

Pas de gnration
spontane

Redi

1626-1697

Expriences
sur la gnration
des insectes

Description du
parasitisme animal

Conception de
la continuit vitale

LE SICLE

DES LUMIRES

Classication
binaire

Linn

1707-1778

Systema naturae
Fundamenta botanica

Classication binaire
chez les vgtaux
et les animaux

Fixiste
Admet un transformisme
restreint

Classication
naturelle

Buffon

1707-1788

Histoire naturelle
(44 volumes)

Description
du monde vivant

Transformiste

Biologie
exprimentale

Raumur

1683-1757

Mmoires pour servir


lhistoire des
Insectes

Connaissance
des insectes
Physio. animale

Rejet de
la tradition biblique
du crationnisme

Camerianus

1665-1721

De seu plantarum
epistola

La sexualit
des plantes

Transpiration
vgtale

Hales

1677-1761

Vegetable staticks

La plante et leau

Composition
minrale

Lavoisier

1743-1794

Sexualit
des plantes

Respiration
Composition
des vgtaux

Transformiste

Dautres trs nombreuses questions ont passionn les biologistes. La gnration


spontane, lpignisme (prformation des tres dans luf) nen sont que quelques
exemples. Le lecteur intress par tous ces problmes pourra utilement consulter
LHistoire du dveloppement de la biologie de H.C.D. de Wit dj cit, ainsi que les
petits ouvrages de Denis Bucan : volution de la pense biologique, Lvolution
aujourdhui (Fondamentaux Hachette), Histoire de la Biologie (128 Nathan Universit).
6

9782100544141-Laberche.fm Page 7 Jeudi, 4. fvrier 2010 3:47 15

1.1 Lacquisition des connaissances biologiques

Tableau 1.1c Quelques grandes tapes des dcouvertes en biologie


du
Grands
concepts

XIXe

Dates

sicle jusqu nos jours.


Ouvrages
principaux

Acquisition des
connaissances

Ides
philosophiques

XIXe SICLE

Dgagement
doxygne

Respiration

Priestley

1733-1804

Premire thorie
de lvolution

Lamarck

1744-1829

La ore franaise

Zoologie, connaissance
des Invertbrs

Transformisme
Hrdit des caractres
acquis

Cuvier

1769-1832

Rgne animal

Palontologie

Fixisme

Geoffroy
Saint-Hilaire

1772-1844

Philosophie
anatomique

Connaissance
des mammifres

Transformisme

Schleiden

1804-1881

Beitrage
zur Phytogenesis

La plante est un
agrgat de cellules

La vie ne peut venir


que de la vie

Strasburger

1844-1912

Zellbildung
und Zellheilung

La mitose

Transformisme

Thuret

1817-1875

Fcondation
chez le Fucus

Nutrition

Boussingault

1802-1887

Rle de lazote

Gntique

Mendel

1822-1884

Versuche ber
Panzenhybriden

Les lois de
la gntique

Seconde thorie
de lvolution

Darwin

1809-1882

The origins
of species

Inuence
de la slection
naturelle

Microbiologie

Pasteur

1822-1895

Biochimie

von Liebig

1803-1873

Nouvelles lettres
sur la chimie

nergtique
biologique

Continuit
du plasma
germinatif

Weismann

1834-1914

ber germinal
Selektion

Relation entre
hrdit et slection

Anatomie
compare
Tratologie
Thorie
cellulaire
Mitose
Fcondation

Thorie
de lvolution

Fermentations,
microbiologie

Dunod La photocopie non autorise est un dlit.

XXe SICLE

Dgradation
des glucides

Krebs
1900-1981

Prix Nobel
1953

Cycle de Krebs

Cultures
in vitro

Gautheret

1910-1996

Cultures cellulaires

Structure de lADN

Watson et
Cricks

Prix Nobel
1962

Forme hlicodale
de lADN

Monod,
Jacob
et Lwoff

Prix Nobel
1965

Synthse protique

Chimiosmose
mitochondriale

Mitchell
1920-1992

Prix Nobel
1978

Protons
et synthse ATP

Aquaporines

Agre
N en 1949

Prix Nobel
1992

Canaux
hydriques

Boyer,
Wolker
et Skou

Prix Nobel
1997

Moteur molculaire

Synthse
protique

Fonctionnement
ATP-synthase

9782100544141-Laberche.fm Page 8 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 1 Les cheminements de la connaissance en biologie vgtale

1.2 LES

THORIES DE LVOLUTION

ET LA BIOLOGIE VGTALE
La pense biologique trouve ses racines dans lantiquit grecque et romaine do
germrent les prmices des ides dveloppes encore aujourdhui. Aprs la traverse
du dsert que reprsente le Moyen ge, la pense biologique a fait lobjet de
rflexions passionnes ds la Renaissance mais elle sest vritablement panouie au
cours des XVIIe et XIXe sicles. Loin dtre termine, cette rflexion sur lorigine et
lvolution des tres vivants se prolonge actuellement, enrichie quelle est de tous
les progrs apports par la biologie molculaire ou le gnie gntique.
La grande question, qui a travers les sicles, concerne le fixisme1 ou le transformisme des espces. Il est arbitraire de sparer ltude de lune de lautre, tant elles
sont imbriques. Parfois mme, chez les plus farouches partisans dune thorie, on
peut trouver des arguments que ne renieraient certainement pas les partisans de
lautre. Pourtant par commodit elles seront tudies successivement.

1.2.1 Le fixisme dAristote


Il est habituel de prsenter lorigine du fixisme dans la pense dAristote. Grand
admirateur des tres vivants car en toutes les parties de la nature, il y a des
merveilles , il met lhomme au-dessus de tout. Pour lui, cest le seul tre vivant qui
raliserait toutes les intentions de la nature. Les animaux et les vgtaux ne seraient,
alors, que des ensembles inachevs, incomplets. De ces observations, il soutenait
limmobilit des tres vivants, do le nom de fixisme donn sa thorie. Ces notions
furent dveloppes par Galien (131-201 aprs J.-C.) qui tait persuad que la structure
de chaque animal, de chaque plante portait la marque dun tre suprme dou dune
intelligence et dune sagesse surnaturelles. Pour Galien, cet tre est Dieu, do le
nom de disme donn sa pense. Rien dtonnant que durant des sicles, lglise
ait fait de Galien un pilier de sa doctrine. Pourtant Galien soppose la gense biblique
de la vie qui consiste en la cration dun tre vivant partir de matire morte. Pour
lui, tous les tres proviennent de germes vivants qui ont grandi (thorie de lpigense).
Il serait faux de croire quAristote ainsi que Galien aient pu penser que les tres
vivants fussent toujours immuables. Ainsi quand le premier affirmait que les organismes
faibles disparaissaient, il sagissait dune assertion qui rappelle la slection naturelle
que Darwin postulera plus de 2 000 ans plus tard.
Cette thorie du fixisme a trouv, plusieurs sicles aprs, son plus clbre
reprsentant en Linn (1707-1778) pour qui il y a autant despces diverses que de
formes diverses, cres au commencement, par ltre infini (Species tot sunt diverseae
quot diverseas formas ab initio creavit infinitum ens), pourtant il dit aussi (quil) a
longtemps nourri le soupon, (quil) nose prsenter comme hypothse, que toutes
les espces dun mme genre nont constitu lorigine quune mme espce qui sest
1. Les mots en gras sont expliqus dans le glossaire (pages 275 294).
8

9782100544141-Laberche.fm Page 9 Jeudi, 4. fvrier 2010 3:47 15

1.2 Les thories de lvolution et la biologie vgtale

diversifie par voie dhybridation . Il ouvrait une petite porte au transformisme,


comme lavaient dj fait avant lui, Lonard de Vinci ou Bernard de Palissy.

1.2.2 Le transformisme de Lamarck et de Darwin


Avec Linn, on se trouve dj dans le XVIIIe sicle qui voit labandon progressif du
fixisme au profit du transformisme. Cest dans lobservation du monde animal que
les diffrents auteurs tireront le plus souvent leurs exemples. Cest Lamarck
(1744-1829) que lon doit la premire thorie du transformisme. Elle est base sur
deux mcanismes trs prcis.
1. Lemploi dun organe chez un animal le dveloppe ; son dfaut dutilisation au
contraire laffaiblit, voire le supprime.
2. Les changements acquis par le corps des tres vivants peuvent se transmettre
leur descendance : il sagit de la loi de lhrdit des caractres acquis.
Le lamarckisme

Dunod La photocopie non autorise est un dlit.

lappui de sa thorie, Lamarck apportait un certain nombre darguments qui


pouvaient et peuvent emporter, encore, ladhsion de profanes. La girafe, par
exemple, vit dans des milieux arides, sans herbage, ce qui loblige brouter le
feuillage des arbres. Il en serait rsult pour Lamarck, un allongement des pattes
mais aussi du cou. linverse, la taupe vivant dans le sol, donc lobscurit na
pas besoin dyeux pour y voir. Tout naturellement ils satrophient.

Bien videmment, une telle thorie ne pouvait que susciter des controverses. Ce
fut le cas de Cuvier (1769-1832), fondateur de la palontologie et de lanatomie
compare, et en mme temps le plus clbre reprsentant du fixisme avec Linn. Il
comparat le transformisme de Lamarck des palais enchants de vieux romans .
En 1859, soit juste 50 ans aprs la publication de la thorie de Lamarck, paraissait
lOrigine des Espces de Charles Darwin (1809-1882). Ce livre devait imposer le
darwinisme parmi les scientifiques mais aussi dans lopinion publique mondiale.
Pour Darwin, les populations naturelles quelles soient animales ou vgtales, se
transforment. Ces transformations seffectuent sous laction de la slection naturelle.
Cette thorie de la lutte pour lexistence (volutionnisme), impose quen un lieu
donn, seul lindividu le mieux adapt puisse survivre. La slection naturelle au sein
dune mme espce ou entre des espces diffrentes est seule responsable de toutes
les adaptations naturelles.
Le darwinisme fut amend plusieurs fois. Ainsi, ds le tout dbut du XXe sicle,
Auguste Weismann (1834-1914) signe lacte de naissance du no-darwinisme en
sattaquant lhrdit de lacquis, puis il fut modifi une seconde fois partir de
1950, particulirement aprs la dcouverte de la structure de lacide dsoxyribonuclique (ADN) par les Amricains Watson et Crick. Ceci a permis lmergence de
la thorie synthtique de lvolution. Lvolution y est dcrite comme un processus
lent et graduel daccumulation de petites modifications gntiques, conduisant
lapparition despces nouvelles, uniquement sous le contrle exerc par la slection
naturelle.
9

9782100544141-Laberche.fm Page 10 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 1 Les cheminements de la connaissance en biologie vgtale

La thorie synthtique, avec son principe de mutation-slection, est devenue la


position dominante de la communaut scientifique internationale. Aujourdhui, lvolution nest plus envisage comme la transformation dindividus isols mais comme
celle de groupements dindividus de mme espce, cest--dire des populations.
Mais le principe de base est le mme : elle explique lvolution par laction de la
slection naturelle sur des populations.
Elle peut tre rsume par trois ides essentielles :
1. lvolution est le fruit dune modification progressive et continue des tres vivants
au cours des gnrations ;
2. la reproduction implique une hrdit : le matriel hrditaire (les gnes) subit,
au niveau molculaire, des modifications par mutations, aboutissant ainsi une
grande diversit ;
3. le mcanisme central est la slection naturelle qui opre au niveau des populations
en slectionnant les individus les mieux adapts leur environnement.
Une population volue quand la frquence dun gne (ou plusieurs gnes) change.
Des caractres ayant acquis une valeur adaptative nouvelle gnralement en raison
de changements du milieu, se rpandent chez certaines espces. Les individus porteurs
de ces caractres sont favoriss dans le nouveau milieu ; ils constituent alors rapidement
une grande partie de la population ou mme toute la population de lespce. Les
caractres qui se rpandent correspondent des allles existant auparavant silencieusement au sein de lespce. Lorsque lensemble des individus qui constituent
une espce forme plusieurs populations isoles, chacune de ces populations peut
acqurir des caractres particuliers et donner naissance des varits diffrentes au sein
de la mme espce. Si ces variations sont, par la suite, dans limpossibilit de se croiser,
elles divergent de plus en plus et finalement sont inter-striles : elles constituent alors
des espces distinctes.
Cette thorie synthtique de lvolution sest impose progressivement, malgr
quelques combats darrire-garde jusquaux environs des annes 1960 en France.
Elle permet de comprendre la microvolution, comme lapparition dune espce
nouvelle, dans un milieu naturel. Lexprimentation permet, en effet, de crer des
espces nouvelles en suivant, pas pas, les mcanismes prsents par Darwin. Mais,
elle est moins laise pour expliquer la macrovolution comme le passage de la vie
aquatique la vie terrestre, lapparition des Gymnospermes, des Angiospermes, etc.
Les exemples manquent et lexprimentation est impossible. Malgr ce handicap, le
darwinisme reste ce jour, la thorie de lvolution, permettant de comprendre le
mieux la diversit des espces animales et vgtales sur la Terre. Lhomme utilise
son profit les mcanismes dcrits par Darwin pour crer de nouvelles espces
vgtales. Des exemples seront prsents et dtaills dans le chapitre 9 intitul
Lhomme et les plantes .

10

9782100544141-Laberche.fm Page 11 Jeudi, 4. fvrier 2010 3:47 15

Rsum

Rsum

La biologie actuelle est le rsultat dune longue srie dobservations qui dans
notre monde occidental a commenc en Grce ds Aristote. Aprs la priode
bien obscure du Moyen ge, cest lutilisation des premiers microscopes qui a
permis de reconnatre les cellules puis les tissus constituants les vgtaux. Les
grandes fonctions physiologiques datent du XIXe sicle et la biologie molculaire
de la seconde moiti du XXe. Parce quelle touche la vie, la biologie fut longtemps indissociable de la philosophie. Longtemps sous linfluence de lglise,
le fixisme et le disme constiturent la doctrine officielle. Cest Darwin que
lon doit la thorie de lvolution base sur limportance de la slection naturelle.
Elle permet de comprendre la microvolution, comme lapparition dune espce
nouvelle, dans un milieu naturel. Mais, elle est moins laise pour expliquer la
macrovolution comme le passage de la vie aquatique la vie terrestre, lapparition des Gymnospermes, des Angiospermes, etc. Lhomme, et particulirement
le biologiste vgtal, utilise les diffrentes squences dcrites par Darwin pour
crer des espces voire des genres nouveaux.

11

9782100544141-Laberche.fm Page 12 Jeudi, 4. fvrier 2010 3:47 15

SAVOIR

DCRIRE
UN VGTAL

La biologie tant par essence mme, dabord une science dobservation, il faut
savoir reconnatre les diffrentes parties qui composent les plantes, puis les nommer
correctement. Il est donc indispensable dutiliser un vocabulaire commun tous.
Cest le but de ce chapitre.
Intuitivement, quand on parle dun vgtal, on pense aux plantes ayant des tiges,
des feuilles et des racines. Les biologistes les appellent les Cormophytes. Elles
possdent un ensemble de tiges feuilles pourvues ou non de racines, le cormus.
Elles reprsentent, elles seules, plus de 70 % des vgtaux qui se dveloppent sur
la terre. La pquerette, le granium, les mousses sont des Cormophytes.
Mais nous connaissons tous dautres vgtaux nayant pas de tige, de feuille et de
racine comme les champignons et les algues. Lagaric champtre (fig. 2.1) et la
laminaire (fig. 2.2) sont des Thallophytes car lappareil vgtatif est un thalle.

carcophore

myclium

1 cm

Figure 2.1 Lagaric champtre est beaucoup plus connu


sous sa dnomination commerciale de Champignon de Paris
en rfrence sa culture dans les anciennes carrires souterraines de Paris.

Certaines dfinitions qui mergeront de lobservation des Cormophytes, seront tout


fait valables pour les Thallophytes. Dautres ne le seront manifestement pas. Ceci
permettra dapprhender la diversit dorganisation, de forme et de fonctionnement
du monde vgtal.
12

9782100544141-Laberche.fm Page 13 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Figure 2.2 La laminaire est


une grande algue de nos ctes.
lame

stipe
10 cm

2.1 LA

DESCRIPTION DUNE PLANTE CORMUS

Le trfle blanc est une petite plante trs commune des prairies. Couvrant le sol, il est
facilement identifiable par ses feuilles caractristiques en trois parties, ses tiges
rampantes sur le sol et ses petites fleurs banches irrgulires regroupes en boules.
Tige, feuille, racine, fleurs sont des termes connus de tous, facilement reconnaissables
chez les vgtaux et participant lorganisation gnrale des plantes (fig. 2.3).
fleur

Dunod La photocopie non autorise est un dlit.

bracte florale

feuille

bourgeon terminal

ramification

tige

Figure 2.3 Organisation


schmatique dune plante
fleurs.

bourgeon axillaire
cotyldon

poils absorbants
racine

coiffe

13

9782100544141-Laberche.fm Page 14 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

2.1.1 La tige et lappareil caulinaire


Avec les feuilles, les tiges sont les organes que lon observe le plus facilement chez
les plantes. Chez le trfle blanc, certaines tiges sont dresses, dautres sont rampantes
mais dans tous les cas, il sagit dorganes allongs portant les feuilles et les fleurs.
La tige est tendre et fragile. On la dit herbace. Elle est annuelle, car elle ne vit
quun an, mme si la plante survit par sa souche enterre. Les branches et les
rameaux que lon distingue chez les arbres et les arbustes sont galement des tiges.
Ce sont des ramifications. Elles sont ligneuses lorsquelles sont dures et solides.
Elles sont vivaces, car vivent des annes durant, voire des sicles dans le cas des arbres.
Le tronc est une tige ligneuse de grande taille. Cest la tige principale. Une branche
darbre est galement une tige ligneuse mais cest une ramification secondaire
(fig. 2.4). linverse des troncs, certaines tiges peuvent tre trs courtes, la plante
est alors dite acaule et les feuilles forment un bouquet qui semble merger du sol.
Cest le cas des plantes en rosettes comme les pissenlits ou les plantains.

feuille

Figure 2.4 Une branche


de noisetier montrant les
ramifications secondaires.

rameau terminal
de lanne
tige principale
rameau de lanne
prcdente

1 cm

ramification secondaire
de lanne

14

9782100544141-Laberche.fm Page 15 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Bien videmment, on trouve dans le monde vgtal de trs nombreux autres types
de tiges.
Les stolons (de stolo = rejeton) qui sont des tiges rampantes non souterraines
feuilles rduites et produisant leur extrmit une tige feuilles dveloppes,
semblable celle dont elle est issue. Le fraisier est une plante acaule formant une
rosette de feuilles : il met des stolons avec de petites rosettes leur extrmit qui
donnent de nouvelles plantes (fig. 2.5). Une variante du stolon, le tubercule, est
bien connue. Chez la pomme de terre (fig. 2.6), cest la partie terminale du stolon
enterr qui se dveloppe et se charge de rserves.

feuille

racine

nouveau
plant

stolon

Figure 2.5 Le stolon de


fraisier est une tige arienne
courant sur le sol.

1 cm

bourgeon
axillaire

cicatrice foliaire

Figure 2.6 Le tubercule


de pomme de terre est
une tige souterraine, renfle
qui accumule des rserves
son extrmit.

bourgeon
terminal

reste
de stolon

Dunod La photocopie non autorise est un dlit.

1 cm

Le rhizome (de rhizoma = racine), qui, malgr son nom, ne doit pas tre confondu
avec une racine. Cest une tige puisquil porte des feuilles (certes rduites ltat
dcailles et non fonctionnelles) et des bourgeons. Le rhizome du sceau de Salomon
(fig. 2.7) est pais, charnu. Cest un organe qui contient des rserves utilises par
la plante pour sa croissance printanire.
Les bulbes (de bulbos = bulbe) sont des ensembles souterrains constitus dune
tige trs courte (le plateau) et de feuilles charnues bourres de substances de rserve
et accoles les unes contre les autres (fig. 2.8). Ce sont les oignons de tulipe, de
lis, dchalote du langage familier.
15

9782100544141-Laberche.fm Page 16 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Connaissez-vous les usages de la pomme de terre?


Premire culture vivrire non cralire au monde, la pomme de terre (Solanum
tuberosum L., Solanaceae) se situe au quatrime rang de lensemble des cultures
vivrires derrire le mas, le bl et le riz. Poussant dans tous les types de sols,
exception faite des sols sals et alcalins, elle sacclimate facilement ce qui fait quelle
est prsente dans plus dune centaine de pays, quils soient temprs, subtropicaux
et tropicaux.
Une fois rcolte, la pomme de terre peut tre utilise de diverses manires. Daprs
les chiffres de la FAO (donnes 2008), plus des deux tiers des 320 millions de tonnes
de pommes de terre produites en 2005 ont t rservs un usage alimentaire. En
fait, moins de la moiti des tubercules produits dans le monde sont consomms
frais. Le reste est transform en produits drivs ou en fcule destine lindustrie
ou bien rutilis sous forme de plants pour la prochaine saison agricole.
Les usages alimentaires
Depuis quelques annes, la consommation mondiale a chang. Les tubercules
sont de plus en plus consomms, non plus frais mais sous forme de produits
transforms : ainsi, les produits surgels dpassent les 11 millions de tonnes par
an. Les proprits liantes de la fcule de pomme de terre, une poudre ne au got
neutre et la texture excellente, sont suprieures celles de lamidon de bl et de
mas et permettent dlaborer des produits plus goteux. Elle est utilise ainsi
pour paissir sauces et ragots, et comme agent liant pour les gteaux, ptes,
biscuits et crmes glaces. Enn, en Europe de lEst et en Scandinavie, les pommes
de terre sont utilises dans lalimentation animale ou broyes puis soumises un
traitement thermique pour convertir la fcule en sucres, qui aprs fermentation
est distille an de produire des boissons alcoolises, comme la vodka et laquavit.
Usages non alimentaires
La fcule de pomme de terre est aussi utilise par les industries pharmaceutiques,
textiles ou du bois et les papeteries comme adhsif, liant, apprt et mastic, ainsi
que par les compagnies qui perforent les puits ptroliers pour laver les puits. Cest
un substitut cent pour cent biodgradable des polystyrnes et autres matires
plastiques servant par exemple fabriquer les assiettes, les couverts jetables et
les sacs.
Daprs Ccile Cassier, Prserver la pomme de terre pour nourrir la plante , Univers-nature du
30-12-2008.

dpart
dinflorescence

cicatrice

bourgeon
axillaire
1 cm

bourgeon terminal qui avorte

Figure 2.7 Rhizome du sceau de Salomon.


Cest une tige charnue, portant des feuilles cailleuses. Elle se ramie et ses bourgeons
axillaires sont lorigine des feuilles et des eurs ariennes.

16

9782100544141-Laberche.fm Page 17 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

c
bourgeon
floral

1 cm
feuilles charnues

racines

plateau
(tige)

Figure 2.8 Le bulbe de tulipe.


a, aspect gnral ; b, les feuilles charnues ont t enleves permettant de voir le
plateau et le bourgeon oral central ; c, coupe longitudinale.

Les tiges sallongent et se ramifient. Deux variantes sont observables.


1. La ramification monopodiale quand le bourgeon terminal de la tige principale
reste fonctionnel dune anne sur lautre. La tige principale et les ramifications sont
donc constitues dunits annuelles rsultant de lactivit priodique dun seul et
vrai bourgeon terminal (fig. 2.9).
Du plus grand au plus petit

Dunod La photocopie non autorise est un dlit.

Larbre le plus haut du monde est un squoia toujours vert (Sequoia sempervirens (D.Don) Endl., Cupressaceae) qui culmine 111 mtres et qui pousse dans
le Redwood National Park de Californie aux tats-Unis. Larbre le plus haut de France,
une hauteur plus modeste : 50 mtres seulement. Cest le sapin Prsident
(Abies alba Mill., Pinaceae) de la fort de Russey dans le Doubs. Il dtient ce record
depuis quun arbre de 55 mtres de haut situ lui aussi dans la fort de Russey a
t abattu par la tempte de dcembre 1999.
linverse, le saule herbac (Salix herbacea L., Salicaceae) est un saule des rgions
arctiques et montagnardes. Il pousse dans les prairies daltitude, principalement
ltage alpin aussi bien dans les Alpes que dans les Pyrnes. Cet arbre est rduit
sa plus simple expression, deux feuilles et quelques fruits au milieu. Cette espce
darbre a une hauteur gnralement comprise entre 0,5 et 5 centimtres. Il sagit
nanmoins dun arbre car lespce produit du xylme secondaire (voir chapitre 5.6).
Mais larbre le plus haut du monde, nest pas (et de loin !) le plus g. Le plus vieil
arbre actuellement vivant est un pin Bristlecone (Pinus longaeva D.K.Bailey, Pinaceae)
baptis Mathusalem et situ 3 050 mtres daltitude dans les White Mountains en
Californie. Son ge a t dtermin en 2008 prcisment 4 773 ans par dendrochronologie.
En France, le record de longvit (2 500 ans) appartient au chne pdoncul (Quercus
pedunculata Ehrh, Fagaceae) ou aux chtaigniers (Castanea sativa Mill., Fagaceae).

17

9782100544141-Laberche.fm Page 18 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

bourgeon terminal

feuille

rameau de lanne

rameau
de lanne

cailles du bourgeon terminal


de lanne prcdente

rameau de lanne prcdente

1 cm
bourgeon terminal

rameau de lanne : ramification secondaire


issue dun bourgeon axillaire

Figure 2.9 La ramification monopodiale chez le htre.


Le bourgeon terminal se dveloppe. Les bourgeons axillaires peuvent aussi se
dvelopper et donner des rameaux secondaires.

18

9782100544141-Laberche.fm Page 19 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

2. La ramification sympodiale. Le bourgeon terminal avorte et est remplac par un


bourgeon axillaire qui se redresse et se met en position sub-terminale. Cest le
cas du chtaignier (fig. 2.10) ; la ramification est dite sympodiale-monochasiale.
Chez le lilas, le bourgeon terminal est remplac par deux bourgeons axillaires
redresss. Cest une ramification sympodiale-dichasiale.

feuille
bourgeon terminal
qui va avorter
bourgeon axillaire
qui deviendra subterminal
bourgeon axillaire
tige issue du bourgeon axillaire subterminal
reste du bourgeon terminal avort

Dunod La photocopie non autorise est un dlit.

cicatrice foliaire
1 cm

rameau provenant du dveloppement


dun bourgeon axillaire : ramification secondaire

Figure 2.10 La ramification sympodiale monochasiale chez le chtaignier.


Le bourgeon terminal avorte et est remplac par le bourgeon axillaire subterminal
qui se redresse et se dveloppe.

Ainsi la tige peut tre considre comme un axe qui porte ou a port des feuilles.
Cette notion purement morphologique est gnrale et stend aux mousses et aux
fougres. Les champignons et les algues nont pas de tige. Parmi ces dernires, les
laminaires prsentent un stipe (fig. 2.2) qui pourrait faire penser une tige. Ltude
structurale montre quil nen est rien.
19

9782100544141-Laberche.fm Page 20 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

2.1.2 La feuille
Chez le trfle blanc, on observe que les feuilles sont portes par une tige sur laquelle
elles sinsrent au niveau dun nud. Cette feuille est compose de trois folioles
planes, tales transversalement. Elle admet un plan de symtrie. Une feuille comporte
typiquement un ptiole (de petiolus = petit pied) intermdiaire entre la tige et le
limbe (de limbus = coin, rebord). Elle a une croissance dfinie dans le temps.
Comment reconnatre une feuille dune foliole?
linsertion de la feuille sur la tige on distingue un bourgeon axillaire, qui sera
lorigine dune nouvelle ramication. la base des folioles il ny a pas de bourgeon.

Le ptiole est gnralement troit, plus ou moins cylindrique slargissant sa base,


comme chez le marronnier, et spanouissant au sommet en un limbe tal. Celui-ci
est une lame verte, parcourue de nervures constituant une ornementation caractristique (palme, penne ou parallle). La forme du limbe est trs varie. Elle peut tre
entire, dente, lobe, palmatisque, palmatifide (fig. 2.11).

Figure 2.11 Quelques


types de feuilles.

b
a
c

e
20

a, lobe : chne ; b, entire :


bouleau ; c, dente : orme ;
d, palmatide : lierre ; e,
palmatisque : rable.

9782100544141-Laberche.fm Page 21 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Certaines feuilles, comme celles du pois sont composes. Elles ont des folioles.
leur point dinsertion sur la tige des stipules se dveloppent (fig. 2.12). Ce sont des
appendices plus ou moins dvelopps, verts ou membraneux, entiers ou diviss,
pineux ou unis deux deux.

vrille
rachis

Figure 2.12 Les stipules de la feuille


de pois, ainsi que les folioles transformes
en vrilles, lui permettant de saccrocher
diffrents supports.

foliole
(limbe lmentaire)
ptiole
tige
stipules

Dunod La photocopie non autorise est un dlit.

1 cm

La disposition des feuilles sur la tige nest pas lie au hasard. Elles peuvent tre
alternes (une seule chaque nud), opposes (deux feuilles en vis--vis de chaque
nud) ou verticilles quand il y a trois feuilles, ou plus, disposes en couronne
chaque nud. Elles se placent selon des rgles de phyllotaxie trs prcises. Quand
on observe deux feuilles qui se suivent sur une tige, on constate quelles ne sont pas
places lune au-dessus de lautre. Elles forment toujours entre elles, un angle dfini
constituant une caractristique du vgtal. Il peut tourner soit vers la droite (dextre)
ou vers la gauche (snestre). Cette disposition des feuilles conditionne la place des
bourgeons axillaires sur la tige qui ultrieurement assureront les ramifications. Par l
mme, cette phyllotaxie est lun des facteurs responsables de larchitecture, on dit
aussi du port, des plantes. La dure de vie des feuilles est limite. Dans nos rgions
la majorit des plantes ont des feuilles annuelles. Elles sont caduques. Pour une fort
dont les arbres sont feuilles caduques, on parle de fort dcidue. Certaines feuilles
vivent plus longtemps. Ce sont des feuilles persistantes. Cest le cas de lolivier, du
houx, du laurier
Il existe de trs nombreux types de feuilles dont :
les cailles de bourgeon comme chez le marronnier ;
les feuilles vrilles du pois qui permettent la fixation de la plante un support
(fig. 2.12) ;
les feuilles des plantes carnivores qui peuvent tre couvertes de poils glanduleux
(drosra) ou replies pour former des urnes (utriculaire) ;
les feuilles succulentes chez les joubarbes et les sdums ;
21

9782100544141-Laberche.fm Page 22 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

les feuilles bulbeuses charges de rserves des bulbes dj signales dans les tiges
particulires (cf. fig. 2.8) ;
les feuilles pineuses chez les ajoncs.
Variations chez les feuilles et les bourgeons
Chez le chne, les feuilles restent sur larbre lautomne, bien quelles ne soient
plus fonctionnelles. Ce nest quau printemps, lors du dbourrement des bourgeons
quelles tomberont ; on dit quelles sont marcescentes.
Tous les bourgeons ne sont pas entours dcailles. Le chou de Bruxelles est un
bourgeon axillaire nu. Labsence de bourgeon sur les racines est gnrale, sauf
dans le cas des drageons, comme chez les ronces, les peupliers

Comme la tige prcdemment tudie, la feuille peut tre dfinie daprs des
caractres morphologiques. Elle se caractrise par sa position latrale sur les tiges et
sa symtrie bilatrale ainsi que par sa croissance limite dans le temps et lespace.
Elle axile un bourgeon, situ sur la tige. Cette dfinition convient aux mousses, fougres
et aux plantes fleurs. Elle ne peut sappliquer aux algues et aux champignons.
Pourtant certaines algues comme la dlesseria sanglante, prsentent des analogies de
formes surprenantes. Ltude de la structure montre cependant que ce nest quune
concidence.
Notion dhomologie et danalogie
Un organe est analogue un autre quand il a la mme forme, le mme aspect mais
pas le mme rle physionomique. Inversement un organe est homologue dun
autre organe quand il a le mme rle physionomique tout en nayant pas la mme
forme ou le mme aspect. Les pines dEuphorba pulvinata (un cactus) et du rosier
sont analogues, car les premiers sont des rameaux, les secondes des expansions
supercielles de lpiderme.

2.1.3 La racine et lappareil racinaire


Des graines de poireau ou de haricot mises germer montrent que la racine est un
axe qui croit vers le bas (gotropisme positif) et fuit la lumire (phototropisme
ngatif). Elle nest pas chlorophyllienne et ne porte ni feuille, ni bourgeon. Les jeunes
racines portent des poils absorbants leur extrmit et assurent la fixation de la plante
au sol.
Cette morphologie de la racine se complique quand la plante se dveloppe. Elle se
ramifie et devient pivotante, tubreuse, fascicule (fig. 2.13).
Cette classification correspond-elle la majorit des racines observables ? Dans
lensemble oui, si lon considre les plantes fleurs. Quelques plantes cependant vivent
sans racines apparentes comme le gui. Dautres plantes ont des racines spcialises.
On peut trouver ainsi :
des racines ariennes adventives qui apparaissent le long dune tige comme chez
les philodendrons ;
les racines crampons qui fixent la plante un support (le lierre) ;
22

9782100544141-Laberche.fm Page 23 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Figure 2.13 Diffrents types de racines.


a, pivotante (giroe) ; b, tubreuse (carotte) ; c, fascicule (bl). Il peut arriver que
des racines soient chlorophylliennes comme des phylodendrons. De mme sur les
racines peuvent apparatre des bourgeons, lorigine des drageons (framboisier,
peuplier).

des racines aplaties chez des orchides tropicales vivant sur dautres vgtaux.
Elles peuvent tre chlorophylliennes et former des voiles qui recueillent leau (de
pluie ou la rose) indispensable la vie de la plante.
La racine est un axe qui ne porte jamais de feuilles. Les champignons nont pas de
racines comme celles observes chez le trfle blanc ou chez les fougres. Chez les
mousses, la prsence de racines est moins vidente, un chevelu de filaments pais et
courts, les rhizodes, fixe la plante au sol.

Dunod La photocopie non autorise est un dlit.

2.1.4 La fleur
La fleur est un ensemble composite constitu de diverses pices spcialises. Elle
contient les organes sexuels de la plante et se trouve en position terminale ou latrale
sur la tige.
Cest un organe qui a servi et sert encore dlment de reconnaissance et de
classification pour de nombreux botanistes. La petite flore de Gaston Bonnier Les
noms des fleurs trouvs par mthode simple (Librairie Gnrale de lEnseignement)
en est lillustration parfaite. Cest quen effet, le nombre de pices florales, leur
couleur, leur disposition varient. Cependant les caractres gnraux de lappareil reproducteur sont relativement constants.
Les paragraphes, fleur, graine et fruit ne concernent que les plantes fleurs. En
effet, plusieurs catgories de Cormophytes ainsi que les Thallophytes nont pas de
fleur. Les caractristiques des organes de reproduction de celles-ci seront tudies
dans le chapitre 6.
23

9782100544141-Laberche.fm Page 24 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Les tulipes de Hollande


Les eurs exercent depuis toujours une puissante fascination sur lhomme. Ceci
se transforma en vritable passion au XVIe sicle, lorsque les premires tulipes
furent introduites en Europe. Lhistoire raconte que le premier europen les voir
fut A. Bousbecq, ambassadeur en Turquie de lempereur germanique Ferdinand
1er. Celui-ci reut par la valise diplomatique, quelques bulbes qui furent plants
la Cour. La oraison de ces eurs dchana des passions et le prix des bulbes atteignit
rapidement des sommes exorbitantes, notamment en Hollande o leur culture fut
rapidement matrise. Avec le temps, les prix sont redevenus plus raisonnables,
mais lengouement que cette eur et, reste unique en son genre et mme les
orchides si fascinantes nont jamais connu une telle gloire.

Les botanistes ont lhabitude de dire que la fleur est constitue de quatre verticilles
de pices florales places sur un rceptacle, au sommet dun pdoncule floral axil
par une bracte.
Il est possible de schmatiser lorganisation gnrale dune fleur (fig. 2.14).
On distingue alors de lextrieur vers lintrieur :
le calice comprenant des pices chlorophylliennes, les spales ;
la corolle constitue de pices non chlorophylliennes, diversement colores, les
ptales ;
landroce, constitu des tamines portant lextrmit du filet les sacs polliniques
contenant le pollen ;
le gynce, ou pistil form de lovaire, contenant des ovules, surmont du style
et des stigmates.

sac pollinique
carpelle
rceptacle

pistil

style
ovule
ovaire
stigmate
pollen
tamine
filet
ptale
spale
pdoncule floral
bractole
bracte
tige

24

Figure 2.14 Organisation gnrale


dune fleur dAngiosperme.

9782100544141-Laberche.fm Page 25 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Le pollen de lambroisie provoque des allergies


Lambroisie feuille darmoise (Ambrosia artemisiifolia L. Asteraceae) fait partie
de ce que lon appelle couramment les mauvaises herbes mme si elle entre
parfois dans des dcoctions alcooliques comme en Allemagne. Cest une plante
annuelle qui, au moment de la oraison, apparat comme un buisson qui peut
atteindre plus dun mtre de haut. Or le pollen de lambroisie provoque chez de
nombreuses personnes des ractions allergiques. Si lon se rfre aux donnes du
ministre de la Sant (http://www.ambroisie.info/), il suft de 5 grains de pollen
par mtre cube dair pour que les symptmes apparaissent ! Il sagit le plus
souvent de rhinite (nez qui pique et coule, ternuements), de conjonctivite (les
yeux sont rouges, gons, larmoyants et ils grattent), de trachite (toux sche),
dasthme (difcult respirer) ou durticaire et deczma (rougeurs, boutons,
dmangeaisons). En France, on estime que 6 12 % de la population est sensible
lambroisie. Incommodante, cette plante lest dautant plus quelle est extrmement envahissante. Largement implante en rgion Rhne-Alpes, elle a, depuis,
investi les dpartements voisins des valles de la Sane et du Rhne. Si les plaines
et les collines de basse altitude lui sont propices, cela ne lempche pas de se xer
jusqu plus de 800 mtres daltitude. Elle colonise des types de terrains varis. Il
nest pas rare de lapercevoir sur les bas-cts des routes. Elle affectionne galement les aires incultes et les sites en friche. Enn, elle se dveloppe dans les cultures
agricoles.
Quant aux moyens de lutte contre lambroisie, ils sont trs restreints. Le recours
larrachage ou au fauchage simposent dans les terrains non cultivs mais beaucoup
plus alatoire est sa destruction dans les champs surtout si on veut intervenir
avant la oraison, laquelle commence la mi-aot.

Dunod La photocopie non autorise est un dlit.

Le calice et la corolle constituent la partie strile de la fleur, le prianthe.


Landroce est la partie mle, le gynce la partie femelle. Ensemble, ils forment la
partie sexue. On va trouver toutes les formes de variations possibles par rapport
ce schma thorique. Souvent, on observera quune ou plusieurs pices peuvent tre
absentes lintrieur dun ou de plusieurs verticilles, quun ou plusieurs verticilles
peuvent manquer compltement ou que des verticilles peuvent se ddoubler. Ceci
entrane une terminologie particulire quil est bon davoir vu, dfaut de la connatre.
Ainsi pour des variations au niveau du prianthe on parlera :
de tpales, quand les ptales et les spales sont de forme et de coloration identiques
(cas de la tulipe ou de la colchique) ;
de fleur actinomorphe, quand elle est rgulire, cest--dire quand elle prsente
une symtrie radiale (le tabac) ;
de fleur zygomorphe, quand elle est irrgulire et prsente un plan de symtrie,
gnralement antro-postrieur comme chez laconit ;
de fleur asymtrique, quand elle est dpourvue de tout plan de symtrie (la
valriane).

25

9782100544141-Laberche.fm Page 26 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Le lieu dinsertion des pices florales permet de distinguer :


les plantes thalamiflores quand les fleurs prsentent une double enveloppe florale
ptales distincts insrs sur le rceptacle ;
les calcyflores quand un ou plusieurs ptales libres ou souds sont attachs au
calice ;
les coroliflores quand plusieurs ptales souds en une corolle gamoptale est insre
sur le rceptacle ;
les disciflores quand lovaire super repose sur un disque nectarifre.
Au niveau de la rpartition des sexes dans les fleurs et les individus on distingue :
les fleurs hermaphrodites possdant la fois landroce et le gynce (cas du trfle
blanc) ;
les fleurs unisexues ne possdant que landroce, (il sagit alors dune fleur
stamine appele aussi fleur mle), ou le gynce (fleur pistille ou fleur femelle) ;
une plante est dioque, si chaque individu ne porte que des fleurs mles ou des
fleurs femelles. Le saule marsault est un exemple de plante dioque : des arbres
portent des fleurs mles ( les chatons qui apparaissent au printemps) lextrmit
des rameaux feuills, dautres des fleurs femelles formant aussi des chatons
dun vert plus sombre et disposs sur des rameaux gs ;
une plante est monoque quand elle ne produit que des fleurs unisexues mais
chaque individu porte la fois des fleurs mles et femelles. Cest le cas du noisetier,
du bouleau, de laulne, du mas et du ricin.
Pour les cycles reproducteurs, de nombreuses distinctions sont possibles
Dans landroce on distingue les tamines introrses, pour lesquelles la fente de
dhiscence est situe sur la face suprieure et les tamines extrorses o la fente se
trouve sur la face infrieure.
Quant au gynce, la position de lovaire par rapport aux pices florales est
importante. Il est dit supre, comme chez la tomate et loranger par exemple, sil est
au-dessus de linsertion du prianthe et des tamines et infre si linsertion est en
dessous, cas du pommier ou du bgonia par exemple. Quand linsertion se fait mihauteur du rceptacle on parle alors dovaire semi-infre.
Le gynce est compos de carpelles et du style (cf. fig. 2.14). Lensemble des
carpelles forme lovaire de la fleur. Il contient les ovules qui seront lorigine des
graines. Il est dit simple ou compos selon quil comporte un ou plusieurs carpelles.
Les ovules sont de petites masses ovodes de quelques diximes de millimtre de
long. Leurs diffrents tissus seront dtaills dans le chapitre concernant la reproduction. Mais dj, on peut observer quils sont entours de tguments, dlimitant
lune des extrmits de lovule une invagination, le micropyle. Lintrieur contient
un tissu, le nucelle, dans lequel est inclus le sac embryonnaire. Lovule nest pas
libre dans le carpelle. Il est attach par le funicule constitu dun tissu nourricier, le
placenta. Le point dinsertion du funicule sur lovule est le hile. Pratiquement cest
la cicatrice que porte une graine au point o elle tait attache la plante (dans la
gousse, la capsule) dont elle est issue. On appelle aussi chalaze, le point dans la graine
o le funicule franchit l'paisseur du tgument interne du nucelle.
26

9782100544141-Laberche.fm Page 27 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Le carpelle: nom masculin


Sur les 600 mots environ de la langue franaise se terminant par -elle, seuls nucelle
et carpelle sont du masculin et constituent des exceptions la rgle gnrale qui
veut que les mots se terminant par -elle soient du fminin.
Cette originalit est lorigine de fautes typographiques qui se perptuent au
cours des ges. Ainsi dans Les nouveaux lments de botanique et de physiologie
vgtale de A. Richard, Membre de lInstitut et publi Paris en 1852, chez
Bchet, louvrage commence par un errata :
Par suite dune erreur typographique () les mots carpelle et nucelle ont t
indiqus tre du genre fminin, quoique ltymologie de ces mots ne permette de
les crire quau masculin. Le lecteur voudra bien ne leur attribuer que ce genre
linverse, dans larticle Le sexe du melon publi dans le magazine de lINRA
n 6, doctobre 2008, le mot carpelle perd sa terminaison double et est crit carpel
(il retrouve cependant sa bonne criture un peu plus loin dans les notes). Peut-tre
sagit-il ici dune simple faute de relecture par un non-botaniste moins quil ne
sagisse dune consquence de linuence grandissante de la langue anglaise
comme outil de communication scientique sachant queffectivement dans cette
langue le carpelle se traduit par the carpel.

Les ovules sont de trois grands types (fig. 2.15) :


Lovule orthotrope (de orthos = droit) est dress sur un funicule trs court. Le
hile, la chalaze et le micropyle restent parfaitement aligns (exemple : le noyer).
Lovule anatrope (de ana = vers le haut) est port par un funicule recourb et uni
lovule sur sa plus grande longueur. Le micropyle est en bas, proche du placenta.
Le plan de raccordement du funicule et de lovule sappelle le hile. Dans le funicule,
pntre un faisceau de tissus conducteurs qui se ramifient au niveau de la chalaze
(exemple : la renoncule).
m
ch
n

ch

teg

Dunod La photocopie non autorise est un dlit.

se
ovule

n
teg
ch
h
f

m
se
teg

se
m

Figure2.15 Reprsentation schmatique des diffrents types dovules.


a, orthotrope ; b, campylotrope ; c, anatrope
m : micropyle, teg : tguments, se : sac embryonnaire, n : nucelle, ch : chalaze,
h : hile, f : funicule

27

9782100544141-Laberche.fm Page 28 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Lovule campylotrope (de campylos = recourb) est couch et port latralement


par le funicule. Le micropyle et le hile sont loigns lun de lautre et forment une
droite parallle la paroi de lovaire. Du fait de la croissance ingale de lovule,
le sac embryonnaire se trouve dport prs du micropyle (exemple lillet).
Beaucoup plus rarement on parle aussi :
dovule hmitrope. Il sagit dun ovule dont le corps est courbe (pas entirement
renvers comme chez un ovule anatrope) et dont la croissance est symtrique de
part et dautre du plan mdian du sac embryonnaire (pas comme chez un ovule
campylotrope). Le micropyle est relativement proche du funicule ;
ovule crassinucell quand l ovule est pourvu d'un nucelle pais ou dovule tnuicell quand le nucelle est rduit ;
dovule unitegmin quand lovule ne possde quun tgument et dovule bitegmin
quand lovule possde deux tguments : la primine interne et la secondine externe.
La placentation dfinit la position des ovules lintrieur de lovaire. Celle-ci
est fort variable. Il est possible de les regrouper en quatre grands types, mme si
lobservation peut en dvoiler dautres moins frquents.
Il sagit (fig. 2.16) de la placentation :
axile, les ovules sont runis au centre de lovaire (la tulipe, la bryonne) ;
paritale, les ovules sont souds aux sutures des carpelles ouverts (le pavot, le
bgonia, la violette) ;
centrale, les ovules se dressent au centre de la cavit ovarienne (la primevre) ;
axile devenant centrale avec la disparition des cloisons radiaires (le lychnis).

Figure 2.16 Quelques exemples de placentation.


a, axile ; b, paritale ; c, centrale ; d, axile devenant centrale.

Il est traditionnel aussi de reprsenter schmatiquement la fleur. Elle est symbolise


par autant de cercles concentriques (pour les fleurs rgulires) ou dellipses (pour les
fleurs irrgulires) quelle possde de cycles. La formule florale est une expression
condense de la structure de la fleur. Elle scrit par une srie de chiffres et de
symboles qui correspondent un code international. Le trfle blanc a, ainsi, pour
formule (fig. 2.17) : 5S, 5P, (9) + 1 E, 1C pour : 5 spales, 5 ptales, 10 tamines
dont une libre et 1 carpelle. On peut aussi prciser : .I. pour zygomorphe et C pour
carpelle supre.
28

9782100544141-Laberche.fm Page 29 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Figure 2.17 Diagramme floral


du trfle blanc. 5S; 5P; (9) + 1E; 1C

2.1.5 Les inflorescences


linverse de la tulipe, qui lors de sa floraison, prsente une fleur isole et unique,
le trfle blanc montre des capitules globuleux comportant de 20 100 fleurs. Il sagit
dinflorescences. Elles sont en position latrale sur la tige. Dautres comme celles
du lilas sont en position terminale.
premire vue, les diffrents types dinflorescences paraissent trs nombreux.
Pourtant leurs architectures reposent sur les lois qui rgissent la ramification des tiges.
De ce fait, elles appartiennent seulement deux grands types fondamentaux.

Dunod La photocopie non autorise est un dlit.

a) Les inorescences de type monopodial


Ces inflorescences croissance indfinie, faciles reconnatre, sont souvent aussi
appeles racmeuses (du latin racemus = grappe de raisin). Ceci rappelle que la
grappe est le type fondamental dinflorescence monopodiale.
1. La grappe (fig. 2.18a). Les fleurs pdicelles, sont portes directement par le
rameau principal. Les fleurs les plus ges sont la base, les plus jeunes au sommet.
Plusieurs variantes sont possibles :
grappe ouverte, quand la croissance de laxe est indfinie (pilobe, linaire) ;
grappe ferme, quand la croissance de laxe est limite. Dans ce cas la grappe
se termine par une fleur.
2. Lpi (fig. 2.18c). Cest une grappe dont les fleurs sont sessiles, cest--dire sans
pdicelle. Le chaton (de saule ou de noisetier) est un pi portant des fleurs
incompltes (sans ptales et unisexues). Lpillet est un petit groupe de fleurs trs
29

9782100544141-Laberche.fm Page 30 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

incompltes, enveloppes de bractes minces, sches (scarieuses) formant lunit


lmentaire dont sont constitues les inflorescences des Gramines (bl, avoine,
brome, ivraie) (fig. 2.18d) et des Cyperaceae comme les carex.

fleur
pdicelle
bracte

pdoncule

e
fleurons tubuls

involucre de bractes

rceptacle

fleuron
ligul
bractes de
linvolucre

i
ombellule
involucelle
involucre de bractes

Figure 2.18 Inflorescences de type monopodial.


a, grappe ; b, grappe de grappes ; c, pi ; d, pi dpillets ; e, corymbe ; f, corymbe
de corymbes ; g, ombelle ; h, ombelle dombellules ; i, capitule.

3. Le corymbe. Il sagit dune grappe (fig. 2.18e) dont toutes les fleurs se disposent
sur un plan du fait de lingalit des pdicelles (les fleurs de pommier).
4. Lombelle diffre du corymbe par le fait que les fleurs sont toutes rattaches
laxe au mme niveau, matrialis par linvolucre des bractes (fig. 2.18g). Les
ombelles simples sont assez rares, bien souvent il sagit dombelles composes.
Les rameaux les plus proches de la tige ne portent pas de fleurs mais de petites
ombelles, les ombellules (fig. 2.18h).
5. Le capitule (fig. 18i) est une grappe de fleurs sessiles insres sur le sommet
dune tige largie en plateau. Il est homologue dune ombelle dans laquelle tous
les pdicelles seraient nuls. Le trfle blanc a une inflorescence en capitule. Il
arrive de trouver dans la littrature que les fleurs des capitules soient appeles
fleurons.
30

9782100544141-Laberche.fm Page 31 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Les grappes sont souvent composes. On peut trouver des grappes de grappes
(fig. 2.18b), des corymbes de corymbes (fig. 2.18f), des pis dpillets (le bl) mais
aussi des grappes dpis (les palmiers), des grappes dombelles (le lierre) ou des
corymbes de capitules (les achilles).

b) Les inorescences de type sympodial


Ces inflorescences de type cyme, sont dfinies parce que laxe primaire se termine
par une fleur ce qui provoque larrt de la croissance. Elles sont gnralement unipares
(une fleur dun ct, comme chez la grande consoude (fig. 2.19a) ou bipares, deux
fleurs de chaque cot de laxe, bgonias (fig. 2.19d) et ont une organisation centrifuge,
oriente vers lextrieur (fig. 2.19b). Si les axes successifs des cymes deviennent trs
courts, les fleurs apparaissent toutes insres au mme niveau sur une cyme contracte
appele glomrule, que lon rencontre chez les labies par exemple (fig.2.19c).

Figure 2.19 Quelques exemples de cymes.


a, cyme unipare hlicodale ; b, cyme unipare scorpiode ; c, glomrule ; d, cyme bipare.

Dunod La photocopie non autorise est un dlit.

2.1.6 Les graines


Dune manire gnrale, chez les plantes fleurs, ds la double fcondation ralise
(cf. 6.4.4 La reproduction sexue chez les Angiospermes), la fleur fane entranant
la chute des pices florales. Lovaire, quant lui, subit de profondes modifications
morphologiques qui aboutiront la formation du fruit, tandis que les ovules deviennent
des graines (fig. 2.20).
Les graines conservent la forme gnrale de lovule, mais leurs dimensions sont
tout autres. Elles sont beaucoup plus grosses et contiennent :
1. Lembryon qui est une plantule pluricellulaire, diffrencie en une radicule
(premire racine), une gemmule (bourgeon apical), une tigelle (premire tige) et
le ou les cotyldon(s) (premire(s) feuille(s) assurant la nutrition de la plante).
31

9782100544141-Laberche.fm Page 32 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

tguments

albumen
cotyldon
gemmule

embryon

tigelle
radicule

micropyle

Figure2.20 Schma dorganisation dune graine thorique albumine


dAngiosperme dicotyldone.

2. Les tguments plus ou moins durs et coriaces qui rsultent de la transformation


des tguments de lovule. A leur surface, il est possible de reconnatre lemplacement
du hile (lieu de fixation de lovule dans le carpelle) et le micropyle (espace entre les
tguments ovulaires permettant le passage du tube pollinique lors de la fcondation).
3. Les substances de rserve qui entourent lembryon. Chez les plantes fleurs le tissu
de rserve est essentiellement lalbumen. Cependant, cest un tissu transitoire
form au dpens du nucelle. Chez certaines plantes cette digestion est incomplte
et le nucelle senrichit alors de rserves pour former un tissu nourricier original,
le prisperme. Cet albumen, lui aussi peut se rsorber ; les glucides passent alors
dans le ou les cotyldons et forment de lamidon.
Ces diffrents tissus de rserves permettent de diffrencier trois types de graines :
Les graines prisperme chez lesquelles le nucelle senrichit en totalit ou en
partie de rserves (cas du canna ou du nnuphar).
Les graines albumines, o lalbumen constitue le tissu de rserve. Dans ce cas
les plantules sont minces et fines car noyes littralement dans lalbumen qui sest
substitu au nucelle pendant le grossissement de la graine. La graine de ricin
(fig. 2.21) est la plus connue des graines albumines.
Les graines exalbumines o lalbumen a t digr. Les glucides ont migr vers
les cotyldons pour former de lamidon. Les cotyldons occupent tout lespace
entre les tguments. Les graines de pois, de haricot (fig. 2.22) ou de trfle sont des
graines exalbumines.
32

9782100544141-Laberche.fm Page 33 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

tgument

albumen
cotyldons

gemmule
tigelle

cicatrice
du cotyldon
enlev

1 cm

radicule

Figure 2.21 Graine albumine de ricin.


a, aspect extrieur ; b, un cotyldon et la plantule (coupe entre les 2 cotyldons) ;
c, coupe longitudinale au niveau de lembryon.

tgument

plantule

gemmule
tigelle

plantule

radicule

hile
cotyldons
micropyle

cotyldon

0,5 cm

Figure 2.22 Graine exalbumine de haricot.


a, aspect extrieur ; b, coupe longitudinale montrant les deux cotyldons et la
plantule ; c, le haricot ouvert.

Dunod La photocopie non autorise est un dlit.

Un conservatoire des graines


Une chambre forte semencire mondiale proprit du gouvernement norvgien
et situe sur une le isole du Cercle polaire fonctionne depuis 2006. Elle est constitue de trois pices scurises places au bout dun tunnel long de 125 mtres,
creus dans la montagne de Svalbard en Norvge. Sa conception et sa localisation
permettent au btiment de maintenir une temprature de stockage des graines de
18 degrs Celsius.
Cette chambre forte est conue pour accueillir 4,5 millions dchantillons, soit
environ 2 milliards de semences. Le but du projet est, dabord, la mise en place
dune garantie contre la perte rgulire de la diversit et, ensuite, de permettre un
redmarrage de la production agricole en cas de catastrophe dorigine naturelle ou
humaine. Chaque pays ou rgion restent propritaire des semences quil a dposes.
Le systme a t conu pour maintenir une activit mtabolique rduite, assurant,
selon les types de semence, une viabilit allant de plusieurs dcennies plusieurs
millnaires. Ainsi les caryopses dorge (Hordeum vulgare L. Poaceae) doivent pouvoir
survivre 2 000 ans, ceux du bl (Triticum sp., Poaceae) 1700 ans, quant ceux du
sorgho (Sorghum bicolor (L.) Moench, Poaceae) presque 20 000 ans.
Daprs Michel Sage, Univers-nature 27-02-2008

33

9782100544141-Laberche.fm Page 34 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Chez les Orchides lembryon est trs petit, indiffrenci et les rserves trs
restreintes. Pour germer les graines ont besoin dun champignon (Rhizoctonia) qui
vivra en symbiose avec lorchide.

2.1.7 Les fruits


En mme temps que se forment les graines, les parois de lovaire subissent des transformations importantes et voluent en fruit. Dans un fruit, on reconnat trois ensembles
cellulaires (fig. 2.23) qui forment le pricarpe :
lpicarpe correspondant lpiderme externe du fruit ;
le msocarpe (le tissu mdian) ;
lendocarpe ou piderme interne.
Mais ces transformations peuvent affecter, aussi, le rceptacle floral qui peut
shypertrophier comme chez la pomme (fig. 2.24). Dans ce cas, on nest plus en
pdoncule
rceptacle
1 cm

picarpe
pricarpe
graine
noyau

msocarpe
endocarpe lignifi

Figure 2.23 La formation dun fruit: la cerise.


pdoncule

piderme
loge carpellaire
graine

trajet vasculaire
rceptacle dvelopp
(conceptacle)
endocarpe
parchemin

1 cm

tamines fltries

spales (calice)

Figure 2.24 Coupe longitudinale dune pomme.


34

9782100544141-Laberche.fm Page 35 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

prsence dun fruit, sensu stricto, mais de quelque chose de complexe qui porte le
nom de pseudo-fruit, ou faux fruit. On loppose donc au vrai fruit.
Ces notions de vrais et faux fruits sont rattacher la position de lovaire sur le
rceptacle. Ainsi, lovaire supre donne de vrais fruits et lovaire infre, invagin et
protg par les parois du rceptacle donne des faux fruits.

a) Les vrais fruits


Lvolution du pricarpe au cours de leur formation permet de distinguer les fruits
secs des fruits charnus.
Chez les fruits secs, le pricarpe se dshydrate et se lignifie, il devient dur. Certains
fruits souvrent maturit et librent les graines. Ce sont des fruits secs dhiscents
(fig. 2.25). On peut reconnatre :
le follicule comprenant un carpelle et souvrant selon une fente (lhellbore) ;
la gousse un carpelle et deux fentes (le trfle blanc, le pois) ;
la silique deux carpelles et quatre fentes (la moutarde) ;
la capsule plusieurs carpelles et nombreuse fentes et pores de dhiscences (le
pavot).

Dunod La photocopie non autorise est un dlit.

1 cm

1 cm

1 cm

le follicule
dhellbore

la gousse
de pois

le silique
de moutarde

Figure 2.25 Exemples de fruits secs dhiscents.


a, follicule de lhellbore ; b, la gousse de pois ; c, la silique de la moutarde.

Dautres fruits secs restent ferms maturit. Ce sont des fruits secs indhiscents.
Ils sont de trois types (fig. 2.26) :
les aknes renfermant une seule graine libre (le gland du chne) ;
la samare, qui est un akne ail (le frne) ;
le caryopse contenant une graine soude au pricarpe sec. Cest le fruit caractristique des crales.
35

9782100544141-Laberche.fm Page 36 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

1 cm

embryon

1 mm

cupule

albumen

1 cm
aile

tgument

le gland

la samare

le caryopse

Figure 2.26 Exemples de fruits secs indhiscents.


a, le gland du chne est un akne ; b, la samare du frne ; c, le caryopse de bl (coupe).

Dans les fruits charnus, les parois du msocarpe shypertrophient pour donner la
pulpe. Deux types sont reconnaissables :
les baies entirement charnues comme le raisin (fig. 2.27) et la tomate (fig. 2.28a)
ou globuleuse : lorange (fig. 2.28b) ;

picarpe
color

graines

msocarpe
pulpeux

Figure2.27 La baie de raisin.


Elle est forme partir dun ovaire
compos supre deux loges
carpellaires.

1 cm

carpelles

endocarpe

endocarpe
picarpe
msocarpe

Figure 2.28a La tomate


est une baie qui sest
dveloppe partir
dun ovaire compos
de deux carpelles.

limite de la loge
carpellaire
graine
fausse cloison

a
1 cm

36

9782100544141-Laberche.fm Page 37 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

picarpe
endocarpe
msocarpe

carpelles
poches scrtrices

1 cm

graines

Figure 2.28b La baie globuleuse de lorange.

les drupes dont lendocarpe lignifi forme un noyau qui protge les graines
appeles aussi amandes : la cerise (cf. fig. 2.23).

b) Les pseudo-fruits ou faux fruits

Dunod La photocopie non autorise est un dlit.

La pomme est lexemple classique de pseudo-fruit. Elle comporte (fig. 2.24) 5 loges
centrales, aux parois membraneuses, qui contiennent chacune deux graines (les ppins).
La partie charnue peut tre comprise de diverses manires suivant linterprtation que
lon donne aux limites de lovaire infre. La paroi membraneuse des loges reprsente lendocarpe tandis que la partie charnue serait pour partie dorigine pricarpique
et pour partie dorigine rceptaculaire. Pour dautres auteurs, la paroi membraneuse
des loges correspondrait la totalit du carpelle.
Il existe bien dautres pseudo-fruits. Le fruit des rosiers, le cynorrhodon, est dun
type analogue celui du pommier, except le fait que les carpelles sont libres au fond
de la coupelle. Chez le fraisier (fig. 2.29) la partie charnue est dorigine rceptaculaire
ptale
tamine

aknes

stigmate

ovaire
graine

rceptacle
spale

rceptacle
charnu

pdoncule
1 cm

1 cm

0,2 mm

a la fleur

b la fraise

c akne

Figure 2.29 Le fraisier.


a, coupe longitudinale de la eur ; b, coupe longitudinale du fruit ; c, dtail
dun akne.

37

9782100544141-Laberche.fm Page 38 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

et les fruits sont les aknes disposs dessus selon des spirales gnratrices rappelant
les spirales phyllotaxiques.

c) Les fruits composs


La liste des fruits ne serait pas complte sans les fruits composs, qui sont des ensembles
auxquels participe lensemble des fleurs dune inflorescence. Chez la figue (fig. 2.30)
cest le rceptacle de linflorescence qui est charnu et creux. Les fruits sont des
aknes disposs lintrieur. Lananas est la coalescence des baies, des bractes et
de laxe dune inflorescence.
fleurs mles
stigmate
style
fleurs femelles
calice

ovaire

fleur femelle
1 mm

rceptacle charnu et creux


1 cm

Figure 2.30 Le figuier.


a, dtail de lune des eurs femelles ; b, coupe longitudinale du fruit (la gure est
lhomologue dun capitule invagin).

Une autre classification des fruits est souvent prsente. Elle privilgie les types
dorganisation des fruits et non plus le dveloppement du rceptacle. Il est ainsi
possible de distinguer suivant la disposition et le dveloppement des carpelles les
fruits simples, multiples et composs. Des divisions secondaires sont faites. Ainsi, il
y a les fruits secs et dautres qui sont charnus ; des fruits dhiscents ou indhiscents ;
des fruits oligospermes une graine et des fruits polyspermes plusieurs graines.
Cest en combinant ces diffrents caractres que les Botanistes ont tabli la classification prsente dans le tableau 2.1. Cette classification nest pas nouvelle. Elle
reprend et complte celles dj cites par Richard en 1852, dans ses Nouveaux
lments de botanique et de physiologie vgtale ou par Guillermond et Mangenot
en 1941 dans leur Prcis de biologie vgtale . Dun usage beaucoup moins facile
que la classification base sur la notion de vrai et de faux fruit, elle est effectivement
beaucoup plus prcise mais combien plus sotrique quant au vocabulaire utilis.

38

9782100544141-Laberche.fm Page 39 Jeudi, 4. fvrier 2010 3:47 15

2.1 La description dune plante cormus

Tableau2.1 Les diffrents types de fruits


Types de fruit

Description

Exemples

Fruits simples
Fruits simples
charnus
Baie

Fruit simple, charnu, gnralement


indhiscent, ayant une ou plusieurs
graines.

Raisin, datte, aubergine,


kaki, tomate, poivre vert,
myrtille groseille
maquereau, goyave,
banane

Hespride

Baie polysperme ; le pricarpe a laspect


de cuir et est parsem de poches
essence.

Tous les agrumes tels


que : orange citron,
pamplemousse

Pponide

Baie norme enveloppe coriace

Citrouille, concombre,
courge, melon, pastque

Piridion

Fruit intermdiaire entre la baie et


la drupe ; la majeure partie du fruit
(msocarpe) provient pour partie
du rceptacle oral, pour partie
des carpelles.

Poire, pomme

Drupe

Graine unique entoure dun endocarpe


sclri gnralement appel noyau.
Le msocarpe et lexocarpe sont
gnralement charnus ou breux.

Olive, pche, amande,


cerise, prune, abricot,
noix de coco

Follicule

Fruit constitu dun seul carpelle,


souvrant le long dune seule suture
lorsque les graines mres sont prtes
tre libres.

Ancolie, pivoine,
magnolia

Gousse

Fruit une seule loge, qui souvre en deux


valves dont chacune porte une range
de graines.

Pois, fve, arachide,


haricot

Silique

Fruit de la grande famille des Fabaceae.


Les graines peuvent provenir dun ovaire
commun ou de loges spares.

Chou, cresson, radis

Capsule

Fruit au moins trois fois plus long que


large, form de deux valves spares
par une cloison portant les graines.

Pavot, iris, muier,


orchide

Pyxide

Fruit ayant deux carpelles ou plus,


qui se sparent de diffrentes faons
maturit : souvent le long des marges
des carpelles, ou par une fente
transversale ce qui dlimite une sorte
de couvercle qui se soulve maturit,
ou encore par des pores.

Amarante

Dunod La photocopie non autorise est un dlit.

Fruits simples,
dhiscents secs

39

9782100544141-Laberche.fm Page 40 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Tableau2.1 Les diffrents types de fruits (suite)


Types de fruit

Description

Exemples

Fruits simples,
indhiscents secs
Akne
(sensu stricto)

Fruit simple uniloculaire souvrant par


une scissure (fente) circulaire en deux
valves superposes formant une sorte
dopercule (couvercle).

Tournesol, renoncule,
fraise

Samare

Petit fruit une seule graine, dont


le pricarpe est de consistance
membraneuse ; la graine unique
est attache au pricarpe seulement
par sa base.

rable, orme, frne

Nucule

Fruit sec, indhiscent, une ou deux


graines, dont le pricarpe porte une
excroissance en forme daile qui facilite
la dispersion par le vent.

Noisette, gland du chne,


chtaigne

Caryopse

Fruit graine unique, dont le pricarpe


est troitement uni au tgument de la
graine quil entoure.

Caractrise les Poaceae


telles que bl, mas et riz

Schizocarpe

Fruits provenant dovaires carpelles


souds dont chaque loge se transforme
en un akne qui, maturit, se spare
en loges monospermes.

Familles des Asteraceae,


Rubiaceae, Lamiaceae,
Borraginaceae, Malvaceae

Fruits multiples
Fruits polycarps

Fruits produits partir dune eur


plusieurs carpelles.

Mre (roncier), framboise

Fruits composs
Fruits
synanthocarps

2.2 LES

Fruits forms par la fusion des carpelles


de plusieurs eurs sur un rceptacle
commun.

Ananas, mre (mrier),


gue

PLANTES THALLE

Mme si dans notre subconscient le terme de plante voque une plante fleurs,
lensemble des vgtaux ne se limite pas seulement eux. Lappareil vgtatif des
algues, des champignons et des lichens, est un thalle, do leur nom de Thallophytes.
Ils ont des structures varies quil faut savoir dcrire.

2.2.1 Organisation des thalles des algues


Les thalles des algues sont uni- ou pluricellulaires. En effet, certains peuvent avoir
des dimensions trs respectables, comme les laminaires. Ils appartiennent trois grands
types dorganisation.
40

9782100544141-Laberche.fm Page 41 Jeudi, 4. fvrier 2010 3:47 15

2.2 Les plantes thalle

a) Les archthalles
Ce sont des thalles constitus dune cellule unique, ou de cellules semblables entre
elles qui se divisent par bipartition ou se transforment en cellules reproductrices. Il
sagit essentiellement dalgues unicellulaires (libres ou en colonies) et plus rarement
des thalles massifs de petite taille (fig. 2.31).
flagelle

a
stigma

chloroplaste

noyau
flagelle
noyau

chloroplaste

b
paramylon
0,1 mm

0,05 mm

Figure 2.31 Exemples darchthalles.


a, leuglne ; b, synura. (Daprs Gorenot.)

Dunod La photocopie non autorise est un dlit.

b) Les nmatothalles
Il sagit de thalles constitus dun ensemble de filaments ramifis. Ils proviennent
dun archthalle qui met des filaments rampants sur lesquels se dveloppent des
filaments dresss porteurs dorganes reproducteurs. Le thalle peut ne pas conserver
son aspect filamenteux. Des filaments comportent plusieurs files de cellules et
lensemble peut prendre un aspect de lame comme chez la laitue de mer : lulve.

c) Les cladothalles
Ils constituent incontestablement un plus grand degr de complexit. Les filaments se
ramifient pour donner des cladomes. Larchitecture dun thalle clamodien prfigure
la tige feuille des Cormophytes. Plusieurs types de cladomes peuvent tre observs.
Certains comme celui de la dlessria prsente une analogie de forme surprenante
avec une feuille darbre.
41

9782100544141-Laberche.fm Page 42 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

2.2.2 Organisation du thalle des champignons


Aux nmatho- et cladothalles des algues, chez les champignons correspond un
myclium constitu par lenchevtrement de nombreux filaments ramifis.
Ils sont de deux types.
Cnocytiques, quand les filaments ne sont pas cloisonns. Tous les noyaux sont
rpartis dans les filaments. Les filaments sont des siphons.
Cloisonns, quand chaque cellule est bien dlimite par une cloison. Les filaments
sont des hyphes.
Un champignon insecticide
Les invasions de criquets plerins (Schistocerca gregaria Forsskl, Acrididae), qui
dvorent toute la vgtation sur leur passage sont une calamit en Afrique de lEst
et mridionale. De par le nombre considrable dindividus constituant un essaim
en dplacement, une concentration de taille moyenne mange autant en une journe
que lquivalent de 2 500 personnes environ. Autrement dit, le passage des criquets
est synonyme de cultures ravages et de famines dans des rgions o la situation
alimentaire est souvent dj trs difcile. Pour lutter contre ces prdateurs, le
recours des pulvrisations massives de pesticides est quasiment systmatique.
Si les rsultats demeurent frquemment perfectibles, les pesticides causent galement des dgts chez dautres insectes, tels que les pollinisateurs, dont le rle est
essentiel quant au volume des rcoltes. De mme, les tudes scientiques sur le
sujet, dnoncent depuis longtemps leffet non-ngligeable de ces pratiques sur les
ennemis naturels des criquets et les hommes. Depuis quelques annes, les
responsables de la lutte anti-acridienne testent des traitements alternatifs sans
substances chimiques. Ainsi, lpandage de spores du champignon Metarhizium
anisopliae (Metchnikoff) Sorokin, Clavicipitaceae (Green Muscle, un champignon
qui pousse naturellement dans les sols travers le monde et cause des maladies
chez une gamme varie dinsectes en agissant comme un parasite, champignon
entomopathogne) a t men avec succs sur prs de 10 000 hectares de Tanzanie.
Le succs rencontr devrait, lavenir, ouvrir les portes dun large recours cette
prparation.
Daprs Invasion de criquets : succs dun insecticide biologique grande chelle par Pascal
Farcy, Univers-nature du 29-06-2009.

Par rapport aux algues, les champignons ont aussi des thalles bourgeonnants,
comme chez la levure de bire. Elle bourgeonne quand sa croissance est rapide. Les
diffrents lments ainsi forms sapparentent un filament en chapelet trs fragile
qui par sparation peut redonner un nouveau filament. La reproduction des algues et
des champignons est gnralement discrte, cest pourquoi les lments qui interviennent ne seront pas dcrits ici, mais dans le chapitre concernant la reproduction.
Remarquons cependant que ce que chacun appelle champignon est en ralit le
carpophore (cf. fig. 2.1) constitu dhyphes accols, et qui porte les fructifications
la face infrieure du chapeau.
42

9782100544141-Laberche.fm Page 43 Jeudi, 4. fvrier 2010 3:47 15

2.2 Les plantes thalle

2.2.3 Organisation des lichens


Les lichens rsultent de lassociation (fig. 2.32) entre une algue (bleue, rarement
verte) et un champignon, le plus souvent, asques.
zone suprieure
filaments souds
algue

hyphes du champignon

zone infrieure
filaments souds
0,1 mm

Figure 2.32 Structure htrogne chez un lichen foliac.

Dunod La photocopie non autorise est un dlit.

Les thalles des lichens ne sont pas de simples enchevtrements dhyphes fongiques
et de cellules dalgues. Ils se rpartissent en plusieurs catgories (fig. 2.33).
Les thalles fructiculeux ou buissonnants. Ce sont ceux que lon remarque le plus
souvent, car ils donnent des touffes pendantes ou dresses dassez grandes dimensions. Ils sont constitus, soit de tiges cylindriques plus ou moins ramifies, soit
de lames entires ou divises.
Les thalles foliacs sont forms de lames plus ou moins divises en lobes appliqus
au support qui les porte. Ils sont fixs par des crampons.
Les thalles squamuleux sont constitus par des cailles qui adhrent au substrat
par toute leur face infrieure, sauf sur les bords.

1 cm

1 cm

1 cm

a. Ramalina prascinea

b. Umbilicania pustulata

c. Esora decipieus

Figure 2.33 Quelques types de thalles de lichens.


a, fructiculeux ; b, foliac ; c, squamuleux. (Daprs Souchon, simpli.)

43

9782100544141-Laberche.fm Page 44 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 2 Savoir dcrire un vgtal

Les thalles crustacs sont troitement appliqus au support et font corps avec lui.
Les thalles glatineux sont noirtres, rigides et opaques quand ils sont secs. Ils
gonflent en masses glatineuses sombres mais translucides sous linfluence de
lhumidit.
Les thalles complexes sont forms de touffes dresses simples ou ramifies portes
par un thalle foliac, squamuleux ou crustac.
Racine, tige, feuille, fleur, fruit, thalle, la variabilit entre les diffrentes formes est
immense, surtout que prs de 300 000 plantes ont t recenses sur notre terre. Il va
falloir dabord savoir les nommer puis aussi les classer en runissant par commodit,
les plantes semblables. Ceci fera lobjet du chapitre suivant.

Rsum

Dcrire les vgtaux ncessite la connaissance dun vocabulaire prcis. Les


Cormophytes, les plus frquentes, sont constitues de tiges, de feuilles, de racines. Si lorganisation thorique est relativement simple, elle recouvre en ralit
de trs nombreuses variantes aussi bien dans les formes que dans les fonctions.
La reproduction chez les plantes fleurs, se fait dans les fleurs comprenant
classiquement quatre verticilles de pices : les spales forment le calice et les
ptales la corolle, landroce est constitu des tamines et le gynce est
compos de lovaire. Ce dernier est form de carpelles dans lesquels se trouvent
les ovules. Aprs fcondation, lovule donne la graine et lovaire le fruit. Quand
seul lovaire se dveloppe, cest un vrai fruit, quand le rceptacle crot aussi,
cest un pseudo-fruit.
Chez les Thallophytes lappareil vgtatif est constitu de cellules isoles ou
plus frquemment dhyphes pouvant tre cnocytiques ou cloisonns.

44

9782100544141-Laberche.fm Page 45 Jeudi, 4. fvrier 2010 3:47 15

COMMENT SAPPELLE
CETTE PLANTE?
QUELLE EST SA PARENT?
QUELLE EST
SON HISTOIRE?

La nomenclature vgtale a pour but de nommer et de dsigner les innombrables


plantes qui poussent la surface du globe, mais aussi de les rassembler en groupes plus
ou moins vastes, mettant en vidence leurs caractres communs, leurs ressemblances
ou leurs diffrences.
Les premires classifications ont t tablies sur des bases purement morphologiques.
Ltude de lanatomie, des phnomnes de reproduction, et plus rcemment les
caractres biochimiques et molculaires, ne sont venus que bien plus tard et nont fait,
le plus souvent, que confirmer les premires classifications. Ceci apporte quelque
confiance dans les systmes actuels.

3.1 LA

CLASSIFICATION DES PLANTES EN


JUSQU LINN

EUROPE

Dunod La photocopie non autorise est un dlit.

Bien peu de choses nous sont parvenues des uvres de Thophraste (IV e sicle av. J.-C.),
ou de Dioscoride (mdecin grec du Ier sicle). Pourtant, ils connaissaient quelques
centaines de plantes quils divisaient simplement en arbres, arbustes et herbes.
Au temps des Grecs
Thophraste, lve dAristote est lauteur dune Histoire des Plantes, dans laquelle
il traitait des plantes des rivires, des marais et des lacs, spcialement en gypte.
Il mettait prot les expditions de son Matre et ami, Alexandre le Grand. Le
Trait Sur la Matire Mdicale de Dioscoride, nous est seulement connu par les copies
successives qui en furent faites comme le Codex Lutetianus datant du IXe sicle.

La botanique moderne date de la Renaissance. Les premiers botanistes descripteurs


comme Brunfels (Herbarum Vivae Eicones, 1530), Fuchs (De Herboria Stirpium,
1532), tablirent les catalogues descriptifs des plantes cultives ou connues dans leurs
pays respectifs. Ils grouprent ensemble les plantes qui leur paraissaient voisines et
45

9782100544141-Laberche.fm Page 46 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

constiturent souvent lbauche des premires familles vgtales comme les Ombellifres, les Composes, les Lamiaces ou les Lgumineuses. Pendant le XVIIe sicle,
les progrs de la botanique gnrale, lemploi du microscope, la dcouverte de la
sexualit des fleurs et du rle de leurs diverses parties amenrent de rapides progrs
dans les classifications. LAnglais John Ray (1623-1703) difie la premire classification dallure moderne, base sur le nombre de cotyldons de la graine. Cest de lui que
date la distinction entre Monocotyldones et Dicotyldones. Au XVIIIe sicle, au milieu
des hommes minents dont les travaux et les dcouvertes ont amen la botanique
ltat o la voyons aujourdhui, trois dentre eux se distinguent.
Tournefort, n Aix-en-Provence, le 5 juin 1656 a eu le mrite de tracer avec une
admirable prcision les caractres de toutes les plantes connues cette poque.
Linn peut tre considr, juste titre, comme le fondateur de la botanique moderne.
N Roeshult, en Sude, le 23 mai 1707, il prcisa les caractres des plantes et
donna les moyens de les reconnatre et de les identifier grce un systme binaire
dappellation. Enfin Jussieu, ou plus exactement les Jussieu, puisquil sagit de Bernard
de Jussieu et de son frre Laurent fondrent la mthode des familles naturelles. Elle
est toujours applique la botanique mais aussi toutes les branches des sciences
naturelles.

3.2 LA

HIRARCHIE BOTANIQUE ET SA NOMENCLATURE

Les premiers botanistes dsignaient les plantes soit par leur nom populaire (on dit
aussi vernaculaire), ou alors par une suite de mots latins difficilement utilisables
quand il faut classer, ou mme seulement rpertorier, un grand nombre de plantes.
Progressivement des repres hirarchiques ont t employs. Il est indispensable de
les connatre avant daborder un systme de classification.

3.2.1 Lindividu
Le nom dindividu sapplique chaque tre distinct formant un tout et que lon ne
peut diviser sans lui faire perdre une partie de ses caractres et de ses proprits.
Ainsi dans un champ de tabac, dans un champ de trfle blanc chaque pied de tabac
ou de trfle est un individu.

3.2.2 Lespce
Lespce est lensemble de tous les individus qui ont sensiblement les mmes caractres. Tous les individus qui la composent peuvent se fconder mutuellement et donner
naissance une suite dindividus se reproduisant dans les mmes conditions. Tous
les individus dun champ de trfle blanc appartiennent lespce trfle rampant. Les
individus qui composent une espce prsentent ordinairement les mmes caractres
essentiels. Des diffrences mineures (couleur, pilosit) naltrent pas les caractres
essentiels. On parle alors de varits. Ce terme est trs utilis en agriculture.
46

9782100544141-Laberche.fm Page 47 Jeudi, 4. fvrier 2010 3:47 15

3.2 La hirarchie botanique et sa nomenclature

Histoire du tabac
Christophe Colomb, en 1493, son retour des Antilles, introduisit en Europe une
espce de tabac ( priser), qui est lorigine des varits industrielles (tabac brun,
blond et tabac Burley) qui ont t obtenues par slection lintrieur de cette
espce originelle. Cest une autre espce plus rustique abandonne actuellement
en Europe, que Nicot aurait introduite dans notre pays en 1560. Ces deux espces
de tabac, font partie des 67 espces de tabac actuellement connues et dont certaines sont cultives pour la dcoration orale. Ensemble, elles forment le genre
tabac qui appartient la famille des Solanaceae. Les tomates, les aubergines, les
poivrons, les pommes de terre et les ptunias appartiennent aussi la famille des
Solanaceae.

3.2.3 Le genre

Dunod La photocopie non autorise est un dlit.

De mme que la runion des individus forme lespce, les diffrentes espces qui ont
entre elles une ressemblance vidente constituent le genre. Lespce trfle des prs
de couleur rouge (fig. 3.1b), ainsi que lespce trfle rampant (fig. 3.1a) appartiennent
toutes deux au genre trfle.

1 cm
1 cm

Figure 3.1 Deux genres de lespce Trfle.


a, le tre rampant ; b, le tre des prs.

47

9782100544141-Laberche.fm Page 48 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

3.2.4 La famille
Les biologistes regroupent dans une famille toutes les espces ayant un certain
nombre de caractres communs comme par exemple la forme des fleurs. Les trfles,
les pois, les fves se ressemblent aussi bien dans leur morphologie que dans la forme
de leurs fleurs. Ils appartiennent la famille des Fabaceae.

3.2.5 Les catgories suprieures


Les familles proches les unes des autres sont groupes en ordre, les ordres proches
en classes, elles-mmes assembles en divisions (appeles aussi phylum) avec la
possibilit de crer des sous-divisions, des sur-ordres, des sous-ordres, des sousphylums, etc. Lensemble des divisions constitue le rgne vgtal.
Cette hirarchie tant universellement reconnue et adopte par les biologistes, la
ncessit de fixer indiscutablement les noms a entran ladoption de rgles de
nomenclature. Le premier texte date de 1867, puis rgulirement les lois sont
ractualises. Selon les prescriptions de lInternational Code of Botanical Nomenclature adoptes en juillet 2005 au XVIIe Congrs international de botanique Vienne,
tous les noms utiliss doivent tre en latin et la terminaison doit correspondre un
niveau hirarchique. Le trfle rampant blanc doit dornavant scrire :
Rgne :
Sous-rgne :
Embranchement :
Sous-embranchement :
Classe :
Ordre :
Famille :
Genre :
Espce :

Eucaryotae
Plantae
Spermatophyta
Magnoliophytina (ex. : Angiospermae)
Magnolitae
Fabales
Fabaceae
Trifolium
repens

Heureusement les anciennes dnominations comme Angiospermae, voire Angiospermes pour Magnoliophytina, Dicotyldones pour Magnolitae, Fabaces (ex
Papilionaces) pour Fabaceae sont encore tolres pour lusage local.
Le poids des traditions
Il est encore tolr que huit familles portent des noms plus traditionnels :
Compositeae = Asteraceae,
Crucifereae = Brassicaceae,
Gramineae = Poaceae,
Labiateae = Lamiaceae,
Umbellifereae = Apiaceae,
Guttifereae = Clusiaceae,
Palmeae = Arecaceae,
Leguminoseae = Fabaceae
48

9782100544141-Laberche.fm Page 49 Jeudi, 4. fvrier 2010 3:47 15

3.3 La nomenclature binaire de Linn

Il en sera parfois, fait usage dans cet ouvrage, mais dans les publications internationales le code doit tre adopt. La typographie latine est obligatoire, quel que
soit lalphabet utilis dans le reste des crits.
La nomenclature horticole a des rgles de nomenclature aussi codifies
1.
2.
3.
4.
5.
6.
7.

Les formes cultives sont les cultivars.


Une plante hybride est prcde du signe .
Une plante chimre du signe +.
Les noms des cultivars sont tirs des langues vivantes et non du latin.
Le nom scrit avec une initiale capitale.
Le nom est signal par des simples.
Il scrit en lettres droites.

3.2.6 Le taxon
Cette classification en espce, genre, famille parat simple, mais devant la diversit
du monde vivant, bon nombre de naturalistes, dans un souci initialement louable de
prcision, ont pris lhabitude de subdiviser les familles en sous-familles, les varits
en sous-varits, il devient parfois bien difficile de sy retrouver. Cest pourquoi a
t introduite voici quelques annes, la notion de taxa (singulier taxon). Cest
lunit occupant un rang dfini dans la classification. Elle prsente lavantage de ne
pas prciser le niveau o lon se trouve. Toujours pour le commun trfle rampant on
parlera du taxon des Fabaceae ou du taxon des trfles.

Dunod La photocopie non autorise est un dlit.

3.3 LA

NOMENCLATURE BINAIRE DE

LINN

Le grand mrite de Carl von Linn, professeur de botanique Uppsala en Sude, fut
de donner pour chaque plante une nomenclature binaire base sur le nom de genre et
despce. Elle a t publie le 1er mai 1753, dans son ouvrage Species Plantarum .
Cette classification est universellement utilise aussi bien dans le monde vgtal
quanimal.
Chaque genre est dsign par un nom particulier qui reste le mme pour toutes les
espces quil runit. Chaque espce dun genre se distingue des autres par un second
nom ajout au genre.
La nomenclature binaire: une simplification
Le tre blanc (nom vernaculaire) appel Tre rampant (Trifolium repens L.) par
Linn en 1753, tait nomm Trifolium pratense album par Tournefort en 1700, et
Trifolium caule repente, spicis depressis, siliquis tetraspermis par Haller en 1732.

Ainsi toutes les espces de chnes, formant le genre Chne, sont dnommes
universellement par Quercus (notez le Q majuscule). Mais chaque espce de ce
genre a un nom spcifique ajout au premier. Ainsi le chne pdoncul sappellera
Quercus pedonculata (avec un p minuscule), le chne vert : Quercus ilex, le chne
lige : Quercus suber.
49

9782100544141-Laberche.fm Page 50 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

Lorigine des noms latins


Le nom de genre correspond bien souvent aux noms quils portent dans la langue
latine : Quercus (chne), Pinus (pin), Prunus (prunier), Rosa (rose) ou Triticum (bl).
Le nom despce exprime souvent un caractre saillant : repens (rampant), pratense
(des champs), odoratum (odorant), moins quil ne soit forg de toutes pices
par le botaniste qui le premier a dcrit cette espce et qui veut honorer sa
famille ou un botaniste clbre ou un(e) ami(e). La rose Rosa serani Viviani, a t
dcrite en 1824 par Viviani et ddie Srani, botaniste italien.

Ces noms spcifiques sont souvent dorigine latine ou latinise. Ceci leur confre
luniversalit et explique quils soient crits soit en italique, soit souligns, rgles
typographiques habituelles quand on utilise en franais un mot dorigine trangre.
ces deux noms de genre et despce, on ajoute traditionnellement les initiales du
botaniste qui a dcrit cette espce. Le plus clbre est incontestablement Linn, ce
qui fait que bien des noms de plantes sont suivis de L. ; dans les flores les plus rcentes
on dnombre plus de 300 initiales. Ainsi, chez les pins qui appartiennent la famille
des Abietineceae, Pinus silvestris L. correspond au pin sylvestre dcrit par Linn, et
Pinus maritima Lam. au pin maritime dcrit par Lamarck (1744-1829). Dans un texte
crit, il est dusage de ne donner le nom dauteur que lors de la premire citation.
Quelques botanistes ayant dcrit des espces
DC.
Fr.
Jacq.
Juss. A
K.Koch
L.
LHrit.
Lam.
Mill.
Poepp.

Augustin Pyrame de Candolle, botaniste suisse (1778-1841)


Elias Magnus Fries, botaniste sudois (1794-1878)
Nikolaus Joseph von Jacquin, botaniste nerlandais, (1727-1817)
Antoine Laurent de Jussieu, naturaliste franais (1748-1836)
Karl Koch, botaniste allemand (1809-1879)
Karl Linn, naturaliste sudois (1707-1778 )
Charles-Louis lHritier de Brutelle, naturaliste franais (1746-1800)
Jean-Baptiste Monnet, chevalier de Lamarck naturaliste franais
(1744-1829)
Philip Miller botaniste dorigine cossaise, (1691-1771)
Eduard Friedrich Poeppig, naturaliste allemand (1798-1868)

Rchb.
Thunb.
Tourn.
Trin.

Heinrich Gottlieb Ludwig Reichenbach, naturaliste allemand (1793-1879)


Carl Peter Thunberg, naturaliste sudois (1743-1828)
Joseph Pitton de Tournefort, naturaliste franais (1656-1708)
Carl Bernhard von Trinius, naturaliste allemand (1778-1844)

On retrouvera la liste des abrviations dauteur en taxinomie vgtale sur le site :


http://fr.wikipedia.org/wiki/Liste_des_abr%C3%A9viations_d%27auteur_en_taxinomie_
v%C3%A9g%C3%A9tale#L

3.4 LES

CLASSIFICATIONS VGTALES

Ds les temps les plus anciens, les savants ont cherch classer les plantes. Tout
naturellement, ce sont des caractres faciles observer qui servirent dabord de clefs
de classement. Les classifications de Tournefort, Linn et de Jussieu sont les plus
50

9782100544141-Laberche.fm Page 51 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

connues. partir du XIXe sicle, simultanment aux dbats sur les notions dvolution,
les naturalistes ont tent dtablir les enchanements des groupes en allant des plus
primitifs aux plus volus. Il sagit alors de classifications phylogntiques. Science
dobservation, la taxonomie (science de la classification des taxons) a aussi fait
appel la palontologie (science de ltude des fossiles) pour retrouver des anctres
parfois disparus. Actuellement, elle fait aussi appel aux techniques les plus modernes
de biologie molculaire (analyse des protines et des acides nucliques) pour prciser
les liens de parent entre les diffrents groupes de plantes. Les classifications se
modifient rapidement. Cest une consquence de limportant travail scientifique
effectu mais aussi de la complexit du problme vouloir systmatiquement classer
la nature dans des petites botes . Dans le cadre de cet ouvrage quelques classifications seront voques. Mme si, intellectuellement, les classifications phylogntiques
sont plus satisfaisantes pour lesprit, ce sont les classifications naturelles beaucoup
plus didactiques, malgr leurs imprcisions, qui servent de fil conducteur dans
lapproche de la biologie vgtale.

3.4.1 Les classifications naturelles


Tableau 3.1 Classification (simplifie) de Tournefort
daprs Le Maout, 1846 (la terminologie prsente est celle du XIXe sicle).
Classes
rgulires
monoptales
Irrgulires

simples
rgulires

ptales

polyptales

herbes

Dunod La photocopie non autorise est un dlit.

Infundibuliformes

Liseron

PERSONNES

Muier

LABIES

Sauge

CRUCIFORMES

Giroe

ROSACES

Fraisier

OMBELLIFRES

Carotte

CARYOPHYLLES

illet

LILIACES

Tulipe

PAPILIONACES

Pois

ANOMALES

Violette

12

FLOSCULEUSES

Chardon

13

SEMI-FLOSCULEUSES

Pissenlit

14

RADIES

Pquerette

15

TAMINES

Avoine

16

SANS FLEURS

Fougres

17

SANS FLEURS NI FRUIT

Champignons

18

APTALES

Laurier

19

AMENTACES

Saule

20

MONOPTALES

Sureau

rgulires

21

ROSACES

Cerisier

irrgulires

22

PAPILIONACES

Robinier

composes

aptales

aptales
monoptales
polyptales

Belladone

10

eurs

ptales

CAMPANIFORMES

11

irrgulires

arbres

Exemples

51

9782100544141-Laberche.fm Page 52 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

La classification des plantes tablie par Tournefort en 1693 se base sur la consistance
de la tige, sur la prsence ou labsence de corolle (et pour lui toute enveloppe florale
non verte est une corolle), sur lisolement ou lagglomration des fleurs et sur la forme
des ptales. Cette mthode comprenant 10 000 espces tait fonde sur la partie la
plus saillante de la plante, donc facile pratiquer et comprendre (tabl. 3.1). Elle
obtint immdiatement un succs universel, mais trs vite laugmentation des espces
connues, dont un grand nombre ne pouvait entrer dans aucune de ses classes, la
faite tomber en dsutude.
Le systme de Linn, qui parut quarante deux ans aprs celui de Tournefort date
de 1735. Il tait essentiellement fond sur les modifications varies que peuvent
prsenter les organes sexuels, tamines et carpelles. Suivant la philosophie des
poques antrieures (priode grecque, loi salique) Linn donnait dans le choix des
critres de classification, la priorit au sexe mle (tabl. 3.2).
Tableau 3.2 Clef du systme de classification de Linn.
(Daprs Le Maout, 1846, simplifi.)
Classes
1 tamine

MONANDRIE

Centranthe

2 tamines

DIANDRIE

Vronique

3 tamines

TRIANDRIE

Iris

4 tamines

TRANDRIE

Plantain

5 tamines

PTANDRIE

Mouron

6 tamines

HEXANDRIE

Lis

7 tamines

HEPTANDRIE

Marronnier

8 tamines

OCTANDRIE

pilobe

9 tamines

ENNANDRIE

Laurier

10 tamines

10

DCANDRIE

illet

11 19 tamines

11

DODCANDRIE

Joubarbe

+ 20 sur calice

12

ICOSANDRIE

Fraisier

+ 20 sur rceptacle

13

POLYANDRIE

Renoncule

4 dont 2 longues

14

DIDYNAMIE

Muier

6 dont 2 longues

15

TTRADYNAMIE

Giroe

en un corps

16

MONADELPHIE

Mauve

en deux corps

17

DIADELPHIE

Pois

en n corps

18

POLYADELPHIE

Millepertuis

soudes en un cylindre

19

SYNGENSIE

Bleuet

tamines adhrentes au pistil

20

GYNANDRIE

Orchide

eurs sur le mme individu

21

MONOCIE

Arum

eurs sur deux individus diffrents

22

DIOCIE

Urtica

eurs sur un ou plusieurs individus

23

POLYGAMIE

Paritaire

24

CRYPTOGAMIE

Fougre

libres
entre
elles
et gales

prsents sur
la mme
eur
tamines
et pistil

tamines
non
adhrentes
au pistil

visibles

libres et
ingales
soudes
par leurs
lets

prsents sur
des eurs
diffrentes
non visibles

52

Exemples

9782100544141-Laberche.fm Page 53 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

Cette classification qui comprenait 24 classes de plantes na gard quun intrt


historique. Ce systme trs artificiel runissait cte cte loseille et la bruyre, la
carotte et la belladone.
Granium ou plargonium?
En 1753 Linn dcrivait dans le genre Geranium plusieurs espces dont Geranium
robertianum L. et Geranium peltatum L. (le granium lierre). En 1783, le botaniste
LHritier sappuyant sur de nouveaux critres a fragment le genre Geranium et a
cr le genre nouveau Pelargonium o il a inclus Geranium peltatum L. qui depuis
sappelle Pelargonium peltatum (L.) lHrit. (L.) rappelle que prcdemment Linn avait
dcrit cette espce, mais que cest lHritier, LHer., qui en a x les canons actuels.
Dans le langage courant on conserve le nom de granium pour les Pelargonium.
Cest une rminiscence de la botanique de Linn.

Cest en 1789, quAntoine-Laurent de Jussieu prsenta dans son ouvrage Genera


plantarum, la premire classification naturelle des vgtaux. Il tablissait une mthode
runissant en 15 classes des familles vgtales ayant des points communs. Les critres
de classement sont pris dans les organes les plus importants. En premire ligne, il
considrait la structure de lembryon et ensuite la position relative des organes
sexuels entre eux. Les vgtaux ont t diviss en trois grands embranchements : les
Acotyldones auxquelles manque lembryon, les Monocotyldones un cotyldon et les
Dicotyldones deux. Puis une seconde srie de caractres, permet dtablir les classes.
Elle est fonde sur linsertion relative des tamines, ou de la corolle par rapport aux organes femelles de reproduction. Les Dicotyldones tant les plus nombreuses chaque classe
a t subdivise selon le fait que les anthres sont libres ou soudes entre elles (tabl. 3.3).
Tableau 3.3 Classification naturelle de Jussieu. (Daprs Le Maout, 1846, simplifi.)
Classes
Acotyldones
Monocotyldones

Dunod La photocopie non autorise est un dlit.

Fleur
aptale

Dicotyldones

Fleur
monoptale
avec corolle
staminifre

Fleur
polyptale

Exemples

ACOTYLDONES

Champignons

tamines insres sur le rceptacle

MONO-HYPOGYNIE

Avoine

tamines insres sur le calyce*

MONO-PRIGYNIE

Iris

tamines insres sur lovaire

MONO-PIGNIE

Orchide

tamines insres sur lovaire

PISTAMINIE

Aristoloche

tamines insres sur le calyce*

PRISTAMINIE

Rumex

tamines insres sur le rceptacle

HYPOSTAMINIE

Plantain

insre sur le rceptacle

HYPOCOROLLIE

Belladone

insre sur le calyce*

PRICOROLLIE

Campanule

picorollie

10

SYNANTHRIE

Bleuet

picorollie

11

CORISANTHRIE

Sureau

tamines insres sur lovaire

12

PIPTALIE

Carotte

tamines insres sur le calyce*

13

HYPOPTALIE

Renoncule

tamines insres sur le rceptacle

14

PRIPTALIE

Fraisier

15

DICLINE

Ortie

insre sur lovaire

Fleurs stamines et pistilles sur individus diffrents

* En 1846, dans lAtlas lmentaire de Botanique dEmmanuel le Maout, paru chez Fortin et Masson, libraires des Socits savantes
Paris, le calice, partie strile de la eur, est orthographi avec un y.

53

9782100544141-Laberche.fm Page 54 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

Le choix judicieux des critres de classement permit Jussieu de placer les plantes
de manire quelles soient prcdes et suivies de celles qui avaient le plus daffinit.
Il introduisait sciemment ou inconsciemment lide dune progression naturelle entre
les familles, concept la base des classifications phylogntiques actuelles. Cette
classification naturelle et celles qui suivirent comme celle du botaniste suisse De
Candolle (1778-1841) eurent de trs grandes applications pratiques puisquelles sont
la base des flores couramment utilises, depuis les plus simples comme Les noms des
fleurs trouvs par mthode simple de Gaston Bonnier du dbut du XXe sicle, jusqu
la Flore de Marcel Guinochet et Ren de Vilmorin en 5 volumes publie en 1983.
Pourquoi des herbiers?
Lherbier est un outil indispensable aux tudes de systmatique vgtale. Les herbiers
(8 millions dchantillons au Musum national dhistoire naturelle de Paris) servent
de rfrences pour les chercheurs. Ce sont dabord des conservatoires dchantillons
et aussi, des tmoins de lvolution rcente des plantes. Ils constituent des outils
biologiques qui retent les conditions dans lesquelles les plantes ont pouss.

3.4.2 Les classifications phylogntiques


Les classifications actuelles tentent dtablir lenchanement des groupes de plantes
des plus primitifs aux plus volus. Ce sont les classifications phylogntiques. Elles
ont commenc se dvelopper au XIXe sicle ; ainsi ds 1866 Haeckel en Allemagne
proposait une classification o toutes les plantes avaient un anctre commun et en
drivaient par laction de diversifications multiples. Depuis prs de 150 ans les botanistes recherchent une classification universelle devant reflter les ressemblances
entre les espces et rsumer les tapes de lvolution. Pour y arriver, ils se basent sur
des critres morphologiques (comme les classifications naturelles antrieures), mais
aussi sur les rsultats des sciences nouvelles : biochimie, palynologie, taxonomie
exprimentale Depuis le milieu du XXe sicle, plusieurs grandes classifications
phylogntiques ont t proposes. Citons seulement celles de lamricain Arthur
Cronquist de 1988 et du russe Armen Thaktajan de 1997. Loin dtre immuables, les
classifications sont modifies en fonction des progrs des connaissances permettant
de proposer de nouvelles hypothses. Il reste, cependant, de nombreuses difficults
qui proviennent du fait que trs peu de formes actuellement vivantes sont rellement
primitives et qu il arrive que des plantes partagent un caractre qui nest pas d une
parent proche mais un simple convergence volutive. Lutilisation de la biologie
molculaire depuis quelques annes donne aux botanistes une nouvelle mthode de
comparaison entre familles et ordres permettant de prciser plusieurs points encore
obscurs ou imprcis de la classification des vgtaux. Pour construire ces classifications
phylogntiques, les botanistes sappuient sur des critres trs prcis :

a) Importance de la structure cellulaire :


Procaryotes et Eucaryotes
Une importante distinction apporte par les biologistes dans la classification naturelle
fut de distinguer ds la fin du XIXe sicle, que le monde vivant est constitu des
54

9782100544141-Laberche.fm Page 55 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

Procaryotes et des Eucaryotes (du grec karuon = noyau, proto = premier et eu = bien).
Les procaryotes sont des organismes de petite taille, aux cellules dpourvues de
noyaux et dlimites par une membrane. Le plus souvent, ils sont microscopiques, en
majorit unicellulaires. Dans ltat actuel de nos connaissances, on ne connat pas de
reproduction sexue typique mais seulement une multiplication cellulaire correspondant une fission binaire de chaque cellule. A loppos, le groupe des Eucaryotes
rassemble des organismes pour la plupart pluricellulaires et trs diffrents tant par
leur taille et leur forme que par leur complexit structurale. Ils possdent un noyau
vrai, dlimit habituellement par une membrane.
Deux hypothses sur lorigine des Eucaryotes
Selon lhypothse de lorigine autogne, la complexit de la cellule eucaryote
proviendrait de linvagination et de la spcialisation de la membrane plasmique,
tandis que selon lhypothse de lorigine endosymbiotique, la cellule eucaryote
proviendrait dun conglomrat de procaryotes qui ont tabli des relations symbiotiques. Les membranes des mitochondries et des chloroplastes seraient alors des
vestiges des anciens procaryotes.

Dunod La photocopie non autorise est un dlit.

b) Thallophytes et Cormophytes
En se basant sur lorganisation gnrale des vgtaux eucaryotes, les biologistes ont
distingu les Thallophytes et les Cormophytes, dont lappareil vgtatif est respectivement un thalle ou un cormus. Ce dernier est constitu de rameaux feuills tandis
que le premier ne comprend jamais de tiges, de feuilles, de racines et pas de tissus
conducteurs. Il tait donc logique de trouver chez les Thallophytes, les algues et les
champignons. Cette distinction apparemment simple entre le thalle et le cormus
saccompagne de diffrences beaucoup plus importantes au niveau des organes reproducteurs : au moment de la reproduction les Thallophytes eucaryotiques produisent
partir dune cellule mre des spores et des gamtes qui restent lintrieur de la paroi
squelettique de celle-ci en formant un sporocyste ou un gamtocyste. Au contraire
chez les Cormophytes, au cours des premires divisions dune cellule mre une couche
pluricellulaire forme un sac qui contiendra spores et gamtes : le sporange ou le
gamtange (fig. 3.2).
Le gamtange femelle des Cormophytes est larchgone (du grec gon = semence
et arca = coffre) en forme de bouteille. Le ventre est surmont dun col et contient
un seul gamte femelle : loosphre (fig. 3.3). Les Cormophytes sont aussi appeles
des Archgoniates, mme si certaines Cormophytes (les Angiospermes) prsentent
des archgones modifis.
Lensemble des Cormophytes comprend limmense majorit des plantes terrestres.
Pour mieux les dcrire de nombreux biologistes ont introduit des sparations bases
sur des observations morphologiques.
55

9782100544141-Laberche.fm Page 56 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

cellule mre

paroi de
la cellule
mre
sporocyste
gamtocyste

couche
pluricellulaire
sporange
gamtange

THALLOPHYTES

CORMOPHYTES

Figure 3.2 Thallophytes et Cormophytes, diffrences quant aux organes


reproducteurs.
Les Thallophytes produisent des spores et des gamtes qui restent lintrieur de
la paroi squelettique. Chez les Cormophytes, une couche pluricellulaire forme un
sac qui contiendra spores et gamtes. (Daprs Gorenot, modi.)

cellules
du col

col

oosphre

archgone jeune

ventre

Figure 3.3 Larchgone


et loosphre des Cormophytes
(Archgoniates).
(Daprs Feldmann,
in Gorenflot, 1997.)

archgone mr

1. La prsence de racines et de vaisseaux conducteurs caractrise les Rhizophytes.


2. La prsence de fleurs nappartient quaux Phanrogames (de phaneros = visible
et gamos = mariage), les plantes ayant des organes de reproduction moins voyants
tant les Cryptogames (de cryptos = cach),
3. La prsence du carpelle clos ne sobserve que chez les Angiospermes. La feuille
carpellaire ouverte appartient aux Gymnospermes.
4. La prsence de graines dfinit les Spermaphytes.
Plusieurs de ces critres sont redondants entre eux, ce qui ne facilite pas toujours
la comprhension. Nanmoins, traditionnellement en France, on avait lhabitude
jusquaux annes 1960, de classer les vgtaux de la manire suivante (tabl. 3.4) :
56

9782100544141-Laberche.fm Page 57 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

Tableau 3.4 Classification trs utilise en France jusque vers 1960.


(Daprs J.-L. Guignard, simplifie.)
Bactries

Procaryotes
Sans noyau

Cyanophyces
Algues
Thallophytes
Thalle

Champignons
Lichens
Bryophytes

Eucaryotes
Avec noyau

Ptridophytes
Cormophytes
Cormus

Rhizophytes
Racines
Trachophytes

Prspermaphytes
Gymnospermes
Spermaphytes
Graines

Chlamydospermes
Angiospermes

Dunod La photocopie non autorise est un dlit.

Cette classification avait le mrite dtre simple tout en montrant la progression de


la complexit organisationnelle des vgtaux. Elle soulevait cependant des problmes
quant aux limites quil faut donner aux diffrentes classes. Algues et champignons
sont le plus souvent sources de difficults. Ainsi les Myxomyctes (classiquement placs
durant des sicles parmi les champignons, mais parfois aussi considrs comme des
animaux) sont absolument aberrants ; amibodes et mobiles, ils semblent cependant
parfois appartenir au monde vgtal et forment des appareils reproducteurs semblables
ceux que lon trouve chez les fougres (cf. 6.3.2). Plusieurs auteurs les ont donc
spars des autres champignons pour en faire un ensemble distinct. Mais justement, les
champignons sont-ils des vgtaux ? Si on compare un champignon, comme un bolet,
et un plant de bl, le premier est incolore car dpourvu de chlorophylle, alors que le
second est vert, car chlorophyllien. Le champignon est htrotrophe ; il se nourrit de
molcules organiques complexes et le second autotrophe car il synthtise ses molcules
organiques partir deau, danhydride carbonique, de sels minraux et de lumire. Ceci
a amen plusieurs auteurs repenser compltement la classification ; Whittacker en
1969, proposait, ainsi, chez les Eucaryotes trois rgnes distincts : les vgtaux autotrophes, les champignons saprophytes et les animaux pourvus dune fonction digestive.
De la difficult dtablir une classification uniquement
sur des critres morphologiques
Si on observe les euphorbes (plantes trs communes des friches, aux tiges paisses
contenant un latex allergisant) et les cactes (famille des cactus), elles prsentent
toutes deux le caractre de succulence, qui pourrait laisser penser quelles sont apparentes. Il nen est rigoureusement rien puisquelles nappartiennent ni aux mmes
familles botaniques, ni aux mmes ordres. Cette convergence morphologique ou
homologie des formes (certains botanistes parlent aussi dhomoplasie) est une
adaptation commune la scheresse. Une confusion identique pourrait tre faite avec
les cnes de pins et les cnes des aulnes qui prsentent dimportantes ressemblances
physionomiques, ce qui fait que les anciens botanistes avaient classs ces plantes
ensembles bien que les premiers soient des Gymnospermes et les autres des
Angiospermes.
57

9782100544141-Laberche.fm Page 58 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

c) Lapport des nouvelles sciences biologiques


Au milieu du XXe sicle, lapport la botanique de nouvelles sciences permit de faire
voluer les classifications naturelles dfinitivement vers des classifications phylogntiques, qui refltent les tapes de lvolution. Jusque vers les annes 1990, il
sagissait essentiellement des tudes embryologiques (dveloppes par Sougues
vers 1950 et plus rcemment par Lebgue), de la taxonomie exprimentale et numrique
de Guinochet partir des annes 1960, ou de la palobotanique (tude des vgtaux
fossiles) et la palynologie (tude des pollens) mais aussi de la biochimie. La palobotanique a confirm, par exemple, que les Gymnospermes ovules nus sont plus
primitives que les Angiospermes ovules enclos. Ceci ne veut pas dire cependant que
ces dernires drivent directement des premires. Ils viennent danctres communs,
trs anciens, aujourdhui disparus.
Les outils exprimentaux
La taxonomie exprimentale tudie particulirement la plasticit des espces. Les
rsultats obtenus sur leur facilit dadaptation de nouvelles conditions cologiques
naturelles ou exprimentales, ainsi que leurs possibilit de croisement permettent
de rapprocher ou de sparer de nombreux taxons. La palobotanique en sintressant
aux formes anciennes rapproche les maillons manquants dans lenchanement des
groupes les plus primitifs aux plus volus. La biochimie apporte des lments
permettant de prciser les classications phylogntiques, ainsi, chaque genre de
Papaveraceae (comme le coquelicot ou le pavot) sa propre combinaison dalcalodes. De mme, dans le genre Iris, on peut classer les espces daprs leur
composition en glucides et cette classication est bien meilleure que toutes les
classications morphologiques.

Toutes ces informations nouvelles font que la classification des vgtaux a t


continuellement rvise. Aline Raynal-Roques en 1994 a rapport une classification
synoptique du rgne vgtal rajoutant aux critres morphologiques dj admis dans
les classifications naturelles, la composition des pigments (tabl. 3.5).
En analysant ce schma on constate que les divisions proposes constituent des
units taxonomiques reconnues et bien diffrencies depuis de nombreuses annes.
Certaines comprennent un grand nombre de reprsentants, alors que dautres sont
numriquement plus limites. Mais, comme le prcisait Aline Raynal-Roques, ce
qui est important et novateur dans ce tableau, cest que les divisions sont ordonnes
de manire voir progresser la complexit de lorganisation des tres ; on voit apparatre successivement des structures qui sajoutent aux prcdentes, permettant des
stratgies biologiques de plus en plus labores1 .
Ce tableau ne prsente que les grandes divisions ou phylums du rgne vgtal. Il
devient en effet, beaucoup plus difficile de reprsenter une classification allant jusquaux
ordres, voire aux familles surtout quand on sait que des botanistes comme Arthur
Cronquist du jardin botanique de New York de 1957 1988 a chang trois fois sa classification et reconnat dans sa dernire mouture, 321 familles et 64 ordres, tandis quaprs
plus de 50 ans de travail, Armen Takhtajan et son quipe de chercheurs de lAcadmie
1. La botanique redcouverte, Belin/Inra diteurs, 1994, page 98.
58

9782100544141-Laberche.fm Page 59 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

Tableau 3.5 Prsentation synoptique des divisions du rgne vgtal actuel.


(Daprs A. Raynal-Roques, 1994, simplifi.)
Bactries

PROCARYOTES
algues bleues

Cyanobactries

champignons

Oomyctes

champignons

Eumyctes

EUCARYOTES
Pas de chlorophylle

Myxomyctes
Pyrrhophytes

Chlorophylle a + Pigments accessoires

Chrysophytes
Bacillariophytes
algues brunes

Phaeophytes

algues rouges

Rhodophytes

algues jaunes

Xanthophytes

Chlorophylle a + Chlorophylle b
Zygote sans protection

euglnes
algues vertes

Zygote protg par une coque dure (oogone)

Euglnophytes
Chlorophytes
Charophytes

Gamte femelle contenu dans un archgone


pas dappareil vasculaire

mousses

Bryophytes

un appareil vasculaire
sexualit aquatique

Psilophytes

ni eur

Lycophytes

ni graines

Phnophytes
fougres

Ptridophytes

sexualit arienne: gamtophyte femelle dans un ovule


ovules nus, pendus
des organes dans lesquels
ils ne sont pas enferms

Dunod La photocopie non autorise est un dlit.

Ginkyo
Gymnospermes

Cycadophytes
Gntophytes
Ginkophytes
Conifrophytes

ovules enferms dans


un carpelle, eurs, graines
Angiospermes

Anthophytes

des Sciences de Russie Saint-Ptersbourg, proposaient en 1997, 589 familles et


232 ordres ! De ce fait la prsentation des classifications modernes devient complexe
(et le plus souvent partielle) dans la mesure o elles tentent dexprimer la fois les
relations de ressemblance-dissemblance entre les groupes de plantes et leurs relations
phylogntiques. Elles abandonnent souvent la prsentation du tableau aux sections
embotes au profit de larbuste aux multiples ramifications (fig. 3.4).
59

60
Nlumbonales

Ranunculales

Thales

Illiciales

Paoniales

Violales

Magnoliales

Polmoniales

Cornales

Clastrales

Laurales

Piprales
Nymphaales

Aristolochiales
Alismales

Najadales

Hydrocharitales

Fabales

Triuridales

Connarales

Dipsacales

Poales

riocaulales

Cyclanthales

Pandanales

Arcales

Arales

Bromliales

Typhales

Commlinales

Restionales
Juncales

Liliales

Zingibrales

Cyprales

Orchidales

Scrophulariales

Rhamnales
Gentianales
Olales
Iridales

Santalales

Saxifragales
Rafflsiales

Dillniales

Rosales

Npenthales

Sapindales
Rutales

Podosternales

Malvales

Myrtales

Hippuridales

Graniales

Polygalales
Thymlaales
Tamaricales
Protales
Euphorbiales
Capparales
laagnales

Salicales

Campanulales

Lamiales

Il sagit dun arbuste aux branches ramies dont les tiges principales partent dun groupe ancestral, les Magnoliales 0 , les plus grandes
se terminent par les ordres les plus volus comme les Poales (Gramines), les Orchidales (Orchides), ou les Astrales
(Composes), alors que les Fabales (Lgumineuses), moins volues, sont disposes plus bas. (Les chiffres 0 , , , et
permettront de comparer avec la gure suivante.)

Figure 3.4 La classification phylogntique des plantes fleurs de Takhtajan (1996). (Daprs A.Raynal-Roque, 1994, simplifi.)

Euptlales

Papavrales

Sarracniales

Caryophyllales

Thligonales

Plumbaginales

ricales

Polygonales

Trochodendrales

bnales

Diapensiales

Primulales

Hamamlidales

Cercidiphyllales

Didymlales

Eucommiales

Urticales

Barbeyales

Casuarinales

Fagales

Btulales

Balanopales

Myricales

Juglandales

Leitnriales

Cucurbitales
Bgoniales
Passiflorales

3 Astrales
Calycrales

9782100544141-Laberche.fm Page 60 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

9782100544141-Laberche.fm Page 61 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

Larbuste de Takhtajan lavantage dtre trs lisible mais la reprsentation en


deux dimensions peut masquer des relations taxonomiques entre diffrents phylums
et surtout, il est construit sur le postulat que toutes les plantes fleurs ont une mme
origine, ce qui est, bien sr, contest par des botanistes ! Cest pourquoi dautres
classifications gnralement en trois dimensions ont t proposes. Larbuste phylogntique de Dahlgren datant de 1975, est le plus connu (fig. 3.5).

Figure 3.5 Larbuste phylogntique de Dahlgren.

Dunod La photocopie non autorise est un dlit.

(Daprs A.Raynal-Roque, 1994, simplifi.)


Dans cet arbuste, tridimensionnel, laxe vertical exprime le temps et lapparition
progressive dune ramication le long dune branche reprsente la sparation dun
nouveau groupe taxonomique partir dun autre prexistant. Il ny a pas un anctre
commun. La section horizontale en haut du schma, correspond au temps prsent
et reprsente limportance quantitative de ces plantes dans la ore actuelle. Les
chiffres 0 : Magnoliales, : Poales : Orchidales, : Astriales et : Fabales,
permettent de comparer les deux classications phylogniques.

Depuis une dizaine dannes grce aux tudes molculaires, les botanistes
dtiennent une nouvelle mthode dtudes permettant une meilleure comparaison entre
genre, famille et ordre. Elle est base sur la biologie molculaire et particulirement
sur lamplification des gnes par PCR (Polymerase Chain Reaction ou raction en
chane par lADN polymrase). Elle consiste rpliquer de nombreuses fois un
fragment dADN et den tudier ensuite lordre des bases. Pour dterminer la parent
entre deux plantes, il suffit de comparer les squences dun extrait dun mme
gne et de convertir en indices de divergence ou de convergence les diffrences
(fig. 3.6).
61

9782100544141-Laberche.fm Page 62 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

En travaillant sur le gne de la RubisCo situ dans les chloroplastes (cf. 7.3.4)
lquipe de Mark Chase, botaniste anglais du jardin Botanique de Kew, a donn, en
1998, une nouvelle classification des Angiospermes en 462 familles qui maintenant
fait rfrence quelques dtails prs.
Hyacinthus

CGTCTGACGCT TAGGCGGGAAAGGCGCACGACGCGATCCTGCAATATCGT

Polygonatum

ACCC - GGCGCGGTGGGCGCCAAGGAATCACTGCAGTCGGAGAGCGAC - CG

Maianthenum

ACCC - GGCGCGGTGGGCGCCAAGGAA CAGTGCCGTCGGAGAGCG C - CG

Lilium

ACCCCGGCGCGGCCTGCGCCAAGGAA CA TATGTCAGGAG GACGTG

a Squences partielles obtenues par Mugnier et al. (2000) dune rgion non
codante de lADN ribosomique de 4 plantes prcdemment classes dans
lordre des Liliales (Monocotyldones) et leurs nuclotides communs (identies
par les bases). A : adnine, T : Thymine, G : Guanine, C : Cytosine. Les tirets
indique labsence de base et les griss permettent de visualiser les pourcentages
de bases communes aux 4 plantes : A 100 %,
75 %,
50 %.

Ordre

Famille
Hyacinthaceae

Genre
Hyacinthus (la jacinthe)

Asparagales
Maianthemun (le petit muguet)
Convallariaceae
Polygonatum (le sceau de Salomon)

Liliales

Liliaceae

Lilium (le lis)

b Arbre phylogntique (partiel) propos par Mugnier et al. (2000) partir des
squences dADN dcrites en a).

Figure 3.6 Exemple darbre phylogntique obtenu partir des squences


partielles de nuclotides. (Daprs J. Mugnier, modifi et simplifi.)
Les quatre plantes, qui dans les classications anciennes appartenaient toutes
lordre des Liliales ont 11 bases communes, en 5 squences, sur les 50 tudies, ce
qui montre bien leur parent. Les squences du sceau de Salomon et du petit
muguet ne diffrent que de 4 bases (M), ils appartiennent la mme famille des
Convallariaceae ( laquelle appartient aussi le muguet), tandis, qu linverse, les
squences du lis et de la jacinthe prsentant 38 diffrences sur 50 bases compares,
se voient spares dans deux ordres diffrents : les Liliales pour le premier et les
Asparagales pour la seconde.

Ces dernires annes, est de plus en plus utilise (fig. 3.7) la phylognie molculaire,
tudie par lAPG (Angiosperm Phylogenetic Group). Elle reflte les efforts faits en
systmatique pour que le systme de classification des tres vivants reflte au plus
62

9782100544141-Laberche.fm Page 63 Jeudi, 4. fvrier 2010 3:47 15

3.4 Les classifications vgtales

Ordre
Plantes primitives
Cratophyllales
ANCIENNES
DICOTYLDONES

M
O
N
O
C
O
T
Y
L

D
O
N
E
S

Dunod La photocopie non autorise est un dlit.

E
U
D
I
C
O
T
Y
L

D
O
N
E
S

Plantes volues

Nombre
de familles

Exemple
de famille

Exemple
de genre

Amborellaceae

Amborella

Ceratophyllaceae

Myriophyllum

Laurales

Lauraceae

Laurier

Magnoliales

Magnoliaceae

Magnolia

Piprales

Aristolochiaceae

Aristoloche

Acorales

Acoralaceae

Acne odorant
Zoostre

Alismatales

Zoosteraceae

Asparagales

Convallariaceae

Muguet

Dioscorales

Dioscoreaceae

Borderea

Pandanales

Pandanaceae

Pandanus

Liliales

Liliaceae

Lis

Acrales

Aceraceae

rable

Poales

Poaceae

Bl

Commnilales

Commelinaceae

Tradeseantia

Zinizibrales

Cannaceae

Canna

Ranunculacales

Papaveraceae

Coquelicot

Protales

Ranunculaceae

Anmone

Santanales

Santanalaceae

Osyris

Caryophyllales

11

Caryophyllaceae

illet

Saxifragales

Saxifragaceae

Saxifrage

Graniales

Geraniaceae

Granium

Malpighales

Violaceae

Violette

Oxalidales

Oxalidaceae

Oxalis

Fabales

Fabaceae

Tre

Rosales

Rosaceae

Pommier

Cucurbitales

Cucurbitaceae

Courge

Fagales

Fagaceae

Htre

Myrtales

Onagraceae

Onagre

Brassicales

Brassicaceae

Colza

Malvales

Malvaceae

Mauve

Sapindales

Rutaceae

Citronnier

Cornales

Cornaceae

Cornouiller
Bruyre

ricales

Ericaceae

Garryales

Garryaceae

Aucuba

Gentianales

Gentianaceae

Gentiane

Lamiales

Lamiaceae

Lamier

Solananes

Solanaceae

Pomme de terre

Aquifoliales

Aquifoliaceae

Houx

Apiales

Apiaceae

Carotte

Astrales

Asteraceae

Tournesol

Dipsaccales

Valerianaceae

Valriane

Figure 3.7 La classification APG des Angiospermes par Chase en 1998 (simplifie).
Dans cette classication, toutes les Angiospermes drivent dun anctre commun qui
pourrait tre une amborella, de la famille des Amborellaceae. Par souci de simplication pour chaque ordre, une seule famille et un seul genre sont prsents, comme
exemple. On retrouve les anciennes Monocotyldones primitives, tandis que les
Dicotyldones sont spares en anciennes Dicotyldones et en Eudicotyldones plus
volues. Ces dernires ayant au moins trois pores dans les grains de pollen.

63

9782100544141-Laberche.fm Page 64 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

prs la vracit des liens de parent entre les espces, quelles soient actuelles ou
teintes. Cette classification est base en grande partie sur les analyses des gnes codant
pour les chloroplastes et montre que la grande division des Angiospermes (Monocotyldones et Dicotyldones) ne repose plus sur le nombre de feuilles primordiales
(cotyldons) de lembryon, mais sur un critre nouveau : le nombre de pores prsents
sur le grain de pollen. Un pore pour les plantes les plus primitives, trois pores ou plus
pour les plus volues qui portent alors le nom dEudicotyldones (Dicotyldones
vraies).
Elle introduit, mme au niveau des familles, de notables changements avec la classification classique. Ainsi, par exemple, lancienne famille des Liliaces est maintenant
clate en une dizaine de familles et cette classification conduit parfois des regroupements diffrents des classifications prcdentes (le genre Veronica, par exemple,
appartient aux Plantaginaceae dans la classification APG et aux Scrophulariaceae
dans celle de Takhtajan). Reflet dun consensus sur les connaissances acquises lors
de sa publication en 1998, cette classification a t rvise en 2003.
Il est important de noter que si, effectivement, ces classifications molculaires
permettent de prciser la parent entre des plantes, il est faux et parfaitement illusoire
de croire quelles remettent en cause les classifications naturelles prcdentes. Dun
point de vue strictement systmatique, il est incontestable quelles prcisent des
points encore obscurs comme lavaient fait avant elles, la taxonomie exprimentale
ou la palynologie. Ces classifications sont nanmoins particulirement intressantes
pour les gnticiens et les agronomes qui les apprcient dans leurs schmas de slection.
Mais, sur le terrain, ce sont bien toujours les caractres morphologiques qui servent
reconnatre les plantes et les utilisateurs de la biologie molculaire en sont si conscients
quils traduisent les diffrences gntiques quils mettent en vidence par des
critres morphologiques (le nombre de pores dans le grain de pollen, la protection de
lovule, la structure de la corolle ptales souds). Il leur est indispensable de
revenir ces caractres morphologiques sils veulent que leurs rsultats puissent tre
utiliss, dfaut du terrain, au moins dans un laboratoire quip dune loupe binoculaire
ou dun microscope ! Cest la petite revanche des botanistes de terrain que bien des
utilisateurs de la biologie molculaire considrent un peu comme ringards , avec
leur boite prlvements, leur presse, leur pinces fines, leur loupe et leurs multiples
papiers pour scher ou taler leurs chantillons !
Il apparat donc que les systmes de classification changent continuellement ; le
sous rgne des vgtaux a t amput des champignons alors que le nombre de
familles et de genres augmente ou diminue selon les sparations ou les regroupements.
Incontestablement la classification universelle, adopte par tous nexiste pas encore.
Chacun peut donc choisir en fonction de sa formation, de ses affinits scientifiques
ou philosophiques la classification qui lui convient le mieux condition, bien sr, de
le justifier et de le signaler.

64

9782100544141-Laberche.fm Page 65 Jeudi, 4. fvrier 2010 3:47 15

3.5 Lhistoire des vgtaux

La taxonomie a encore de beaux jours devant elle


Lge dor de la dcouverte ne connat pas de dclin. Le bilan 2007 du SOS (State
of Observed Species) annonce 18 516 nouvelles espces dcrites, plus encore quen
2006. Quant celles reconnues en 2008, lInstitut international pour lexploration
des espces de luniversit dArizona vient de rendre publique la liste des dix
espces les plus remarquables. Ainsi, cette institution signale que le plus grand
insecte jamais dcouvert a t dcrit en 2008. Il sagit dun phasme, Phobaeticus
chani, dune longueur totale de plus de 56 cm. Telle une brindille suspendue dans
les forts mlansiennes, il ne stait pas fait remarquer jusqualors.
Le monde vgtal a rserv aussi quelques surprises. Une espce de cafier (Coffea
sp. Rubiaceae) dont les fruits ne contiennent pas de cafine a t trouve au
Cameroun. De quoi imaginer un dcafin un peu plus naturel tandis qu
Madagascar, cest un palmier gant qui a t dcrit, le Tahina spectabilis J.D. Dransf.
& Rakotoarinivo, Arecaceae. Trs rare, cet arbre ne serait reprsent sur lle que
par une petite centaine dindividus. Sa particularit est de eurir au bout de 50 ou
100 ans, avec une inorescence de 5 6 mtres de haut, tant spectaculaire quelle
en est fatale pour larbre. Le palmier ne survit pas, en effet, ses innombrables
eurs.
La systmatique tant animale que vgtale est un vaste royaume inexplor
1,8 million despces vivantes ont t dcrites ce jour mais la diversit du vivant
est estime dans une fourchette allant de dix millions cent millions despces. Il
y a donc du pain sur la planche pour les taxonomistes qui dcouvrent chaque
anne quelque 16 000 nouvelles espces en moyenne.
Daprs Biodiversit : le palmars des nouvelles espces dcouvertes du 29-05-2009 paru dans
Univers-nature.

3.5 LHISTOIRE

DES VGTAUX

Dunod La photocopie non autorise est un dlit.

Les classifications phylogntiques essayant de montrer lvolution des vgtaux, il


est normal de sattarder quelques instants, sur lhistoire des plantes. Fort de toutes les
informations runies depuis des sicles, il est possible den imaginer le droulement
probable (fig. 3.8).
Plusieurs points sont particulirement importants retenir :
La photosynthse

Mme si bien souvent on dfinit une plante par son activit photosynthtique, (cf. 7.3),
il faut savoir que la photosynthse a prcd de loin lapparition de la cellule
eucaryotique. De nombreux procaryotes marins taient dj photosynthtiques au
Prcambrien (donc il y a plus de 3 milliards dannes). Ceci est prouv par des
traces dorganismes unicellulaires fossiles retrouvs dans des sdiments dAfrique
du Sud. Ils ont rejet de loxygne modifiant de ce fait la teneur de cet lment dans
latmosphre primitive. Ultrieurement ceci a permis le passage de la vie aquatique
la vie terrestre. Les Microcystis, cyanobactries actuelles (ou algues bleues) sont
certainement les organismes unicellulaires les plus proches de ces fossiles.
65

9782100544141-Laberche.fm Page 66 Jeudi, 4. fvrier 2010 3:47 15

rm

rm
An
g

io

sp
e

sp
e
no
Gy
m

r
es
ug

sse
s
ou

Fo

10

Millions dannes
avant notre re

es

es

Chapitre 3 Comment sappelle cette plante?

Tertiaire
60
Crtac
Jurassique
Trias
Permien
Carbonifre
Dvonien
Silurien
Ordovicien
Cambrien

Premier ovaire

140
200

400

Premier vaisseau

500

Premire graine
Premier ovule
Passage de la vie aquatique
la vie terrestre

750
1 000

Unicellulaires eucaryotes

2 000
Procaryotes filamenteux
Unicellulaires chlorophylliens

3 000
PROCARYOTE ANCESTRAL
4 000

MOLCULES ABIOTIQUES

4 560

Figure 3.8 Droulement probable de lvolution des vgtaux.


(Daprs Jacob, Jger et Ohrmann, simplifi.)
Environ 2 milliards dannes aprs la formation de la Terre apparaissent les premires
cellules procaryotes sans noyau qui nanmoins peuvent sassocier en laments.
Elles driveraient de formes hypothtiques primitives, htrotrophes et sans paroi
cellulaire. Les unicellulaires eucaryotes avec noyau, sont apparus il y a un milliard
dannes et ce nest que dans les 450-540 derniers millions dannes que les plantes
sont sorties des eaux pour coloniser les milieux terrestres.

Les organismes pluricellulaires

Beaucoup de scientifiques sinterrogent encore sur lapparition de la cellule eucaryotique. Certains pensent lavoir observe dans des sdiments dats dun milliard
dannes (gisement de Bitter Springs en Australie), dautres la voit beaucoup plus
rcente, seulement 750 millions dannes lors du passage du Prcambrien au Cambrien.

66

9782100544141-Laberche.fm Page 67 Jeudi, 4. fvrier 2010 3:47 15

3.5 Lhistoire des vgtaux

Il est mieux tabli que cest cette dernire poque que se sont dvelopps les premiers
organismes pluricellulaires possdant des mcanismes de contrle de la croissance,
caractre indispensable au dveloppement des plantes cormus.
Le passage de la vie aquatique la vie terrestre

Dunod La photocopie non autorise est un dlit.

Du fait des grandes diffrences chimiques et physiques entre les deux milieux, ce
formidable bond en avant, il y a 400 millions dannes, a impos, une nouvelle srie
de contraintes qui peuvent tre regroupes en quatre points :
1. conomie deau. La plupart des vgtaux terrestres sont en en contact avec
latmosphre, la diffrence en vapeur deau entre les tissus et le milieu ambiant
provoque un transfert deau du vgtal vers lair. Ils sont donc obligs dadopter
des structures permettant dabsorber cette eau, mais aussi de freiner les pertes au
moyen de structures anatomiques comme les stomates.
2. Alimentation minrale. Elle seffectue chez les vgtaux aquatiques sur lensemble
des organes. En passant la vie terrestre, ils perdent une grande partie de cette
possibilit (mme si elle na pas compltement disparue). Pour rsoudre cette
alimentation, les vgtaux terrestres ont dvelopp les feuilles qui servent
labsorption et lassimilation du gaz carbonique. Dautre part, leau et les sels
minraux doivent tre absorbs partir du sol. Cette fonction est assure par les
racines. Enfin les transports se font dans les tiges et plus particulirement dans
les faisceaux criblovasculaires.
3. Problmes mcaniques. Ils correspondent aux ports rigs quadoptent la plupart
des vgtaux terrestres. Ceci nest possible que par un grand dveloppement des
tissus de soutien, ainsi que des systmes de fixation des plantes au sol (racines).
4. La propagation des plantes qui est souvent lie la dissmination. Lors du
passage la vie terrestre les vgtaux ont abandonn la dissmination par leau
au profit de celle par lair. De mme, les organes de reproduction se modifient et
les ovules se protgent. La phase gamtophytique se rduit considrablement et
devient parasite.
Mais tout ceci sest fait progressivement avec parfois des balbutiements, comme
chez les mousses chez qui le sporophyte est parasite du gamtophyte.
Lapparition des Angiospermes

Les Angiospermes sont rcentes. Longtemps les plus anciennes traces de fleurs fossiles
taient dates du Crtac infrieur (110 millions dannes), puis des fragments de
feuilles, de pollen voire de vaisseaux ont t identifis jusquau Trias (230 millions
dannes), mais la prsence dun carpelle clos a t dcouvert en Chine dans des
strates du Jurassique suprieur (140 millions dannes). La palynologie montre aussi
que les Angiospermes seraient apparues dans les rgions tropicales et que lAsie
aurait t une des premires zones de diversification des premires Angiospermes.

67

9782100544141-Laberche.fm Page 68 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 3 Comment sappelle cette plante?

Rsum

Depuis Linn au XVIIIe sicle, les plantes sont nommes par leur nom de genre
et despce, en respectant les rgles strictes de la nomenclature internationale.
Les plantes sont classes en phylum, classe, ordre et famille. Les premires
classifications taient bases sur des critres morphologiques descriptifs. Elles
subsistent avec succs dans les clefs utilises dans les flores usuelles. Mais
beaucoup de biologistes prfrent les classifications phylogntiques qui
permettent de rapprocher les plantes ayant des anctres communs. Pour les
tablir ils nhsitent pas utiliser, en plus des observations de la taxonomie
exprimentale, les techniques de la biologie molculaire, particulirement la
composition des ADN. Actuellement plusieurs classifications sont proposes,
sans quaucune pourtant ne simpose unanimement et incontestablement. Ce
sont surtout les champignons, htrotrophes car non chlorophylliens et les
algues aux multiples pigments qui sont lobjet de discussions.

68

9782100544141-Laberche.fm Page 69 Jeudi, 4. fvrier 2010 3:47 15

LORGANISATION
CELLULAIRE

La cellule est lunit fondamentale de la vie. Cest aussi lentit biologique la plus
simple capable de vivre isole. Dans un organisme unicellulaire, la cellule soccupe
de tous les processus vitaux, alors que dans un organisme pluricellulaire, les cellules
tendent se spcialiser. Elles dpendent les unes des autres, chaque cellule se
chargeant de fonctions particulires.
La thorie cellulaire
Elle a t propose par Schleiden et Schwann en 1838 et est base sur trois principes :
1. toute forme de vie est faite par une ou plusieurs cellules ;
2. les cellules ne peuvent provenir que de cellules prexistantes ;
3. la cellule est la plus petite forme de vie.

Dunod La photocopie non autorise est un dlit.

Comme lhomme est limit par les possibilits de son il, la connaissance de
lorganisation cellulaire est quelque chose de rcent. Elle suit le progrs technique
permettant de voir des structures invisibles lil nu. La figure 4.1 rappelle quelques
dates et faits fondamentaux de la biologie cellulaire.
Lorganisation cellulaire sera le premier niveau de connaissance du monde vgtal.
lil nu, il est impossible de voir que le vgtal est constitu de cellules. Mais il
Robert Hoocke
observe des
cellulles dans un
microscope primitif
1644

Leewenhoeck
dcouvre
les bactries
1683

1674
Leewenhoeck
dcouvre les protozoaires

Kolliker
Golgi utilisant Commercialisation
dcrit les
du nitrate dargent
du premier
mitochondries dcouvre la structure microscope
dans le muscle qui portera son nom balayage
1847
1898
1964

1838
1882
Schleiden
Koch utilise laniline
et Schwann
pour identifier
proposent la
la bactrie
Thorie cellulaire
responsable
du cholra

1931
Ruska
construit
le premier
microscope
lectronique
transmission

Figure 4.1 Les grands moments de la dcouverte de la biologie cellulaire.


69

9782100544141-Laberche.fm Page 70 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

nen est pas de mme si on observe une coupe transversale de feuille au microscope
optique (maintenant on dit plutt photonique).
Il est ais de voir que le limbe est constitu de cellules, plus ou moins polydriques
compartimentes. De lextrieur vers lintrieur, on distingue plusieurs zones.
La paroi : zone paisse opaque.
Le cytoplasme : zone translucide, plus ou moins granuleuse plaque contre la
paroi et occupant une grande partie de la cellule. Il est compos du cytosol et des
organites (baignant dans le cytoplasme).
Un noyau lintrieur du cytoplasme. Cest un corps ovale situ en priphrie de
la cellule.
Des chloroplastes lintrieur du cytoplasme. De couleur verte, ils possdent de la
chlorophylle et participent activement un phnomne physiologique fondamental :
la photosynthse.
Une vacuole qui occupe toute la zone centrale de la cellule. Elle parat vide tant
elle laisse passer la lumire.
Lobservation en microscopie photonique est insuffisante pour connatre lintrieur
du cytoplasme ou du noyau. Effectivement la microscopie lectronique transmission
rvle dautres structures (fig. 4.2).

RE

RE
ri
M

MN
mb

Figure 4.2 Coupe partielle dune cellule vgtale


observe au microscope lectronique transmission permettant
de mettre en vidence de nouveaux constituants.
N, noyau ; M, mitochondrie ; RE, rticulum endoplasmique ; ri, ribosome ; mb,
membrane nuclaire. Grossissement : 8 500. Clich : J.C. Laberche BioPi-UPJV.

70

9782100544141-Laberche.fm Page 71 Jeudi, 4. fvrier 2010 3:47 15

4.1 La cellule bactrienne

Toujours plus petit


Cest le microscope lectronique qui a permis dobserver les organites. Il utilise un
faisceau dlectrons permettant ainsi dobtenir des grossissements de lordre de
200 000. On peut mme obtenir un grossissement de plus de 1 000 000 lorsquon
prend une photo du spcimen observ et quon lagrandit. Sa capacit de rsolution
est aussi leve que son pouvoir de grossissement, ce qui permet aux biologistes
de scruter les moindres dtails de la cellule. En microscopie lectronique transmission, on observe des coupes comme en microscopie photonique. Certes, elles
sont plus nes et diffremment prpares. On peut aussi faire de la microscopie
lectronique balayage. Dans ce cas les chantillons ne sont pas coups mais
fractionns. Ceci permet dapprcier et de visualiser les volumes.

On distingue ainsi de nouvelles structures.


lintrieur du cytoplasme apparaissent de nouveaux organites. Les mitochondries
sont allonges et prsentent, en coupe, des crtes. Les lysosomes sont ronds.
Enfin les corps de Golgi se prsentent sous forme de saccules aplaties. Tous ces
corpuscules sont dans un rseau tubulaire dense, le rticulum endoplasmique
ponctu de points noirs : les ribosomes.
Des membranes entourent le cytoplasme et le noyau.
Le noyau nest pas homogne, des concrtions denses sont visibles. Il sagit des
nucloles.
Le Trifolium repens avec son noyau vrai est un Eucaryote, comme les champignons
(excepts les Myxomyctes), les algues (exceptes les Cyanophyces), les mousses,
les fougres et les plantes fleurs. Cependant, pour apporter quelques lments de
comparaison, voire de rflexion sur limportance de lorganisation cellulaire, quelques
donnes sur la cellule bactrienne seront dabord rappeles.

Dunod La photocopie non autorise est un dlit.

4.1 LA

CELLULE BACTRIENNE

Les bactries sont des Procaryotes. Les lments constitutifs de la cellule bactrienne
sont complexes comme le montre la figure 4.3.
La cellule bactrienne comprend plusieurs parties.
Une paroi. Dpaisseur variable, elle reprsente 20 % du poids sec de la cellule.
Sa composition diffrente selon les bactries permet de les classer en deux groupes
ragissant diffremment la coloration de Gram (tabl. 4.1).
corpuscule
mtachromatique

paroi

glycogne

flagelle

chromosome
plasmide

plasmalemme

Figure 4.3 Reprsentation schmatique de la cellule bactrienne.


71

9782100544141-Laberche.fm Page 72 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

La coloration de Gram
La coloration de Gram permet de colorer les bactries. Un frottis x par vaporation
de la suspension bactrienne sur la lame est recouvert dune solution de violet de
gentiane ou de violet crystal. Il est alors recouvert de lugol puis dcolor ou non
par de lalcool absolu. Aprs rinage leau les bactries sont colores la fuchsine
avant dtre de nouveau laves leau. Les bactries Gram positives sont colores
en violet, les bactries Gram ngatives sont presque incolores. Cette coloration
diffrentielle est lie la composition de la paroi. Chez les bactries Gram positives
lalcool qui dcolore le violet de gentiane, ne peut la traverser.

Tableau 4.1 Composition chimique de la paroi bactrienne.


Les % sont exprims par rapport la matire sche. (Daprs Gorenot, simpli.)
Bactries Gram +

Bactries Gram

Hexosamine

16 20 %

24%

Acides amins

24 34 %

40 %

4-10

16-17

prsence

absence

Nombre dacides amins


Acides teichoques
Lipides
Oses simples

12%

10 20 %
20 60 %

Chez les bactries Gram positives, la paroi est constitue dune couche paisse
(10 80 nm) de peptidoglycanes associs des acides teichoques. linverse chez
les bactries Gram ngatives la couche de peptidoglycanes est plus mince et est
double lextrieur dune membrane biologique de phospholipides permettant la
diffusion de petites molcules grce des canaux protiques.
Une membrane plasmique. Appele aussi plasmalemme, elle a une structure
classique (membrane tripartite en microscopie lectronique) et assure la permabilit
slective des ions pntrant lintrieur de la bactrie. Elle est aussi le sige de
nombreuses activits enzymatiques. Cette membrane peut prsenter des invaginations
complexes, plus ou moins feuilletes. Ce sont les msosomes qui auraient un rle
dans la rplication de lADN et dans la synthse de la paroi lors de la division.
Un cytoplasme. Le cytoplasme fondamental ou hyaloplasme, possde lui aussi
les mmes caractristiques que celui de toute cellule vivante. Cependant, les inclusions peuvent tre diffrentes de celles des Eucaryotes. En microscopie lectronique
on peut y voir :
1. des ribosomes (de 10 000 20 000 par cellule) ;
2. des grains de polysaccharide proches du glycogne ;
3. des grains damylose (amidon bactrien) ;
4. des corpuscules de polyphosphates inorganiques ;
5. des lipides ;
6. des pigments (qui bien souvent donnent leur nom la bactrie : le Staphylocoque
dor par exemple).
72

9782100544141-Laberche.fm Page 73 Jeudi, 4. fvrier 2010 3:47 15

4.1 La cellule bactrienne

Un appareil nuclaire. Il nexiste pas de vrai noyau chez les bactries. De


nature fibrillaire dense, il ne comporte ni membrane limitante, ni nuclole. Cet
appareil nuclaire se limite en un filament unique dADN ferm sur lui mme, le
chromosome, attach au plasmalemme. Chez le colibacille, la molcule dADN,
circulaire et dune longueur de 1,2 mm environ, comprendrait prs de 340 000 paires
de nuclotides.
Le plasmide. Cest une molcule dADN circulaire, extrachromosomique de
petite taille (1/100e environ de celle du chromosome) capable de sautoreproduire
en liaison avec des sites membranaires et indpendamment de la rplication du
chromosome.
Utilisation des plasmides en biotechnologie
Depuis quelques annes, ils constituent aussi llment indispensable aux transformations gntiques dans les cultures in vitro. Le ou les gnes introduire sont
gnralement ports par ces plasmides dont un fragment, une fois introduit dans
les cellules vgtales eucaryotiques sintgre un chromosome.

Dunod La photocopie non autorise est un dlit.

ces cinq lments constants, il convient dajouter des lments facultatifs.


La capsule. Certaines bactries, possdent une capsule mucoglatineuse entourant
la paroi cellulaire. Elle est de nature chimique varie, le plus souvent polysaccharidique, mais aussi parfois polypeptidique.
Les flagelles. Ce sont des filaments plus ou moins sinueux parfois plus longs
que la cellule elle-mme. Composs de protines, ils assurent le dplacement des
bactries.
Les pilis. Ils sont composs de pilines, protines de structure hlicodale. Ils ont
un rle dans lagglutination des cellules. Les pilis sexuels, plus longs et plus pais
ont un rle dans la fixation des cellules en dbut de conjugaison.
Les bactries se multiplient par voie vgtative : chaque cellule se divise par
bipartition. Les nouvelles cellules se sparent et deviennent indpendantes, ou
demeurent associes en files. Cependant, dans certains cas, des phnomnes complexes
de sexualit mettent en jeu trois mcanismes. Il sagit de :
La transformation. Dcouverte exprimentalement par Griffith en 1928, chez
Streptococcus pneumoniae (agent de la pneumonie), la transformation est un
change gntique entre une bactrie et de lADN bicatnaire exogne. Pour que
la pntration puisse se raliser, la bactrie doit synthtiser des protines spcifiques
de faible poids molculaire qui permettent lentre dans la cellule de lADN
transformant. Celui-ci est intgr dans le gnome bactrien sous forme de courtes
squences simple brin .
La transduction. Dcrite par Zinder et Lederberg en 1942, elle ne peut se faire
que par lintermdiaire dun bactriophage qui infecte la bactrie. Il intgre dans
son patrimoine gntique une partie de celui de la bactrie. Infectant ultrieurement
dautres bactries, ce bactriophage pourra son tour intgrer cette squence
cette nouvelle cellule devenue alors rceptrice.
73

9782100544141-Laberche.fm Page 74 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

La conjugaison. Cette sexualit occasionnelle chez les bactries a t dcrite par


Lederberg et Tatum en 1946. Elle se caractrise par le passage dune partie du
matriel gntique dune cellule une autre. Cette conjugaison nest pas une
fusion de deux cellules mais un simple transfert. Celui-ci est assur par un poil
sexuel tubulaire, le pili, issu de la cellule donatrice entre les deux bactries.
Des bactries pour protger la fraise de la pourriture grise
La pourriture grise attaque de nombreux lgumes et des fruits tels que les tomates,
les courgettes, le raisin ou encore la laitue. Elle est surtout dvastatrice pour la fraise.
Vhicule par un champignon, le Botrytis cinerea, Pers. ex Fr. (Sclerotiniaceae)
cette maladie provoque la pourriture prmature du fruit, rendu ds lors impropre
la consommation. Elle est extrmement virulente pendant les priodes de semis
et de stockage. ce dernier moment o tout traitement fongicide est strictement
interdit, une alternative biologique existe pourtant. En effet, des bactries du genre
Bacillus comme Bacillus subtilis Ehrenberg (Bacillaceae) et Bacillus pumilus Meyer
and Gottheil (Bacillaceae) vivants dans des milieux trs sals, et connus dj pour
empcher la germination des spores des champignons pathognes comme le
Rhizoctonia (Rhizoctonia solani J.G. Khn, Corticiaceae) et le Fusarium (Fusarium
oxysporum Link Nectriaceae) sont capables de rduire dau moins 50 %, voire
dradiquer, la pourriture grise comme la montr une quipe de chercheurs de la
facult des sciences de Tunis de 2006 2008.
(Daprs lInstitut de recherche et de dveloppement de Tunis, Tunisie).

4.2 LA

CELLULE EUCARYOTIQUE VGTALE

La cellule est le sige de nombreux processus biochimiques mettant en jeu un trs


grand nombre de molcules organiques (jusqu 10 000 chez certaines cellules) et
dions inorganiques qui agissent de faon coordonne dans des structures cellulaires
prcises. Les cellules contiennent 90 % deau et sur le 10 % de matire sche restants,
il y a pratiquement 40 % de protines, 14 % de glucides et de lipides. La cellule est
compartimente (fig. 4.4) et ce sont des membranes qui dlimitent les diffrents
compartiments. Ce sont donc ces membranes qui seront en premier tudies.

4.2.1 Les membranes cellulaires


Deux membranes sont particulirement importantes.
Le plasmalemme, appel aussi membrane plasmique, dlimite le cytoplasme de
la priphrie de la cellule. Ce plasmalemme nisole pas compltement la cellule
car il existe entre les cellules, un continuum symplasmique. Cette continuit du
plasmalemme dune cellule lautre seffectue par lintermdiaire de ponts cytoplasmiques passant dans les lumires des plasmodesmes.
Le tonoplaste qui isole la vacuole du cytoplasme.
Les constituants les plus importants des membranes sont des lipides et des protines.
Daprs le modle de Singer et Nicholson, les membranes prsentent une structure
tridimensionnelle plane de protines et de lipides (fig. 4.5).
74

9782100544141-Laberche.fm Page 75 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

plasmodesme

tonoplaste

REG

vacuole

chloroplaste
noyau

ribosomes

membrane
stroma
lamelle
thylacode
amidon
pore nuclaire
nuclole
chromatine
nucloplasme
membrane

hyaloplasme

lysosome
corps
de Golgi

REL
mitochondrie
plasmalemme
paroi
(apoplasme)

lamelle amyloplaste
moyenne

Figure 4.4 Schma des compartiments de la cellule vgtale.


Extrieur de la cellule

6
5

Dunod La photocopie non autorise est un dlit.

4
Hyaloplasme

Figure 4.5 Modle molculaire du plasmalemme.


1, ples des phospholipides ; 2, protines priphriques ; 3, protines intgres ;
4, molcule de cellulose-synthase ; 5, bre de cellulose ; 6, rsidu glucidique.

Une membrane est forme dune bicouche de phosphoglycrolipides et de


cholestrol, dont les ples hydrophiles sont orients vers lextrieur et o se trouvent
des particules protiques parses. Certaines sont simplement accoles, dautres sont
littralement enchsses.
75

9782100544141-Laberche.fm Page 76 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

La stabilit de la structure membranaire se fait grce aux protines membranaires.


Elles ont des ples hydrophiles dans lesquels se concentrent les groupements polaires
des acides amins et des ples lipophiles forms des chanes carbons apolaires des
acides amins. Les domaines lipophiles des protines sont en interaction avec
les ttes hydrophiles des lipides qui constituent la surface membranaire.
Dans le plasmalemme, on trouve aussi des protines en rosette constitues de
six molcules de cellulose synthase. La face interne absorbe les prcurseurs de la cellulose provenant du cytoplasme tandis que la face externe extrude des microfibrilles
cellulosiques dans la paroi cellulaire. Chez la levure de bire Saccharomyces cerivisae,
qui appartient au sous rgne des Fungea, le plasmalemme ne synthtise pas de
cellulose mais des microfibrilles de chitine.
La composition des membranes en lipides et en protines leur confre des proprits
quant aux passages des lments. Diffusion passive simple et transports facilits et
actifs seffectuent au niveau des membranes (fig. 4.6).
Transport actif secondaire
Transports facilits
Diffusion
passive simple

Canal K+

Transporteur

Transport
actif
primaire
H+

ATP + H2O

Protine

Cotransporteur
H+

Saccharose

ADP + Pi
Cytoplasme

Plasmalemme
ou membrane
plasmique

ATPase

Paroi

K+

H+

H+ Saccharose

Figure 4.6 Processus de transports travers les membranes.

Les mcanismes de transport sont donc de trois types : la diffusion passive simple, les
transports facilits et le transport actif.
La diffusion simple se produit quand les molcules passent directement travers les
membranes, selon un gradient de concentrations. Cette diffusion est un mcanisme
de transport suffisant pour de nombreuses substances.
Le transport facilit permet le passage dions, particulirement K+, Na+, Ca++ et

Cl . Les transports facilits sont limits par le nombre de protines membranaires,


mais aussi par les gradients de concentrations entre les deux cots des membranes.
Les mcanismes permettant ces transports sont lis aux protines. Elles sont
appeles des permases (fig. 4.7).
76

9782100544141-Laberche.fm Page 77 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

entre

raction
changement
a
avec
de
le substrat conformation

sortie

Figure 4.7 Les mcanismes de transport facilit au niveau des membranes.

Dunod La photocopie non autorise est un dlit.

a, transport simple ; b, mcanisme dchange ; c, cotransport.

Lors dun transport facilit, la protine membranaire change de structure ou de


conformation au moment de la fixation du substrat transporter. Ceci permet le
passage du substrat travers la membrane. Il est important de voir que ce transport
nest pas obligatoirement coupl de lnergie mtabolique. Il peut sagir dun
processus passif rversible qui ne contribue qu ltablissement dquilibres entre les
deux cots de la membrane, plusieurs biologistes parlent alors de diffusion catalyse.
Comme pour les ractions enzymatiques, les processus de diffusion catalyse peuvent
prsenter une saturation par le substrat ; la vitesse de diffusion naugmente plus,
mme si la concentration augmente.
Le transport actif ncessite une dpense dnergie pour transporter les molcules
dun ct de la membrane lautre. Le transport actif est le seul type de transport
dlments qui puisse tre effectu contre leur propre gradient de concentrations.
Comme pour les transports facilits, les transports actifs sont directement limits par le
nombre de protines transporteuses prsentes dans les membranes. On peut distinguer
deux catgories de transports actifs : les primaires et les secondaires.
Le principal systme de transport actif primaire est lATPase-pompe protons.
Lnergie chimique libre par lhydrolyse de ladnosine-triphosphate (ATP) permet
dexcrter des protons H+ de lintrieur vers lextrieur de la cellule (fig. 4.6), crant
ainsi dans la membrane des gradients de pH, le cot le plus acide tant lextrieur de
la membrane (donc cot paroi dans le cas du plasmalemme) et de potentiel lectrique,
la face ngative tant cette fois lintrieur (donc cot cytoplasme, toujours dans le
cas du plasmalemme) et peut atteindre 150 200 millivolts.
77

9782100544141-Laberche.fm Page 78 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

Les systmes de transport actif secondaires sont coupls ce systme de transport


actif primaire selon deux modalits : les canaux et les transporteurs.
Le canal est un pore protique de la membrane qui laisse passer slectivement un
ion par diffusion, le long de son gradient de potentiel lectrochimique. Ainsi, lion
potassium pntre dans la cellule par un canal grce au champ lectrique transmembranaire. Comme la diffrence de potentiel lectrique de la membrane
plasmique est de 150 mV, ceci permet davoir une concentration interne en ions
K+ denviron 150 millimoles par litre soit 1 000 fois suprieure la concentration
apoplasmique (entre les cellules, cette concentration oscille autour de quelques
centaines de micromoles par litre). Le passage des ions peut tre trs rapide : au
moins 106 ions par seconde et par canal.
Cependant tous les canaux, pour un mme ion, ne sont pas identiques. Ds 1950
(donc avant la connaissance des mcanismes du transport actif), Epstein avait
constat que les cintiques dabsorption du potassium variaient en fonction de la
concentration du milieu. Ainsi, quand le milieu externe a une trs faible concentration en potassium, labsorption est forte mais ne dure pas longtemps, inversement
si le milieu externe est riche, labsorption est plus lente mais dure plus longtemps et
atteint des quantits plus leves. Les physiologistes et les biologistes molculaires
actuels reprenant les travaux dEpstein, saccordent sur les cintiques biphasiques
et distinguent des canaux forte et faible affinit (HATS et LATS pour High
Affinity et Low Affinity System Transport).
Les transporteurs sont diffrents des canaux. Dabord ils concernent certes des
ions, mais aussi des molcules comme des sucres, des acides amins et mme des
peptides. Ces transports peuvent seffectuer soit dans le sens du gradient de pH ou
plus frquemment contre le gradient de pH, on parle alors de cotransport car le
passage de llment est coupl au transport dun proton dans le sens du gradient
lectrochimique, donc vers lintrieur de la cellule. La figure 4.6 montre lexemple
de la pntration du saccharose lintrieur dune cellule. On y retrouve le transport actif primaire avec lATPase situe dans la membrane de la cellule qui pompe
les protons cytoplasmiques H+ et les expulse vers la paroi. Profitant de cet excs de
protons dans la paroi, le cotransporteur absorbera la fois un proton et la molcule
de saccharose, faisant passer les deux de lextrieur de la cellule vers lintrieur.
Ces transporteurs et cotransporteurs subissent des dformations lors du transport
de llment mais surtout les transports sont beaucoup plus lents que dans les
canaux (1000 fois moins rapides). Labsorption des anions NO3, H2PO4 et SO42
sont raliss par des cotransporteurs. Lapport de ces anions dans le cytoplasme va
dpolariser transitoirement la membrane plasmique et surtout alcaliniser le milieu,
pour y remdier le cotransporteur transfrera plusieurs protons par ion transport.
Les gnes impliqus dans les transports dions
Depuis plus de 20 ans, plusieurs laboratoires ont tent de connatre les gnes
impliqus dans les transports dions. Seul le systme actif primaire avait pu tre
facilement identi grce une approche biochimique. En effet, lATPase est facilement mesurable in vitro. Mais ce sont les progrs de la biologie molculaire et
des techniques de transformations gntiques, particulirement sur larabette
78

9782100544141-Laberche.fm Page 79 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

(Arabidopsis thaliana) qui ont permis dapprhender des gnes de transporteurs.


Ainsi, chez larabette, le gne NRT1 code un transporteur de NO3. Ce gne, pourtant, nest pas le seul permettre labsorption des nitrates. Il agit de concert avec
un autre gne transporteur de NO3 de la catgorie des LATS, qui normalement est
rprim quand le milieu contient de lammonium NH4+ alors que NRT1 ne lest pas.
Ceci montre toute la complexit des actions des gnes, qui sexpriment, bien
souvent, en fonction des caractristiques du milieu o se dveloppent les plantes.

4.2.2 Le noyau
Le noyau (fig. 4.8) est le centre de contrle de la cellule. Le matriel gntique de la
cellule se situe en effet, principalement dans le noyau.

RE
N

Figure 4.8 Schma de


lultrastructure du noyau.
N, nuclole ; Po, pores nuclaires ;
EN, enveloppe nuclaire ; RE, rticulum endoplasmique ; Pl, nucloplasme ; Ch, chromatine.

EN
Pl
Po

Ch

Dunod La photocopie non autorise est un dlit.

a) Les constituants du noyau


Le noyau cellulaire a t dcouvert en 1831 par Robert Brown (1773-1848) chez la
misre Tradescantia zebrina Loud. Son diamtre moyen est extrmement variable.
Il est de 0,4 mm chez les champignons et varie de 4 24 mm chez la majorit des
vgtaux. Il a plusieurs composants.
1. Une enveloppe nuclaire.
Elle est constitue dune double membrane. Lespace entre les deux membranes
forme un continuum avec le rseau de rticulum endoplasmique qui se trouve
dans le cytoplasme. Cette enveloppe est ponctue de pores nuclaires qui laissent
passer des molcules dARN messager, des nuclotides, des ions
2. De la chromatine.
Quand le noyau est au repos, donc quand il nest pas en division, on peut observer
des zones plus denses, qui correspondent lassociation dADN et dhistones
constituant les chromosomes. ce stade, ils ne sont pas condenss.
3. Un ou plusieurs nucloles.
Il sagit de zones trs sombres, non dlimites par des membranes, qui se distinguent
trs bien de la quatrime phase du noyau : le nucloplasme.
79

9782100544141-Laberche.fm Page 80 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

4. Le nucloplasme
Il apparat structur comme le cytoplasme fondamental avec lequel il est en relation
par lintermdiaire des pores nuclaires.

b) Les chromosomes
Au cours de la division cellulaire, les chromosomes sont visibles en microscopie
photonique condition dtre colors (le plus souvent par la coloration de Feulgen).
Quand ils sont compacts ils ont une forme de btonnets recourbs, anguleux ou
sphriques (fig. 4.9).

Figure 4.9 Photographie de chromosomes de mas observs en


microscopie optique, aprs coloration au Feulgen dans une cellule de racine.
Grossissement: 1300. (Clich F. Saly-MNHN Paris.)

La raction de Feulgen
Elle comporte deux grandes tapes. LADN constitutif des chromosomes est dabord
hydrolys laide dun traitement lacide chlorhydrique chaud. Le groupement
aldhyde du dsoxyribose de lADN est libr et se colore en rouge-violet aprs
raction lacide fuschinique sulfureux.

Lobservation de chromosomes, montre quils sont constitus dune paire hlicodale


de chromatides parallles, enrobs dune substance formant la matrice. Le pas de cette
hlice est trs variable, mais toujours trs court.
Les chromosomes sont runis par paire dans les cellules diplodes. On dit alors
que le nombre de chromosomes est 2n. Les cellules reproductrices, sont haplodes,
le nombre de chromosomes est alors n. Ce nombre n est trs variable et nest pas
corrl avec le degr dvolution des plantes. Il oscille entre 2 et 100 (tabl. 4.2). Les
plus frquents sont entre 4 et 17.
80

9782100544141-Laberche.fm Page 81 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

Tableau 4.2 Quelques nombres (2n) chromosomiques.


Nom commun

Nom scientifique

Nombre de chromosomes

Nnuphar blanc

Nymphaea alba L.

2n = 84

Nnuphar candide

Nymphaea candida Presl

Adonis de printemps

Adonis vernalis L.

2n = 16

Compagnon blanc

Melandrium album Garcke

2n = 24

2n = 180

Saxifrage en panicules

Saxifraga aizoon Jacq.

2n = 48

Tre rouge

Trifolium pratense L.

2n = 14

Tre rampant

Trifolium repens L.

2n = 32

Linaire vulgaire

Linaria vulgaris Miller

2n = 12

Sabot de Vnus

Cypripedilum calceolus L.

2n = 20

Engrain sauvage

Triticum aegilopoides (Link)

2n = 14

Bl dur

Triticum durum (Desf.) Husn.

2n = 28

Bl tendre

Triticum aestivum L.

2n = 42

Dunod La photocopie non autorise est un dlit.

La longueur des chromosomes condenss varie entre 0,2 et 40 mm et le diamtre


entre 0,2 et 4 mm (fig. 4.10).

Figure 4.10 Exemples de chromosomes au mme grossissement.


a, Scorsonre (Scorzonera humilis L.), 2n = 14 ; b, Dahlia (Dahlia variabilis Desf.),
2n = 64 ; c, Chanvre indien (Cannabis sativa L.), 2n = 20 ; d, pinard (Spinacea oleracea L.), 2n = 12 ; e, Pommier sauvage (Malus silvestris (L.) Gray), 2n = 34.

c) La mitose
La mitose est dfinie comme la division du noyau suivie de la division cellulaire
(cytokinse) aboutissant la formation de deux cellules filles (fig. 4.11). Cette
multiplication cellulaire porte parfois le nom de mrse.
81

9782100544141-Laberche.fm Page 82 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

prophase
dbut

mtaphase

anaphase

tlophase

fin

Figure 4.11 Reprsentation schmatique


des diffrentes tapes de la mitose.

Cinq phases sont caractristiques de la mitose.


1. La prophase.
Les chromosomes, dj diviss en deux chromatides, commencent se condenser
par un enroulement en spirale.
Les microtubules, qui sont des protines globulaires formant des tubes et situes
normalement prs du plasmalemme, se dplacent dans la cellule et sordonnent
autour du noyau.
2. La mtaphase.
Les chromosomes condenss et fissurs en deux chromatides se positionnent
au milieu de la cellule pour former la plaque quatoriale.
Lenveloppe nuclaire disparat.
Le nuclole se dissocie.
Les microtubules sassocient pour former un faisceau qui saccroche aux
centromres des chromosomes. Lensemble forme le fuseau nuclaire.
3. Lanaphase.
Les deux chromatides se sparent et sont transportes chacune un ple de la
cellule.
Les microtubules du fuseau servent de guide.
4. La tlophase.
Les chromatides sont arrives aux ples opposs de la cellule et de nouvelles
membranes sorganisent pour dlimiter les deux nouveaux noyaux.
Les chromosomes se dspiralisent et ne sont plus observables en microscopie
photonique.
Les microtubules se dispersent et la cytokinse, ou sparation en deux cellules
filles, intervient.
5. Linterphase.
Il est traditionnel de complter les diffrentes phases de la mitose par une cinquime,
linterphase, bien quelle soit indpendante de la mitose. Durant cette phase
aprs une phase de repos, il se produit une duplication de lADN raboutissant
des chomosomes composs de deux chromatides.
82

9782100544141-Laberche.fm Page 83 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

4.2.3 Le cytosol
Dans lobservation des cellules en microscopie photonique, on a dfini le cytoplasme
comme lespace dlimit entre le plasmalemme et le tonoplaste. Il est constitu du
cytosol et des organites. Lobservation au microscope lectronique du cytosol ne rvle
pas dorganisation structurale mais la prsence dun cytosquelette constitu :
de structures en forme de cylindre, les microtubules, dont le diamtre interne est
de 14 nm environ. Ces microtubules sont forms par lassemblage de 13 ranges de
tubulines (a et b) et de protines globulaires (MAP) ; ces MAP sont soit structurales
et impliques dans lassemblage des microtubules, soit elles permettent un transport
polaris le long du microtubule par lhydrolyse dATP ; la structure des microtubules est remarquablement identique chez tous les tres vivants, ce qui pourrait
signifier que cette structure est apparue trs tt au cours de lvolution ;
de microfilaments constitus dun assemblage dactine et de protines (ABP), le
tout formant des doubles brins, torsads en hlice ; en se contractant et en se relchant par polymrisation-dpolymrisation ces microfilaments sont lorigine
des mouvements observs dans le cytosol.
Le cytosol est le sige de trs nombreux processus mtaboliques. Des nuclotides
(lments constitutifs des acides nucliques), des acides gras et des acides amins sont
synthtiss dans le cytosol. Mais ceci est du domaine de la biochimie mtabolique,
plus que de la biologie vgtale. Il est important cependant de remarquer que dans
certaines voies mtaboliques, il y a coopration troite entre le cytosol et les organites
cellulaires. Ainsi, la dgradation oxydative des glucides est initie dans le cytosol et
se termine dans les mitochondries (cf. 7.3.2).

Dunod La photocopie non autorise est un dlit.

4.2.4 Le rticulum endoplasmique et les plasmodesmes


Dans les cellules eucaryotiques, le cytosol contient un rseau de structures tubulaires
ramifies : le rticulum endoplasmique (abrviation gnralement utilise : RE). Il
est limit par une membrane unique qui est souvent en contact avec la membrane
nuclaire externe. Il se prolonge dans les plasmodesmes et assure la continuit cellulaire.
Il est possible de distinguer deux types de RE :
le rticulum endoplasmique granuleux (REG) dont la surface membranaire externe
est couverte de ribosomes de 17 20 nm de diamtre. Les protines synthtises par
les ribosomes saccumulent parfois dans la lumire du RE sous jacent et peuvent
ainsi tre transportes vers dautres parties de la cellule.
le rticulum endoplasmique lisse (REL) qui est dpourvu de ribosomes. Il intervient
surtout dans les synthses de lipides.
Zone de synthses et de transports, le RE fournit ainsi les composants lipidiques
et protiques aux autres systmes membranaires du cytoplasme.
La structure de base qui assure la communication intercellulaire est le plasmodesme.
Schmatiquement, cest un canal denviron 20 50 nanomtres de diamtre traversant
les parois pectocellulosiques et bord par la membrane cytoplasmique (plasmalemme).
83

9782100544141-Laberche.fm Page 84 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

lintrieur de ce canal, un composant axial, le desmotube, assure la continuit du


rticulum endoplasmique entre deux cellules contigus. Ce desmotube est ancr au
plasmalemme par des ponts constitus de protines globulaires denviron 3 nm associes
dun cot aux membranes et de lautre 2 faisceaux hlicodaux dactine encadrant
un pont de myosine central. Ces structures dactine et de myosine en se polymrisant
et dpolymrisant permettent la fermeture ou louverture de ces communications,
donc le contrle du cheminement des molcules entre les cellules. ltat ferm, seules
les toutes petites molcules peuvent diffuser tandis qu ltat ouvert des molcules
50 100 fois plus grosses peuvent passer dune cellule lautre. La forme et la
fonction des plasmodesmes peuvent changer grandement dans les cellules foliaires
quand celles-ci passent dun tat juvnile htrotrophe (elles reoivent leurs nutriments
pour se dvelopper) un tat adulte autotrophe exportateur des produits de la
photosynthse. Les plasmodesmes des feuilles jeunes sont linaires et de grosses
molcules peuvent diffuser entre les cellules. Plus tard, les plasmodesmes se creusent,
dans la rgion de la lamelle moyenne de la paroi et prsentent des structures branches,
avec une limitation trs nette de la grosseur des molcules pouvant les traverser. Ces
plasmodesmes branchus se retrouveront dans les mcanismes sur le cheminements
des assimilats dans la plante.

4.2.5 Les ribosomes


Les ribosomes sont de petites particules en forme de grains quon retrouve soit la
surface du rticulum endoplasmique, soit libres dans le cytoplasme. Ils sont surtout
composs dARN ribosomal, un type particulier dacide nuclique, et de protines.
Ils sont le site de la synthse des protines dans la cellule, en assurant lassemblage
des acides amins les uns aprs les autres (fig. 4.12).
formation dune
nouvelle liaison peptidique
protine

do

ico

t
an

ARNt libr

codons
mouvement du ribosome

Figure 4.12 Schma de synthse des protines au niveau du ribosome.


(Daprs Kollman, 1979, cit par Mohr et Schopfer, 1994, modifi.)

84

9782100544141-Laberche.fm Page 85 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

Les protines qui sont fabriques vont se dplacer dans le rticulum endoplasmique,
puis tre transportes dans toutes les parties de la cellule via des vsicules. Les
protines synthtises par les ribosomes et dverses dans le RE migrent vers lappareil
de Golgi.

4.2.6 Les organites cellulaires


Les organites sont des structures spcialises localises dans le cytoplasme. Cest le
microscope lectronique qui a permis de dcouvrir les dtails des structures de chaque
type dorganite. Ils ont des fonctions mtaboliques prcises qui appartiennent au
domaine de la biologie cellulaire et seront donc seulement cites.

a) Les vsicules de Golgi


Ces organites sont trs visibles au microscope lectronique. Gnralement concentrs
prs du noyau, ils peuvent aussi tre parsems dans le cytosol. Ils ressemblent gnralement un ensemble de plusieurs tubes membraneux aplatis les dictyosomes. Leurs
extrmits portent des petits sacs, les vsicules (fig. 4.13). Celles-ci se dtachent et
se dplacent pour dverser leur contenu au niveau du plasmalemme aprs fusion
membranaire.

vsicule golgienne
dictyosome
(ensemble des saccules)
saccules

Dunod La photocopie non autorise est un dlit.

Figure 4.13 Reprsentation schmatique des vsicules de Golgi.

Les vsicules de Golgi peuvent aussi servir de lieux dentreposage. Les protines
synthtises par les ribosomes peuvent sunir avec des glucides prsents dans les
vsicules pour former des glycoprotines essentielles pour llaboration de la paroi
cellulaire

b) Les mitochondries
On peut observer les mitochondries dans certaines cellules par le truchement du
microscope photonique. Elles ressemblent de petits points ou de petits btonnets,
mais leur structure interne et leur forme deviennent bien visibles au microscope
lectronique. Elles sont de forme ronde ou allonge de quelques mm de grandeur.
Une mitochondrie est entoure de deux membranes, ressemblant ainsi la membrane
85

9782100544141-Laberche.fm Page 86 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

nuclaire et aux membranes plasmiques. La membrane interne se replie vers lintrieur en plusieurs replis, appels crtes mitochondriales. La matrice interne des
mitochondries constitue le stroma (fig. 4.14). lintrieur, on trouve des zones
contenant de lADN circulaire et des ribosomes. Ils assurent la synthse des protines
mitochondriales.

crtes
ADN
membrane externe
membrane interne

espace
intermembranaire

matrice

ribosomes

Figure 4.14 Reprsentation schmatique


de lorganisation de la mitochondrie.

Les biologistes ont remarqu que les cellules ayant subi diffrents stress (thermiques,
salins, hydriques) ont plus de mitochondries que les autres. Ils ont donc suppos,
que ces organites jouent un rle dans la libration de lnergie, ce qui a t confirm.
Les mitochondries sont le centre de la respiration de la cellule et elles contiennent
des enzymes qui provoquent la scission de composs organiques riches en nergie. La
membrane externe est particulirement riche en lipides, tandis que les crtes internes
contiennent surtout des enzymes intervenant dans la chane de transfert des lectrons.
Dans le stroma, on trouve galement des enzymes qui sont impliques dans le cycle de
Krebs (cf. p. 193). Celui-ci permet grce aux ractions chimiques successives entre
diffrentes molcules, la libration dnergie. Elle peut tre transfre dautres
molcules ainsi qu toutes les parties de la cellule pour des ractions mtaboliques.

c) Les plastes
On trouve ces organites dans les cellules des plantes et chez quelques Protistes. Ils
sont de plusieurs types et ont des fonctions mtaboliques particulires. Certains plastes
synthtisent de nouvelles molcules, alors que dautres les emmagasinent. Tous les
plastes sont des organites cellulaires ovodes ou sphriques de quelques microns de
long. Ils sont limits par une double membrane.
Le plaste le plus commun est le chloroplaste qui contient la chlorophylle ncessaire
la photosynthse. Mais dans la cellule vgtale on trouve aussi les amyloplastes
(ils stockent lamidon), des chromoplastes (ils accumulent des pigments) ainsi que
des proplastes qui comme leur nom lindique sont lorigine des autres plastes.
86

9782100544141-Laberche.fm Page 87 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

Les chloroplastes

Facilement observables en microscopie photonique, les chloroplastes ont gnralement


entre 4 et 10 mm de long. Mais pour avoir plus de dtails, il faut les observer en
microscopie lectronique (fig. 4.15).

membrane interne
stroma
lamelles

Dunod La photocopie non autorise est un dlit.

thylacode

Figure 4.15 Observation en microscopie lectronique transmission


dun chloroplaste dune orchide piphyte Bulbophyllum fischeri Reichenb. f.
Grossissement 30 000. (Clich : Tlpova-Texier, Institut Komarov, Saint-Ptersbourg.)

Pour dcrire les chloroplastes, il existe une terminologie maintenant classique dont
les termes ont t prciss voici quelques annes par plusieurs auteurs dont Nougarde
(1969), Ledbetter et Porter (1970), Gunning et Steer (1974). Le chloroplaste est
87

9782100544141-Laberche.fm Page 88 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

limit par une double membrane. Lexterne est continue, tandis que linterne prsente
parfois des invaginations dans le stroma. En coupe longitudinale on observe dabord
une organisation avec des grana comprenant chacun des disques granaires quon
appelle aussi saccules, ou thylacodes. Ces grana, qui peuvent tre constitus de 2
100 disques, sont relis les uns aux autres par des lamelles stromatiques dont lensemble
forme un rseau continu. Le stroma contient aussi des ribosomes ainsi que de lADN
circulaire. La structure des membranes granaires est particulirement complexe. Ils
contiennent les molcules de chlorophylle. Le principal constituant protique du stroma
est une enzyme, la ribulose-diphosphate-carboxylase (la Rubisco). Dans le stroma sont
disposs des globules lipidiques et au centre du chloroplaste des grains damidon qui
assurent un stockage temporaire de sucres. On peut reprsenter schmatiquement
cette organisation du chloroplaste (fig. 4.16).
membrane externe
membrane interne

stroma

lamelle

thylacode
granum
(ensemble des thylacodes)

Figure 4.16 Reprsentation schmatique dun chloroplaste.

Cest dans les chloroplastes que se passe la photosynthse. Ses diffrents mcanismes
seront tudis dans le chapitre traitant de la nutrition carbone des plantes.
Les chromoplastes
Certains plastes contiennent dautres pigments que la chlorophylle comme des
carotnes (pigments jaunes et orangs) ou de la xanthophylle, (pigment jaune ple).
lls se trouvent dans les cellules de plusieurs fruits colors, comme les tomates ou des
fleurs, comme les roses rouges. Le changement automnal de la couleur des feuilles
est d la dgnrescence de la structure des thylacodes des chloroplastes. Les
carotnodes saccumulent alors dans des plastoglobules.
Les amyloplastes
Dans les cellules des organes de rserves, les dpts damidon seffectuent dans les
amyloplastes. Ce sont des plastes contenant fort peu de membranes internes mais de

88

9782100544141-Laberche.fm Page 89 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

nombreux grains damidon. Le dveloppement de plusieurs grains peut entraner


lclatement de lenveloppe. Lensemble est alors libr dans le cytosol. Chez la
pomme de terre, Solanum tuberosum L. ces grains damidon ont 20 mm de diamtre.

d) Les cytosomes
Les cytosomes appels aussi microbodies , sont des organites cellulaires sphriques
ayant un diamtre denviron 1 mm. Contrairement aux plastes et aux mitochondries,
ils sont limits par une membrane simple. Lintrieur contient un certain nombre
denzymes ce qui permet une classification.
Les lysosomes
Il sagit de vsicules formes par les vsicules de Golgi. Ils contiennent des enzymes
lytiques qui coupent de nombreuses macromolcules comme les polysaccharides et
les acides nucliques. La membrane dun lysosome rsiste laction digestive des
enzymes quil contient. Sil en tait autrement, les enzymes schapperaient dans la
cellule et en dtruiraient le contenu. On observe dailleurs, que les enzymes se mettent
immdiatement dcomposer le cytoplasme ambiant lorsque la membrane du lysosome cde. Ce sont les ribosomes qui produisent les enzymes des lysosomes. Elles
traversent le rticulum endoplasmique et pntrent dans les vsicules de Golgi. Elles
se logent dans les petits sacs qui se trouvent leurs extrmits. Ces sacs grossissent
pour devenir des lysosomes.
Les glyoxysomes
Ce sont des organites cellulaires qui, en collaboration avec les mitochondries, assurent
la transformation des lipides de rserve en glucides.
Les peroxysomes
On les trouve dans les cellules photosynthtiques actives. Ils sont le sige des principales tapes de la photorespiration, en particulier le phosphoglycolate fait lobjet
dune squence de ractions conduisant au dgagement de 2 CO 2.

Dunod La photocopie non autorise est un dlit.

e) Les vacuoles
Les cellules vgtales diffrencies sont caractrises par de grandes vacuoles centrales.
Elles occupent gnralement plus de 40 % du volume cellulaire total et finissent par
repousser tout le contenu cellulaire contre la paroi. Chaque vacuole est entoure dune
membrane vacuolaire, le tonoplaste, produite par le cytoplasme et semblable la
membrane plasmique (plasmalemme).
Chaque vacuole contient un grand nombre de substances en solution : saccumulent
de nombreux mtabolites : des anthocyanes responsables de la coloration des roses,
du sucre dans les cellules de la racine de betterave sucrire, de lacide malique chez les
Crassulaceae (comme la joubarbe), des mtabolites secondaires dont les alcalodes
chez les Solanaceae (comme le tabac). Cette accumulation correspond souvent
une dtoxication du cytoplasme ; lexcrtion vers le milieu extrieur tant le
plus souvent impossible. Elle contient aussi de nombreuses enzymes hydrolytiques,
89

9782100544141-Laberche.fm Page 90 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

dont les hydrolases, qui dcomposent les macromolcules. Les vacuoles assurent un
rle important dans la rgulation du mtabolisme cellulaire mais cest leur action dans
la turgescence des cellules qui est le plus connue. De par ses substances dissoutes, la
solution vacuolaire cre une pression osmotique permettant les mouvements deau.
Leau entre dans la vacuole rendant la cellule turgescente. Ceci contribue grandement
assurer la tenue de la plante.
Le rle capital des soluts vacuolaires chez les vgtaux rsulte avant tout de
leurs proprits osmotiques. Quand dans un systme (fig. 4.17) deux compartiments
contenant lun un solut (A) et lautre, de leau pure (B) sont spars par une membrane
semi-permable laissant passer leau, mais pas les molcules du solut, il se produit
un transfert deau de (B) vers (A), provoquant une augmentation de pression hydrostatique en (A). Elle correspond lattraction quexerce (A) vis--vis de (B). Elle est
aussi appele pression osmotique.

Figure 4.17 Mise en vidence


de la pression osmotique au travers
dune membrane semi-permable.

solut

eau
membrane
(A)
(B)
semi-permable

En gnral, les membranes biologiques ne sont pas rigoureusement semi-permables.


Elles possdent, pour les soluts, une certaine permabilit qui diffre selon leur
nature. Le saccharose ne passe pas au travers des membranes biologiques, on dit alors
quil est rflchi , leffet sur la pression osmotique est maximum. Il nen est pas de
mme pour tous les soluts qui induisent une pression osmotique moins forte (tabl. 4.3).
Tableau 4.3 Coefficients de rflexion des soluts
par rapport aux membranes vgtales.
Saccharose

90

Glucose

0,99

Glycrine

0,80

thanol

0,34

9782100544141-Laberche.fm Page 91 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

Les vacuoles se retrouvent chez les algues et les champignons ainsi que chez
certains protistes aquatiques comme lamibe et la paramcie. Chez ces dernires,
elles se dplacent vers la membrane plasmique, se contractent et rejettent leur contenu
lextrieur, on les appelle des vacuoles contractiles.

4.2.7 La paroi cellulaire


Une originalit du monde vgtal sur le monde animal est la prsence dune paroi
cellulaire situe au-del du plasmalemme. Elle assure la rigidit de la cellule sans pour
autant empcher gnralement leau et les soluts de la traverser pour atteindre le
plasmalemme. Elle constitue un compartiment extracytoplasmique appel apoplasme.
Toutes les cellules ont une paroi primaire (fig. 4.18), comprenant quelques
microfibrilles de cellulose et une lamelle moyenne (dpourvue de cellulose) qui
constitue le ciment assurant la jonction entre les cellules dun tissu. Les cellules de
soutien, comme le sclrenchyme (cf. chapitre suivant) prsentent une cavit centrale
vide (la cellule est morte) et une paroi secondaire paisse. Celle ci est gnralement
compose de trois couches riches en cellulose orientes diffremment : horizontalement
en priphrie et verticalement au milieu (fig. 4.19).
4
1
8
2

1
3

5
7

Dunod La photocopie non autorise est un dlit.

Figure 4.18 Schma dorganisation


des diffrentes parois dans les cellules.
, cavit centrale vide ; , paroi secondaire ;
, paroi primaire ; , plasmodesme ; , noyau ;
, vacuole ; , plasmalemme ; , lamelle
moyenne.

Figure 4.19 Schma tridimensionnel


dorganisation dune paroi cellulaire.
1, Paroi 2, couche 1 ; 2, Paroi 2, couche 2 ;
3, Paroi 2, couche 3 ; 4, Cavit ; 5, Paroi
primaire ; 6, Lamelle moyenne.

La paroi cellulaire est constitue de glucides (90 % de la masse de matire sche)


et de protines (10 %).
Les glucides sont essentiellement des polysaccharides de trois types.
91

9782100544141-Laberche.fm Page 92 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

La cellulose, qui est un polymre linaire et homogne du b-1,4-glucose. Elle


constitue des microfibrilles dont lensemble forme une charpente. La cellulose est
quantitativement le compos le plus rpandu chez les tres vivants. Elle reprsenterait elle seule environ 40 % du carbone fix dans la matire organique terrestre.
La cellulose est produite par des rosettes de cellulose synthase. Ce sont des
protines transmembranaires (cf. figure 4.5) comptant un millier dacides amins,
formant un canal dans la membrane plasmique. Dans le cytoplasme une sucrose
synthase hydrolyse le saccaharose en donnant de luridine diphosphate glucose ; cet
UDP-glucose se greffe au polymre de b1-4 glucose au niveau cytosolique et la
chane de cellulose est progressivement exporte travers le canal transmembranaire.
Des pectines qui sont des mlanges de divers polysaccharides acides. Le plus
frquent est une chane dacide polygalacturonique portant de courtes chanes
latrales constitues dautres sucres comme le ramnose, la galactose ou larabinose.
Des hmicelluloses constitues de polymres doses varis : pentoses, hexoses, oses
mthyls.
Des rles mconnus mais pleins despoirs, pour la paroi primaire
La paroi primaire est une structure trs hydrate (jusqu 90 % deau) constitue
dun rseau lche de microbrilles de cellulose enchsses dans une structure
amorphe composes de substances pectiques hemicellulosiques et protiques. Ces
molcules possdent des groupements hydrophyles, carboxyles, amines, aldhydes,
phosphates, thiols qui peuvent reprsenter des ligands potentiels pour des
lments traces mtalliques. Ainsi, dans des cultures de cellules de tomate (Solanum
lycopersicum L., Solanaceae) Aurlie Muschitz (Thse de doctorat de lUniversit
dArtois, 2009) a montr que la prsence de zinc, de cadmium ou de plomb entrane
une augmentation de la masse paritale. De mme, la paroi primaire apparat dans
tous les cas comme le principal compartiment de squestration des ions mtalliques
en excs.
Ces proprits sont trs intressantes dans les tudes de phytoremdiation.

Les protines de la paroi cellulaire sont des glycoprotines synthtises dans


lappareil de Golgi. Il sagit de chanes polypeptidiques, portant des chanes glucidiques latrales.
Le dveloppement de la paroi cellulaire commence ds la fin de la mitose. Lors
de la tlophase, les microtubules du fuseau chromatique forment une structure en
forme de tonneau transversalement aux deux nouveaux noyaux. En mme temps
saccumulent prs delles des vsicules issues des corps de Golgi et contenant des
glycoprotines. Le contact avec la paroi cellulaire prexistante stablit. La lamelle
moyenne est alors forme. Tout autour saccumulent de nouveaux matriaux formant
alors la paroi primaire.
Laccumulation de ces matriaux est variable dans le temps. Ce sont dabord les
hmicelluloses qui forment des structures lches, propices llongation cellulaire
qui se dposent en premier. Inversement quand les dpts de cellulose deviennent
majoritaires et ce, plus tardivement, ils forment la paroi secondaire. Lagencement
des fibrilles ne permet plus la croissance. Enfin un dpt de lignine peut apparatre.
92

9782100544141-Laberche.fm Page 93 Jeudi, 4. fvrier 2010 3:47 15

4.2 La cellule eucaryotique vgtale

Sil est continu, la paroi devient impermable, la cellule meurt et na plus quun rle
de soutien. La lignine est un polymre htrogne constitu de phnylpropanes. Elle
est associe de faon covalente la cellulose ou lhmicellulose via lacide frulique.
La lignine est un constituant caractristique de la paroi secondaire qui saccumule
juste la limite de la paroi primaire.
Les champignons ont une paroi cellulaire, mais elle nest pas constitue de cellulose
mais de chitine. Elle est quantitativement trs rpandue dans le monde animal
puisquelle constitue llment principal de lexosquelette des insectes. La chitine,
une substance constitue de sous-units dactylglucosamine, a cependant une structure
trs proche de celle de la cellulose.
Pourquoi les champignons ont-ils dvelopp des parois cellulaires
avec de la chitine?
Pour beaucoup dauteurs, il est probable que le constituant majeur de la paroi est
le reet de la disponibilit des organismes en azote et carbone. Pour les plantes
chlorophylliennes, le carbone nest pas un facteur limitant, linverse de lazote. Il
peut donc tre immobilis dans les parois cellulosiques. Chez les champignons
saprophytiques, htrotrophes pour le carbone, mais disposant dimportantes
sources de produits azots, la xation de lazote dans la paroi cellulaire nest pas
alors un handicap.

la fin de ce chapitre, il apparat nettement que la cellule eucaryote est compartimente par les membranes qui dlimitent des entits avec un contrle coordonn
de la permabilit des barrires. Ceci permet une rpartition diversifie du travail
dans la cellule. En tant que systme, la cellule acquiert des proprits que les
compartiments ou organites, ne possdent pas individuellement.
Il apparat aussi, que lon ne peut dissocier structure et fonction, et ceci est valable
tous les niveaux dorganisation, quil sagisse de molcules dans une membrane,
de compartiments dans une cellule, ou comme dans les chapitres suivants, de cellules
dans les tissus, de tissus dans des organes, dorganes dans les organismes, enfin
dorganismes par rapport au milieu environnant quil soit abiotique ou anthropique.
Ltude des structures et des fonctions ne pourra tre disjointe de la dcouverte, mme
partielle du monde vgtal.

93

9782100544141-Laberche.fm Page 94 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 4 Lorganisation cellulaire

Rsum

Toute la matire vivante est compose de cellules trs varies dans leurs fonctions.
Cependant elles ont toutes en commun, une structure de base similaire. Dabord
elles sont entoures par une membrane externe (le plasmalemme). Ensuite
lintrieur, on trouve le cytoplasme et linformation gntique hrditaire sous
forme dADN.
Les cellules se classent en deux types fondamentaux.
1. Les cellules des Procaryotes nont pas de vrai noyau dlimit par une
membrane. Elles correspondent essentiellement aux bactries.
2. Les cellules des Eucaryotes ont un vrai noyau et elles sont compartimentes
par des membranes qui contrlent le passage des substances dans et hors de
la cellule. Elles contiennent aussi diffrentes structures aux fonctions trs
prcises. Ce sont les cellules des vgtaux.
La cellule vgtale classique est entoure dabord dune paroi compose essentiellement de cellulose. Elle dtermine la structure de la cellule ainsi que celle des
tissus.
lintrieur on trouve le cytosol, des organites, une ou des vacuoles et le noyau.
Le noyau est le centre de contrle de toute la cellule. Il est entour dune double
membrane. lintrieur se trouvent les chromosomes. Constitus dADN, ils
portent linformation gntique.
Le cytosol est compos dun rseau dense de doubles membranes : le rticulum
endoplasmique et les dictyosomes du corps de Golgi. Le REG intervient dans la
synthse des protines et leur transport, le REL dans celle des lipides. Quant
aux dictyosomes, ils participent la formation de glycoprotines.
Les organites ont des rles physiologiques trs prcis : mitochondries (respiration), chloroplastes (photosynthse), lysosomes (enzymes lytiques), amyloplastes
(stockage de lamidon).
Les cellules sont entoures dune paroi qui joue un grand rle dans la rigidit
cellulaire.
Enfin, la cellule vgtale eucaryotique se divise au cours de la mitose, en conservant chez chaque cellule-fille, le mme nombre de chromosomes. Cette mitose
comporte quatre grandes phases : la prophase, la mtaphase, lanaphase et la
tlophase.

94

9782100544141-Laberche.fm Page 95 Jeudi, 4. fvrier 2010 3:47 15

LORGANISATION
TISSULAIRE
DE LA PLANTE

Lobservation, la loupe, dun filament dalgue verte filamenteuse dune mare, montre
quil est constitu de cellules sensiblement de mme taille et de mme format. Au
point de vue fonctionnel, il nexiste aucune division du travail le long de ce thalle.
Les cellules sont semblables entre elles, tant sur le plan structural que sur le plan
physiologique.
Au contraire, des observations effectues sur des coupes de tiges, de feuilles de
plantes fleurs, surtout quand elles sont colores, montrent plusieurs ensembles cellulaires facilement identifiables. Ce sont des tissus constitus de cellules aux tailles assez
voisines et aux parois dpaisseur et composition proches.
La coloration au carmino-vert
Trs classique, elle se fait en plusieurs tapes :
vidage des cellules, par de leau de Javel (hypochlorite de sodium) ;
acidication, par de lacide actique ;
coloration par le carmino-vert de Mirande ;
lavage leau.
Les tissus dont la paroi nest pas encore lignie sont colors en rouge, les autres
en vert.

Dunod La photocopie non autorise est un dlit.

5.1 LES

MRISTMES PRIMAIRES

Lembryon dune Angiosperme comporte dj les bauches des futurs mristmes


(du grec meris = partie et stma = filament) caulinaires (des tiges) et racinaires. Ces
mristmes primaires, qui sont lorigine des tissus de la plante, sont situs (fig. 5.1)
chez les Spermaphytes, au niveau de la gemmule et de la radicule.
De la germination jusqu la mort de la plante les mristmes assurent la croissance
en longueur des tiges et des racines. Mme si cette croissance se ralentit parfois, il est
possible de parler de croissance indfinie. Les cellules mristmatiques sont facilement
reconnaissables dans la plante (tabl. 5.1).
Ces mristmes primaires en fonctionnant vont donner des tissus. Ils sont dnomms
tissus primaires pour les diffrencier des tissus secondaires qui apparaissent chez
certaines plantes ultrieurement.
95

9782100544141-Laberche.fm Page 96 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

albumen
tgument
mristme caulinaire
cotyldon
embryon
tigelle

mristme radiculaire

Figure 5.1 Graine de striga (Striga


hermontica) (Del.) Berth observe
en microscopie lectronique balayage
(coupe longitudinale).
(Clich: J. Par, Universit
de Picardie-Jules Verne.)

0,1 mm

Le striga, ou herbe des sorcires, est un redoutable parasite


Les Striga, plantes de la famille des Scrophulariaceae, se situent au tout premier
plan des parasites vgtaux par les ravages quils occasionnent dans les cultures
vivrires des rgions tropicales sches, compromettant trs srieusement les cultures
et les rcoltes des crales en particulier.

Tableau 5.1 Les caractristiques des mristmes primaires.

96

Localisation

aux extrmits des tiges et des racines

Rles

assurent la croissance en longueur

Cellules

petites, isodiamtriques

Noyau

sphrique, volumineux, au centre de la cellule, trs riche en


chromatine

Cytoplasme

dense abondant

Vacuoles

nombreuses et trs petites, contenu trs concentr

Paroi

paroi pecto-cellulosique

Plastes

plastes non diffrencis, proplastes

Inclusions lipidiques

peu nombreuses

9782100544141-Laberche.fm Page 97 Jeudi, 4. fvrier 2010 3:47 15

5.2 Les diffrents tissus primaires

Ces tissus primaires constituent la tige et les feuilles des Bryophytes, le cormus et
les racines des Ptridophytes, les organes jeunes des Spermaphytes et les organes jeunes
et gs des Monocotyldones.

5.2 LES

DIFFRENTS TISSUS PRIMAIRES

Les tissus primaires sont nombreux. Il est possible cependant de les regrouper en
cinq catgories :
les parenchymes ;
les tissus de revtement ;
les tissus conducteurs ;
les tissus de soutien ;
les tissus scrteurs.
Dans chaque catgorie plusieurs types sont observables. Cest ce que montre le
tableau 5.2.
Tableau 5.2 Les diffrents types de tissus primaires .
Tissus

Types de cellules

Forme des cellules

Paroi

Localisation

PARENCHYMES
Ce sont les tissus fondamentaux. Ils sont le sige de toutes les fonctions de synthse.
Intrieur
des feuilles

Chlorenchyme
Parenchyme
de rserve

Cellules vivantes

Cellules
isodiamtriques
ou allonges

Paroi
peu diffrencie
nombreux mats

Parenchyme
aquifre

Racines,
tubercules
Plantes
succulentes

TISSUS DE REVTEMENT
Ils isolent les parenchymes du milieu extrieur.
piderme
Rhizoderme

Vivantes,
peu diffrencies

Une seule assise

Paroi externe
paissie

Sur les organes


ariens

Poils absorbants

Paroi mince

Assise pilifre
de la racine

Dunod La photocopie non autorise est un dlit.

TISSUS

CONDUCTEURS

Le xylme
assure la circulation de la sve brute.

Traches
(vaisseaux)
Mortes
en n de
diffrenciation
Trachides

Un vaisseau est
constitu de cellules
assez courtes
disposes bout
bout et parallles
entre elles

Paroi primaire
rigide. La secondaire est constitue danneaux
spirals. Perforations sur les cots

Chaque trachide
est constitue de
cellules allonges
et parallles.
Les extrmits
sont en biseau

Paroi rigide mais


peu paisse. Paroi
secondaire constitue danneaux et
de spires, ponctuations sur les parois

Localisation
profonde

97

9782100544141-Laberche.fm Page 98 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Tableau 5.2 Les diffrents types de tissus primaires (suite) .


Tissus

Types de cellules

Forme des cellules

TISSUS

Paroi

Localisation

CONDUCTEURS (SUITE )

Le phlome
assure la circulation de la sve labore.

Tubes cribls

Cellules
compagnes

Vivantes,
sans noyau quand
diffrencies

Cellules allonges,
dans le sens
longitudinal.
Aux parois obliques.
Places bout bout

Parois paisses
pectocellulosiques.
Les parois
transversales sont
cribles de pores

Vivantes

Une cellule troite


allonge le long
du tube cribl

Parois
cellulosiques,
non cribles

TISSUS

Localisation
profonde

DE SOUTIEN

Collenchyme

Vivantes,
plastes peu
diffrencis

Cellules,
recloisonnes
pourvues
dun noyau

Fibres
libriennes

Mortes

Cellules
trs allonges

Paroi paisse,
ponctuations

ct
des tubes cribls

Fibres
ligneuses

Mortes

Cellules
trs allonges

Paroi paisse,
ponctuations
peu nombreuses

ct
des vaisseaux

Vivantes

Jusqu 50 cm
de longueur

Se distinguent
du collenchyme
par la prsence
dune paroi
secondaire

Fibres ct
du phlome

Mortes

Grand allongement
parallle laxe de
lorgane. Plusieurs
cm de longueur

Paroi lignie,
paisse

Se dveloppent
dans les organes
dont lallongement est termin

Paroi pectocellulosique

Parenchymes
corticaux de
tiges, parenchymes foliaires

Fibres
cellulosiques

Sclrenchyme

TISSUS
Cellules
isoles

Vivantes,
accumulent dans
les vacuoles les
produits labors

Canaux
excrteurs

Vivantes,
excrtent
les produits
labors dans
des poches
et des canaux

Paroi primaire
paissie,
cellulosique

la priphrie
des parties
ariennes

DE SCRTION

Isodiamtriques

Paroi
cellulosique

Tous ces tissus, mme sils sont prsents par commodit de manire isole, doivent
tre considrs comme fonctionnant ensemble. Ils constituent une unit fonctionnelle.
La conduction de la sve brute dans les trachides et les vaisseaux ligneux exige en
effet laction du parenchyme voisin. Les tissus de soutien ralisent une armature
98

9782100544141-Laberche.fm Page 99 Jeudi, 4. fvrier 2010 3:47 15

5.3 Le fonctionnement des mristmes

interne au vgtal. Ceci lui confre une solidit, mais aussi une certaine souplesse,
surtout quand la paroi des cellules reste cellulosique comme dans le collenchyme.
linverse le sclrenchyme est un tissu trs rigide et indformable qui se forme dans
la plante une fois son dveloppement termin.

5.3 LE

FONCTIONNEMENT DES MRISTMES

CHEZ LES

ANGIOSPERMES

Avant de commencer quelques prcisions terminologiques :


Lapex est une notion morphologique qui correspond lextrmit dune tige ou
dune racine.
Le mristme est le tissu indiffrenci qui assure la production dorganes nouveaux
(feuilles, racines, fleurs).
Un mristme apical se trouve lextrmit dune tige ou dune racine donc lapex.
Aux apex apparaissent les nouveaux organes grce au fonctionnement des mristmes. Ceux-ci sont de deux types : les mristmes apicaux caulinaires lorigine
des parties ariennes et les mristmes apicaux racinaires pour lappareil souterrain.
Ils fonctionnent de manire trs diffrente.

Dunod La photocopie non autorise est un dlit.

5.3.1 Le fonctionnement du mristme caulinaire


Le mristme caulinaire (de la tige) est responsable de ldification de la partie arienne
de la plante. De lui, apparaissent des cellules qui en se multipliant et en se diffrenciant
donneront les feuilles, les bourgeons axillaires et floraux et les tiges. De manire,
tout fait rptitive et indfinie, jusqu la mort de la plante, il engendre la formation
des phytomres, constitus dun axe (ou entre-nud) dune ou plusieurs feuilles (cas
des feuilles opposes comme chez lrable) et dun bourgeon axillaire. Ltude du
fonctionnement de ce mristme a donn lieu de trs nombreuses recherches.
lheure actuelle, plus personne ne reconnat lexistence dune cellule unique apicale,
comme semblait lavoir vue Hofmeister au sicle dernier. la suite des travaux de
Buvat, Plantefol, Nougarde et de leurs quipes, pour ne citer que quelques botanistes
franais, on sait maintenant que le mristme apical nest pas constitu dun simple
empilement de cellules, mais en ralit de plusieurs zones sans limites trs nettes.
Chez les Angiospermes, ce mristme forme un dme (plus rarement une structure
plate), de 0,5 3 mm de diamtre, compos de cellules de petite taille non quivalente.
Comme la prcis chez le chrysanthme A. Nougarde 1, la section centrale du
mristme rvle, aprs coloration des ARN au vert de mthyle-pyroxile (qui permet
de montrer lactivit mtabolique des cellules), trois rgions (fig. 5.2) :

1. A. Nougarde, 2001. Le mristme caulinaire des Angiospermes : nouveaux outils, nouvelles


interprtations . Acta Botanica Gallica, 148, 3-77.
99

9782100544141-Laberche.fm Page 100 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Za
C

T2

T1
dp
ZLF

ZL

Mm

Figure 5.2 La zonation dans


une coupe longitudinale axiale
du mristme vgtatif
caulinaire de chrysanthme
(Chrysanthemum segetum L.).
Explications dans le texte.
(Daprs A. Nougarde, modifi.)

Une zone axiale, Za, trs peu active quant aux mitoses, avec deux couches superficielles, les tunicas T1 et T21 et le corpus, C, sous-jacent.
Une zone latrale, ZL entourant cette zone axiale, Za, la partie droite correspond
lapparition dune feuille, ZLF. On distingue des divisions priclines, dp, (les
cloisons sont parallles la surface)
Un mristme mdullaire, Mm, aux mitoses peu frquentes formant des files
empiles de cellules lorigine de la moelle centrale, M.
Zones ou assises?
Le mristme vgtatif peut aussi tre dcrit en faisant appel une structuration
en assises. Lassise supercielle, tunica (T1), tout autour du mristme se distingue
par ses divisions strictement anticlines (cloisons perpendiculaires la surface).
Elle est lorigine de lpiderme. La tunica T2, initie les feuilles par cloisonnements
priclines. Enn, la tunica T3, situe au dessous donne les tissus centraux de la
tige et des feuilles. Dans cette couche, les mitoses seffectuent dans tous les sens.
Par rapport au chrysanthme, prcdemment dcrit, T3 correspond au corpus.

Les zonations ne sont pas immuables, lorsque les cellules de lune delle sont
dtruites, naturellement ou exprimentalement, elles sont remplaces par les cellules
de lassise voisine et adoptent le modle de division cellulaire de leur situation
nouvelle. La destine des cellules ne dpend donc pas de leur origine initiale mais de
leur position.
Organisation cellulaire des mristmes
Les cellules de la zone axiale ont un volume cellulaire moyen nettement suprieur
celui des cellules latrales. Le cytoplasme et les vacuoles occupent des espaces
pratiquement similaires, seuls les noyaux sont importants. Dans la zone latrale,
les vacuoles sont trs petites. Quant la dure du cycle cellulaire (temps entre
deux mitoses), elle est la plus longue dans la zone axiale, la plus courte dans la
zone latrale et de dure intermdiaire dans le mristme mdullaire.

1. Dans la littrature anglo-saxonne, T1 et T2 sont remplacs par L1 et L2, L tant labrviation du


mot anglais layer (couche).
100

9782100544141-Laberche.fm Page 101 Jeudi, 4. fvrier 2010 3:47 15

5.3 Le fonctionnement des mristmes

La formation dun phytomre comprend lapparition dune ou plusieurs feuilles, du


ou des bourgeons axillaires et de lallongement de la tige. Chaque tape correspond
un fonctionnement particulier de lapex caulinaire :
Linitiation foliaire correspond un largissement de la zone latrale ZLF qui
produit un initium foliaire. Provenant de divisions essentiellement priclines, cet
initium une forme de croissant qui par surrection va grandir et donner lbauche
foliaire (fig. 5.3). Le fonctionnement du mristme est donc priodique, il se
produit une alternance rgulire entre une croissance horizontale (initium foliaire)
et verticale (bauche foliaire).
Le bourgeon axillaire est dorigine superficielle exogne, car cest dans les cellules
des tunicas quil se diffrencie.
La formation de la tige est lie lactivit du mristme mdullaire, au centre du
dme.
Mais lorganisation dun phytomre obit aussi des lois tout fait originales qui
ont intrigu et intressent encore de nombreux scientifiques. Il sagit de cette organisation spatiale, appele phyllotaxie, qui sdifie autour dune spirale durant la mise
en place des feuilles. Celle-ci varie dune espce lautre et semble dpendre de
contraintes physiques mais aussi de ractions biochimiques qui, en dfinitive, dterminent le lieu dapparition dune nouvelle feuille sur la zone latrale. Les interactions
entre ces paramtres physiques et les gnes impliqus dans la phyllotaxie ne sont
pas encore connus. Le stade de dveloppement physiologique de la plante peut
entraner des modifications dactivit du mristme caulinaire. Le changement le plus
spectaculaire correspond la floraison.

Dunod La photocopie non autorise est un dlit.

ZLF

croissance horizontale :
initium foliaire

croissance verticale :
bauche foliaire

Figure 5.3 Fonctionnement dun apex caulinaire.


La mise en place des tissus se fait en deux temps : une croissance horizontale a,
puis verticale, b.
ZLF : zone latrale foliaire.

101

9782100544141-Laberche.fm Page 102 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Les gnes du fonctionnement


La biologie molculaire, particulirement sur Arabidopsis thaliana, a apport de trs
intressants renseignements sur les gnes qui interviennent lors du fonctionnement
du mristme caulinaire. Globalement deux types de gnes sont connus1 :
1. Ceux qui xent lidentit des cellules mristmatiques. Il sagit des gnes STM2,
KNATI, WUS qui maintiennent les cellules dans un tat non organogne. Ils ne
sont actifs que dans la zone centrale et inactifs dans la zone latrale. Leur
mode daction est particulirement intressant : la protine code par ces gnes
(dnomme homodomaine car implique dans le dveloppement de lorganisme) se xe sur lADN et rgule la transcription des gnes cibles. La majorit de
ces gnes fonctionne lors des diffrentes phases du dveloppement, ce qui
signie quils sont sous le contrle de mcanismes rgulateurs communs.
2. Ceux qui dterminent le devenir organogne des cellules de la zone latrale. Le
nombre de feuilles formes dpend dabord de la quantit de cellules disponibles. Ce sont les rles des gnes STM et CLV. Le devenir organogne dpend
aussi de la manire dont les cellules se rpartissent entre les bauches. Cette
fois, cest le rle du gne MGOUN. Ces gnes limitent la dimension de la zone
latrale et contrlent donc le nombre de feuilles mises. Il est probable aussi,
que les gnes NFL et LeExp 18 xent les limites des sites dinitiation foliaire alors
que les gnes PHAN et PHB dterminent trs tt la destine respectivement
ventrale ou dorsale des cellules des initiums foliaires, bien avant leur diffrenciation apparente.

5.3.2 La transformation du mristme apical


en mristme floral
Sous laction de signaux encore mal identifis, mais qui pourraient tre lis deux
protines sensibles la lumire, un phytochrome et un cryptochrome, le mristme
caulinaire se transforme soit en mristme floral, lorigine dune fleur unique, soit
en mristme dinflorescence, qui son tour produira des mristmes floraux. Ce
changement saccompagne de modifications exceptionnelles : un systme croissance
indfini comme le mristme apical, devient dfini, puisque, une fois la morphogense
florale termine, le mristme cesse toute activit et disparat la chute des fleurs ou
des fruits.
Ces transformations correspondent un ralentissement dactivit de la zone latrale
(ZL) qui pourtant donnera les spales, premires pices florales apparaissant, tandis
que le corpus prolifre abondamment en mettant en place ce qui deviendra le rceptacle
floral. La tunica 2 sera lorigine des pices florales reproductrices dou son nom de
promristme sporogne. La formation des ptales, des tamines et du pistil, sans
tre vritablement simultanes, interfre largement entre elles. Les ptales apparaissent
au dessus et entre les spales. Landroce se met en place partir dun bourrelet do
mergent les tamines. Quand il y plusieurs cycles dtamines, ils apparaissent
1. Daprs A. Nougarde (ouvrage cit page 99).
2. Le nom des gnes correspond gnralement laction constate sur un mutant. Les gnes STM
(de shootmeristemless) correspondent ainsi des perturbations du mristme.
102

9782100544141-Laberche.fm Page 103 Jeudi, 4. fvrier 2010 3:47 15

5.3 Le fonctionnement des mristmes

successivement sur des bourrelets, gnralement plus internes. Quant au futur gynce,
sa formation se manifeste par lapparition de massifs sur lesquels les ovules se dvelopperont, entours de bourrelets qui difieront les carpelles lesquels enfermeront plus
tard les ovules.

5.3.3 Le fonctionnement du mristme racinaire


Lallongement de la racine se fait par son extrmit au niveau du mristme racinaire.
Celui-ci est dun fonctionnement plus simple que le mristme caulinaire. lextrmit des racines, on distingue une coiffe, qui protge le mristme (fig. 5.4a). Entre
celle-ci et les poils absorbants, on observe une zone quiescente (sans division cellulaire), autour de laquelle on peut remarquer de trs nombreuses divisions cellulaires
qui sont lorigine des tissus de la racine (fig. 5.4b, c et d.).

cylindre central
rhizoderme
zone de croissance
et diffrenciation
des tissus

cortex

zone de division
cellulaire

zone
quiescente

coiffe

Dunod La photocopie non autorise est un dlit.

Figure 5.4 Fonctionnement


du mristme racinaire.
a, zonation schmatique (daprs Roland) ; b, cellules proches de lextrmit racinaire, encore plus ou
moins indiffrencies ; c, plus haut, la taille de
plusieurs cellules augmente : ce sont celles qui
formeront les tissus conducteurs ; d, encore plus
loin de lextrmit, on constate une trs nette
diffrenciation cellulaire, les vacuoles augmentent
de volume ; des cellules au centre, inversement,
sallongent grandement et se vident : un vaisseau
est en train de se former.

b
103

9782100544141-Laberche.fm Page 104 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Les mristmes qui sont lorigine des racines secondaires sont forms en
profondeur, ce qui prsuppose une ddiffrenciation cellulaire pralable des tissus
(fig. 5.5). Lorigine endogne des racines secondaires soppose lorigine exogne
des rameaux.

parenchyme
cortical

meristme
secondaire

Figure 5.5 Photographie dune coupe transversale dune racine


de datura innoxia Mill. au niveau dune ramification secondaire.
On distingue parfaitement le mristme secondaire endogne ( 100). Coloration
Schiff + Naphtol-Blue-Black. (Clich J.-C. Laberche, BioPi-UPJV.)

Lobservation des mristmes caulinaires et racinaires montre donc que :


dans les bourgeons la multiplication des cellules mristmatiques permet la mise
en place de nouveaux nuds avec des bauches foliaires et dentre-nuds trs
courts. Ceci permet la croissance terminale de la tige ;
la multiplication des cellules mristmatiques de lapex racinaire entrane aussi
une croissance terminale, mais sans construction de nouveaux organes, la racine
tant toujours sans feuille ;
dans les deux cas, la persistance de mristmes primaires aux points vgtatifs permet
une croissance thoriquement indfinie. Il nen est pas de mme de la feuille, car son
mristme a une vie limite dans le temps. La feuille est un organe croissance
dfinie contrairement la tige et la racine.

5.4 LA STRUCTURE PRIMAIRE DES ORGANES VGTATIFS


Les cellules issues des divers mristmes primaires vont se diffrencier et sorganiser
en tissus primaires. Ceux-ci adoptent une position prcise dans les plantes (fig. 5.6).
Plutt que de considrer lensemble des tissus, Van Tieghem et Douliot (1885) se
sont intresss seulement aux tissus conducteurs qui sorganisent de manires trs
diffrentes selon les plantes. Ils ont donn le nom de stle cette structure primaire
dans les plantes. Le tableau 5.3 rsume les diffrentes stles que lon peut rencontrer.
104

9782100544141-Laberche.fm Page 105 Jeudi, 4. fvrier 2010 3:47 15

5.5 La structure des organes jeunes chez les Spermaphytes

p
pr
Px

600
env.

zone du maximum
dintensit dlongation

Figure 5.6 Mise en place des diffrents


Pxi
Ph

tissus dans une racine de tabac


en fonction de lloignement
par rapport au mristme radiculaire.
e, endoderme ; p, pricyle ; Pxi, protoxylme en
voie de diffrenciation ; et Px, dnitivement diffrenci ; Phi, phlome en cours de diffrenciation ;
et Ph, compltement diffrenci ; Co, coiffe ; pr, poils
absorbants. (In Guinochet, 1965.)

Phi
300
env.

Co

Tableau 5.3 Les diffrentes formations constitues de tissus conducteurs (les stles).
Stle sans
parenchyme
central

Dunod La photocopie non autorise est un dlit.

Stle avec
parenchyme
central

Protostle

xylme cylindrique plein entour de phlome

Actinostle

colonne de xylme cannel en toile (arche)

Plectostle

colonne de xylme polyarche envahie par du phlome

Siphonostle

manchons cylindriques embots de xylme et de phlome

Solnostle

siphonostle plus ou moins ajoure

Eustle

fragmentation de la stle

Cette structure primaire ne subsiste pas longtemps chez la majorit des vgtaux
sauf chez les Monocotyldones. Elle caractrise les organes jeunes chez les Gymnospermes et les Dicotyldones. Puis, elle est supplante par des formations secondaires
qui les crasent et les disloquent.

5.5 LA

STRUCTURE DES ORGANES JEUNES


CHEZ LES SPERMAPHYTES

La diversit des tiges, des feuilles et des racines est si grande quil est impossible de
voir en dtail toutes les structures. Seuls quelques exemples seront prsentes.
105

9782100544141-Laberche.fm Page 106 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

5.5.1 La structure de la racine


Sur des coupes effectues au niveau des poils absorbants, on distingue de lextrieur
vers lintrieur plusieurs structures (fig. 5.7).

En

En

Pe

Ph
Pe

Xy

Pm
Xy

Pc
rh

Figure 5.7 Schma tridimensionnel dune racine jeune


au niveau de la zone plifre.
rh, rhizoderme ; Pc, parenchyme cortical ; En, endoderme ; Pe, pricycle ; Xy, xylme ;
Ph, phlome ; Pm, parenchyme mdullaire. (Daprs Luttge, 1994, modi.)

La racine prsente une symtrie axiale et une structure bien dfinie quil est facile
de reconnatre.
Les poils absorbants sont les prolongements des cellules du rhizoderme. Chaque
poil absorbant (on dit aussi trichoblaste, ou simplement poil racinaire) est constitu dune seule cellule trs allonge grande vacuole, dont les parois permettent
labsorption de leau et des sels minraux. La prsence de ces nombreux poils
permet daugmenter considrablement la surface dabsorption de la racine. Ces poils
absorbants ont une vie transitoire correspondant la croissance de la racine et
meurent trs vite. Ils sont remplacs par dautres au fur et mesure de la croissance
de la racine, ce qui fait que la zone pilifre est globalement toujours de la mme
taille. Ils ont un diamtre de 12 15 micromtres de diamtre et de 1 plusieurs
millimtres de long. Il peut y avoir jusqu 2 000 poils par cm2 de surface racinaire.
Cependant ces poils ne se trouvent pas chez toutes les plantes ; par exemple, chez
le cocotier, Cocos nucefera de la famille des Palmaceae, les radicelles sont
dpourvues de poils absorbants.
Le parenchyme cortical est form de cellules laissant entre elles dimportants
mats. Il est constitu de cellules jointives paralllpipdiques, allonges dans le
106

9782100544141-Laberche.fm Page 107 Jeudi, 4. fvrier 2010 3:47 15

5.5 La structure des organes jeunes chez les Spermaphytes

sens de laxe de la racine. la paroi cellulosique sajoute un cadre subrifi, sur


quatre des six faces du paralllpipde. Au niveau du cadre, ladhrence du cytoplasme la paroi est trs forte. Ceci oblige les substances dissoutes qui arrivent
ce niveau de traverser le cytoplasme, do un contrle, par ces cellules des ions
et autres substances absorbs. La rgion la plus interne du cylindre cortical est
lendoderme, qui constitue un anneau unistratifi. Les cellules sont en forme de
paralllpipde dont les parois axiales sont minces mais dont les parois radiales
possdent un paississement formant les bandes de Caspary constitues de lignosubrine, impermable leau.
Le cylindre central est limit par une couche mince de parenchyme, aux cellules
jointives et aux parois minces, le pricycle. Plus au centre, des vaisseaux de xylme,
facilement reconnaissables par leur paisse paroi. Ils alternent rgulirement et sur
un seul cercle, avec les tubes cribls du phlome. Les uns et les autres reprsentent
le tissu conducteur de la racine. Cest dans ce tissu que circulent la sve brute (dans
le xylme) et la sve labore (dans le phlome). La partie centrale est un parenchyme mdullaire en partie remplac par des cellules mortes de sclrenchyme.
Les cellules du xylme ont des tailles diffrentes selon leur emplacement dans le
cylindre central. Prs du pricycle, elles sont jeunes et petites. Vers le centre, elles
sont grandes et ges. La diffrenciation du xylme est centripte. Les cellules
formes le plus tt sont repousses vers lintrieur de la racine. Mme si ceci est
moins visible, il en est de mme pour le phlome.

5.5.2 La structure de la tige


La tige reprsente larmature de la partie arienne de la plante. Chez la renoncule
cre (Ranunculus acrilis L., Ranunculaceae) la coupe transversale dune tige jeune
(fig. 5.8) prsente plusieurs zones.
stomate
piderme

Dunod La photocopie non autorise est un dlit.

parenchyme
cortical
ple de formation du phlome
protophlome
mtaphlome
mtaxylme

phlome
faisceau criblovasculaire
xylme

protoxylme
ple de formation du xylme

Figure 5.8 Schma dune coupe transversale de tige jeune


de renoncule cre (Ranunculus acrilis L.).

107

9782100544141-Laberche.fm Page 108 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Lpiderme, constitu dune couche de cellules juxtaposes. Leur paroi est peu
paisse et elles ne contiennent pas de chloroplaste.
Le parenchyme cortical, compos de grandes cellules polydriques. Les cellules
de la priphrie renferment des chloroplastes, mais leur nombre diminue au fur et
mesure quon senfonce vers lintrieur.
Les tissus conducteurs rassembls en amas superposs de xylme et de phlome.
Le xylme, vers le centre de la tige, est coiff, vers lextrieur, par le phlome. Ce
sont les faisceaux criblovasculaires (parfois encore appels faisceaux libroligneux).
Les diamtres des cellules de xylme ne sont pas identiques. Ils diminuent au
fur et mesure que lon se rapproche du centre. Les plus anciens, constituant le
protoxylme (de protos = premier), sont repousss vers lextrieur du faisceau. Leur
diffrenciation est centrifuge. Les vaisseaux plus rcents du xylme, formant le
mtaxylme (le prfixe mta indique une succession), sont vers le centre. Les caractres de ces deux cellules de xylme sont diffrents comme le montre le tableau 5.4.
Tableau 5.4 Caractres du protoxylme et du mtaxylme.
Protoxylme

Mtaxylme

Apparat quand la tige est en croissance

Apparat quand la croissance de la tige est termine

Premier form

Succde au protoxylme

Trachides anneles et spirales

lments rticuls

lments souvent crass

lments persistants

Le phlome lui non plus nest pas homogne, mme si les diffrences entre les
cellules sont moins marques. Il est possible de distinguer du protophlome et du
mtaphlome. La diffrenciation du phlome est centripte ; le protophlome apparat
sur la face externe du faisceau et ses tubes cribls, comme ceux du mtaphlome, se
diffrencient rgulirement de la priphrie vers le centre. Cependant les premiers
mis en place prcocement sont tirs, crass et finalement rsorbs. linverse les
seconds apparus plus tardivement persistent beaucoup plus longtemps.
Ces observations correspondent une tige jeune de Dicotyldone. Mais trs rapidement des formations secondaires vont apparatre et compliquer ces structures. Chez
les Monocotyldones, o il ny a pas de formations secondaires ces structures sont
dfinitives. On retrouve donc de lextrieur vers lintrieur : lpiderme, un parenchyme
o il est impossible de sparer le cylindre central du parenchyme cortical, plusieurs
cercles concentriques de faisceaux criblovasculaires, un anneau de sclrenchyme
qui entoure le cercle externe des faisceaux ; une zone centrale souvent lignifie.

5.5.3 La structure de la feuille


Une tude (fig. 5.9) de la structure dun limbe foliaire de houx (Ilex aquifolium L.
Aquifoliaceae) montre tout dabord un parenchyme chlorophyllien trs important.
Cest l en effet que se droule la photosynthse.
108

9782100544141-Laberche.fm Page 109 Jeudi, 4. fvrier 2010 3:47 15

5.5 La structure des organes jeunes chez les Spermaphytes

cuticule
piderme suprieur
parenchyme palissadique

faisceau criblovasculaire
sclrenchyme

lacune

parenchyme lacuneux
piderme infrieur
stomate

Figure 5.9 Schma dune coupe transversale

Dunod La photocopie non autorise est un dlit.

de feuille de houx (Ilex aquifolium L.).

De la face suprieure la face infrieure, on distingue plusieurs couches.


Un piderme suprieur fait de cellules, sans chloroplaste, rgulirement disposes
les unes ct des autres. Lpiderme est doubl extrieurement dune fine cuticule.
Une couche dune ou plusieurs ranges de hautes cellules, abondamment remplies
de chloroplastes. Les anatomistes, lui ont donn le nom de parenchyme palissadique.
Une couche de parenchyme lacuneux, constitu de cellules moins rgulires, peu
jointives et laissant entre elles dimportantes lacunes. Ces cellules sont plus pauvres
en chloroplastes, surtout vers le centre de la feuille.
Des tissus conducteurs superposs, les faisceaux criblovasculaires, sont identiques
ceux observs dans la tige. Ils sont en ralit, la suite de ceux de la tige et du ptiole
et correspondent aux nervures du limbe. Des formations secondaires apparatront
rapidement.
Par rapport aux Dicotyldones, les Monocotyldones comme les Poaceae (le bl,
le mas), les Liliaceae (le lis), les Plantaginaceae (le plantain) prsentent des
diffrences de structures quil faut noter (tabl. 5.5).
Les structures dcrites pour la racine, la tige et la feuille ne sont pas immuables.
Quand on observe une coupe, on voit des structures qui correspondent des zones
prcises et un ge donn de la plante. Il faut imaginer que toutes ces structures
sorganisent dans lespace au cours du dveloppement.
On ne peut opposer, la disposition alterne de la tige et la disposition superpose de
la feuille. Lorganisation fondamentale de ces organes est la mme mais la disposition
spatiale de leurs vaisseaux conducteurs volue diffremment selon lemplacement
dans la plante, surtout quil ny a pas continuit, mais juxtaposition, des vaisseaux
des racines vers les tiges et les feuilles.
109

9782100544141-Laberche.fm Page 110 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Tableau 5.5 Diffrences structurales entre les feuilles de Monocotyldones


et de Dicotyldones.
Monocotyldones

Dicotyldones
LIMBE

SYMTRIE BILATRALE

PIDERME
Peu ou pas de stomates sur la face infrieure

Stomates rpartis gnralement sur les 2 faces

PARENCHYME CHLOROPHYLLIEN
Cellules isodiamtriques, peu chlorophylliennes, sans mats
Prsence frquente de collenchyme et de sclrenchyme
homogne

htrogne
parenchyme palissadique
parenchyme lacuneux

TISSUS CONDUCTEURS
Un ou plusieurs faisceaux criblovasculaires
Faisceaux criblovasculaires
Xylme et phlome superposs
Xylme vers la face ventrale de la feuille
Phlome vers la face dorsale de la feuille
Nervures parallles constitues dun faisceau
unique, trs souvent uni lpiderme dorsal
par les bandes des bres sclries.
PTIOLE

Nervures ramies constitues dun ou


plusieurs faisceaux de xylme interne et de
phlome externe, entours de tissus de soutien

SYMTRIE BILATRALE

PIDERME
Cutinis, stomatifre

5.6 LES

FORMATIONS SECONDAIRES

Si les mristmes primaires sont lorigine de la mise en place des tissus primaires,
des mristmes secondaires apparatront dans ces structures primaires. Dnomms
cambiums, ils sont lorigine de tissus secondaires, appels formations secondaires.
Elles permettent la croissance en paisseur de certaines Cormophytes. Les Bryophytes
et les Angiospermes Monocotyldones nen possdent pas.

5.6.1 Les mristmes secondaires


Dans les plantes on trouve deux mristmes secondaires qui se diffrencient tardivement.
1. La zone gnratrice libro-ligneuse, ou cambium, responsable de la formation
du xylme secondaire (le bois) et du phlome secondaire (le liber).
2. La zone gnratrice subro-phllodermique, ou assise subro-phllodermique1,
responsable de la formation de lige et de phelloderme (fig. 5.10).
1. Pour certains auteurs on devrait dire cambium et non assise subro-phllodermique ou encore
phellogne.
110

9782100544141-Laberche.fm Page 111 Jeudi, 4. fvrier 2010 3:47 15

5.6 Les formations secondaires

piderme

suber (lige)
assise subrophellodermique

formation secondaire
de lcorce

phelloderme
collenchyme
parenchyme cortical

phlome secondaire
(liber)
cambium

formation secondaire
du cylindre central

xylme secondaire
(bois)

Figure 5.10 Schma dune coupe transversale de tige ge


de sureau (Sambucus nigra L.).
Il montre les deux zones lorigine des tissus secondaires. Ceux-ci sont constitus
de cellules sries, alors que les formations primaires sont faites dlments alterns.

Dunod La photocopie non autorise est un dlit.

Dans la tige, le cambium apparat trs tt au niveau des faisceaux criblovasculaires.


Il faut partir de ces ensembles pour comprendre sa localisation et son fonctionnement.
Entre le xylme et le phlome primaires se trouvent coinces quelques cellules qui
sont lorigine du cambium. Ce cambium produit du bois centripte et du liber
centrifuge donc selon des gradients contraires au xylme et au phlome. Plus tard
la suite dune ddiffrenciation des cellules du parenchyme mdullaire apparaissent
des arcs de cambium interfasciculaires. qui peuvent relier entre eux les faisceaux et
constituer un manchon mristmatique continu (fig. 5.11).
Dans la racine, alors que lvolution vasculaire primaire nest pas encore dtermine,
des cellules situes sur la face interne des faisceaux de phlome entrent en division
et mettent en place des arcs cambiaux discontinus. Plus tard au niveau des ples du
xylme, des cellules se ddiffrencient et construisent de nouveaux arcs cambiaux.
Ceux-ci se raccordent aux massifs prcdents ralisant un manchon cambial continu
comme dans la tige. Lapparition de lassise subro-phllodermique est toujours beaucoup plus tardive. Chez les plantes herbaces, elle est mme souvent absente. Dans
la tige, lassise subro-phellodermique se diffrencie dans la couche de parenchyme
(ou de collenchyme) cortical, sous-pidermique. Rapidement se forme un manchon
continu en priphrie de la tige. Les cellules de ces deux mristmes ont des caractristiques bien prcises (tabl. 5.6).
111

9782100544141-Laberche.fm Page 112 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Type de tissus

Primaires

Secondaires

Protection

piderme

Lige

Nutrition

Parenchyme

Phelloderme

Soutien

Collenchyme

Soutien

Sclrenchyme

Conduction

Xylme

Bois

Conduction

Phlome

Liber

Multiplication

Mristme

Cambrium

Figure 5.11 Les deux types de structures secondaires reprsents


selon les conventions habituelles dans les tiges.
a, cambium continu ; b, cambium fasciculaire ; c, reprsentation conventionnelle.

Le fonctionnement de ces assises est trs particulier. Les cellules mristmatiques


se divisent sur leur face interne et externe mettant en place des files de cellules filles.
Lpaisseur de la zone cambiale reste identique et ce sont les cellules-filles qui se
diffrencient en tissus secondaires (fig. 5.12).
Ceci permet une croissance en paisseur de la tige ou de la racine. Thoriquement
les cellules cambiales sont susceptibles de se diviser alternativement sur leurs deux
faces, mais cette priodicit nest pas aussi rgulire. Il se forme toujours plus de
bois que de liber, de lige que de phelloderme.
112

9782100544141-Laberche.fm Page 113 Jeudi, 4. fvrier 2010 3:47 15

5.6 Les formations secondaires

Tableau 5.6 Les caractristiques des mristmes secondaires.


Localisation

Dans les parties ges des tiges et des racines

Rles

Assurent la croissance en paisseur

Cellules

Grandes, allonges et aplaties radialement

Noyau

Fusiforme, petit, appliqu contre la paroi

Cytoplasme

Peu important

Vacuoles

Une ou deux grandes vacuoles

Paroi

Paroi pecto-cellulosique

Plastes

Plastes non diffrencis, proplastes

Inclusions lipidiques

Peu nombreuses

Vers la priphrie de la tige

a1
a1

a1

a2

Figure 5.12 Fonctionnement


dun cambium secondaire.

b1

b1

Vers le centre

Dunod La photocopie non autorise est un dlit.

5.6.2 Les tissus secondaires


Deux tissus secondaires proviennent du fonctionnement des deux cambiums.
1. Le priderme issu du fonctionnement de lassise subro-phellodermique. Dans
la tige, le lige est vers lextrieur et le phelloderme vers lintrieur. Il est constitu
de cellules aplaties radialement. Elles meurent trs rapidement aprs leur formation
et se vident. Les parois contiennent de la subrine impermable. Le phelloderme
est orient vers le centre. Cest un parenchyme typique, parfois chlorophyllien.
Les parois des cellules sont pecto-cellulosiques et minces. Du fait de limpermabilit de la subrine, les tissus situs au-dessus du lige, donc la priphrie de la
tige, meurent aussi. Il se forme le rhytidome (du grec rhutis = ride) ou corce.
Dans la racine, lcorce isole vers lextrieur par le priderme va sexfolier sous
la pousse des tissus secondaires.
2. Des formations libro-ligneuses. Elles sont toujours beaucoup plus importantes et
plus profondes que les formations du priderme. Elles se trouvent aussi bien dans
les tiges que les racines. Elles sont au nombre de deux.
Le liber est dispos vers lextrieur. Sa formation, centrifuge, est rythmique et
donne des couches concentriques minces de cellules aplaties. Elles ressemblent
des feuilles dun livre, do le nom de liber (= livre).
Le bois se dveloppe vers lintrieur. Il a une croissance rythmique centripte,
synchronise avec les saisons. Il forme donc des couches annuelles constitues
113

9782100544141-Laberche.fm Page 114 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

parenchyme
mdullaire
trachide
mdullaire

trachides

parenchyme
mdullaire
ponctuation
arole

a
trachides

parenchyme
ligneux

parenchyme
mdullaire
trachide

b
trache ponctue

Figure 5.13 Modles tridimentionnels de bois.


a : homoxyl chez le pin, b : htroxyl chez le tilleul.
(Daprs Braune, Leman et Taubert, simpli.)

114

9782100544141-Laberche.fm Page 115 Jeudi, 4. fvrier 2010 3:47 15

5.6 Les formations secondaires

de deux parties : le bois de printemps clair, avec de grandes cellules car les
conditions climatiques sont favorables la croissance (eau et temprature) et le
bois dautomne, plus sombre, plus dur et constitu de cellules plus petites. Ce
bois constitue la plus grande partie des troncs des arbres. Mais les parties jeunes
(les seules fonctionnelles) sont en priphrie et le bois le plus ancien est au centre.
Quand il est trs g, il peut se dcomposer (les arbres creux).
Les observations en microscopie photonique montrent que toutes les cellules de bois
ne sont pas identiques. Chez les Gymnospermes, ce sont uniquement des trachides.
Le bois est dit homoxyl (fig 5.13a). Chez les Angiospermes, ce sont des vaisseaux
mais aussi quelques trachides et parfois des fibres. Le bois est htroxyl (fig. 5.13b).
La structure secondaire engendre par les deux assises gnratrices peut, trs rapidement, masquer la structure primaire mise en place par les mristmes primaires.
Elle nest plus visible que dans les organes jeunes comme les rameaux. Encore ne fautil pas attendre trop longtemps. Gnralement quand un rameau commence avoir
des formations secondaires, il devient plus dur, perd sa coloration vert clair pour
prendre une teinte grise. Les agriculteurs disent quil est aot car ceci intervient
gnralement en t au mois daot. Chez les vgtaux herbacs, les formations
secondaires sont beaucoup plus discrtes. Le parenchyme cortical et la moelle centrale
sont donc beaucoup mieux conservs et en coupe il est possible de reconnatre xylme
et phlome primaires.
Pour prsenter les tissus des exemples ont t pris essentiellement chez les Spermaphytes. Chez les autres Cormophytes on trouve aussi des tissus et une organisation
des tissus conducteurs diffrente. Ainsi dans le rhizome du polypode, une fougre,
(Polypodium vulgare L.), on trouve des cordons vasculaires dlimits par un endoderme
et un pricyle et contenant du xylme et du phlome.

Dunod La photocopie non autorise est un dlit.

Du bois gntiquement modifipour diminuer la pollution engendre


par la fabrication de la pte papier?
Depuis quelques annes, sous la pression des industriels, des recherches sont menes
pour modier certaines caractristiques dessence forestires ou fruitires. Ainsi,
titre dexemple, de nombreux tests sont entrepris pour parvenir diminuer le taux
de lignine darbres comme le peuplier ou le bouleau. En effet, le bois est principalement compos de cellulose (65 80 %) et de lignine (cf. 4.2.7). La cellulose,
lorigine des bres du bois, offre une rsistance mcanique exceptionnelle en
traction et en compression, mais, linverse, ses performances transversales sont
quasiment nulles. La cohsion transversale du bois est assure par la lignine, laquelle
imprgne la cellulose pour augmenter sa durabilit (y compris aux insectes et autres
champignons) et sa rsistance. En consquence, les papetiers recherchent des bois
pauvres en lignine, tandis que les secteurs du btiment, de lameublement et de
lnergie privilgient les bois qui en comptent le plus.
Il est alors tentant pour les papetiers de demander aux scientiques de modier
gntiquement les arbres comme le peuplier et le bouleau pour que leur vitesse
de croissance augmente et que le taux de lignine diminue. Ils se prvalent pour
convaincre leurs interlocuteurs dune diminution notable des pollutions engendres
par les processus industriels. Des essais sont actuellement en cours en GrandeBretagne, en Finlande et en Chine notamment.
115

9782100544141-Laberche.fm Page 116 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

5.7 STRUCTURE

ET IMPORTANCE
DES TISSUS CONDUCTEURS

La coupe transversale dune tige non ligneuse a permis de voir les tissus conducteurs.
Ils forment de petits paquets appels faisceaux criblovasculaires. Chacun est constitu
par du xylme externe et du phlome interne. Ces deux tissus sont spars par un
cambium libro-ligneux donnant le liber vers le phlome et le bois vers le xylme.
Chacune des deux parties du faisceau vasculaire contient des lments conducteurs.
Ceux cot xylme sont constitus par deux types de cellules spcialises : les vaisseaux
et les trachdes. Ceux du ct du phlome sont des tubes cribls.
Les vaisseaux (souvent aussi appeles traches) sont faits de ranges de cellules
alignes qui se soudent bout bout au cours de leur dveloppement. Les parois
transversales disparaissent pour former une sorte de tube qui constitue un excellent
canal conducteur deau pouvant avoir plusieurs mtres de longueur et au moins
30 mm de diamtre. Les parois des vaisseaux sont renforces par des paississements
souvent de forme spirale (fig. 5.14).

annel

spiral

ponctu

Figure 5.14 Diffrents types dpaississements dans les parois des vaisseaux.

Les trachides ressemblent aux vaisseaux mais sont constitues par une cellule
unique et dote dune paroi transversale. Elles sont beaucoup plus courtes que les
traches puisquelles ne dpassent pas 0,3 10 mm de long mme si leur diamtre
est identique.
Une fois mises en place, traches et trachides perdent leur noyau et leur contenu
cellulaire normal. Ce sont des cellules mortes, incapables dvoluer ou de se
transformer.
Les tubes cribls sont aussi des cellules allonges, places bout bout, mais leurs
parois transversales sont perfores (fig. 5.15), si bien que leau peut circuler dun
lment un autre. Les tubes cribls ne spaississent pas longitudinalement et
restent vivants, (pourtant le noyau cellulaire rgresse ainsi que le tonoplaste) durant
116

9782100544141-Laberche.fm Page 117 Jeudi, 4. fvrier 2010 3:47 15

5.7 Structure et importance des tissus conducteurs

une priode de vgtation. Chez les plantes pluriannuelles ils sont renouvels
chaque anne. Les tubes cribls sont entours de cellules compagnes qui assurent
les changes des assimilats avec les tubes cribls. Ces transports sont actifs, donc
consommateurs dnergie.

cellules
compagnes

20 m

tubes cribls

Figure 5.15 Les lments du phlome.

Dunod La photocopie non autorise est un dlit.

Coupe longitudinale schmatique du phlome montrant les lments des tubes


cribls et les cellules compagnes charges de transporter de manire active les
assimilats des parenchymes vers les tubes cribls. (Daprs Kollmann, in Luttge, 1994,
simpli.)

Toutes les parois des lments conducteurs sont perfores. Ce sont des ponctuations.
Elles se forment dans la paroi cellulaire l o, il ny a pas dpaississement
secondaire de la paroi. Ce sont donc des pores dans la paroi cellulaire. Chez les
Angiospermes ces ponctuations sont particulirement grandes et simples tandis que
les ponctuations des trachdes chez les Gymnospermes sont beaucoup plus complexes.
Dans cette structure appele ponctuation arole (fig. 5.16) les parois secondaires
de deux cellules voisines forment une ceinture dlimitant une cavit centrale (le pore).
Sous celui-ci, la membrane obturante est paissie (torus) et autour de lui, elle est
rduite quelques faisceaux de fibrilles en rayons qui forment le systme de suspension
du torus. Une telle ponctuation fonctionne comme un clapet.
Les fonctions du xylme et du phlome sont diffrentes. Le xylme assure principalement le transport longue distance de leau et des sels minraux absorbs par
les racines (la sve brute). Le xylme peut cependant parfois transporter des sucres
ou des acides amins. Le phlome sert au transport des assimilats exports partir
des feuilles (sve labore) et assure leur distribution dans la plante.
117

9782100544141-Laberche.fm Page 118 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 5 Lorganisation tissulaire de la plante

Figure 5.16 Microphotographies obtenues en microscopie lectronique


balayage de ponctuations chez une Gymnosperme.
a, champ de croisement avec pores chez Podocarpus andinus Poepp. (barre = 10 mm).
b, dtail dune ponctuation radiale arole avec torus central chez Podocarpus
nubigenus Lindley (barre = 2 mm). (Clichs P. Woltz, universit Marseille 3, in Revue
de biologie et cytologie vgtales-Le Botaniste, XXI, 1998, p. 10-11.)

Ces tudes anatomiques ont permis de comprendre la structure des organes. Ils sont
constitus de tissus qui peuvent tre de plusieurs sortes dont essentiellement : les
tissus de soutien (sclrenchyme et collenchyme), les tissus de revtement (piderme
et rhizoderme), les tissus conducteurs (xylme pour la sve brute, phlome pour la
sve labore), enfin les tissus qui participent aux activits mtaboliques (les parenchymes). La mise en place de ces tissus et leur organisation est sous la dpendance
des mristmes primaires qui dterminent une structure primaire. Mais trs vite chez
bon nombre de plantes (particulirement les Dicotyldones) la mise en fonctionnement de mristmes secondaires (les cambiums) met en place de nouveaux tissus
et surtout des structures secondaires qui masquent, voire dtruisent compltement la
premire. Ces formations secondaires sont cependant trs organises et ont mme
servi de critres de classification pour diffrents auteurs. Mais la formation des mristmes secondaires est particulirement intressante retenir. Elle est le rsultat dune
ddiffrenciation cellulaire puis dune nouvelle diffrenciation permettant daboutir
des cellules aux vocations nouvelles. Ceci a aussi t observ lors de lapparition
des bourgeons axillaires dorigine superficielle ainsi que pour les nouvelles ramifications endognes. Cette proprit qualifie de totipotence, appartient pratiquement
au seul monde vgtal. Une cellule diffrencie, peut revenir mristmatique puis se
rediffrencier en une cellule phnotypiquement diffrente de sa premire diffrenciation. Cest ce qui se passe aussi quand lors dune bouture, des cellules de tige se
ddiffrencient pour se transformer ensuite en cellules de racines. Nous verrons que
lhomme saura se servir de cette totipotence. Il use, peut-tre mme abuse, de cette
extraordinaire proprit dans lexploitation quil fait des vgtaux dans les cultures
in vitro.

118

9782100544141-Laberche.fm Page 119 Jeudi, 4. fvrier 2010 3:47 15

5.7 Structure et importance des tissus conducteurs

Rsum

Les tiges, les feuilles, les racines sont constitues de tissus. Ceux-ci sont de
plusieurs sortes mais les quatre types principaux sont : les tissus de soutien
(sclrenchyme et collenchyme), les tissus de revtement (piderme et rhizoderme),
les tissus conducteurs (xylme pour la sve brute, phlome pour la sve labore),
enfin les tissus qui participent aux activits mtaboliques (les parenchymes). La
mise en place de ces tissus est sous la dpendance des mristmes primaires qui
dterminent une structure primaire. Le fonctionnement des mristmes primaires
est beaucoup plus complexe dans la tige que dans la racine. De mme lorganisation des tissus est diffrente selon les racines avec un cylindre central comportant
les faisceaux criblovasculaires et la tige o ces mmes faisceaux sont rpartis
en priphrie. Ces mristmes assurent la croissance en longueur des plantes.
Trs vite, chez les Dicotyldones, des mristmes secondaires apparaissent et
fonctionnent. Lassise subro-phellodermique concerne la partie la plus extrieure
des tiges, tandis que le cambium libro-ligneux, plac entre le phlome et le xylme
donne du liber et du bois assurant de ce fait une croissance en paisseur du
vgtal.

119

9782100544141-Laberche.fm Page 120 Jeudi, 4. fvrier 2010 3:47 15

LA

REPRODUCTION

La reproduction est un moment fondamental de la vie des vgtaux. Elle revt un


grand nombre de modalits et lon ne peut qutre surpris par la grande diversit des
structures adoptes par les vgtaux. Il est classique de sparer deux phnomnes
distincts.
La multiplication vgtative par fractionnement de lindividu ou mission de
cellules spcialises. Dans les deux cas, il ny a aucun brassage gntique au niveau
des chromosomes, ces supports de lhrdit, et les individus obtenus sont strictement
identiques ceux dont ils sont issus.
La reproduction sexue qui fait intervenir des cellules haplodes. Elles sont obtenues aprs une rduction du nombre et des remaniements des chromosomes dans
la cellule au cours de la miose. Aprs fusion, ces cellules haplodes donnent un
zygote diplode qui se dveloppera pour donner un nouvel individu dont certaines
cellules subiront la miose et ainsi de suite. Il se produit une alternance de gnrations, lune est haplode, cest lhaplophase ; on est en prsence du gamtophyte.
Lautre est diplode, donc appele diplophase ; on a alors le sporophyte (fig. 6.1).
Sporophyte
2n chromosomes (diplophase)

Zygote
fcondation

Phases :
Miose

haplode
diplode

gamtes

Gamtophyte
n chromosomes (haplophase)

Figure 6.1 Lalternance des phases haplode et diplode.


120

9782100544141-Laberche.fm Page 121 Jeudi, 4. fvrier 2010 3:47 15

6.1 La miose

Au cours des deux milliards dannes qui nous ont prcds, limportance du
sporophyte et du gamtophyte dans la vie des organismes a souvent vari. Le temps
a parfois privilgi lune par rapport lautre et ce nest que chez les Archgoniates
quil se produit une rduction de plus en plus importante du gamtophyte au profit
du sporophyte. Chez des vgtaux on distingue un type dindividu quel que soit le
stade de dveloppement ; le cycle de la plante est monogntique. Chez dautres,
deux phases sont distinctes ; le gamtophyte des fougres (le prothalle) mne une
existence indpendante, mais il est rduit une lamelle de quelques cm 2 de surface.
Ce gamtophyte est beaucoup plus rduit que le sporophyte (les frondes). Au contraire
chez les mousses, cest le gamtophyte qui constitue la plante verte autonome que
lon rencontre sur les vieux murs, les zones humides et les sous-bois. Le sporophyte
ne peut se voir gnralement quau printemps et vit en parasite du gamtophyte.
Dans ces deux cas, on parle de cycle digntique, puisque lon peut distinguer deux
types dorganismes qui se succdent dans le temps. Chez les algues et les champignons,
limportance de la diplophase et de lhaplophase est trs variable. Certaines algues
rouges ont mme un cycle trigntique comportant trois gnrations successives :
gamtophyte, carpo-sporophyte (le zygote se dveloppe en parasite du gamtophyte)
et sporophyte.
Dans les pages qui suivent, quelques modalits de reproduction sexue seront
abordes au travers dexemples pris dans les grands groupes de vgtaux. Mais avant,
il faudra bien comprendre ce qui se passe durant la miose et la formation du zygote.
Ce chapitre prsentera, aussi, quelques donnes concernant la multiplication vgtative. Enfin, il se terminera par une rflexion concernant le passage de la vie aquatique
la vie terrestre.

6.1 LA

MIOSE

Dunod La photocopie non autorise est un dlit.

Durant la miose, le nombre de chromosomes est rduit de moiti dans chaque


cellule et une recombinaison alllique modifie linformation gntique. Le nombre
de chromosomes sera cependant rtabli lors de la fcondation qui conduit au zygote.
La miose comprend deux phases successives.
La connaissance de la miose est rcente
Ce nest que vers la n du XIXe sicle que des observations chez lascaris montrrent
des diffrences dans le nombre de chromosomes entre lindividu et ses gamtes.
Quant aux diffrents stades de la miose, ils ne furent compltement observs et
expliqus que dans les annes 1930.

6.1.1 La division rductionnelle


Cette premire division permet de rpartir dans deux cellules-filles un exemplaire de
chaque chromosome prsent dans la cellule initiale. Le nombre des chromosomes
est rduit de moiti et passe de 2n n. Il est maintenant bien tabli que cette division 1
se passe en quatre temps : prophase, mtaphase, anaphase et tlophase.
121

9782100544141-Laberche.fm Page 122 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Cest surtout la prophase 1 qui est importante (fig. 6.2). Durant cette phase des
remaniements chromosomiques se produisent. Au tout dbut, les 2n chromosomes,
clivs en deux chromatides sindividualisent progressivement (stade leptotne), puis
les deux chromosomes analogues se rapprochent, sapparient (stade zygotne) et se
condensent (stade pachytne). Aprs ils commencent scarter (stade diplotne)
tout en laissant des zones de contact (les chiasmas) o se produisent des changes
de matriel gntique (crossing-over). La condensation saccentue et la cellule
passe progressivement au dernier stade de cette prophase 1 (la diacinse), les chromosomes homologues ne sont plus relis que par les chiasmas. Lenveloppe nuclaire
disparat.
PROPHASE 1
stade : leptotne

zygotne

MTAPHASE 1

pachytne

ANAPHASE 1

diplotne

diacinse

TLOPHASE 1

Figure 6.2 Les phases de la miose: la premire division


ou division rductionnelle (explications dans le texte).

La mtaphase 1 commence. Les chromosomes homologues de chaque paire se


placent de part et dautre du plan quatorial. lanaphase 1 les chromosomes de
chaque paire sloignent et se dirigent vers les ples de la cellule. Contrairement la
mitose, il ny pas de sparation des chromatides du chromosome au niveau du centromre. Cest le chromosome entier avec ses deux chromatides qui se dplace. En fin
danaphase, chaque ple on trouve n chromosomes ayant chacun deux chromatides.
La tlophase 1 est identique celle de la mitose, on aboutit la formation de deux
cellules n chromosomes.

6.1.2 La division quationnelle


Cette seconde division, ou division quationnelle, commence aprs une dure de
repos (lintercinse) trs variable. Ses diffrentes phases sont trs semblables celle
dune mitose classique, mais elle ne fait intervenir que n chromosomes (fig. 6.3).
122

9782100544141-Laberche.fm Page 123 Jeudi, 4. fvrier 2010 3:47 15

6.2 La formation du zygote

Division quationnelle
MTAPHASE 2

ANAPHASE 2

TLOPHASE 2

Figure 6.3 Les phases de la miose: la division quationnelle


(explications dans le texte).

la fin de cette division, on est en prsence de quatre cellules haplodes gntiquement recombines. Selon les individus, les modalits de formation des gamtes
qui fusionneront pour donner un nouvel individu sont trs varies. Ceci fera lobjet
de prcisions au cours des paragraphes suivants. Mais chaque fois des cellules
haplodes sunissent par deux pour former un uf ou zygote diplode.

Dunod La photocopie non autorise est un dlit.

6.2 LA

FORMATION DU ZYGOTE

Dans lensemble du monde vgtal, la chronologie et la formation du zygote sont


trs varies. Chez les plantes fleurs, le gamtophyte mle est le grain de pollen.
Dpos sur le stigmate dune fleur, il met un tube pollinique qui senfonce dans les
tissus du pistil pour sapprocher du gamtophyte femelle. Ce tube contient deux
noyaux dont un seul fcondera loosphre (le gamte femelle). Le zygote constitue
un nouvel individu diplode tandis que lautre noyau donne un tissu de rserve. Cette
modalit, trs schmatiquement rsume et qui sera reprise et dtaille ultrieurement,
est caractristique des Angiospermes. Dans les autres groupes de vgtaux, la
fcondation et la formation du zygote est souvent plus simple. Il est particulirement
important de retenir quavec la fusion des gamtes, donc avec la formation du
zygote, lhaplophase se termine et quune nouvelle diplophase commence. Le zygote
est form de laddition des chromosomes mles et femelles. Chaque apport tant luimme original, puisquau moment de la miose, de nombreux remaniements gntiques
ont pu se produire au niveau des chiasmas.
Il ne faut cependant pas oublier qu la fusion des noyaux correspond aussi la
transmission dun patrimoine gntique non chromosomique puisque dans les plastes
ainsi que dans les mitochondries se trouvent de lADN circulaire porteur de messages
gntiques.

123

9782100544141-Laberche.fm Page 124 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

6.3 LA REPRODUCTION SEXUE CHEZ LES THALLOPHYTES


6.3.1 La reproduction sexue chez les algues
Les quatre exemples qui suivent, montrent que la reproduction sexue chez les algues
est trs variable et que les diffrentes phases sporophytiques et gamatophytiques
peuvent tre dimportance fort variables.

a) Lulve, Ulva lactuca L. (Chlorophyceae) au cycle digntique


Lulve est une algue verte trs commune le long des ctes europennes. Appele la
laitue de mer (et consomme comme telle, dans plusieurs prparations culinaires), elle
prsente un thalle bord ondul constitu par une lame verte forme de deux couches
cellulaires. Au moment de la reproduction sexue (fig. 6.4), la priphrie de certains
thalles change de couleur. Les cellules du bord deviennent vert sombre et se divisent
trois quatre fois lintrieur de la cellule initiale. Finalement des cellules mobiles
flagelles sont libres par ouverture de la cellule mre initiale, le gamtocyste, il
sagit des gamtes femelles. Chez dautres individus, les cellules priphriques deviennent jauntres et se divisent. Elles librent 16 ou 32 cellules mobiles et biflagelles,
Comme elles sont de petite taille on dit quil sagit des gamtes mles et la cellule
dans laquelle elles se sont formes est appele le gamtocyste mle. Chaque thalle ne
libre quun type de gamtes : on est en prsence dune espce dioque.
gamtophytes

gamtocystes

zoospores

gamtes

sporocystes
zygote
sporophyte

Figure 6.4 Le cycle de lulve, Ulva lactuca (explications dans le texte).


124

9782100544141-Laberche.fm Page 125 Jeudi, 4. fvrier 2010 3:47 15

6.3 La reproduction sexue chez les Thallophytes

Ces deux gamtes librs dans leau vont se dplacer grce leurs flagelles et se
rencontrer. Ils fusionnent, le zygote se dveloppe aprs avoir perdu ses flagelles. Il
se fixe sur un rocher et une nouvelle lame verte se forme, morphologiquement
identique celle qui portait les gamtocystes. Mais le comportement des cellules
marginales est diffrent. Les cellules du bord du thalle se divisent deux ou trois fois et
les sporocystes librent des spores volumineuses flagelles. Ce sont des zoospores
qui aprs une courte priode de vie libre se fixent et donnent deux types de thalles
identiques aux premiers.
Le cycle de lulve se caractrise donc par la prsence de deux gnrations successives
morphologiquement identiques. La premire comporte deux sortes dindividus qui
librent des gamtes. Il sagit des gamtophytes haplodes. La seconde issue de la
fusion de deux gamtes, donc diplode, produit des individus morphologiquement
identiques aux prcdents. Ils librent des spores qui, en germant, donneront des
gamtophytes. Cest donc le sporophyte. Lors de la formation des zoospores se produit
la miose. Le cycle de lulve est bien digntique et isomorphe.

b) Le codium : une algue au cycle de dveloppement


monogntique diplode
Le Codium tomentosum L. Stackh, Chlorophyceae (algue verte), est une algue trs
commune de nos ctes. Souvent mlange aux fucus, elle se retrouve sur les tals
des poissonniers. Cest une algue dun vert bruntre thalle cylindrique ramifi. On
peut y observer des gamtocystes dans lesquels des cellules se multiplient activement
et donnent des gamtes biflagells. Tous les codiums ne donnent pas des gamtes
identiques : certains sont petits, ce sont les gamtes mles. Dautres sont plus grands :
ce sont des gamtes femelles. Lespce est dioque. Ces gamtes sont librs dans le
milieu. Ils vont sunir pour former un zygote qui simmobilise sur un rocher et
donne naissance un nouveau thalle sexu. La miose se produit au moment de la
production des gamtes. Le codium ne prsente quune gnration diplode, il a un
cycle monogntique, diplode.

Dunod La photocopie non autorise est un dlit.

c) Le chlamydomonas : une algue monogntique haplode


Les chlamydomonas (Chlamydomonadaceae) sont des algues flagelles unicellulaires
qui vivent en colonies et qui se multiplient rapidement par multiplication vgtative
ralise par bipartition longitudinale. pisodiquement, elles adoptent une reproduction
sexue. Dans ce cas une cellule devient un gamtocyste et lintrieur de la paroi se
forment 8, 16 ou 32 gamtes morphologiquement identiques la cellule initiale
mais manifestement plus petits. Lchs dans le milieu ces gamtes fusionnent deux
deux. Gnralement ils sont issus de gamtocystes diffrents et donnent un zygote
diplode. Celui-ci est la seule cellule diplode car il subit immdiatement la miose.
Le cycle est uniquement monogntique haplode.

125

9782100544141-Laberche.fm Page 126 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

d) Larchrochaetum : une algue rouge cycle trigntique


Quelques algues rouges comme Archrochaetum prsente un cycle trigntque. Cette
espce marine, possde un thalle cylindrique plus ou moins ramifi. Celui-ci, haplode,
porte des gamtocystes mles et femelles. Les premiers produisent des gamtes
incolores non flagells qui sont librs dans le milieu. Les seconds contiennent un
noyau gamtique. Leur fusion produit un zygote qui se dveloppe et donne un thalle
porteur de spores diplodes. Elles germent et redonnent un thalle, morphologiquement
identique au premier, mais vivant en parasite du gamtophyte. Cependant ses parties
terminales subissent la miose et donnent des spores haplodes. Celles-ci sont
lorigine des thalles haplodes. On peut donc dire que le cycle est haplo-diplophasique
avec un doublement de la phase diplode.

6.3.2 La reproduction sexue chez les champignons


Les champignons constituent un rgne part entire. Depuis quelques annes les
myxomyctes en ont t exclus. Pourtant quelques lignes leur seront ici consacres.
Les notions dcrites font partie de la culture gnrale et donc peuvent servir comme
lments de comparaison, voire de rflexion.
Myxomyctes et champignons reprsentent deux niveaux dorganisation des
Eucaryotes particulirement difficiles ranger dans le rgne vivant. Les myxomyctes
et les champignons ne possdent pas de plastes et pas de pigments chlorophylliens.
Ils sont htrotrophes et salimentent de manire saprophytique ou parasitaire. Les
rserves nergtiques sont des lipides et le glycogne ; ce dernier constitue le glucide
de rserve typique des animaux.

a) Les myxomyctes
Les myxomyctes font partie des organismes eucaryotiques les plus simples. Leur
appareil vgtatif est constitu dune masse indiffrencie plus ou moins lamellaire
de cytoplasme. Elle peut atteindre plusieurs dcimtres carrs. Cet appareil vgtatif
est appel plasmode. Il nest pas cloisonn et comprend un grand nombre de noyaux
cellulaires diplodes.
Lors de la reproduction sexue, le plasmode se condense en sporanges parfois
fortement colors, contenant des spores haplodes. Ces spores germent dans leau et
donnent des cellules myxoflagelles, qui perdent rapidement leurs deux flagelles, ce
sont alors des myxamibes. Deux myxamibes font fusionner dabord leur cytoplasme
puis leurs noyaux rtablissant la diplodie. La croissance du cytoplasme se poursuit
en mme temps que se divisent les noyaux et quun nouveau plasmode se construit.
Le cycle est digntique (fig. 6.5), dominante sporophytique.
cologie des myxomyctes
Les myxomyctes vivent sur des substrats humides. Ils salimentent en enveloppant
des particules alimentaires solides qui sont absorbes par phagocytose et digres dans les cellules. Certaines espces peuvent tre parasites de vgtaux suprieurs comme la hernie du chou (Plasmodium brassicae, Plasmodiophoraceae), qui
provoque des dgts importants en agriculture.
126

9782100544141-Laberche.fm Page 127 Jeudi, 4. fvrier 2010 3:47 15

6.3 La reproduction sexue chez les Thallophytes

miose

formation
du sporange

spores
(n)

plasmogamie
myxamibes
caryogamie

zygote

sporophyte

Figure 6.5 Cycle de reproduction dun myxomycte


(explications dans le texte).

Dunod La photocopie non autorise est un dlit.

b) Les champignons
Actuellement, plus de 40 000 espces de champignons ont t recenses et il est sr
que ceci ne reprsente quune partie de lensemble des champignons. Lappareil
vgtatif des champignons est un thalle compos de filaments : les hyphes, souvent
tendus et dont lensemble forme le myclium. Ces filaments peuvent tre organiss
en siphons, ou segments. La plupart des champignons ont une paroi cellulaire
constitue de chitine, qui est une substance du rgne animal constituant lexosquelette
des insectes. Quelques champignons cependant possdent une paroi cellulaire
cellulosique.
Les champignons se multiplient vgtativement par fractionnement des hyphes
ou par production des spores comme le Bremia lactuca Regel, Peronosporaceae. Le
Meunier de la laitue attaque prfrentiellement les jeunes plants, qui prsentent
rapidement leur face infrieure des plages de duvet blanchtre (fig. 6.6).
Ils possdent aussi des modes de reproduction sexue trs diversifis. Trois cas
seront successivement tudis.

127

9782100544141-Laberche.fm Page 128 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

face suprieure
de la feuille

parenchyme

mycelium

stomate

face infrieure
de la feuille

strigmate
0,1 mm

sporocystes

Figure 6.6 La production de spores de reproduction asexue


du Bremia lactuca chez la laitue.
Les laments du champignon sallongent entre les cellules du parenchyme, portant
et l des appendices qui pntrent dans les cellules de lhte. Par lostiole du
stomate, sortent des laments perpendiculairement la surface du limbe. Ils se
ramient plusieurs fois. Chaque ramication se termine par un renement en
soucoupe pourvu sur son bord de pointes (les strigmates) o sinsrent de petits
sporocystes sphriques.

LAllomyces javanicus, Kniep, Blastocladiaceae,


un champignon digntique isomorphe

Allomyces javanicus est un champignon aquatique thalle siphonn et ramifi qui


lextrmit de ses hyphes portent des gamtocystes contenant des gamtes uniflagelles
(fig. 6.7). Aprs libration dans leau, ils fusionnent pour donner un zygote diplode
qui en germant donnera un thalle identique au prcdent. lextrmit des hyphes,
des sporocystes produisent, aprs miose, des spores haplodes qui seront lorigine
des thalles. Le cycle est bien digntique et isomorphe.
La pzize Pyronema conuens Fuckel, Pyronemacetaceae (Ascomyctes)

La pzize est un champignon trs frquent dans nos sous-bois, reconnaissable ses
coupes colores, oranges, de quelques centimtres de diamtre. Ce champignon terrestre
dveloppe un mycelium cloisonn et peu ramifi dans le sol. Sur ce mycelium
primaire certains filaments ont un gotropisme ngatif et se ramifient abondamment
128

9782100544141-Laberche.fm Page 129 Jeudi, 4. fvrier 2010 3:47 15

6.3 La reproduction sexue chez les Thallophytes

spores haplodes

miose

sporocyste

gamtocyste

gamtes
sporophyte

zygote

gamtophyte

Figure 6.7 Le cycle digntique isomorphe dAllomyces javanicus

Dunod La photocopie non autorise est un dlit.

(explications dans le texte).

pour donner les pzizes. Les extrmits de nombreux filaments se diffrencient en


organes sexuels : lascogone femelle surmont de son appendice tubulaire le trichogyne
et lanthridie mle. On nobserve pas de formation de gamtes, mais quand lanthridie entre en contact avec le trichogyne (dont le noyau a dgnr), celle-ci y dverse
son contenu qui passe dans lascogone. Il se produit une fusion des cytoplasmes
(plasmogamie) mais pas des noyaux qui restent individualiss dans la cellule, on est
en prsence dun dicaryon. Ce dicaryon se dveloppe, partir de lascogone, en donnant
le mycelium secondaire form dhyphes cloisonns o les divisions nuclaires des deux
types de noyaux seffectuent simultanment. Lextrmit des hyphes dicaryotiques
se recourbe, sanastomose et deux cloisons dlimitent une cellule terminale o les
deux noyaux du dicaryon fusionnent pour former un zygote.
Cette phase diplode se termine immdiatement par la miose suivie dune deuxime
mitose qui aboutit la formation de huit spores haplodes contenues dans la paroi de
la cellule ou asque. Ces ascospores entoures dune paroi paisse seront libres
dans le milieu o elles germeront pour redonner un thalle haplode.
129

9782100544141-Laberche.fm Page 130 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Le cycle (fig. 6.8) est donc complexe. une phase haplode, succde une phase
dicaryotique (forme particulire de la diplophase) qui se termine par la formation du
zygote immdiatement suivie de la miose.
ascogone femelle

myclium
primaire

anthridie
mle

formation
du dicaryon

asque
8 ascospores

miose 2

myclium
secondaire

miose 1

caryogamie

Figure 6.8 Le cycle de la pzize Pyronema confluens


(explications dans le texte).

Le champignon de Paris Agaricus campestre L., Fragaricaceae


(Basidiomyctes)

Le champignon de Paris, lagaric champtre, (Agaricus campestre) fait partie des


quelques champignons domestiqus par lhomme. Cest un basidiomycte dont la
reproduction sexue se fait au niveau des fructifications comestibles. Elle donne lieu
la production de basidiospores issues de basides au niveau des lamelles rayonnantes
du chapeau . Ce basidiomycte a un dveloppement et une reproduction sexue
pratiquement identique (fig. 6.9) celle des ascomyctes avec une phase dicaryotique
et une miose suivant immdiatement la formation du zygote. Cependant les spores
issues de la miose, gnralement au nombre de quatre, migrent hors du sporocyste
et se positionnent sur des appendices cellulaires, les strigmates. Ce sont des basidiospores et le sporocyste est une baside (fig. 6.10).
130

9782100544141-Laberche.fm Page 131 Jeudi, 4. fvrier 2010 3:47 15

6.3 La reproduction sexue chez les Thallophytes

plasmogamie
baside
dicaryon
miose

caryogamie
carpophore

Figure 6.9 Schma du cycle de la reproduction sexue


chez un basidiomycte, Agaricus campestre (explications dans le texte).

basidiospore

strigmate

Figure 6.10 La baside


des Basidiomyctes.

baside

Dunod La photocopie non autorise est un dlit.

10 m

Souvent peu visibles mais trs importants


Les champignons jouent un grand rle dans le fonctionnement des cosystmes :
car ils dcomposent la matire organique. Ils ont aussi des actions sur nos activits
humaines. Parfois ils sont pathognes pour lhomme (mycoses Albugo candida)
pour les animaux et surtout pour les vgtaux (mildiou, odium, rouilles).
Heureusement, ils peuvent aussi tre bnques. Ils sont producteurs de pnicillines
et assurent les fermentations lors de la fabrication de la bire ou du vin ainsi que
des fromages ( ptes euries), etc.

Ainsi chez les Thallophytes plusieurs types de cycles de dveloppement sont


possibles. Ils correspondent ceux qui seront retrouvs chez les Cormophytes, except,
131

9782100544141-Laberche.fm Page 132 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

peut-tre, le cycle trigntique. Cependant au cours de lvolution, et paralllement


une complication de plus en plus grande des organes de reproduction, on assiste
une prpondrance de la diplophase avec rgression de lhaplophase qui devenant
parasite se rduira quelques cellules. Cependant, tout ne sest pas fait aussi simplement, comme nous le dcouvrirons ultrieurement.

6.4 LA REPRODUCTION SEXUE CHEZ LES CORMOPHYTES


Les Cormophytes sont les vgtaux dont une partie est constitue par une tige feuille.
Ce sont, pour leur immense majorit, des vgtaux terrestres qui ont acquis au cours
des temps des organes de reproduction de plus en plus sophistiqus.

6.4.1 La reproduction chez une Bryophyte: le polytric


Polytrichum juniperinum Hedw, Polytrichaceae
Les Bryophytes comprennent de nombreuses espces dont les plus connues sont les
hpatiques, les sphaignes et les mousses. Parmi ces dernires, le polytric, Polytrichum
juniperinum, est remarquable. Cest une grande et belle mousse formant des tapis
dun beau vert sombre dans les bois. Il est ais de constater que cette plante est
forme de nombreux axes feuills chlorophylliens dresss, denviron 10 cm de haut.
Ces axes sont relis entre eux, terre, par des filaments, le protonma. La fixation
au sol se fait par des poils pluricellulaires, les rhizodes. Cest au printemps que se
produit la reproduction sexue. Sur les rameaux vgtatifs ayant termin leur croissance apparaissent des bourgeons gamtangiaux qui donneront des gamtanges. Le
polytric est dioque. Sur les pieds femelles des rameaux slargissent au sommet et
prennent une forme de coupe. Dans celle-ci, on trouve des structures en forme de
bouteilles spares les unes des autres par des filaments striles. Ce sont des archgones. Ils sont constitus dune couche cellulaire externe, dune file de cellules
centrales alignes (le col) dont la plus profonde, situe au niveau de la partie ventrue
de larchgone est loosphre immobile.
Sur les pieds mles, les rameaux sont termins par une rosette de larges feuilles.
Au centre, on trouve les anthridies. Elles ont une forme de massue limite par une
paroi forme dune seule assise cellulaire. lintrieur un massif de cellules se
transforme progressivement en spermatozodes filiformes flagells.
En avril-mai, au moment de louverture des anthridies, les spermatozodes nagent
dans leau et sapprochent des archgones, attirs par le mucilage des cellules du col
qui ont dgnr. Ils pntrent dans larchgone et viennent fconder loosphre
immobile. Cette fcondation, appele zodogamie, conduit la formation dun uf
diplode, le zygote, qui se dveloppe immdiatement. La partie basale senfonce dans
la tige feuille tandis que la partie suprieure donne le sporogone. Il contient des
cellules qui vont subir la miose et qui donneront des ttraspores haplodes qui
progressivement sentourent dune paroi paisse et rsistante, riche en drivs lipidiques.
132

9782100544141-Laberche.fm Page 133 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

Au dbut de lt ces spores seront dissmines. Tombant sur le sol et trouvant


des conditions dhumidit et de temprature suffisantes pour germer, elles redonneront
la mousse bien connue.
Plusieurs choses sont retenir de cet exemple de la mousse surtout si on le compare
avec les points importants observs chez les Thallophytes.
1. Le cycle est haplo-diplophasique (fig. 6.11), digntique, gamtophyte (haplode)
dominant. Le sporophyte a une morphologie et une dure de vie diffrentes du
gamtophyte mais surtout il vit en parasite. Cette dominance de la phase haplode
est particulirement rare et originale chez les Cormophytes.
2. Les deux gamtes sont de morphologie trs diffrentes. Loosphre est immobile
et volumineuse, le spermatozode est petit et flagell donc mobile. On parle dans
ce cas doogamie.
3. Les parois des organes reproducteurs, anthridie et archgone, sont constitues
par une couche de cellules. Il sagit bien de gamtanges, quil faut opposer aux
gamtocystes des Thallophytes.
4. Le gamtange femelle a une structure originale : cest un archgone. Celui-ci se
retrouvera (plus ou moins modifi) chez tous les vgtaux suprieurs, De ce fait
on utilise souvent comme synonyme Cormophytes le terme dArchgoniates.

miose

spores
haplodes
protonma

sporogone

Dunod La photocopie non autorise est un dlit.

gamtophyte

gamte
mle

dveloppement
du sporophyte
embryon

uf

archgone
fcond

anthridie

archgone

Figure 6.11 Le cycle dune mousse, le polytric (explications dans le texte).


133

9782100544141-Laberche.fm Page 134 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

5. La fcondation ne peut seffectuer quen prsence deau. Le spermatozode nage


dans leau pour se rapprocher de larchgone. Les Bryophytes sont des plantes
terrestres mais elles ont gard la fcondation aquatique.

6.4.2 La reproduction chez une Ptridophyte:


le polypode, Polypodium vulgare L., Polypodiaceae
Les fougres sont des Cormophytes ayant un appareil conducteur diffrenci en vaisseaux et trachides. Classiquement, les biologistes considrent que ce sont les premiers
vgtaux ayant colonis le milieu arien. Leur importance dans la flore actuelle, est
relativement rduite. Les fougres, les prles, et les slaginelles sont les Ptridophytes
les plus connues de nos jours ; pourtant, elles se sont beaucoup dveloppes lre
primaire tout particulirement au carbonifre.
Lexemple tudi est le polypode (Polypodium vulgare). Il sagit dune plante de
taille modeste, de 30 cm de hauteur environ et dont on voit essentiellement les frondes
ariennes dcoupes. Elles stalent au printemps et meurent lautomne en prenant
une teinte brun-fonc. Ces feuilles apparaissent sur une tige souterraine, le rhizome,
qui porte de nombreuses racines. La fougre proprement dite est le sporophyte Au
dbut de lt se diffrencient sur la face infrieure des frondes, des sporanges
bruntres. Il sagit densembles ovodes, ports par des pdicelles et limits par une
couche de cellules. Ces sporanges sont regroups en amas : les sores (fig. 6.12).
Chaque sporange contient 64 spores haplodes provenant dune miose suivie de
quatre mitoses. Ces spores sont trs dshydrates et prsentent une paroi paisse
ornemente. Elles sont libres dans le milieu par ouverture du sporange grce au
fonctionnement dun anneau mcanique. Celui-ci est constitu dune file de cellules aux
face suprieure de la fronde

indusie
anneau
mcanique
sporange
0,1 mm

pdicelle

Figure 6.12 Un sore de fougre mle (Dryopteris filix). Chez Dryopteris filix,
une indusie recouvre les sporanges alors quelle est absente chez le polypode.
134

9782100544141-Laberche.fm Page 135 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

parois paissies sur trois cts et qui en se dshydratant se rtractent. Quand, tombes
au sol, elles rencontrent des conditions dhumidit et de temprature favorables ces
spores se rhydratent puis germent. Elles commencent par mettre un filament puis
rapidement se forme une lame cordiforme de moins d1 cm2 de surface (fig. 6.13).
Cette lame verte est constitue dune couche de cellules, sauf au centre qui plus pais
forme le coussinet. On est en prsence du prothalle. Il adhre au sol par quelques
rhizodes. Ceux-ci emprisonnent entre le prothalle et le sol quelques gouttes, voire
une lame deau. Sur la face infrieure du prothalle apparaissent les gamtanges mles
et femelles. Il sagit :
des anthridies qui sont de petites sphres disposes la priphrie du prothalle.
Elles possdent une paroi pluricellulaire qui en se dchirant maturit libre des
spermatozodes hlicodaux flagells qui vont pouvoir nager dans leau du sol ;
des archgones dont lorganisation est sensiblement identique celle dcrite chez
la mousse. Cependant le ventre qui contient loosphre est intgr au tissu prothallien.
De mme le col est plus court.
La fcondation est oogame, le zygote se dveloppe immdiatement en une jeune
plante avec des frondes, un rhizome et des racines.
Le cycle de cette fougre est caractris par deux gnrations bien distinctes, il est
donc haplo-diplobiontique, digntique avec dominance de la phase sporophytique.
spore

sporanges

jeune
gamtophyte

fronde
prothalle

Dunod La photocopie non autorise est un dlit.

sore

oosphre
archgone

anthridie

rhizome
jeune
sporophyte

uf

fcondation

anthrozode

Figure 6.13 La reproduction chez la fougre Polypodium vulgare


(explications dans le texte).

135

9782100544141-Laberche.fm Page 136 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Quelques points mritent en plus dtre nots :


1. Le prothalle (gamtophyte) est petit par rapport aux dimensions du sporophyte.
Cette volution rgressive du prothalle est gnrale dj chez les Ptridophytes et
saccentuera chez les plantes fleurs. De mme, on constate que le nombre de
gamtanges est beaucoup plus petit chez dautres Ptridophytes et que le nombre
de gamtes mles librs diminue aussi drastiquement.
2. Larchgone, et plus particulirement la partie contenant loosphre, est partiellement
protg dans les tissus prothalliens.
3. Le rapprochement des gamtes exige toujours la prsence deau.
4. Le sporophyte au dbut de son dveloppement est parasite du gamtophyte,
rapidement il prend son autonomie.

6.4.3 La reproduction chez les Gymnospermes


Les Gymnospermes forment avec les Angiospermes lancien embranchement des
Phanrogames caractris par des fleurs o se produit la reproduction sexue alors que
les Crytogames comme les Bryophytes et les Ptridophytes ont une reproduction
sexue plus discrte, moins visible. On parle aussi de Spermaphytes, puisque la
dissmination des espces se fait par des graines.
Les Gymnospermes sont actuellement peu reprsents quantitativement mais sont
les descendants de groupes beaucoup plus importants qui se sont dvelopps lre
secondaire. Leurs modalits de reproduction sexue prsentent des diffrences
importantes qui permettent de comprendre le sens gnral de lvolution.

a) La reproduction dune Prphanrogame :


un cycas, Cycas revoluta Thunb., Cycadaceae
Les cycas sont des plantes que lon peut confondre avec des palmiers. Leur morphologie
gnrale consiste en un tronc pais, non ramifi, recouvert par la base des anciennes
feuilles alors que les plus jeunes sont disposes en cercle au sommet. Quand larbre
est adulte, un ou plusieurs cnes pendent de cette couronne. Enfin, des racines ancrent
larbre au sol. Les aires de dissmination de la centaine despces actuelles rparties
dans 11 genres, sont essentiellement les rgions tropicales ou intertropicales ; quelquesunes cependant peuvent pousser dans les zones tempres aux hivers doux. Les
appareils reproducteurs sont ces cnes pendants, ports par des individus diffrents
car les cycas sont dioques. Le cne mle est constitu par un ensemble de petites
feuilles modifies et embotes. Elles portent sur leur face infrieure de trs nombreux
sporanges contenant des spores provenant de la transformation dune cellule ayant
subi la miose et stant ensuite plusieurs fois divise. Ces cellules sentourent
dune paroi paisse ornemente, alors mme que les divisions continuent. Ainsi au
moment de leur libration, trois cellules sont visibles. Ces spores dissmines sont
des grains de pollen et reprsentent le gamtophyte mle, ou prothalle mle. Tout
naturellement et par ressemblance avec les organes mles des plantes fleurs, les feuilles
modifies seront appeles tamines et les sporanges, sacs polliniques (fig. 6.14).
136

formation
de lembryon

endosperme

nucelle
archgone

cellule basale

micropyle

cellule
cellule gnrative
vgtative
grain de pollen

tgument

cellule du col
archgone
oosphre

chambre pollinique

le cycas, Cycas revoluta (explications dans le texte).

Figure 6.14 Les diffrentes tapes de la reproduction dune prphanrogame,

tgument

cotyldons

Dunod La photocopie non autorise est un dlit.

cellule du col

spermatozode

9782100544141-Laberche.fm Page 137 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

137

9782100544141-Laberche.fm Page 138 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Lappareil reproducteur femelle est constitu par des feuilles morphologiquement


semblables aux feuilles vgtatives mais lgrement plus petites et de couleur bruntre.
Elles portent leur base deux ranges dovules de grosseur variable (dun pois un
gros abricot). Chaque ovule comprend de lextrieur vers lintrieur :
Un tgument compos de trois couches, dont la centrale est plus dure. Au sommet,
ce tgument mnage un puits : le micropyle.
Un tissu priphrique, le nucelle, natteignant pas le sommet et mnageant sous
le micropyle une petite cavit : la chambre pollinique.
Un tissu central : lendosperme non cloisonn (cnocytique) comportant son
sommet un ou deux archgones. Cet endosperme est un tissu haplode. Il provient de
la diffrenciation dune cellule du nucelle (diplode) qui subit la miose. Seule une
des quatre cellules continue son dveloppement et donne un gamtophyte inclus
dans le nucelle, les trois autres cellules dgnrent.
Ce gamtophyte porte des archgones (1 ou 2) dont le ventre est enfonc dans
lendosperme. Seuls les cols, trs rduits, puisquils ne comportent que quatre cellules,
dpassent et aboutissent dans la chambre pollinique. Les grains de pollen sont librs
dans lair et la pollinisation se fait, soit par des insectes, soit par le vent selon les
espces. Ceci constitue une grande originalit par rapport aux Bryophytes et aux
Ptridophytes. Chaque grain de pollen tomb au niveau du micropyle va germer.
Il met un tube pollinique qui atteint la chambre pollinique. Pendant ce temps, une
des trois cellules composant le grain de pollen se divise en donnant une cellule socle
et une cellule spermatogne. Cette dernire, en se divisant de nouveau, donnera deux
volumineux spermatozodes flagells en hlice. Ils sont librs dans la partie suprieure du nucelle qui se lyse et permet aux spermatozodes de nager vers les cols des
archgones. Ils y pntrent et fcondent loosphre. Un seul zygote sorganise en
embryon, puis en jeune plantule portant deux premires feuilles, les cotyldons. Durant
ce dveloppement, lovule fcond sest dtach de la feuille et a t dissmin. La
croissance du jeune embryon se fait aux dpens des rserves accumules avant la
fcondation et peut se poursuivre sans interruption. Ce nest donc pas une vraie graine
qui a t dissmine. Cest pourquoi on dit que les cycas (ainsi que le Ginkgo) sont des
prphanrogames. Le cycle des cycas est donc constitu de deux gnrations successives
diffrentes. Il est haplo-diplophasique, digntique dominance sporophytique.
Par rapport aux Ptridophytes, des diffrences apparaissent.
1. On parle dornavant dovule comme organe de reproduction femelle. Ce terme
regroupe la fois des tissus du sporophyte (diplode) et du gamtophyte femelle
(haplode). Il est nu.
2. Le gamtophyte femelle, issu dune seule cellule de la miose, devient parasite
du sporophyte. Il diminue de taille et est constitu dun tissu, lendosperme et de
une ou deux archgones.
3. Le nucelle peut tre considr comme le sporange femelle. Il est lui-mme protg
par des tissus spcifiques : les tguments.
4. Les grains de pollen constituent le prothalle, ou gamtophyte mle. Ils sont dissmins maintenant en milieu arien. Ces grains de pollen sont forms partir de
cellules issues de la miose dans des sporanges mles : les sacs polliniques, ports
par des tamines.
138

9782100544141-Laberche.fm Page 139 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

5. Les gamtes mles sont toujours des spermatozodes et la fcondation peut encore
tre considre comme aquatique dans la chambre pollinique.
6. Lembryon se dveloppe grce aux rserves accumules dans lendosperme avant
la fcondation.
7. Cest lovule qui est dissmin et non une graine.
Les cycas sont des fossiles vivants
Ils se sont surtout dvelopps durant le Trias et le Jurassique (soit entre 240 et
140 millions dannes), avant lapparition des plantes eurs. Rien dtonnant alors
que lon considre les cycas comme de vritables fossiles vivants, comme leur
contemporain, le Ginkgo biloba L.. Les cycas prsentent en plus de leur reproduction,
loriginalit de xer symbiotiquement lazote atmosphrique ce qui leur permet de
se dvelopper dans des terrains relativement pauvres. Dans de nombreuses
rgions les ovules servent daliments pour les populations locales. Les cycas sont
universellement protgs par la Convention internationale sur le commerce des
espces menaces.

b) La reproduction sexue chez une Gymnosperme :


le pin sylvestre, Pinus silvestris L., Pinaceae
Les pins comme les autres conifres, sapins, picas, mlzes, cdres mais aussi ifs
et genvriers sont des arbres pouvant atteindre une grande taille. Les feuilles sont
des aiguilles et chez le pin sylvestre elles sont disposes par deux. Ce sont des arbres
monoques, portant la fois des cnes mles et femelles.
Ce sont essentiellement les cnes femelles (fig. 6.15) que lon aperoit en premier
sur larbre.
cne de lanne n + 1
rameau de lanne n

Dunod La photocopie non autorise est un dlit.

jeune cne femelle


de lanne

feuilles
rameau
de lanne
n+2
rameau de lanne n + 1

1 cm
cne de lanne n + 2

Figure 6.15 Les cnes femelles sur une branche de pin la fin du printemps.
Ils ont un ge et une maturit physiologique diffrents. Celui de lanne est
lextrmit ; le deuxime plus grand est ferm ; le troisime (g de deux ans) est
ouvert, ses graines ont dj t dissmines.

139

9782100544141-Laberche.fm Page 140 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Bien souvent on trouve sur le mme rameau des cnes dannes diffrentes. Cest
quen effet la reproduction sexue prend plusieurs annes pour se raliser. Mme si
ce sont les pommes de pin, aux cailles ouvertes qui retiennent lattention, il faut
sintresser dabord aux petits cnes verdtres, trs denses qui se dveloppent dans
la partie terminale des rameaux. Ils sont facilement observables la fin du printemps.
De dimensions modestes, deux centimtres de longueur pour un centimtre de largeur,
ils sont constitus dun ensemble de feuilles modifies, les cailles, chacune laisselle
dune bracte (fig. 6.16).

ovule

Figure 6.16 Schma


de la coupe longitudinale
dun jeune cne femelle de pin
montrant la disposition
des cailles et des ovules.

caille
1 mm

bracte

Sur leur face suprieure se dveloppent deux ovules, ovodes dun millimtre de
long environ et dont un bord est largement soud la feuille. Cet ovule est constitu,
comme chez le cycas, de lextrieur vers lintrieur :
de tguments laissant une entre vers les structures internes, le micropyle ;
dun nucelle (diplode) ;
dun endosperme cnocytique, provenant du dveloppement dune miospore du
nucelle (les trois autres dgnrent).
Cet endoderme est donc haplode et correspond au gamtophyte femelle. ce
stade les archgones ne se sont pas encore diffrencis dans lendoderme. Pourtant
des grains de pollen arrivent au niveau du micropyle. Ils viennent des cnes mles
les puits de soufre (fig. 6.17) qui se sont dvelopps aussi sur larbre.
Les cnes mles sont disposs la base des rameaux de lanne. Ils sont constitus
de petites feuilles troites, les cailles. Elles portent sous elles, deux sacs polliniques
qui correspondent aux sporanges mles. Ces feuilles modifies peuvent donc tre
nommes tamines. Ces sacs polliniques contiennent des grains de pollen, qui
proviennent du dveloppement dune cellule issue de la miose. Ils sont entours
dune paroi paisse et prsente deux ballonnets latraux permettant leur dispersion par
le vent. Chaque grain de pollen est un gamtophyte mle comprenant quatre cellules :
deux cellules prothalliennes, une cellule reproductrice, une cellule vgtative.
140

9782100544141-Laberche.fm Page 141 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

sac
pollinique

c.
1 cm

cne ?

d.

caille

aiguilles

ballonnets

a.

b.
1 cm

1 cm

0,1 mm

Figure 6.17 Les cnes mles chez le pin sylvestre.

Dunod La photocopie non autorise est un dlit.

a, vue densemble des cnes au printemps ; b, coupe longitudinale dans un cne ;


c, une caille et ses sacs polliniques ; d, le grain de pollen et ses ballonnets.

Aprs dissmination en juin, les grains de pollen proches du micropyle commencent


germer sur les tguments, plus exactement, ils mettent un tube pollinique o
sengage le noyau de la cellule reproductive. En mme temps la cellule vgtative se
divise une fois. Toute activit cesse jusquau printemps suivant. la sortie de lhiver,
le dveloppement reprend. Dabord au niveau de lendosperme. Le gamtophyte
femelle diffrencie deux ou trois archgones. Ils sont simples. Une grosse oosphre
(500 600 mm dans sa plus grande longueur) et un col rduit deux ranges de quatre
cellules superposes. Puis dans le gamtophyte mle, la croissance du tube pollinique
reprend alors que la cellule reproductrice se divise en deux cellules non limites par
une paroi. Ce sont des gamtes non cilis. Le tube pollinique pntre dans le col de
larchgone et dverse son contenu dans loosphre. Seul un gamte mle fusionne
avec loosphre pour donner le zygote, tous les autres noyaux mles dgnrent. Le
gamte mle fcondant na jamais fait preuve de mobilit ; on a une siphonogamie.
Lembryon commence se dvelopper et donner une plantule, ses six premires
feuilles, les cotyldons, se chargent de rserves lipidiques et protiques comme
dailleurs lendosperme. Les tguments ovulaires durcissent, se lignifient, pendant
que lendosperme et la plantule se dshydratent. On est en prsence dune graine.
Elle reste inactive, elle est en dormance dans le cne jusquau printemps suivant. ce
moment seulement, les cailles souvriront et les graines seront dissmines par le vent.
Malgr leur aile, cette dissmination se fait 80 % dans les 30 40 mtres autour de
larbre dont elles sont issues. Le cycle de ce pin est donc constitu de deux gnrations successives diffrentes. Il est haplo-diplophasique, digntique dominance
sporophytique.
141

9782100544141-Laberche.fm Page 142 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Comme chez le cycas on retrouve :


1. Lovule comme organe de reproduction femelle, il est toujours nu sur sa feuille.
2. Le gamtophyte femelle, issu dune seule cellule de la miose, qui est parasite du
sporophyte.
3. Le nucelle qui peut tre considr comme le sporange femelle. Il est lui mme
protg par des tissus spcifiques : les tguments.
4. Le grain de pollen constitue le prothalle, ou gamtophyte mle. Il est dissmin
en milieu arien.
Mais des caractristiques nouvelles apparaissent :
1. Les gamtophytes se rduisent : six cellules pour le grain de pollen de pin, un
endosperme cnocytique et quelques archgones pour le gamtophyte femelle
2. Les gamtes mles ne sont plus cilis, ils sont incapables de se mouvoir par eux
mmes.
3. La fcondation saffranchit du milieu hydrique pour se raliser. Cest une siphonogamie.
4. Les tguments de lovule, aprs fcondation, se durcissent protgeant ainsi la
plantule.
5. Pendant le dveloppement de lembryon, les cellules de lendosperme et celles
des cotyldons accumulent des rserves, qui seront utilises au moment de la
germination.
6. La plantule se dshydrate et entre en vie ralentie en attendant des conditions
favorables de germination.
Cest une graine qui est dissmine.

6.4.4 La reproduction sexue chez les Angiospermes


Chez les Angiospermes la reproduction sexue seffectue dans les fleurs. Leur
organisation florale est tout fait caractristique et a t aborde dans le chapitre 2
Savoir dcrire un vgtal . Si nous nous rappelons le trfle blanc, on se souvient
que les fleurs sont hermaphrodites et regroupes en capitule globuleux de 2
100 fleurs (fig. 3.1). Leur organisation est trs classique et comprend (fig. 6.18) :
Des pices florales striles. Les six spales forment le calice rgulier et les six
ptales, la corolle irrgulire. Cette dernire est une papilionace, ce qui signifie
que le ptale suprieur, ltendard, est recouvrant et plus grand que les autres. Les
deux ptales latraux, les ailes, recouvrent les deux ptales infrieurs, qui souds
forment la carne.
Des pices florales fertiles. Landroce est constitu de dix tamines (les neuf
infrieures sont soudes leur base et la suprieure libre) et le gynce comprend
un ovaire supre compos dun unique carpelle contenant de deux six ovules.
Le fruit est une gousse.
Avant de dcrire les stades de la reproduction, il est ncessaire de bien connatre
les organes reproducteurs.
142

9782100544141-Laberche.fm Page 143 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

axe floral

spales souds
tendard
tamines
carne
ovules
aile
ovaire
spales

1 mm
ptales

Figure 6.18 La fleur de trfle.


a : morphologie, b : diagramme oral.

Dunod La photocopie non autorise est un dlit.

a) Les organes reproducteurs femelles sont les carpelles


dont lensemble forme le gynce
Chez le trfle rampant, il ny a quun carpelle. En gnral, chez les Angiospermes,
celui-ci est constitu de deux parties : la basale creuse contient le ou les ovules et la
sommitale forme le pistil constitu du style et des stigmates. Lovule est de forme
ovode et est limit extrieurement par deux tguments (parfois dun seul) interrompus
par un micropyle (fig. 2.15). Cet ovule contient le gamtophyte femelle haplode, qui
est inclus dans les tissus diplodes appartenant la plante-mre (fig. 6.19). Cest le
sac embryonnaire directement comparable au prothalle des fougres mais beaucoup
plus rduit. Cet individu haplode est gnralement octonucl. Les huit noyaux
rsultent de trois divisions successives dune mgaspore. Aprs une miose suivie
dune mitose, il y a huit cellules qui gnralement sagencent en trois cellules au ple
micropylaire (une oosphre flanque de deux synergides), trois autres au ple oppos
(les antipodes) et deux noyaux centraux surnomms selon les auteurs de polaires,
secondaires ou accessoires.
Si ce sac embryonnaire octonucl, issu dune seule mgaspore est, effectivement,
le plus rpandu puisquil se trouve chez la plupart des Dicotyldones et quelques
Monocotyldones, il peut ntre que ttranucl comme chez lonagre bisannuelle,
Oenothera biennis L. Onagraceae. Dans dautres cas plusieurs mgaspores peuvent
se diviser. Avec deux mgaspores se divisant deux fois on aura un sac embryonnaire
huit cellules (cas des Allium), avec quatre mgaspores se divisant une seule fois, on
sera en prsence dun sac embryonnaire contenant toujours huit cellules mais constitu
de quatre prothalles fusionns comme chez ladoxa, Adoxa moschatellina (Tourn.) L.
Adoxaceae (on dit alors quil sagit dun cnoprothalle, du grec koin = commun),
143

9782100544141-Laberche.fm Page 144 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

micropyle

vascularisation

2 synergides
oosphre
2 noyaux polaires

sac embryonnaire
(cnoprothalle)

3 antipodes

nucelle

tgument

Figure 6.19 Lovule contenant le sac embryonnaire chez une Angiosperme,


le sureau Sambucus ebulus L., Caprifoliaceae (Document N. Toutchina,
Institut Komarov de Saint-Ptersbourg, Acadmie de sciences de Russie.)
Le sac embryonnaire bien quoctonucl et de disposition classique nest pas issu
dune seule mgaspore mais de 4 nayant subi que la division rductionnelle. Ce
sac embryonnaire est de type Adoxa (explication dans le texte).

moins que se divisant plusieurs fois, le sac embryonnaire soit 16 cellules comme
chez le chrysanthme, avec cependant un seul ovule fonctionnel mais deux synergides,
deux noyaux centraux et onze antipodes.
O est larchgone dans le sac embryonnaire?
On ne reconnat pas, apparemment, chez ce gamtophyte femelle larchgone des
Bryophytes et des Ptridophytes, encore identiable chez les Gymnospermes, bien
que plus rduit. Plusieurs auteurs ont suggr que le sac embryonnaire reprsente
le gamtophyte femelle rduit deux archgones dont les 3 antipodes reprsenteraient le prothalle proprement dit. Par rapport aux gamtes femelles souvent libres
144

9782100544141-Laberche.fm Page 145 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

des Thallophytes, larchgone apparat comme une protection du gamte die par
le gamtophyte. Libre chez les Bryophytes et les Ptridophytes, ce gamtophyte
haplode devient parasite du sporophyte qui la produit par miose chez les Gymnospermes et les Angiospermes. Chez ces seules dernires il dispose, en outre, de la
protection du carpelle dans lequel les ovules sont enclos. Cette protection de plus
en plus renforce saccompagne alors dune diminution du nombre de cellules le
constituant. Cette rgression de la taille du gamtophyte corrlativement
laugmentation de la protection nest pas propre au monde vgtal et se retrouve
chez les animaux.

b) Les organes reproducteurs mles sont les tamines


Elles sont formes dun filet et une anthre avec deux sacs polliniques. Les grains de
pollen se forment dans les tamines. lorigine se trouvent des microspores diplodes
entoures de cellules nourricires. Par la miose ces microspores voluent en ttraspores haplodes qui vont continuer se diviser, au moins une fois, par une simple
mitose avant de sentourer dune enveloppe rigide paisse constitu de deux couches
contenant de la cellulose : lexine (externe et fortement ornemente) et lintine (interne).
Ce grain de pollen est un gamtophyte mle, trs rduit, constitu de deux cellules
(parfois plus) souvent non cloisonnes : une cellule vgtative et une cellule gnrative
(ou spermatogne) (fig. 6.20). Au moment de lanthse, court laps de temps o les
fleurs sont fonctionnelles pour les organes reproducteurs mles et femelles, les grains
de pollen seront librs dans latmosphre par dchirure des sacs polliniques.
cellule gnrative
noyau reproducteur
intine
exine
ornementation
cellule vgtative

Dunod La photocopie non autorise est un dlit.

pore (aperture)

noyau vgtatif

Figure 6.20 Reprsentation schmatique


dun grain de pollen avec ses deux cellules.
Le grain de pollen est entour dune enveloppe rsistante, rigide et hydrofuge,
lexine qui se conserve ltat fossile. Constitue de couches successives cette
exine est amincie en des zones caractristiques permettant le passage du tube
pollinique (les apertures). La taille mais aussi lornementation varient en fonction
des modes de dissmination : les petits pollens lisses sont transports par le vent,
les gros fortement ornements sont transports par les animaux. Alors que les
fossiles vgtaux sont rares, ltude des pollens (la palynologie) dans les sdiments permet de connatre la vgtation dalors. En industries agroalimentaires,
ltude du pollen permet aussi de contrler lorigine des miels.

145

9782100544141-Laberche.fm Page 146 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

c) Le rapprochement des sexes


Les plantes tant fixes au sol par leurs racines, il faut que le pollen, seul gamtophyte
libre, soit transport vers lautre sexe. Il peut y avoir autogamie : la fcondation de
la fleur se fait par son propre pollen, soit allogamie : la fcondation se fait partir de
pollen provenant dune autre fleur porte par le mme individu ou une autre. Chez
les plantes autogames, les tamines librent, le plus souvent, leur pollen avant mme
lpanouissement de la fleur gnralement petite et discrte (comme chez le bl).
Chez les plantes allogames cette pollinisation revt de trs nombreuses modalits
Certes, des plantes comme lortie dioque, le houx, les saules peuvent tre unisexues
(elles sont dioques). Il faudra donc obligatoirement que le pollen soit transport du
pied mle au pied femelle. Mais 95 % des fleurs sont hermaphrodites et pourtant
lallogamie est de rgle chez beaucoup despces : elle est favorise ou rendue obligatoire par des disjonctions fonctionnelles des sexes. Ainsi chez la campanule feuille
ronde dans la fleur nouvellement panouie seules les tamines sont fertiles, quand
elles seront fltries donc striles, les stigmates eux seront tals et prts recevoir les
grains de pollen. On parle alors de protandrie1. Chez la primevre, Darwin, vers 1860,
a observ deux types dorganisation florales portes par des individus diffrents : des
fleurs longistyles avec le style qui dpasse les tamines, et les fleurs brvistyles
avec des tamines nettement plus grandes que le style ; la fcondation nest possible
quentre fleurs de types diffrents, il y a incompatibilit lintrieur dune mme
forme florale.
Ce sont les animaux (on parle alors de zoogamie) et tout particulirement les
insectes (entomogamie) dans nos rgions (cas du trfle blanc), le vent anmogamie)
et plus rarement leau (hydrogamie) qui amnent les grains de pollen sur les stigmates.
Un mme pistil va recevoir sur ses stigmates plusieurs types de pollen qui proviennent
de plantes diffrentes. Dans limmense majorit des cas, cest bien souvent le pollen de
la mme fleur qui tombe sur les stigmates puisque 95 % des fleurs sont hermaphrodites
et sil est parfaitement exact que du pollen puisse faire le tour du monde emport par les
vents, une grande proportion des grains de pollen se dpose dans un rayon de moins
de cinq mtres de son lieu dmission. Ceci devrait avoir pour consquence de forts taux
de consanguinit prjudiciables la survie des espces. En ralit lautofcondation
est rare dans le monde vgtal et la fcondation croise trs frquente. Un contrle
gntique labor permet aux plantes de reconnatre, daccepter ou de rejeter, le
pollen selon son origine. Chez certaines plantes lorsque le pollen et les tissus du pistil
ont les mmes allles (S), la plante dcle une incompatibilit pollinique ou sexuelle
et le pollen est rejet. On connat actuellement la nature de ces gnes S et la nature

1. Cette protandrie se retrouvait chez les tomates anciennes et les premiers hybrides commerciaux
datant des annes 1970 (H63-4, H63-5, obtentions INRA). Quand les conditions de culture de
cette plante, originairement tropicale, taient dfavorables (jours trop courts par rapport aux nuits),
les tamines taient fertiles aprs lovaire, empchant toute pollinisation utile, donc la fructification.
Pour lever ce handicap agricole, les horticulteurs utilisaient des substances de croissance vgtales
naturelles ou synthtiques qui provoquaient le dveloppement parthnocarpique du fruit.
146

9782100544141-Laberche.fm Page 147 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

de leurs produits : les protines, S, sont des glucoprotines. Certaines possdent des
caractristiques enzymatiques, ainsi chez les Solanaceae (tomate, tabac, pomme de
terre) cette protine S est une ARNase qui dgrade les ARN, tandis que chez les
Brassicaceae (choux, colza) cest une kinase riche en cystine qui lie une molcule
dacide phosphorique une protine pour en modifier lactivit. Dautres mcanismes,
qui restent lucider, permettent le rejet des pollens appartenant des espces ou mme
des genres diffrents.
Les consquences de la disparition des insectes pollinisateurs
La production de plus des trois quarts des cultures, soit une grande majorit de la
production des fruits, des lgumes, des olagineuses et protagineuses, des fruits
coques, des pices et autres stimulants (caf, th, etc.), bncie de lactivit
pollinisatrice des animaux. Cette activit est dautant plus importante quelle est
lorigine de 35 % de la production mondiale de nourriture. conomiquement, ces
cultures pollinisation entomogame taient estimes en 2005 153 milliards deuros
soit 9,5 % de la valeur de lensemble de la production alimentaire mondiale.
Dans ce contexte, le risque li au dclin des insectes pollinisateurs apparat important : dabord sur les fruits, les lgumes, avec une valeur estime 50 milliards
deuros chacun, suivis par les olagineux avec 39 milliards, alors que limpact sur les
stimulants (caf, cacao), les fruits coque et les pices serait de moindre ampleur.
Nanmoins, la valeur moyenne des cultures dpendantes des pollinisateurs apparat
trs suprieure (760 par tonne) celle des cultures non dpendantes comme les
crales ou la canne sucre (150 la tonne).
Ainsi, la disparition des insectes pollinisateurs, en particulier celle des abeilles
domestiques et sauvages, entranerait une chute des rendements et modierait
profondment les quilibres alimentaires mondiaux, que lon connat actuellement.
Daprs Pascal Farcy : Le dclin des pollinisateurs aurait un impact double pour lhomme , Universnature 20-09-2008.

Dunod La photocopie non autorise est un dlit.

d) Reconnus par le pistil, les grains de pollen germent


sur les stigmates
Arrivs sur le pistil de la fleur fconder, les grains de pollen sy maintiennent grce
leurs ornementations ventuelles mais surtout parce que le les stigmates sont
gnralement recouverts dune scrtion visqueuse, qui nest produite que lorsque le
pistil est fcondable. Reconnus par le pistil, les grains de pollen se distendent au niveau
dune aperture, faisant saillir une protubrance qui deviendra le tube pollinique.
Celui-ci pntre dans les tissus du style et sallonge rapidement pour arriver jusquau
micropyle de lovule. Lallongement du tube pollinique peut tre considrable. Ainsi
chez le mas, le tube pollinique a prs de 20 cm de long et 10 m de large pour un
grain de pollen denviron 0,1 mm de diamtre ! Cet allongement correspond une
activit mitochondriale intense, coordonne par le noyau vgtatif qui sest dplac
vers lextrmit du tube pollinique. Il en est de mme du noyau de la cellule gnrative
qui rapidement se divise pour donner deux gamtes (fig. 6.21). Pour avoir une telle
147

9782100544141-Laberche.fm Page 148 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

croissance, le tube pollinique utilise son profit les constituants carbons et azots
des cellules du pistil.
stigmates
noyau vgtatif
tube pollinique

cellule gnrative

aperture

b
tube pollinique

2 gamtes
noyau
vgtatif

tissus du pistil

Figure 6.21 Reprsentation schmatique des modifications


dans le grain de pollen au moment de sa germination.
a, grain de pollen deux cellules ; b, division de la cellule gnrative ; c, germination du grain de pollen et dplacement des noyaux ; d, les deux gamtes ; e, le
cheminement du tube pollinique dans le pistil.

e) La double fcondation
Quand le tube pollinique atteint la cavit ovarienne, il se dirige vers les ovules et
arrive au micropyle et traverse une faible paisseur de nucelle. ce stade, le noyau
vgtatif, alors, dgnre tandis que les deux gamtes mles sont dverss par siphonogamie dans le sac embryonnaire. Lun des gamtes saccole loosphre 1, pntre et
sy unit ce qui donne un uf ou zygote diplode qui entre immdiatement en division,
commenant ainsi ldification de lembryon. Lautre gamte mle sunit aux deux
noyaux polaires pour donner un zygote accessoire triplode qui lui aussi se divise
1. La double fcondation a t dcouverte la fin du XIXe sicle indpendamment par le Russe Serge
Nawashin (1898) et le Franais Lon Guignard (1899).
148

9782100544141-Laberche.fm Page 149 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

rapidement et donne un tissu sans organisation : lalbumen, qui se charge de rserves


dont lembryon se nourrira ultrieurement. Parfois cet albumen se dveloppe peu : cas
des graines prispermes, ou rgresse ultrieurement : cas des graines exalbumines
(cf. 2.1.6).
La dure comprise entre la pollinisation et la fcondation est trs variable : de
quelques heures chez le haricot, elle peut atteindre 20 heures chez le mas et dpasser
un mois chez le bouleau, deux mois chez le chne et mme quatre mois chez le
noisetier ; en effet chez ces dernires espces, la maturit des ovules ne se fait que
tardivement et aprs celle du pollen.
Lembryon parasite
La grande originalit de la fcondation des Angiospermes est dtre double, on peut
dire que les deux fusions nuclaires simultanes entranent lapparition de deux
individus faux-jumeaux , lun diplode (lembryon), lautre triplode (lalbumen,
tissu inorganis vocation nourricire). Comme le signale Aline Raynal-Roques
dans son livre La Botanique redcouverte (Belin/INRA diteurs, 1994) les Angiospermes commencent donc leur vie au stade embryonnaire, en tant que parasite
dun tre trange, triplode, issu par voie sexuelle des mmes parents. Ce fonctionnement curieux assure la nutrition de la nouvelle gnration au stade o elle est
particulirement vulnrable et incapable de se nourrir par ses propres moyens .

Dunod La photocopie non autorise est un dlit.

f) La formation de lembryon
Lembryon est un individu gntiquement nouveau. En se dveloppant, il donnera
une plante adulte qui sdifie partir de luf. Cet uf prsente souvent une symtrie
axiale et une polarit trs nette avec un ple apical, caractris par un cytoplasme
trs dense o se situe lessentiel des potentialits organognes et un ple basal, au
cytoplasme vacuolis qui prendra part au dveloppement de lembryon pour la mise
en place des cellules de la racine.
Chez la plupart des Dicotyldones, lembryon se dveloppe selon un schma simple,
par une srie de divisions cellulaires qui seffectuent dans un ordre et des directions
immuables. Ainsi chez Erophila verna L. (Brassicaceae), (fig. 6.22) la premire division
qui suit immdiatement la fcondation engendre deux cellules superposes : la cellule
apicale (ca) qui est lorigine de lembryon et dune cellule basale (cb) qui produira
essentiellement le suspenseur auquel lembryon est appendu 1 dans la graine . Le
devenir de ces deux premires cellules est dj dtermin.
La cellule apicale (ca) se divise ensuite : une cloison verticale spare deux cellules
juxtaposes. Puis cest au tour de (cb) de subir une partition transversale en deux
cellules superposes. On aboutit une ttrade de quatre blastomres, dite en T, c. Les
deux lments de cette ttrade se divisent ensuite de telle faon que les quatre cellules
obtenues soient spares par deux plans paritaux verticaux orthogonaux : cest la
formation des quadrants a. Des mitoses quatoriales permettent lidentification des
octants b.
1. Appendre = suspendre quelque chose, lattacher, la pendre.
149

9782100544141-Laberche.fm Page 150 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

Par de nouvelles divisions tablissant des cloisonnements longitudinaux, transversaux et anticlinaux, on aboutit la formation des tages (l) et (l) . Les tages
de ltage suprieur (l) seront lorigine des cotyldons, et les cellules de ltage
infrieur (l) donneront naissance lhypocotyle , et .
PVt

PVt
T

ca

O q

cot

h
iec
co h

iec
co

iec
s

co

phy

cb
a

iec
a

b
2

co

s
3

Figure 6.22 Les premiers stades de dveloppement de lembryon


chez Erophila verna (Brassicaceae).
ca : cellule apicale du proembryon bicellulaire, cb : cellule basale du proembryon
bicellulaire, q : quadrants, l : cellules lles suprieures de ca, l : cellules lles infrieures de ca, h : hypophyse, iec : initiales de la racine, co : coiffe, PVt : point
vgtatif, phy : rgion hypocotylaire, cot : cotyldons, s : suspenseur, m : cellule
moyenne de la ttrade. T : stade ttrade, Q : stade quadrants, O : stade octants.
Document Dr. J. Par (UPJV). Explications dans le texte.

Pendant ce temps, la cellule basale subit aussi des divisions cellulaires, mais
beaucoup moins nombreuses, aboutissant de grandes cellules superposes trs
vacuolises qui composent le suspenseur(s) . Seule la cellule suprieure du
suspenseur (h) ou hypophyse b participera ldification de lembryon [ ] en
tant lorigine de la cellule mre des initiales de la racine (iec) et de linitium de la
coiffe (co). Des cloisonnements successifs de cette zone aboutiront la mise en
place de la rgion racinaire de lembryon .
Remarque
La description prsente comme exemple correspond un type de dveloppement
embryonnaire. Il en existe dautres, bases sur les diffrentes proportions que prennent
dans ldication de lembryon, les cellules issues de la cellule apicale (ca) et/ou de
la cellule basale (cb).

Lembryon chez les Dicotyldones comprend donc typiquement (cf. fig. 2.21 et
2.22) :
Une radicule lorigine des racines avec sa base un apex. Elle est oriente vers
le micropyle, par lequel la racine sortira de la graine au moment de la germination.
150

9782100544141-Laberche.fm Page 151 Jeudi, 4. fvrier 2010 3:47 15

6.4 La reproduction sexue chez les Cormophytes

Une tigelle appele aussi hypocotyle. Elle est situe entre la radicule et linsertion
des cotyldons et donnera ultrieurement la tige principale Elle porte son extrmit suprieure les deux cotyldons.
Les cotyldons. Ce sont les premires feuilles diffrencies de lembryon, mais
elles ont une forme et une fonction trs diffrentes des feuilles de la plante adulte.
Les cotyldons participent la nourriture de lembryon en servant dintermdiaires
entre celui-ci et les rserves de la graine (quelles soient dans le prisperme,
lalbumen ou les cotyldons eux-mmes), donc quand la graine est htrotrophe.
Ils peuvent aussi verdirent et initier la photosynthse, marquant le dbut de
lautotrophie de la plante.
Une gemmule situe sur lhypocotyle entre les deux cotyldons. Elle correspond
au bourgeon apical de la tige principale.
Lembryon des Monocotyldones a une organisation diffrente de celle dcrite
ci-dessus. Chez le bl, lalbumen dont les cellules sont bourres damidon constitue
lessentiel de la graine1 et lembryon nen occupe quune petite partie. Lbauche du
cotyldon forme un arc de cercle la priphrie de lembryon qui se retrouve en
position latrale (fig. 6.23).

2 mm

t
Sc

1 mm

Co

s
ep
g
r

Cr

Dunod La photocopie non autorise est un dlit.

Figure 6.23 Lembryon dans le caryopse de bl (Triticum L., Poaceae).


Vu de dos a, en coupe longitudinale b, en vue presque ventrale c, montrant le positionnement de lembryon (e), et dtail de lembryon d: t, enveloppe du caryopse ;
Co, coloptile ; Cr, colorhize ; g, gemmule ; r, radicule ; Sc, scutellum ; ep, piblaste.
(Daprs Guinochet, modi.)

Chez le trfle rampant, trois quatre semaines sont ncessaires entre la fcondation
et la formation de la graine. Elle est en forme de cur et de couleur jaune brune et
mesure environ 1,5 mm de long sur prs dun mm de large avec un poids moyen de
0,5-0,6 g. Ce niveau de diffrenciation atteint, lembryon cesse de crotre. Il devient
1. Rappelons que chez les Poaceae (bl, avoine, mas, dactyle, ftuque), les tguments du fruit sec
indhiscent sont colls lalbumen et ne sen sparent pas. On parle alors de caryopse (cf. 2.1.7).
151

9782100544141-Laberche.fm Page 152 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

latent, terme nullement scientifique qui pourtant sous-entend que lembryon est dsormais apte se dvelopper lorsquil sera dans des conditions favorables de germination.
En attendant, il est en vie ralentie.
propos de la graine
Cette vie ralentie intervient la n de la phase de dveloppement de la graine et
correspond gnralement, dans nos rgions, des priodes climatiquement plus
sches. Il peut arriver, si les conditions climatiques sont trs humides durant cette
formation de la graine que lembryon nentre pas en vie ralentie et continu son
dveloppement en consommant ses rserves. Les agriculteurs connaissent malheureusement bien ce fait ; si lors des moissons, les pluies sont importantes et surtout
persistantes, le bl germe dans lpi lui faisant perdre son pouvoir germinatif
pour lanne suivante et diminuant les qualits boulangres du grain rcolt. Cette
entre en vie ralentie est incontestablement un facteur de survie de lespce.
Ldication de lembryon, se droule selon un processus constant chez toutes les
espces dun genre et mme dune famille. Ceci a permis a plusieurs botanistes
(Sougue, 1950, Lebgue, 1960) de proposer une classication embryognique, base
sur lorientation des premires divisions cellulaires et les devenir de la cellule basale.
Les rgles qui prludent lorganisation de la plantule ont t rcemment comprises
grce ltude de mutants, particulirement dArabidopsis thaliana. Les tapes
successives de lembryogense sont contrles par des gnes agissant en succession
et dirigeant peu peu le devenir des divers territoires embryonnaires. Ainsi deux
gnes (mis en vidence par les mutations gnom et monopteros) assureraient en
tout premier lieu la polarit apico-basale puis juste aprs la mise en place dun
plan gnral dorganisation. Au total, plus de 40 gnes sont impliqus dans les
processus qui conduisent du zygote lembryon achev.

En mme temps que se forme la graine, les parois de lovaire se dveloppent pour
donner chez le trfle une gousse. Ce dveloppement rpond une importante
production de substances de croissance et particulirement dauxine par lovaire ds
la fcondation (cf. 9.3.1). Le fruit est donc une consquence de la fcondation et du
dveloppement de lembryon. Chez dautres Angiospermes, cest le conceptacle qui
shypertrophie, comme chez la pomme. On est en prsence de pseudo-fruits comme
ceci a t signal dans le chapitre 2.
Le cycle des Angiospermes est donc constitu de deux gnrations successives
diffrentes. Il est haplo-diphasique, digntique dominante sporophytique.
Comme chez les Gymnospermes, on retrouve :
1. Lovule comme organe de reproduction femelle.
2. Le gamtophyte femelle, issu dune seule cellule de la miose, qui est parasite du
sporophyte.
3. Les grains de pollen constituent le prothalle, ou gamtophyte mle. Les gamtes
mles ne plus cilis.
4. La fcondation saffranchit du milieu hydrique pour se raliser. Cest une siphonogamie.
5. Les tguments de lovule, aprs fcondation, se durcissent protgeant ainsi la
plantule.
152

9782100544141-Laberche.fm Page 153 Jeudi, 4. fvrier 2010 3:47 15

6.5 Lapomixie ou reproduction asexue

6. La plantule se dshydrate et entre en vie ralentie en attendant des conditions


favorables de germination.
7. Cest une graine qui est dissmine.
Cependant les Angiospermes apportent :
1. Une rduction toujours plus grande des gamtophytes rduits trois cellules chez
le grain de pollen et huit cellules dans le sac embryonnaire octonucl. On peut
trouver des sacs seulement ttranucl, comme chez lonagre.
2. Une double fcondation avec la formation du vrai zygote diplode et du zygote
accessoire qui en se dveloppant donnera un tissu particulier, lalbumen. Ce dernier
aura un rle de tissu de rserve.
3. Une nouvelle protection de lovule qui est enferme dans le carpelle.
Les chromosomes sexuels sont rares chez les plantes
Alors que lvolution semble avoir slectionn la sparation des sexes dans le
monde animal, la plupart des plantes suprieures sont hermaphrodites. Seulement
4 % des Cormophytes ont des sexes spars et dveloppent des eurs unisexues.
Parmi ce type de plantes (les plantes dioques) trs rares sont celles qui possdent
des chromosomes sexuels dont laction est semblable ceux des mammifres soit
XX pour les individus mles et XY pour les femelles. Cest le cas chez le compagnon
blanc (Silene latifolia, Poir. Caryophyllaceae) o le chromosome X provoque larrt
du dveloppement des organes femelles et lactivation du dveloppement des
organes mles tandis quen son absence, les organes femelles se dveloppent
normalement et le dveloppement des organes mles reste bloqu.

Dunod La photocopie non autorise est un dlit.

6.5 LAPOMIXIE

OU REPRODUCTION ASEXUE

Au cours de la reproduction sexue, miose et fusion des gamtes alternent rgulirement mais il peut arriver quun ou lautre de ces vnements ne se produise pas.
On parle alors dapomixie (du grec apo, privatif, et mixis = union). Il ny a donc ni
miose, ni gamte et le patrimoine gntique est rigoureusement identique celui
du parent. Tous les descendants forment un clone. Thallophytes et Cormophytes
pratiquent lapomixie. Elle est exceptionnelle chez les Gymnospermes, rare chez les
Ptridophytes, mais frquente chez les Thallophytes et les Angiospermes.
Chez les Angiospermes, lapomixie peut tre une multiplication vgtative par
bulbes, bulbilles, rhizomes, stolons ou une agamospermie avec la formation de
graines dont lembryon est identique au parent femelle. Cet embryon peut provenir
du dveloppement dune cellule du nucelle ou des tguments ovulaires (on parle alors
dembryon adventif) ou du sac embryonnaire. Cest alors de lapomixie gamtophytique.

6.5.1 La multiplication vgtative


La multiplication vgtative nest considre comme un cas dapomixie que si les
processus sexuels normaux sont suspendus ou inexistants. Cest le cas du pturin
vivipare chez qui les fleurs sont remplaces par des bulbilles. Dans tous les cas, il
153

9782100544141-Laberche.fm Page 154 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

ny a jamais formation de graines ce qui exclut de considrer la multiplication


vgtative des palmiers dattiers, des oliviers, des artichauts ou des graniums comme
de lapomixie puisque la reproduction sexue y est fonctionnelle. Trois grands types de
multiplication vgtative existent : la fragmentation de lorganisme, lisolement de
cellules spcialises, la formation dorganes spcialiss.

a) La fragmentation de lorganisme
Mme si, tout naturellement, cest ce mode de multiplication que chacun pense
quand on aborde cette question (qui na jamais ralis de boutures de granium ?),
force est de constater que la fragmentation ne se produit que rarement en conditions
naturelles. Chez les Thallophytes, le myclium des champignons se fragmente quand
les hyphes centraux vieillissent. Il en est de mme chez les algues comme les sargasses
(algues brunes), o des fragments de la plante mre, spars par loscillation de la
mer, peuvent reconstituer un individu entier. Cest aussi le cas des lichens qui se
brisent lors dune forte scheresse ; chaque fragment est alors capable de redonner un
individu complet. Chez les Cormophytes, ce sont essentiellement les rhizomes, surtout
quand ils sont ramifis comme celui de liris, du muguet ou de la fougre Aigle, qui
assurent la multiplication vgtative par fragmentation. En effet, il nest pas rare que
le rhizome parental dgnre isolant des rhizomes secondaires.
Biodiversit et apomixie
Un exemple de multiplication vgtative naturelle par fragmentation, donc
dapomixie, est celui de llode, Elodea canadensis1 (L.) Michx, Hydrocharitaceae,
qui est en Europe, une plante unisexue originaire dAmrique du Nord. Elle a t
introduite involontairement au XVIIIe sicle en Europe lors dactivits commerciales
transatlantiques. Depuis cette date elle colonise, par fragmentation, les cours
deau dEurope, bien que seul le sexe mle ait t introduit.

b) Lisolement de cellules spcialises


Cest un mode de multiplication vgtative nappartenant quaux Thallophytes. Les
organises produisent des spores asexues qui peuvent tre de deux sortes : les spores
endognes et les spores exognes.
Les spores endognes se forment soit lintrieur dune cellule du thalle, soit
dans des sporocystes. Le plus souvent, il y a formation dune zoospore flagelle qui
aura besoin deau pour se dplacer. Les spores exognes sont trs frquentes chez
les Champignons. Ainsi, chez les pnicilliums, la multiplication vgtative est trs
intense et seffectue dans des zones spcialises du thalle o les filaments dresss et
ramifis, les conidiophores sont groups en masse. lextrmit de chacun deux
une cellule spcialise, la phialide, met des conidiospores par bourgeonnements
successifs (fig. 6.24).
1. Pour plusieurs auteurs, llode doit scrire en latin Helodea (Gorenflot, Heller) alors que
pour dautres le nom latin ne prend pas de h (Guinochet, Raynal-Roques).
154

9782100544141-Laberche.fm Page 155 Jeudi, 4. fvrier 2010 3:47 15

6.5 Lapomixie ou reproduction asexue

conidiospore

strigmate
phialide

Figure 6.24 Schma


dun conidiophore de Pnicillium
Les conidiophores se dressent verticalement
sur le myclium. Chacun est form dune le
de cellules ramies. Chaque extrmit se
termine par une cellule spcialise, la phialide,
possdant un appendice efl, le strigmate,
do schappent les conidiospores (appeles
improprement conidies). Ces spores sont des
sporocystes qui contiennent maturit 5
8 zoospores.

conidiophore

c) La formation dorganes spcialiss

Dunod La photocopie non autorise est un dlit.

De nombreux types dorganes spcialiss existent, surtout chez les Cormophytes. Il


sagit des bulbes, bulbilles et tubercules, stolons, rhizomes, dj dcrits dans le chapitre 2 (pages 15 17). Les propagules chez les Bryophytes compltent cette liste.
Dans tous les cas, il sagit densembles pluricellulaires individualiss qui se sparent
de la plante mre et qui permettent la rgnration de nouveaux individus quand ils
se trouvent dans des milieux favorables leur dveloppement.

6.5.2 Lagamospermie
Lors de lagamospermie, des embryons et des graines se forment, sans pour autant
quinterviennent des phnomnes sexuels. Lembryon est donc gntiquement
identique lindividu qui la produit.

a) Les embryons adventifs


Ils se dveloppent directement partir des cellules diplodes du nucelle et des
tguments de lovule sans quapparaisse le sac embryonnaire. On obtient une
155

9782100544141-Laberche.fm Page 156 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 6 La reproduction

polyembryonie 1 des graines comme chez les citrons (Citrus trifoliata L.,
Rutaceae).

b) Lapomixie gamtophytique
Le sac embryonnaire se met en place mais avec une miose perturbe, non rductionnelle. Un embryon peut se dvelopper partir dune des cellules du sac comme le lis
martagon (Lilium martagon L. Liliaceae).
Toutes ces modalits de lapomixie prsentent en commun plusieurs points
originaux :
1. Elles ne sont possibles que parce ce que les cellules vgtales ont des proprits
de ddiffrenciation, dabord, de diffrenciation, ensuite, de multiplication, enfin,
originales.
2. Elles permettent lobtention de clones, gntiquement identiques.
Lhomme utilise ces proprits en agriculture, en de nombreuses occasions.

6.6 LA

DISSMINATION DES GRAINES

Au cours des diffrents paragraphes de ce chapitre nous avons vu que les Bryophytes
se propagent par des miospores haplodes entranes par le vent et leau qui en
germant donneront des protonmas gamtophytiques. Il en est de mme pour les
Ptridophytes : si les conditions du milieu sont favorables une miospore haplode
sera lorigine dun prothalle gamtophytique puis dun sporophyte. La propagation
des Spermaphytes est diffrente. Elle est ralise lors de la reproduction sexue par
des sporophytes embryonnaires enferms dans des graines. Mais lors de la multiplication vgtative, se sont aussi les bulbes, bulbilles, tubercules et autres rhizomes qui
assurent la propagation des espces. Ainsi ce nest pas toujours la graine qui intervient. Dans le langage courant on parle alors de semence. Les botanistes prfrent
utiliser le terme de diaspore, qui correspond toutes les parties dune plante pouvant
tre dissmines que ce soit une graine, un fruit, une inflorescence, un tubercule, un
bulbe ou mme la plante entire comme chez la Rose de Jricho Selaginella
lepidophylla Spring, Selaginellaceae qui est une plante dsertique arrache et roule
par le vent du dsert.
Les agents de dissmination des diaspores sont nombreux. En premier lieu interviennent la pesanteur et les conditions climatiques. On parle danmochorie, elle
est favorise par la lgret des graines (Orchides), par la prsence dailes aux graines
(graine aile de pin, samare du frne), de poils (laurier-rose, pilobe) ou daigrettes
(benotes, clmatites). Mais les animaux, essentiellement les mammifres (par accrochage la fourrure : bardane) et les oiseaux (par ingestion : gui) sont aussi de puissants
1. La polyembryonie nest pas lie uniquement lagamospermie, mais peut exister lors de la
reproduction sexue. Souvent dans ce dernier cas un embryon est zygotique, lautre ou les autres
sont nucellaires comme chez le manguier (Mangifera indica L. Anacardiaceae) ou chez le cacaoyer
(Theobroma cacao L., Sterculiaceae).
156

9782100544141-Laberche.fm Page 157 Jeudi, 4. fvrier 2010 3:47 15

6.6 La dissmination des graines

facteurs de dissmination des graines, il sagit alors de zoochorie. Enfin, il ne faut


pas oublier le rle de lhomme qui assure volontairement ou involontairement la
dissmination de nombreuses espces (lode, prunier, pommes de terre).

Rsum

La reproduction chez les vgtaux prend de nombreuses formes quil est possible
de regrouper en reproduction sexue et asexue.
La reproduction sexue est caractrise par une alternance de gnrations : la phase
haplode et la phase diplode. On passe de lune lautre soit par la miose soit
par la fcondation. Les Thallophytes prsentent toutes les possibilits de cycles :
phase gamtophytique ou sporophytique dominante. Chez les Cormophytes, si
lon excepte les Bryophytes (les mousses), on assiste une rduction de la phase
gamtophytique. Libre chez les fougres, elle se rduit (prothalle chez les
fougres, sac embryonnaire chez les Angiospermes) en devenant parasite du
gamtophyte. En mme temps la protection de loosphre augmente. De mme,
les modes de fcondations changent. Chez les fougres lanthrozode, flagell,
a besoin deau pour rejoindre loosphre. Chez les Angiospermes il est directement dvers par siphonogamie dans le sac embryonnaire. Chez ces dernires
espces, se produit une double fcondation. Luf diplode donnera le nouvel
embryon, lautre triplode formera des substances de rserves ncessaires lors de la
germination. Ces modifications dans les types de reproductions peuvent tre
juxtaposes au droulement probable de lvolution des vgtaux au cours du
temps et tout particulirement lors du passage de la vie aquatique la vie terrestre.
La reproduction asexue des plantes est possible soit par production ou fragmentation dorganes (bulbes, tubercules, rhizomes...) soit par apomixie, soit par
production de spores comme chez les Thallophytes.

157

9782100544141-Laberche.fm Page 158 Jeudi, 4. fvrier 2010 3:47 15

LA

NUTRITION
DE LA PLANTE

Dans le chapitre 3 Comment sappelle cette plante ? Quelle est sa parent ? , nous
avons vu quautotrophie et htrotrophie taient des critres utiliss dans la classification. Les plantes sont autotrophes car elles sont capables de fabriquer leurs composs
organiques partir dlments simples : gaz carbonique de lair, eau et sels minraux
prlevs dans leau du sol. linverse, les champignons sont htrotrophes puisquils
doivent prlever dans le milieu des molcules organiques pour se dvelopper. Dans
ce chapitre, trois lments fondamentaux de la nutrition des plantes seront tudis.
Dabord leau qui est trs fortement absorbe par les vgtaux. Pourtant, elle nentre
que pour une trs faible part dans le mtabolisme. Puis les sels minraux qui sont
prlevs dans le sol avant dtre vhiculs jusque dans les parenchymes o ils entrent
dans le mtabolisme. Enfin la photosynthse qui permet la synthse de glucides, mais
aussi la production de molcules riches en nergie dont le mtabolisme a besoin.

7.1 LA

NUTRITION HYDRIQUE

Parler de nutrition hydrique chez les vgtaux est quelque chose de commun. Chacun
sait que pour se dvelopper une plante besoin deau et quand celle-ci vient
manquer les consquences peuvent tre graves. Cest certainement la notion de physiologie vgtale la plus ancienne qui ait t tudie. Daprs ce que rapporte Caton
lAncien (234-149 av. J.-C.), aprs la victoire de Rome sur Carthage, il y a tout lieu
de penser que le premier agronome connu, le Carthaginois Magon, vivant au IIe sicle
av. J.-C, dveloppait dj, dans son trait dagronomie, des besoins en eau des cultures
et des techniques dirrigation utilises dans les jardins de lopulente capitale punique.
Cette notion de nutrition hydrique recouvre plusieurs aspects comprenant le sol, les
plantes et latmosphre.

7.1.1 Les rservoirs deau


a) Leau dans le sol
Provenant des pluies naturelles ou artificielles (irrigations), une partie de leau ruisselle
sur le sol avant que le complment ne sinfiltre. L, elle va occuper les espaces entre
158

9782100544141-Laberche.fm Page 159 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

les diffrents constituants daphiques (sables, argiles, limons, matires organiques)


(fig. 7.1). Cette eau va subir un ensemble de forces plus ou moins grandes. Il sagit :
de la gravit ;
des forces osmotiques (dues aux attractions exerces sur leau par les ions de la
solution du sol) ;
des forces dimbibition (attractions lectrostatiques exerces entre les charges
des collodes du sol et les charges + de leau) ;
des forces de capillarit (tension superficielle qui retient leau dans les interstices
fins).
solution du sol

lments minraux (sable, argile)

lacunes remplies dair

film hydrique
collode (eau dimbibition)

capillaires
eau de gravit

Dunod La photocopie non autorise est un dlit.

Figure 7.1 Leau dans le sol.

Ces trois dernires sont gnralement regroupes sous le vocable de forces de


rtention. Lorsque le sol est satur deau, celle-ci va subir laction de la gravit et
des forces de rtention du sol. Tant que la premire est plus forte que la rsultante
des autres, leau ne reste pas dans le sol. Elle sinfiltre en profondeur. lquilibre
les forces de rtention sont gales la force de gravit. La quantit deau retenue dans
le sol est maximale. Cet quilibre dtermine la capacit de rtention maximale. Le sol
va progressivement sasscher par vaporation et prlvement deau par les plantes.
Les forces de rtention exerces par le sol augmentent, ainsi que les forces de succion
dveloppes par le vgtal pour absorber leau du sol. Mais elles ont une limite qui
correspond environ 160 Jg1 (10 Jg1 = 1 bar). Ne pouvant plus prlever deau dans
le sol les plantes fanent. Ce moment sappelle le point de fanaison1. Leau restant
dans le sol ne peut plus tre absorbe par les plantes. Entre ces deux caractristiques
hydriques des sols, leau est disponible pour les plantes, elle constitue la rserve
en eau utilisable (RU) bien connue des agriculteurs (tabl. 7.1).
Ces chiffres paraissent importants. Ils doivent cependant tre relativiss, en effet,
une culture de mas consomme facilement 30 m 3 deau par hectare et par jour en
t.
1. Lexpression point de fanaison est un nologisme, utilis dans le vocabulaire agricole, mais
dfini par A. Raynal-Roques dans son ouvrage, La Botanique redcouverte, Belin/Inra diteurs,
1994.
159

9782100544141-Laberche.fm Page 160 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Tableau 7.1 Quantit deau disponible par hectare pour les plantes,
dans trois types de sols sur une tranche de sol de 40 cm.
Humidit du sol
la capacit de
rtention maximale

Humidit du sol
au point de
fltrissement

Eau disponible
sur une profondeur
de 40 cm

Sol sableux

10 %

4%

400 m3

Sol limoneux

20 %

7%

700 m3

Sol argileux

30 %

16 %

1600 m3

(Les expressions de lhumidit la capacit de rtention maximale et au point de trissement sont donnes
par le pourcentage de la masse deau dans le sol rapporte la masse de matire sche de sol).

b) Leau dans le vgtal


Leau est un constituant de la matire vivante. Elle sy trouve naturellement ltat
liquide, mais aussi sous forme de vapeur deau dans les mats et les chambres sousstomatiques des feuilles.
Sa dtermination et son expression

On dtermine leau dans un vgtal le plus souvent par schage, soit lair libre, soit
en tuve 55-60 C. La quantit est exprime en % par rapport la masse de matire
frache ou par rapport la masse de matire sche. La premire expression est commode
et donne des chiffres entre 5 et 95 %, mais elle est peu sensible, le poids de leau
tant la fois au numrateur et au dnominateur. La seconde mthode de calcul (par
rapport la masse de matire sche) est beaucoup plus rigoureuse mais prsente
linconvnient de donner des chiffres trs levs (tabl. 7.2).
Tableau 7.2 Quelques valeurs moyennes de la teneur en eau des vgtaux
(exprimes par rapport aux masses de matire frache ou sche).
Teneur en eau en % des masses:
Matriel tudi
de matire frache

de matire sche

Feuilles de bl

77

335

Caryopse de bl

12

14

Tubercule de pomme de terre

70

400

Bois de pin

55

122

Les formes deau dans la plante

Prsente dans tous les systmes biologiques, elle est, essentiellement, ltat liquide
et sy trouve sous trois formes diffrentes.
Leau de constitution. Elle fait partie intgrante de nombreuses molcules
organiques et reprsente 3 4 % de la masse deau totale contenue dans le vgtal.
160

9782100544141-Laberche.fm Page 161 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

Leau dimbibition. Elle imprgne les collodes hydrophiles. Elle constitue 20 %


de leau totale.
Leau libre. Elle circule dans les parois pecto-cellulosiques, les mats intercellulaires,
les vacuoles et les vaisseaux. Cest cette eau qui est quantitativement importante
mais aussi la plus facile dplacer.
Importance des soluts vacuolaires : notion de potentiel hydrique

Leau dans les vacuoles forme une solution de sels minraux et de mtabolites
dterminant une pression osmotique (po) qui attire de leau de lextrieur vers lintrieur
de la cellule, les membranes pouvant tre considres comme semi-permables.
Cependant les parois et membranes sopposent lexpansion du contenu cellulaire
en exerant une pression membranaire (pm) oppose. Au fur et mesure que leau
pntre la valeur osmotique dcrot (par dilution de la solution) et la pression
membranaire croit, si bien qu la fin, il y a galit entre les deux pressions ( po = pm)
et leau ne pntre plus. Cette diffrence entre deux pressions opposes tait appele
force de succion ou dficit de pression de diffusion (DPD) . Elle exprimait la
tendance nette de leau pntrer ou sortir de la cellule.
Actuellement, on parle de potentiel hydrique qui est dfini comme une grandeur
thermodynamique permettant de prvoir les mouvements de leau. Le potentiel
chimique de leau pure est par dfinition gal zro. Si dautres molcules ou ions
sont dissous dans leau, le potentiel hydrique baisse, cest--dire quil prend une
valeur plus ou moins ngative en fonction de la concentration des soluts. Dans les
systmes sol/plante ; plante/plante ou plante/atmosphre leau a toujours tendance
diffuser du compartiment o le potentiel hydrique est le moins ngatif vers le
compartiment o le potentiel hydrique est le plus ngatif. Leau va donc vers les
potentiels les plus bas. Quand deux cellules sont contigus, les changes deau entre
elles dpendent de leur gradient de potentiel hydrique (DY) : celle qui a le potentiel
hydrique le plus ngatif empruntera de leau sa voisine.

Dunod La photocopie non autorise est un dlit.

Les rles de leau

Ils sont particulirement nombreux et varis.


Leau contribue au maintien de la structure de la cellule et en particulier de la
structure collodale du cytoplasme.
Elle est le sige des ractions mtaboliques.
Elle intervient dans des ractions mtaboliques comme lhydrolyse ou la photosynthse, elle est donc en ce sens un aliment pour le vgtal.
Elle permet la turgescence des cellules et par l mme des tissus et des organes.
Elle vhicule les nutriments minraux et les produits du mtabolisme.
Par son rejet dans latmosphre sous forme de vapeur, elle emprunte la plante sa
chaleur latente de vaporisation. Elle permet celle-ci de supporter les rayonnements solaires et les divers chauffements climatiques.
Elle permet le dplacement des anthrozodes chez les Thallophytes, les Ptridophytes, les Bryophytes et les Prspermaphytes.
161

9782100544141-Laberche.fm Page 162 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

c) Leau dans latmosphre


Latmosphre contient de leau, essentiellement, sous forme de vapeur. La quantit
maximale, appele teneur en vapeur deau saturante, quelle peut contenir par unit
de volume varie en fonction de la temprature de faon exponentielle :
0 C : 4,75 104 g cm3
10 C : 9,4 104 g cm3
20 C : 17,4 104 g cm3
La vapeur deau atmosphrique est exprime gnralement, non en masse par unit
de volume dair, mais par la pression partielle quelle exerce, soit en millibars (mb),
soit en mm de mercure. Ainsi, les quantits prsentes ci-dessus correspondent des
pressions de vapeur saturantes respectivement de 4,6, 9,2, et 17,5 mm de mercure.
La diffrence entre la pression de vapeur deau dans lair un moment donn et la
pression saturante la mme temprature est appele le dficit de pression de saturation de vapeur deau. Toutes ces caractristiques qui ne sont pas dun usage trs
courant servent dfinir lhumidit relative, notion beaucoup plus usite que les
prcdentes et qui est le rapport (exprim en %) de la teneur en eau de lair existante
la teneur en eau saturante la mme temprature. Le vgtal va se comporter,
devant un dficit de pression de saturation de vapeur de lair comme une surface
vaporante et des transferts deau vgtal-air vont se produire. Ils seront fonction du
dficit, mais aussi des proprits physiques et anatomiques des surfaces vgtales.

7.1.2 Les mouvements de leau dans le systme


sol-plante-atmosphre
La plante absorbe de leau dans le sol. Cette eau va migrer des racines vers les feuilles.
L, elle est rejete presque totalement sous forme de vapeur par la transpiration, le
reste sous forme liquide par la guttation. Ce courant deau est une condition essentielle
de son activit au cours de la priode vgtative.

a) Localisation de labsorption de leau


Chez les plantes terrestres, cest dans la zone des poils absorbants que labsorption
est la plus intense
Les poils absorbants sont des excroissances cellulaires, contenant une grande vacuole,
situes juste au dessus de la coiffe sur la racine. Ils mesurent facilement 1 mm de long
et 0,01 mm de diamtre et multiplient donc la surface radiculaire par un facteur de
10 100. Lefficacit des poils absorbants pour labsorption de leau est due au fait
quils augmentent la surface de contact entre leau de sol et le racine. Dans le parenchyme, on admet gnralement que le cheminement de leau se fait dans les parois
cellulaires (apoplasme) et de cellules cellules dans le symplasme (ensemble des
cytoplasmes en continuit par les plasmodesmes) par suite de lexistence dun gradient
de potentiels hydriques comme lont montr depuis 1929 Ursprung et Blum (fig. 7.2).
162

9782100544141-Laberche.fm Page 163 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

Figure 7.2 Gradient de potentiels hydriques dans une racine de Vicia faba L.

Dunod La photocopie non autorise est un dlit.

Les donnes sont exprimes en bars.

la vue de ces chiffres, on comprend que leau puisse progresser jusqu lendoderme. Mais comment expliquer quelle continue progresser au-del jusquaux
cellules du xylme interne o la force de succion est plus faible ? Il semblerait, quau
contraire elles dussent cder de leau aux cellules voisines et non en recevoir. Pourtant lentre des vaisseaux, leau est mise sous pression, comme on peut le voir en
sectionnant une tige de tournesol la base et en surmontant le moignon dun manomtre. Cette pression, appele pousse radiculaire dpasse facilement un bar. On a
ainsi mesur chez lrable sucre (Acer saccharum March., Aceraceae) : 1 bar, la vigne
(Vitis vinifera L., Vitaceae) : 1,25 bar, le bouleau (Betula sp. L., Betulaceae) : 2 bars
et le marronnier (Aesculus hippocastanum L., Hippocastanaceae : 9 bars (donnes
de Heller, 1993). La pousse radiculaire se remarque lors de travaux agricoles : la
vigne pleure lors dune taille tardive. Elle joue certainement un rle important
dans la monte de la sve et sil ny avait pas de frottement, elle pourrait thoriquement suffire a expliquer lascension de la sve dans les arbres les plus hauts (un
bar = 10 mtres).
Cette pousse radiculaire nexiste que si la racine est vivante. Elle prsente une
priodicit journalire avec un maximum en fin de matine, mais aussi saisonnire
puisquelle permet lalimentation des bourgeons floraux et des fleurs des arbres et
arbustes qui fleurissent au printemps avant lapparition des fleurs (larbre de Jude
(Cercis siliquastrum L., Cesalpiaceae), le forsythia (Forsythia sp., Oleaceae)).
Toutefois son existence nest pas constante. Certaines plantes comme les conifres
nont pas cette pousse radiculaire. Le mcanisme de la pousse radiculaire est
trs mal connu. Il sagit incontestablement dun processus actif, li au mtabolisme.
La tendance actuelle serait de lier cette pousse radiculaire la pntration des
ions minraux dans la racine, la nuit. En effet, ceux-ci pntrent de lextrieur vers
lintrieur de la plante par la voie apoplasmique et symplasmique mais ils ne peuvent
en ressortir : la barrire de lendoderme tant pour les ions infranchissables vers le
parenchyme cortical. Les ions qui saccumulent dans le cylindre central diminuent
le potentiel hydrique, qui tant plus bas que le potentiel hydrique du sol permet le
transfert deau. Laugmentation de la pression de leau dans le cylindre central pousse
alors leau et les ions vers les parties suprieures du vgtal.
On a longtemps cru que la pntration de leau dans les racines ne faisait appel qu
la permabilit des membranes biologiques. Dabord dans le monde animal en 1992
(en particulier sur la membrane plasmique des globules rouges), puis plus rcemment
dans le monde vgtal (1997), la dcouverte, de lexistence de protines qui facilitent
163

9782100544141-Laberche.fm Page 164 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

le transport de leau remet en question cette affirmation. Ces protines sont des aquaporines ou canaux eau . Elles appartiennent la famille des protines appeles
MIP (Major Intrinsic Protein) constitues de six hlices transmembranaires et de
deux boucles contenant les squences dacides amins, asparagine-proline-alanine ; ces
deux dernires boucles contribueraient la formation dun pore par lequel les molcules
deau circuleraient (fig. 7.3).
Circulation deau
Boucles

Hlice protique
transmembranaire

Figure 7.3 Schma dune aquaporine.


Les aquaporines ont six hlices transmembranaires et deux boucles contenant des
acides amins. Ces boucles contribueraient la formation dun pore par lequel
pourrait circuler leau. (Daprs Touraine, simpli.)

On connat actuellement plus de 35 gnes codant la dizaine daquaporines connues


par exemple chez Arabidopsis thaliana (L.) Heynh., Brassicaceae, quelles soient
localises sur la membrane vacuolaire ou sur la membrane plasmique. Les aquaporines
sassocient par quatre pour former un pore dans la membrane cellulaire qui a pour
taille 2 nanomtres de long sur 0,3 de large. Chacune fonctionne comme un canal
indpendant et grce ltranglement en son centre permet aux molcules deau de
passer, mais empche les autres molcules plus grosses et plus petites de sinfiltrer.
Si la taille des aquaporines permet de comprendre limpossibilit pour une grosse
molcule de passer par le canal central, il reste comprendre pourquoi les aquaporines
empchent les protons (plus petits que leau) de traverser. Le mcanisme est maintenant
connu. La largeur du canal de laquaporine fait que les molcules deau se prsentent
lentre les unes derrire les autres et lies par des liaisons hydrognes entre latome
doxygne et un atome dhydrogne. Latome doxygne est en premier. Lorsquelles
arrivent mi-parcours, lattraction des acides amins des boucles protiques internes
les contraignent se retourner et rompre les liaisons hydrognes quelles avaient
entre elles. Cette rotation repousse vers lextrieur, les protons qui ne franchissent pas
le pore. Les molcules deau ressortent de laquaporine, avec cette fois, les atomes
dhydrogne en avant.
Si le passage de leau est le premier rle dvolu aux aquaporines, limpossibilit
des protons de passer par ces pores est de la plus haute importance. En effet, les protons
164

9782100544141-Laberche.fm Page 165 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

sont ncessaires pour fournir la cellule son nergie (cf. respiration vgtale) et sils
venaient schapper la survie de la cellule serait compromise.

b) Le cheminement de leau dans la plante


Leau absorbe dans les racines circule dans le parenchyme cortical puis passe
lendoderme avant de pntrer dans le cylindre central et de se dverser dans les
vaisseaux du xylme. On a lhabitude dappeler sve brute la solution minrale venue
du parenchyme cortical qui est vhicule dans les vaisseaux. Cest une solution trs
dilue (0,1 2 g L1 de sels minraux, avec quelques composs organiques) galement
absorbs dans le sol. ce transit horizontal succde une circulation ascendante appele
conduction vasculaire, dans des cellules mortes, dont les alignements constituent
les vaisseaux (voir le chapitre sur les tissus). Cette circulation est mise en vidence
par les expriences classiques de dcortication annulaire qui empchent le vgtal
davoir ses parties ariennes correctement approvisionnes en eau. La vitesse de
transit est trs variable. Elle peut atteindre les six mtres par heure, mais peut tre
trs faible lobscurit ou inversement plus rapide lorsque latmosphre ambiante
est trs sche. Fait suite, un nouveau cheminement horizontal dans les parenchymes
de lappareil arien (feuilles, fleurs, fruits, etc.). Ces mouvements deau se terminent
par la transpiration, qui est une vaporisation de leau dans les lacunes des tissus, puis
dans latmosphre. Une faible part seulement de leau est utilise par les cellules
(mtabolisme, croissance).

Dunod La photocopie non autorise est un dlit.

7.1.3 Lmission de leau: la transpiration


Leau arrive dans les parenchymes foliaires est rejete dans latmosphre sous
forme de vapeur deau, la transpiration. Cest un rejet deau du vgtal sous forme
de vapeur. Elle constitue la plus grande partie des sorties deau. Il a t tabli, depuis
plus dun sicle, quil y a en fait deux transpirations : la transpiration stomatique et
la transpiration cuticulaire (au travers de la pellicule cireuse recouvrant lpiderme).
La cuticule tant dpaisseur variable selon les espces, le rapport entre ces deux
transpirations est trs variable. Pour les plantes de nos rgions la transpiration cuticulaire avoisine les 10 % de la transpiration stomatique, tandis que dans les pays
chauds et secs elle peut descendre quelques pour-cent (laurier : 2 %). Cest donc
essentiellement la transpiration stomatique qui sera dtaille, tant bien entendu, que
les phnomnes physiques et nergtiques qui interviennent dans la vaporisation de
leau sont les mmes pour les deux transpirations.

a) La mise en vidence de la transpiration


Trs classiquement, depuis Hales en 1727, on met en vidence la transpiration en
disposant une plante sous une cloche de verre et en remarquant que les parois se
couvrent de vapeur deau, si elles sont plus froides que lintrieur de la cloche.

b) Les stomates
La transpiration vgtale se produit essentiellement par les feuilles, mais aussi par les
jeunes tiges et les fleurs. Cette transpiration seffectue surtout par les stomates qui
165

9782100544141-Laberche.fm Page 166 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

sont des dispositifs anatomiques originaux. Ils parsment les pidermes des feuilles.
Ils ont des structures variables (fig. 7.4) selon les espces mais comprennent deux
cellules de garde (anciennement appeles cellules stomatiques) accoles et rniformes,
dont les bords plus ou moins concaves dlimitent un pore : lostiole.
ostiole

cellule de garde

ostiole

cellules de garde

cuticule

cellule de
lpiderme

chambre sousstomatique
vacuole

5 m
5 m

cellules du
chlorenchyme

Figure 7.4 Reprsentation schmatique dun stomate.


a, vue de dessus ; b, en coupe transversale.

Leurs dimensions moyennes oscillent autour dune vingtaine de micronmtres dans


la longueur et 10 15 mm de largeur. Lostiole pouvant lui seul avoir une fentre de
5 10 mm. Les stomates se trouvent donc au niveau de lpiderme, leur densit est trs
variable selon les espces ainsi que leur localisation, comme le montre le tableau 7.3.
Tableau 7.3 Densit de stomates et quantit deau journalire
rejete par les stomates chez trois espces dangiospermes.

Localisation

Densit au mm2

Eau rejete par jour


et par feuille

Dahlia

Face suprieure
Face infrieure

110
150

2 500 mg
3 000 mg

Tilleul

Face suprieure
Face infrieure

0
300

2 500 mg

Lierre

Face suprieure
Face infrieure

0
400

1 000 mg

Espce

Les stomates souvrent et se ferment. Les paississements de la paroi pectocellulosique au niveau de lostiole suggrent que louverture est due une dformation
mcanique des cellules de garde sous leffet de la pression vacuolaire. Cest effectivement ce quavait montr le physiologiste von Mohl ds 1856. Une entre deau
166

9782100544141-Laberche.fm Page 167 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

dans les cellules de garde entrane une ouverture de lostiole. linverse un dpart
deau entrane sa fermeture (fig. 7.5).
ostiole

stomate ouvert

vacuole

stomate ferm

cellule de garde se dformant

Figure 7.5 Modifications dans la forme des stomates lors de leur ouverture
ou de leur fermeture (en gris).

Intensit de la transpiration

Dunod La photocopie non autorise est un dlit.

Ces ouvertures et fermetures ne se font pas nimporte quel moment de la journe.


Il est mme tout fait possible dtablir des courbes reprsentant louverture et la
fermeture journalires des stomates en fonction des conditions climatiques extrieures
(fig. 7.6). Au cours dune chaude journe dt, les stomates souvrent compltement
dans la matine et se referment le soir. Cependant si la journe est trs chaude, ils
peuvent se refermer, plus ou moins, en milieu de journe : cest la dpression de midi.
Les sorties deau diminuent. Cette fermeture saccompagne souvent de modifications
quant lorientation des feuilles. Plutt que dtre perpendiculaires aux rayons du
soleil, elles se tournent et se disposent paralllement ceux-ci augmentant de ce fait
la rflexion (selon le principe de la loi de Descartes). De mme, en senroulant sur
elles-mmes chez les Poaceae, elles diminuent notablement leur surface recevant de
lnergie solaire.

100
90
80
70
60
50
40
30
20
10
0

belle journe
de printemps
forte chaleur
dt
automne

10

12
14
16
18
Heure de la journe

20

22

24

Figure 7.6 Ouverture et fermeture des stomates: priodicit journalire.


(Daprs Leme, 1970, modifi.)
Valeurs exprimes en % de lintensit maximale de la transpiration.

167

9782100544141-Laberche.fm Page 168 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Les phnomnes de nastie


On appelle nastie tous les mouvements chez un vgtal conscutifs un stimulus
extrieur, par opposition un tropisme. Les nasties peuvent tre dues des variations de la temprature ambiante (thermonastie), de lclairement (photonastie) ou
lalternance du jour et de la nuit (nyctinastie) sans oublier les rponses une
stimulation tactile (thigmonastie).
La plupart des organes vgtaux peuvent faire lobjet de nasties. Ainsi de nombreuses plantes ont un cycle douverture et de fermeture de leurs eurs. Souvent elles
ouvrent leur corolle le jour comme lipome (Ipomoea purpurea (L.) Roth, Convolvulaceae) qui est une plante volubile apparente au liseron des champs (Convolvulus
arvensis L.). Ses grandes eurs en trompette, souvrent le matin et se referment dans
laprs-midi la faveur de la chaleur. Il existe aussi des eurs nocturnes. Cest le
cas du Silne pench Silene nutans L. Caryophyllaceae ainsi que la Belle-de-nuit,
Mirabilis jalapa L. Nyctaginaceae. Chez cette dernire, les eurs de couleur blanche,
rouge, jaune, orang, mauve ou fuchsia mais aussi bicolores ne souvrent quen n
daprs-midi. Elles exhalent un parfum rappelant la eur de tabac qui embaume
toute la soire. Elles fanent le matin et sont remplaces par dautres eurs sur le
mme pied. Sans penser comme Linn quil existe une horloge de Flore , qui
permettrait de dire lheure grce aux eurs spanouissant successivement, il est
indniable que la lumire joue un rle, mme si dautres facteurs interfrent comme
la temprature ou lhygromtrie de lair. Chez les eurs qui se ferment en rponse
la tombe de la nuit et souvrent au lever du jour, on constate que lorsque la eur
souvre, les cellules de la surface extrieure des ptales prennent de lexpansion.
Lorsquelles se ferment, ce sont plutt les cellules de la surface infrieure qui
slargissent. Dans les deux cas, ceci est plus marqu la base de la corolle et les
mouvements de leau dans les vacuoles sont lis des variations de concentrations
en potassium.
Les nasties sobservent aussi chez les feuilles. Ainsi, certains jours de faible intensit
lumineuse, le tre (Trifolium sp., Fabaceae) et loxalis (Oxalis articulata L. Oxalidaceae). gardent leurs feuilles en position ferme. Cest une photonastie comme pour
les eurs. Mais la plante type est la sensitive, Mimosa pudica L. Mimosaceae dont les
feuilles se replient la nuit et se dploient le jour. La lumire nest pas le seul facteur
dclenchant le dploiement des feuilles et folioles. Un simple stimulus (thigmonastie) comme le fait de toucher une foliole produit la formation dun signal lectrique qui se propage le long de la plante plus ou moins grande distance selon
lintensit du stimulus. Cest cette onde lectrique qui produit au niveau des pulvinus
(renements la base de chaque ptiole et foliole), une variation de turgescence
responsable du mouvement de repliement de la feuille ou de ses folioles. Il sagit
de lun des mouvements les plus spectaculaires du rgne vgtal ! Ce mouvement
de repli permet de se protger des intempries, des prdateurs herbivores (un
rameau repli sur lui-mme est moins apptissant et les feuilles sont ainsi moins
exposes aux ventuelles dgradations naturelles). Une fois le calme revenu, les
feuilles reprennent leur port. Des cellules spcialises motrices situes sur laxe
de la feuille et du ptiole en sont responsables par un phnomne de migration
deau (la cellule stimule chasse leau engendrant le repli).

Les mcanismes permettant louverture et la fermeture des stomates sont maintenant


bien connus. Il faut que le potentiel hydrique baisse pour provoquer un appel deau,
donc louverture de lostiole, et inversement une augmentation du potentiel hydrique
168

9782100544141-Laberche.fm Page 169 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

provoque un dpart deau, donc une fermeture de lostiole. Actuellement, on voit dans
le potassium, llment dterminant dans louverture et la fermeture des stomates. En
effet, dans les cellules de garde la concentration en K+ passe de 0,01-0,05 M quand
les stomates sont ferms, 0,3-0,4 M, quand ils sont ouverts (fig. 7.7).
stomate ouvert
K+
(M)

stomate ferm

H+
(M)
8

e
K+

e c c

H+
8

0,6

0,4

0,4

0,2

0,2

0,6

Figure 7.7 Concentrations de potassium et de protons dans les stomates


et les cellules de lpiderme chez Commelina communis L. Commelinaceae
dans les positions du stomate ouvert (a) et du stomate ferm (b).
En pointill le potassium, en hachur les protons. c, cellule de garde, e, piderme.
(Daprs Penny et Bowling, cit par Lttge, 1992.)

Louverture des stomates est provoque par laccumulation du potassium dans


le cytosol dabord, dans la vacuole ensuite. Cette entre est la consquence dun
contre-transport (couplage de deux flux de sens opposs) entre les ions K + et les ions
H+ mis par une pompe protons situe dans le plasmalemme et tirant son nergie
de lhydrolyse de lATP. La lumire stimule cette pompe en fournissant des ATP,
mais aussi en permettant la synthse de malate qui est lanion quilibrant le cation
potassium.

Dunod La photocopie non autorise est un dlit.

De nombreuses hypothses pour expliquer louverture des stomates


Plusieurs thories se sont succdes depuis un peu plus dun sicle pour expliquer
louverture et la fermeture des stomates. Von Mohl en 1856 avait constat que les
cellules de garde taient chlorophylliennes. Il mit lhypothse quen prsence de
lumire des sucres taient synthtiss provoquant laugmentation de la pression
vacuolaire. Cependant, certaines cellules stomatiques (chez quelques Liliaceae
comme loignon) ne possdent pas de chloroplastes, pourtant leurs stomates
souvrent et se ferment. Cette hypothse a donc t abandonne, aux environs des
annes 1970, au prot de celle de lhydrolyse de lamidon prexistant en prsence
de lumire. Elle reposait sur le fait que lamidon disparait sous leffet de la lumire,
alors que la concentration en sucres solubles augmente. Lintervention de phosphorylases, trs abondantes dans les cellules de garde avait t envisage et lhypothse
avait t formule quelles taient stimules par laugmentation du pH provoque
par labsorption photosynthtique du CO2 interne. Malheureusement pour les partisans de cette thorie, les mesures de pH effectues dans les cellules ont montr
quil ny avait pas augmentation, mais diminution du pH lors de labsorption du
gaz carbonique. Cette thorie devait donc tre aussi limine.
169

9782100544141-Laberche.fm Page 170 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

c) La vaporisation de leau
Leau arrive dans les parenchymes foliaires sous forme liquide puis sort par les ostioles
stomatiques sous forme de vapeur deau. Cette vaporisation est sous la dpendance
du pouvoir vaporant de lair. Lair ambiant, plus ou moins sec, exerce sur leau
liquide une diffrence de potentiel hydrique (DY) dont limportance dpend de
lhumidit relative (HR) de latmosphre. Ainsi 17 C, pour une HR de 100 %, DY
est nul, mais ds quelle descend 90 % elle est dj de 150 bars et pour une valeur
de 50 %, elle atteint 1000 bars. De telles forces devraient provoquer une vaporation
quasi instantane de leau liquide prsente dans les chambres sous-stomatiques.
Heureusement, linterface eau-air, une couche limite rduit considrablement ce
gradient de potentiels hydriques. En simplifiant, cette couche limite peut tre reprsente comme une couche diffuse stable de quelques diximes de millimtre dpaisseur, compose dair et de vapeur deau retenus nergiquement par les forces de
cohsion intermolculaires. Les molcules deau ont dautant plus de mal traverser
cette couche limite que son paisseur est importante. Or, celle-ci dpend de plusieurs
facteurs et particulirement de la vitesse du vent. Quand elle est forte, la couche
limite est fine. La couche limite offre alors une rsistance faible au passage des
molcules deau et lvaporation est forte. Inversement, quand la vitesse du vent est
faible, lvaporation est faible. Cette vaporisation demande de lnergie. Les thermodynamiciens nous apprennent que la chaleur de vaporisation de leau est de 590 cal.g 1
soit 2,5 kJ.g1 qui provient essentiellement du rayonnement solaire direct arrivant au
niveau du vgtal. Par temps clair et avec le soleil au znith, le rayonnement solaire
est de 0,10 W.cm2, 10 % de cette nergie incidente est rflchie (albdo), et 30 %
sont transmis (fig. 7.8). Les 60 % restants sont absorbs par la feuille qui mettra un
rayonnement thermique de grande longueur donde reprsentant 15 20 % de lnergie
incidente. Comme lnergie utilise par la photosynthse est trs faible (au mieux
1 % de lnergie incidente), pratiquement tout le reste (prs de 40 %) va servir
vaporiser leau.
Rayonnement incident : 100
Rflexion : 10%
Rayonnement thermique 19%
Photosynthse 1 %
Transpiration 40 %
Transmission 30%

mission

Face
suprieure

Intrieur de la feuille

mission

Face
infrieure

Figure 7.8 Rpartition approximative de lnergie reue par une feuille.

Il est vident que ces chiffres sont trs variables selon les types de feuilles. Celles de
dolivier, cireuses et paisses, auront une rflexion plus grande et une transmission
plus faible. Inversement, une feuille de htre, plus fine, aura un albdo plus faible et
une transmission plus grande. Mais les chiffres prsents correspondent bien aux
ordres de grandeur des quantits deau vaporise (5 g.dm2.h1) dans les meilleures
170

9782100544141-Laberche.fm Page 171 Jeudi, 4. fvrier 2010 3:47 15

7.1 La nutrition hydrique

conditions. Mais plus que la quantit dnergie absorbe pour cette vaporisation, il
est ncessaire dinsister sur le rle physiologique de cette vaporisation : en liminant
une grande quantit de lnergie absorbe par la feuille, elle lui vite de schauffer,
donc de dpasser des tempratures incompatibles avec les ractions biologiques.

d) La tension foliaire
La vaporisation de leau au niveau des feuilles cre dans les vaisseaux du xylme un
gradient de potentiels hydriques qui se manifeste par une aspiration de leau. Pour
lexpliquer, on se sert de lexprience ralise par Dixon en 1895. Un entonnoir
(prolong par un long tube de faible diamtre) rempli deau est ferm par une plaque
de pltre poreuse. Le tube est reli une cuve contenant du mercure. Lvaporation
de leau au niveau de la plaque entrane une monte du mercure dans le tube, qui
correspond bien une succion. Celle-ci peut tre de plusieurs bars et suffit expliquer
lascension de leau dans les vaisseaux du xylme, qui se comportent comme de
vritables capillaires.
Ainsi, simultanment, on peut observer la fois la pousse radiculaire qui rejette
leau des racines vers les feuilles et une tension foliaire qui aspire leau des racines
par les feuilles.

e) De lvaporation la transpiration
Les physiciens appellent vaporation une vaporisation de leau qui ne dpend que de
facteurs physiques. Cest, par exemple, lvaporation dune surface deau libre, dun
sol nu ou plus prosaquement du schage du linge humide. Les physiologistes parlent
de transpiration car au niveau de la feuille lvaporation de leau est rgule par les
stomates. Mais le qualificatif de transpiration sapplique aussi la vaporisation de
leau au niveau de la cuticule. La plante pouvant modifier ses pertes deau de plusieurs
faons dont lorientation ou lenroulement des feuilles sur elles-mmes. Enfin, cette
transpiration reprsente pratiquement lensemble des besoins en eau du vgtal,
cependant peine 1 % de leau absorbe sert la photosynthse et au mtabolisme.

Dunod La photocopie non autorise est un dlit.

Lirrigation des cultures


Les techniques dirrigation appliques en agriculture sont un dveloppement
direct des connaissances en physiologie vgtale concernant la nutrition hydrique
des plantes. Matriser les besoins en eau des cultures ncessite de connatre les
rserves du sol et la consommation des cultures. Les sols retiennent de leau utilisable par les plantes. Pour entrer dans les racines, il faut que le potentiel hydrique
du poil absorbant soit infrieur celui de leau dans le sol. Mais si ce dernier est
trs lev, leffort que devra dvelopper la plante pour prlever cette eau sera
important. Ceci risque de nuire la croissance et au dveloppement du vgtal et,
par contrecoup, aux rendements des rcoltes. Pour viter que la plante ne consacre
trop dnergie pour prlever leau dont elle a besoin, les agronomes ont introduit
la notion de rserve en eau facilement utilisable (RFU). Ce sont les 2/3 de la
rserve totale. Cette RFU sexprime en mm deau, et correspond la quantit deau
que la plante peut prlever dans ce sol pour ses besoins tout en assurant un
rendement optimal. Cette RFU reprsente plusieurs centaines de m3 par hectare.
171

9782100544141-Laberche.fm Page 172 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Dans une culture les plantes rejettent de leau par transpiration, mais aussi le sol par
vaporation. Ces deux phnomnes ne peuvent tre dissocis dans un champ, ce
qui fait que depuis Thornthwaite en 1947, on parle dvapotranspiration. Pour la
connatre, on a longtemps utilis des cases lysimtriques, plus ou moins sophistiques, o lon pouvait suivre les consommations en eau des cultures. Actuellement
on prfre des formules utilisant des donnes mtorologiques et permettant de
calculer une vapotranspiration de rfrence : lvapotranspiration potentielle (ETP).
Il est possible de passer de cette rfrence aux besoins en eau dune culture (ETM,
vapotranspiration maximale) par une srie de coefcients culturaux k, tablis
depuis une vingtaine dannes par plusieurs organismes professionnels. Ainsi pour
la laitue il varie entre 0,7 et 0,9 et pour la tomate entre 0,6 et 1 selon le stade de
dveloppement. Disposant la fois de la RFU et de lETM, les agriculteurs tablissent
un plan dirrigation. Celui-ci a pour but de dclencher les irrigations quand la RFU
est puise, et dapporter une dose deau qui permette de revenir la capacit au
champ. Ainsi, elle nest pas perdue par drainage et la plante toujours de leau
disponible sa disposition. Plusieurs types de plans sont possibles, le choix rpond
gnralement des contingences lies directement aux structures dirrigation de
lexploitation agricole.

Il apparat ainsi combien la plante besoin deau pour vivre, lanimal aussi,
puisquil craint plus la dshydratation que la dnutrition. Si les exigences sont les
mmes, les moyens mis en uvre pour les deux rgnes sont totalement diffrents.
Chez le vgtal, le circuit hydrique est ouvert, et limmense majorit de leau ne fait
que transiter, linverse de lanimal o il est ferm. Immobile, le vgtal est capable
de rsister la scheresse grce de nombreuses adaptations morphologiques. De
mme, il rgule ses sorties deau par lintermdiaire des stomates.
50 % de leau utilise par lagriculture est gaspille
La Semaine mondiale de leau de Stockholm est lune des principales instances
mondiales runir chaque anne des spcialistes du monde des affaires, des
gouvernements, des secteurs scientiques et de la gestion des ressources en eau
comme les organisations intergouvernementales et des ONG.
La 18e dition qui sest tenue en 2008 a rappel les multiples enjeux lis leau et
le gaspillage norme qui en est fait, parfois mme sans sen rendre compte. Ainsi,
il a t montr que la moiti de leau utilise pour lagriculture est gaspille alors
quau niveau mondial, prs de 2 personnes sur 10 sont prives deau potable.
Certes, ce gaspillage peut tre d des pratiques agricoles non-adaptes, mais ce
nest pas la cause majeure. La principale cause tient au gchis norme de nourriture qui intervient lors des phases de transport, de stockage et de consommation.
titre dexemple, aux tats-Unis, les 30 % de nourriture gaspills chaque anne
correspondent 40 000 milliards de litres deau, soit de quoi couvrir les besoins
de 500 millions de personnes ! En plus de ce gaspillage direct, lvolution des
rgimes alimentaires est galement en train de peser lourdement sur les ressources
en eau plantaire. Ladoption du modle alimentaire qui fait la part belle aux produits
dorigine animale comme le lait ou la viande, inquite les experts de la FAO (Food
and Agriculture Organisation) en rappelant que la production dun kilo de viande
de buf ncessite 15 500 litres deau contre seulement 1500 litres pour un kg de
bl !
172

9782100544141-Laberche.fm Page 173 Jeudi, 4. fvrier 2010 3:47 15

7.2 La nutrition minrale des plantes

7.2 LA

NUTRITION MINRALE DES PLANTES

Le concept de nutrition minrale des plantes fut relativement long simposer. Jusqu
la fin du XVIIe sicle, le dogme voulait que la plante puise dans le sol des aliments tout
labors. Cette thorie, qui venait dAristote, commence tre conteste par Malpighi
en 1679. Il entrevoit le rle des feuilles dans la production des composs qui
ultrieurement migrent vers les racines. Elle est, ensuite, rejete par Hales en 1727,
qui dcrit les mouvements de leau dans la plante et surtout par Liebig en 1840 qui
tablit le caractre minral de lalimentation des plantes au niveau des racines. Les
travaux effectus au XIXe sicle, en autres biologistes, par Raulin, Boussingault, Sachs
et Knop prcisent limportance des diffrents lments, particulirement des oligolments. Lutilisation des engrais minraux en agriculture, mais surtout la ralisation
des cultures in vitro sur milieu minral par Gautheret en 1939, confirment, si besoin
est, la vracit de cette absorption minrale. Le principe de Lavoisier Rien ne se
cre. Rien ne se perd. Tout se transforme peut servir pour apprhender les besoins
des plantes en lments minraux. En effet, tout ce qui se trouve dans la plante un
moment donn a t absorb. Cette manire daborder le problme qui correspond
une mthode analytique est intressante, mais elle ne prcise pas les besoins ponctuels
des plantes, ni surtout sous quelle forme ces lments doivent tre absorbs. Il sera
donc ncessaire dutiliser dautres mthodes dtudes.

7.2.1 La composition minrale des plantes


Ce sont des mthodes trs anciennes, qui prsentent linconvnient majeur de dtruire
le vgtal. Aprs calcination, ou oxydation par diffrents mlanges (acide sulfurique,
mlange sulfo-nitrique, ou nitro-perchlorique) les diffrents lments minraux sont
doss par colorimtrie, par complexomtrie ou par spectromtrie.
Les mthodes de diagnostic foliaire

Dunod La photocopie non autorise est un dlit.

Elles sont effectues sur des fragments de vgtal et permettent de ne pas le dtruire
dans son entier. Ceci est trs utilis pour les plantes prennes. Il est intressant de
constater que ces mthodes analytiques trouvent actuellement des applications
trs concrtes dans ltude des jus de chaumes de bl qui permet de dterminer
les besoins en lments minraux azots des cultures.

Ces mthodes analytiques aboutissent des sries de donnes (tabl. 7.4), comme
celle tablie par Latshaw et Miller en 1924, correspondant lanalyse dune plante
entire de bl.
Trois points importants sont retenir de ce tableau.
1. Carbone, oxygne et hydrogne reprsentent eux seuls plus de 90 % du poids
sec.
2. Lazote, le phosphore, le soufre, le potassium, le calcium, le magnsium mais aussi
le chlore, la silice et le soufre, sont des pourcentages oscillants entre quelques %
et quelques diximes de %. Ce sont des macrolments.
3. Les autres sont en trs faibles proportions. Ce sont des micro- ou oligo-lments.
173

9782100544141-Laberche.fm Page 174 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Tableau 7.4 Composition minrale dun plant de bl


(exprim en % de la matire sche). (Daprs Miller, 1924, modifi.)
Oxygne

44,4

Magnsium

0,17

Carbone

43,6

Fer

0,07

Hydrogne

6,24

Silice

1,17

Azote

1,46

Aluminium

0,11

Phosphore

0,20

Chlore

0,14

Soufre

0,17

Manganse

0,04

Potassium

0,92

Divers

0,93

Calcium

0,23

Dautres analyses ont t ralises et il est rapidement apparu que dimportantes


diffrences apparaissent entre les plantes, mais aussi lintrieur mme dune plante
selon lorgane (tige, feuille, graine) ou selon lge. Quelques exemples illustreront
cette diversit. Chez le bl, on remarque une proportion de silice, inhabituelle chez
limmense majorit des plantes. En effet, les Poaceae, laccumulent, ce qui donne
aux feuilles, la fois cet aspect et cette consistance dure et coupante bien connue.
Les variations sont importantes aussi entre les espces, les Brassicaceae (choux, colza,
moutarde) accumulent le soufre dans leurs tissus, comme aussi les Fabaceae (luzerne,
trfle).
Les plantes calcifuges comme les rhododendrons (Rhododendron sp. L. Ericaceae)
ou les bruyres, sont, en ralit, capables daccumuler tant de calcium quil en devient
toxique. Sur des sols acides pauvres en calcium, elles se protgent donc de cette
intoxication. Il est bien connu aussi, que la composition des plantes varie avec lge
comme le montre la fig. 7.9.

kg par hectare

150

100

50
Azote
Potassium

0
N

M
Mois

Phosphore
A

Jt

Figure 7.9 Masses totales cumules dlments minraux (azote,


phosphore et potassium) immobiliss mois par mois, dans un champ de bl.
(Donnes de Vincent, 1923, simplifies.)
174

9782100544141-Laberche.fm Page 175 Jeudi, 4. fvrier 2010 3:47 15

7.2 La nutrition minrale des plantes

Ces donnes sont intressantes par le fait quelles tablissent que les jeunes plantes
contiennent de grandes quantits dlments minraux. Mais ces quantits varient
selon lge des plantes. Cest lors de la priode vgtative que la prsence dazote est
importante. Ds le dbut de montaison, puis durant toute la floraison et lpiaison, le
potassium domine. Il arrive aussi quen fin de culture, il y ait une sortie dlments
dans le milieu. Cest une exsorption. Ces tudes analytiques sont intressantes, car
elles prcisent la composition minrale des plantes. Mais elles ne donnent aucune
information sur la nature de llment absorb, ni sur le lieu de pntration dans la
plante ou sur les rles de chacun dans le dveloppement du vgtal
Des applications agronomiques
Ces diffrences de besoins entre les plantes sont bien connues des agriculteurs. Le
colza consomme beaucoup de soufre, donc ils choisissent comme engrais minraux
prfrentiellement les sulfates. Pour la betterave sucrire qui rclame la fois du
potassium et des chlorures, ils choisissent le chlorure de potassium. Cette accumulation de potassium nest cependant gure prise des professionnels du sucre. En
effet, cet lment perturbe les procds de rafnage et de cristallisation.

Dunod La photocopie non autorise est un dlit.

7.2.2 Les ions absorbs


Dautres mthodes dtudes permettent dapporter des rponses aux questions poses
lors des tudes analytiques. Il sagit des mthodes synthtiques qui consistent faire
pousser les vgtaux sur des milieux composs de sels en solution. Les plus anciennes
mthodes synthtiques datent de Raulin. En 1869, il fit pousser le champignon
Sterigmatocystis nigra sur un milieu contenant : acide tartrique, 4 g ; nitrate
dammonium, 4 g ; phosphate dammonium, 0,60 g ; carbonate de potassium, 0,60 g ;
carbonate de magnsium, 0,60 g ; sulfate dammonium, 0,25 g ; sulfate de fer, 0,07 g ;
sulfate de zinc, 0,07 g ; silicate de potassium, 0,07 g ; saccharose, 70 g ; eau distille,
1500 mL.
Partant des donnes de ltude analytique, on construit des solutions runissant
diffrents lments. La variation dans la composition permet de suivre linfluence
dun composant.
Ces mthodes ont permis dtablir que le vgtal utilise pour se nourrir des ions de
deux types :
1. Des cations. Il sagit essentiellement de NH +4 ,Ca++, Mg++, K+, Na+, Fe++.

2. Des anions comme NO 3 , H 2 PO 4 , HPO


4 , Cl , SO 4 .
Elles ont confirm aussi, que certains lments doivent tre fournis des doses qui
oscillent entre 100 et 1000 mg par litre ; ce sont les macrolments. Dautres agissent
des doses beaucoup plus faibles, entre 107 et 106 g par millilitre. Ce sont les microou oligo-lments. Le tableau 7.5 regroupe les rles des diffrents lments absorbs
par les plantes.

175

9782100544141-Laberche.fm Page 176 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Tableau 7.5 Les macro- et microlements indispensables aux plantes.


lment

Formes utilises

Rles
MACROLMENTS

Potassium

Azote
Phosphore

NO3 , NH 4+
H2PO4 , HPO 4

quilibre des charges cellulaires


participe aux pompes protons
activateur denzymes
intervient dans la synthse des diholosides

NO3 directement rduit en NH4+


NH4+ composant des acides amins
phospholipides, acides nucliques
activateurs denzymes
drivs phosphoryls riches en nergie

Calcium

Ca++

Sodium

Na+

indispensable pour la photosynthse des plantes en C4

Magnsium
Chlore
Soufre

Mg++
Cl

SO4, SH

neutralisation dans la lamelle moyenne


ouverture des canaux ioniques
activateur denzymes
second messager des rgulateurs de croissance

composant de la chlorophylle
favorise lentre des cations
composant des acides amins
OLIGO-LMENTS

Fer

Fe++

synthse de la chlorophylle

Cuivre

Cu++

catalyse les oxydorductions

Molybdne
Zinc
Bore

MoO4++
++

Zn

H2BO3

rduction des nitrates


cofacteur enzymatique
action au niveau du plasmalemme

Pourtant des lments, sans tre absolument indispensables, stimulent nanmoins


la croissance ou favorisent le dveloppement. Ils sont utiles comme le sodium qui
est bnfique pour la betterave sucre. Inversement certains lments sont toxiques
car ils inhibent la croissance. Cest le cas du mercure ainsi que pratiquement de tous
les mtaux lourds. Il est intressant de noter que la plante prsente des exigences
plus ou moins strictes quant aux formes quelle peut assimiler.
Les exigences peuvent tre strictes. Ainsi pour le phosphore, seuls les ions phosphoriques sont assimils. Les ions phosphoreux sont inutilisables. Certaines molcules
organiques comme les inositolphosphates ou les glycrophosphates peuvent tre
des sources de phosphore, grce laction de phosphatases scrtes par les racines.
De mme, cest le fer ferreux qui est plutt absorb que le fer ferrique.
Les exigences peuvent tre limites. Lazote peut se prsenter sous forme dions
nitrates, nitreux, ammoniacaux et mme certains acides amins. Mais les nitrates
restent la forme prfre des plantes, mme si lassimilation est meilleure quand
le milieu comporte quelques ions ammoniacaux (10-12 %).
176

9782100544141-Laberche.fm Page 177 Jeudi, 4. fvrier 2010 3:47 15

7.2 La nutrition minrale des plantes

Ces nitrates sont trs rapidement rduits. Cette rduction dbute gnralement
dans la racine et peut se continuer dans les feuilles la lumire (bl, tomate). Cette
rduction seffectue en deux tapes qui se succdent trs rapidement. Les nitrates
sont rduits en nitrites (gnralement dans le cytosol), puis les nitrites en ammoniac
(dans les plastes) selon les ractions globales :
NO 3 + 2 H+ + 2 e NO 2 + H2O puis NO 2 + 6 H+ + 6 e NH3 + H2O + OH
La premire rduction seffectue grce la nitrate-rductase qui est une flavoprotine FAD ayant pour cofacteur le molybdne et la seconde par la nitrite rductase,
qui est un complexe enzymatique de petite taille compos dune protine fer-soufre
et dun groupement ferroporphyrique (le sirohme).
Cette rduction des nitrates est lapanage des vgtaux et est une fonction aussi
essentielle que la photosynthse. Elle bnficie indirectement tous les animaux qui ne
peuvent rduire compltement les nitrates. Dans certains cas, la rduction partielle
en nitrite est mme toxique.
Les exigences peuvent tre trs faibles. Pour le soufre, la plante accepte quil lui
soit fourni sous de multiples formes : sulfates, sulfures mais aussi sous la forme
thiol (SH).
Labsorption des lments minraux se fait prfrentiellement dans des solutions
lgrement acides. Si limmense majorit des sels sont dissocis ces pH, il nen est
pas de mme pour lhydroxyde de fer (la rouille) qui est insoluble au-dessus du
pH 4,5-5. Le fer est absorb sous forme de chlats. Ce sont des complexes caractriss par la prsence dun ou plusieurs cycles, insrant latome dans une sorte de
pince . Lexemple le plus connu dagent chlatant artificiel est lacide thylnediamine-ttra-actique (EDTA) qui avec le fer ferrique, forme une molcule complexe
(fig. 7.10).

OOC

CH2
CH2

Dunod La photocopie non autorise est un dlit.

CH2

CH2

N
Fe+

COO

CH2

Liaisons ioniques

CH2
C

Liaisons de covalence
Liaisons de chlations

Figure 7.10 Le chlat de fer EDTA/Fe+++.

Mme si le pH de la solution est proche de la neutralit le fer ferrique reste


enferm dans la molcule dEDTA et ne prcipite pas. En conditions naturelles, le
sol ne contient pas normalement dEDTA (qui dailleurs est un poison pour lhomme
utilis cependant dans les lessives). Mais les plantes exsudent au niveau de leurs
racines des acides organiques appeles phytomtallophores (ils sont issus chez les
Poaceae du cycle de la mthionine) qui ont des proprits chlatantes. Le fer peut
alors pntrer dans la plante sous forme de chlats. Ensuite il est mis la disposition
du mtabolisme par destruction de lagent chlatant, qui libre le fer ferrique. Celui-ci
est alors rduit en fer ferreux au niveau du plasmalemme.
177

9782100544141-Laberche.fm Page 178 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Les chloroses ferriques en agriculture


Pour de nombreuses plantes, lalimentation en fer est difcile. Chez les Rosaceae,
comme le pommier, les agents chlatants naturels ne sont pas assez puissants
dans les sols riches en calcium pour assurer la plante sa nourriture en fer. Ceci
provoque des carences qui entranent la disparition de la chlorophylle. Le limbe
prend alors une coloration jaune ple et seules les nervures restent vertes. Les
arbres dprissent. Ceci permet de comprendre pourquoi on nobserve pas de
pommiers sur des terrains calcaires. Dans dautres cas, quand les chloroses, apparaissent sur des arbres dj adultes du fait de modications anthropiques brusques
comme la salinisation accidentelle des sols par arrosage ou par des remontes deaux
de mer (cas des orangeraies dAfrique du Nord) les agriculteurs sen prservent par
des apports de chlats de fer au sol.

7.2.3 Labsorption des lments minraux


Feuilles et racines sont capables dabsorber les lments minraux. Les applications
foliaires de sulfate de magnsium sont effectues sur les tomates par les marachers
quand ils constatent des feuilles jaunes, caractristiques des carences magnsiennes.
Mais cest essentiellement au niveau des racines que pntrent les lments minraux
dans les plantes. Cette absorption est indpendante du flux hydrique qui sert la
transpiration. De nombreuses expriences rcurrentes le montrent. Ainsi, deux pieds
de melons, aux stades phnologiques identiques, placs lun dans la pnombre (faible
transpiration), lautre en pleine lumire (forte transpiration) absorbent les mmes
quantits dions minraux. Les tudes ont commenc, voici plusieurs dizaines dannes
et plusieurs mthodes ont t tour tour pratiques. La plus ancienne utilisait des
fragments de tubercule (pomme de terre) ou de racine (carotte) placs dans des
diffrentes solutions. Aprs des laps de temps plus ou moins longs, les concentrations
des extraits cellulaires taient doss. Cette mthode prsente linconvnient majeur de
ne pas diffrencier les lments stocks des produits mtaboliss. La seconde mthode,
dveloppe ds 1911 par Osterhout, utilisait des cellules gantes de Valonia ventriculosa (algue siphone possdant une vacuole de 5 ml) ou de Nitella algue marine
de la famille des Characeae dont les cellules internodales de grandes dimensions. Il
est alors possible de suivre les flux dlments entre le milieu extrieur et la vacuole.
Plus rcemment lemploi de traceurs nuclaires, des microlectrodes spcifiques des
indicateurs spcifiques fluorescents, ou des diffrences de potentiel intermembranaires
ont permis dtendre considrablement les matriels tudis et daugmenter les
informations sur la pntration des ions minraux dans les plantes.
De toutes les tudes, il apparat deux points importants.
1. Les plantes slectionnent les ions quelles absorbent. Ainsi, le sodium pntre trs
mal, alors que le potassium entre trs facilement et saccumule dans les vacuoles.
Les vitesses de franchissement des membranes se fait selon lordre suivant :
pour les anions, dabord NO 3 puis Cl, H 2 PO 4 et SO
4 ,
+
+
++
++
+
pour les cations, NH 4 , K , Mg , Ca enfin Na .
2. Les plantes accumulent les ions. Les concentrations internes peuvent mme tre
plus leves que dans le milieu extrieur. Cest souvent le cas du potassium.
178

9782100544141-Laberche.fm Page 179 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

7.2 La nutrition minrale des plantes

On a longtemps considr les poils absorbants comme le site principal de labsorption


racinaire. Pourtant lutilisation disotopes prouve que toutes les zones de la racine
sont capables dabsorber les lments minraux.
Avant de gagner la sve brute, les ions doivent franchir au moins deux membranes
plasmiques. La premire fois, ils passent de lapoplasme (extrieur des cellules) au
symplasme (intrieur des cellules). La seconde correspond leur entre dans les
vaisseaux du xylme. Le premier passage est actuellement le mieux connu des physiologistes. Pour pntrer lintrieur des cellules, les ions utilisent essentiellement les
systmes de transports actifs primaires et secondaires (cf. 4.2.1). Toutes les expriences
montrent que les ions, une fois absorbs, sont transports dans la racine vers les
vaisseaux du xylme par voie symplasmique, en circulant de cellules cellules par les
plasmodesmes. Comme pour leau, les physiologistes ont longtemps cru que labsorption des ions se faisait sur la surface extrieure du rhizoderme. Cette affirmation tait
trop rapide. En effet, les tudes anatomiques suggrent que le parenchyme cortical
sous le rhizoderme, joue un rle trs important dans la pntration des ions dans
les cellules racinaires. En effet, la densit des plasmodesmes est beaucoup plus
faible entre la couche du rhizoderme et les cellules du parenchyme cortical quau del
vers lintrieur prs de lendoderme. Il semble donc y avoir comme une barrire
entre ces deux tissus. Lutilisation de traceurs fluorescents a confirm quil existe bien
en ralit deux domaines dabsorption des lments minraux majeurs (K +, NO 3 ,
NH +4 ) : le rhizoderme et le parenchyme cortical.
Les ions calcium ne sont pas absorbs partout dans la racine, mais uniquement dans
une petite zone, proche de lapex terminal, l o lendoderme nest pas encore
compltement diffrenci. Il est surprenant de constater que si les plantes semblent
contenir beaucoup de calcium (# 0,2 %), la concentration cellulaire de ce cation est
faible et sa mobilit rduite. Le calcium, linverse des autres lments majeurs,
est essentiellement accumul et transport dans lapoplasme.
La cintique dabsorption des ions dpend, gnralement, de leur concentration
dans la solution externe. Gnralement, quand elle est faible, labsorption est forte
mais ne dure pas longtemps, inversement si le milieu externe est riche, labsorption
est plus lente mais dure plus longtemps et atteint des quantits plus leves. Les
physiologistes expliquent cette cintique biphasique en distinguant des systmes de
transport forte et faible affinit (cf. 4.2.1, proprits des membranes cellulaires).
Mais la quantit totale dions absorbs dpend des besoins de lorganisme pour
assurer sa croissance. Ainsi pour la plupart des ions, les variations de labsorption
racinaire suivent les variations de la croissance ou du mtabolisme, sauf chez les
plantes carences o labsorption est stimule.
Il existe des mcanismes de rgulation internes qui intgrent les besoins de
lorganisme entier et ajustent labsorption racinaire des ions. Ce sont des messagers
issus des feuilles et circulant dans la sve labore qui activent ou rpriment
labsorption racinaire. Mme si la connaissance de ces messagers nen est qu son
dbut, on sait depuis quelques annes que la prsence dacides amins libres dans
la sve labore limite labsorption des nitrates et que les glucides, au contraire,
179

9782100544141-Laberche.fm Page 180 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

favorisent labsorption des ions. Plus rcemment, Touraine et son quipe (1999) ont
montr que le glutathion dans les feuilles gnre un signal transport par la sve
labore qui agit sur les gnes racinaires dabsorption des sulfates.
Tchernobyl et la physiologie vgtale
La catastrophe de Tchernobyl dans lex URSS (actuellement en Ukraine) fut loccasion
pour lquipe des physiologistes de luniversit internationale denvironnement de
Minsk en Blarus dtudier la pntration dans les racines des lments radioactifs,
le csium 137 (137Cs) et le strontium 90 (90Sr). Chez de lorge, du bl, du ray-grass
et du colza, ils ont ainsi montr que les cintiques et les mcanismes de pntration
du 137Cs sapparentent celles du potassium et que le 90Sr entre dans les racines
des plantes par une voie non spcique1.

7.2.4 Lutilisation de ces connaissances


Les connaissances thoriques sur la nutrition minrale des plantes ont eu de grandes
applications. Dabord chez les agriculteurs qui maintenant matrisent les apports
dengrais sur leurs plantes vitant de ce fait les surdosages, nfastes pour lenvironnement et conomiquement dsastreux. Les retombes sont aussi trs importantes
chez les professionnels de la culture in vitro qui laborent des milieux de culture
contenant les ions ncessaires aux vgtaux quils cultivent.

a) Les retombes agronomiques


Il est habituel de dire que les plantes prlvent les lments minraux dans le sol.
Cette affirmation est cependant inexacte. En ralit, cest leau du sol qui fournit aux
plantes les lments dont elles ont besoin. Pour comprendre dun point de vue pratique
la nutrition minrale des plantes avec des engrais, il faut considrer lensemble des
constituants du sol. Le dernier est constitu dlments minraux (sables, argiles,
limons) et dlments organiques constitutifs de lhumus. Argile et humus sont deux
collodes lectrongatifs qui en prsence de calcium vont donner le complexe argilohumique (CAH). Cest un collode lectrongatif qui fixe les cations K +, Ca++, Na+,
Mg++. Il existe entre le CAH et leau du sol, un quilibre entre les concentrations des
ions fixs sur le CAH et des ions dans leau du sol. Il se dplace dans un sens ou dans
un autre, selon la concentration des compartiments. Le CAH a aussi la proprit de
fixer lanion phosphate H 2 PO 4 grce au calcium qui sert de pont entre les 2 charges .
Cette proprit est utilise par les agriculteurs lorsquils pratiquent les fumures de
fond en automne. Les phosphates et le potassium se fixent dans le sol. Ils seront
progressivement restitus leau du sol en fonction des besoins des plantes. Il nen
est pas de mme pour lanion nitrate qui ne peut tre fix dans les sols. Il est lessiv.
Do la ncessit de lapporter de manire trs fractionne afin dviter les lessivages.
1. Nadezhda GONCHAROVA, The transport of
Cyt. Biol. vg., 2001, 23, 1/2, 15-20.
180

137Cs

et

90Sr

across root cell membranes . Rev.

9782100544141-Laberche.fm Page 181 Jeudi, 4. fvrier 2010 3:47 15

7.2 La nutrition minrale des plantes

Physiologie vgtale et environnement


Dans les nouvelles techniques de matrise de la fertilisation azote des crales,
se dveloppent les techniques de dtermination des quantits de nitrates apporter.
Elles sont calcules partir des extraits de jus de bas de chaume . La mthode
Jubil , qui cumule la technique des bilans azots en fonction du type de culture
et le calcul des rsidus dans les sols au printemps, permet ainsi de notablement
diminuer les apports de nitrates en cours de culture, do des risques de pollution
trs amoindris, tout en conservant des rendements conomiquement satisfaisants.
Dans les terres lourdes, se rchauffant mal, il est possible dapporter au printemps
des composs azots sous forme ammoniacale. La transformation en nitrate est
ralentie par les conditions thermiques dfavorables la nitrication.

b) Les milieux de cultures in vitro


De nombreux milieux de culture ont t mis au point pour leur utilisation en culture
in vitro. Les fragments dorganes, voire les cellules se dveloppant dans de telles
conditions ne sont pas immdiatement autotrophes. Il est vident que les exigences
entre les diffrentes espces varient grandement. Ceci explique trs certainement le
grand nombre de milieux de cultures mis au point par les chercheurs. On en trouve
pour les cultures de tissus, pour les apex de bourgeons, pour landrogense, pour
lembryogense, etc. Le plus utilis est le milieu de Murashige et Skoog datant de
1962 (tabl. 7.6). Il a t mis au point par ses auteurs pour la recherche de la croissance
optimale de cals de moelle de tabac. Il est caractris principalement par une forte
teneur en azote (60 meq/L) dont 1/3 apport sous forme dammonium, et par une
Tableau 7.6 Composition de milieu de Murshige et Skoog (1962) en mg par litre.

Dunod La photocopie non autorise est un dlit.

Macrolments
(NH4)2SO4

1 650

CaCl2, 2 H2O

440

MgSO4, 7 H2O

370

KNO3

1 900

KH2PO4

170
Oligo-lments

CoCl2, 6 H2O

0,025

CuSO4, 5 H2O

0,025

MnSO4, 4 H2O

22,3

KI

0,73

Na2MnO4, 2 H2O

0,25

ZnSO4, 7 H2O

7,6

H3BO3

6,2

Na2-EDTA

37,3

FeSO4,7 H2O

27,7

181

9782100544141-Laberche.fm Page 182 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

concentration galement leve en potassium. Dans certains cas, sa teneur en ions


dpasse loptimum. Ceci a amen divers auteurs employer la solution dilue de
moiti. Quant aux oligo-lments, les doses ncessaires sont tellement faibles quune
certaine souplesse existe entre les diffrentes formes.
Les cultures hydroponiques
mi-chemin entre lagriculture classique et les cultures in vitro se dveloppent les
cultures hydroponiques. Les plantes poussent directement dans des solutions nutritives minrales. Leur composition doit beaucoup aux travaux de Coc et Lossaint
lINRA (1971) et leur dveloppement lancien Service dexprimentation et
dinformation de lINRA. Actuellement, cest une technique trs utilise sur tomate
sous abri, particulirement en Hollande

7.3 LE

CYCLE VITAL DU CARBONE ET DE LNERGIE

Les deux principaux rservoirs de carbone les plus directement engags dans ce
cycle du carbone (cf. 8.4.3) sont le CO2 atmosphrique et le carbone dans les molcules
organiques des tres vivants. Au cours de la photosynthse, le CO2 et leau se combinent (raction de rduction) sous leffet de lnergie lumineuse (issue gnralement
du soleil) pour former des glucides. Puis, chez tous les organismes et en particulier
chez les plantes, ces glucides sont oxyds pour reformer de leau et du CO 2 au cours
de la respiration et une partie de lnergie contenue dans les glucides est transforme
en adnosine5- triphosphate (ATP) qui est la forme dnergie libre utilisable par la
cellule pour effectuer les ractions mtaboliques chimiques, mcaniques, de transport).
Ce passage de lnergie lumineuse lnergie chimique peut tre schmatis de la
manire suivante :
nergie lumineuse

glucides + oxygne

ADP + Pi

PHOTOSYNTHSE

RESPIRATION

gaz carbonique + eau

ATP

nergie chimique

7.3.1 La photosynthse
La dcouverte de la photosynthse
Cest langlais Joseph Priestly en 1771 qui, constatant quune souris enferme sous
une cloche hermtiquement close, ne mourrait pas quand elle tait en prsence dune
plante verte suggra que la plante devait avoir un rle dans la survie de ce murid.
Malgr la qualit de ses expriences, il na pas vu le rle de la lumire dans ce
182

9782100544141-Laberche.fm Page 183 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

phnomne. Ce nest quen 1777, que le hollandais Jan Ingenhousz dcouvrit que
loxygne tait fabriqu uniquement par des plantes vertes places la lumire. Ceci
fut confirm et complt par le prtre franais Jean Senebier qui, en 1796, montra
que simultanment du gaz carbonique (dioxyde de carbone) tait fix et de loxygne
libr. Les connaissances sur la photosynthse se prcisrent grce Mayer qui vit
en 1845, la lumire comme source dnergie et Sachs en 1864 qui considra lamidon
quil observait dans les feuilles comme le rsultat final de la photosynthse.
La raction gnrale de la photosynthse pouvait donc dj scrire :
CO2 + H2O + nergie lumineuse CH2O + O2
Mais cest en 1905 que langlais Blackman montra quil fallait distinguer une phase
obscure lie la temprature et une phase claire, photochimique indpendante de la
temprature. Hill en 1937 montra que cette dernire correspond la photolyse de
leau, tandis que Calvin partir des annes 1940 prcisa le mtabolisme du carbone
dans la phase obscure. Toutes ces dernires annes, les connaissances sur les mcanismes de la photosynthse vont en augmentant, mme si les mcanismes quelle
rvle sont particulirement complexes. Signe des temps, la terminologie change, les
ractions photochimiques, appeles de manire trs didactiques ractions claires
sont devenues les ractions de la phase 1, et les ractions sombres celles de la
phase 2 de la photosynthse.
Reprenant cette terminologie, aprs avoir montr les lieux de la photosynthse,
nous en verrons les diffrentes phases.

Dunod La photocopie non autorise est un dlit.

Les lieux de la photosynthse

Cest dans les chloroplastes que se fait la photosynthse. Comme ceci a t montr
dans le chapitre 4, le chloroplaste est limit par une double membrane. Lexterne est
continue, tandis que linterne prsente parfois des invaginations dans le stroma. En
coupe longitudinale on observe une organisation avec des granums comprenant chacun
des disques granaires, les saccules ou thylacodes. Ces granums, qui peuvent tre
constitus de 2 100 disques, sont relis les uns aux autres par des lamelles stromatiques dont lensemble forme un rseau continu. Le chloroplaste a trois compartiments :
lintrieur des thylacodes, lespace intermembranaire et lintrieur du chloroplaste,
le stroma. Ces compartiments spars par des membranes isolent les diffrents phases
de la photosynthse. Les ractions de la phase I (ractions claires) se font dans les
membranes des thylacodes qui contiennent la chlorophylle et les ractions de la
phase 2 (ractions sombres) dans le stroma.
La formule de la chlorophylle est bien connue (fig. 7.11). Elle est constitue par :
quatre noyaux pyrroles en cercle,
un atome de magnsium au centre,
quelques substitutions en priphrie dont un alcool longue chane, le phytol.
Il existe plusieurs chlorophylles. La a est prsente chez tous les vgtaux. La b
ne diffre que dun CH3 remplac par CHO. Elle ne se trouve que chez les vgtaux
suprieurs et les algues vertes. Quant aux algues brunes et rouges, la chlorophylle
est remplace par des pigments voisins (chlorophylles c et d).
183

9782100544141-Laberche.fm Page 184 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Figure 7.11 Structure de la chlorophylle a.


2 H+

Qa
Membrane
plasmique

Qb

e
Pho

D2
e

Q2 non rduite

P680
e
Z

Q2 rduite

D1
Mn
Cl
e

Mn

Photon
O2

Cl
2 H2O

4 H+

Figure 7.12 Schma du photosystme II. (Daprs Coleman, modifi.)


Deux grands polypeptides D1 et D2, traversent la membrane plasmique. Sont xs
dessus la chlorophylle, la phophytine (Pho) et les transporteurs dlectrons,
quinones (Qa et Qb) qui interviennent dans les ractions. Quand un photon est absorb
par deux molcules de chlorophylle (P 680), il se produit un transfert dlectrons
qui se propage dans le photosystme. Plusieurs ions comme le manganse, le chlore,
le fer, les bicarbonates stabilisent la structure des protines ou participent aussi
aux ractions.

184

9782100544141-Laberche.fm Page 185 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

Les molcules de chlorophylle ne sont pas libres dans le chloroplaste. Elles sont lies
des complexes membranaires protiques des thylacodes. La figure 7.12 reprsente
un des deux complexes particulirement important lors de la photosynthse.
La phase 1 de la photosynthse

la suite des travaux de Hill en 1937, dEmerson en 1941 et 1956, on sait que deux
systmes membranaires, propres aux chloroplastes, interviennent dans cette phase 1.
Ce sont les photosystmes 1 (PS I) et photosystmes 2 (PS II). Ils sintgrent dans le
schma en Z, bien connu (fig. 7.13).
PS I
excit

PS II
excit

Transfert e non cyclique


Phophytine
Plastoquinone Qa
Quinone Qb
Photophosphorylation
cyclique

Lumire
P680

Dunod La photocopie non autorise est un dlit.

Tyrosine 2

PS I
Lumire

H2O 2H+ + 1/2 O2 + 2e

Figure 7.13 Les transports dlectrons dans la membrane du thylacode


lors des ractions de la phase I.

Dans le PS I, la chlorophylle est excite par de la lumire dont la longueur donde


est de 700 nanomtres (correspond du rouge clair). En revenant son tat stable, la
chlorophylle met deux lectrons qui peuvent tre transfrs de nouveaux accepteurs
dlectrons de deux manires diffrentes : soit ils restent dans le systme et participent
la phosphorylation de lADP en ATP, selon la raction : ADP + Pi + e ATP. On
185

9782100544141-Laberche.fm Page 186 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

parle alors de photophosphorylation cyclique, soit ils sortent du systme lors de la


production de NADP+ + H+ + e NADPH.
Dans les deux cas, il y a accumulation dnergie.
Le PS II est constitu de cinq composants (fig. 7.12) :
Un pigment chlorophyllien, donneur primaire dlectrons quand il est excit.
Absorbant la lumire une longueur donde de 680 nanomtres (rouge), il est
souvent dsign par P680. Il transforme lnergie lumineuse du photon en nergie
potentielle, avec lmission dun lectron, conduisant en mme temps une
sparation des charges lectriques.
Une molcule X, qui met une lectron e tant en dficit de charges devient X+ et
inversement la molcule Y qui reoit llectron e tant excdentaire en charges
devient Y.
Une tyrosine du polypeptide D1 (appele tyrosine Z) ; elle agit comme donneur
secondaire dlectrons, rendant la chlorophylle un lectron. Elle est donc en
amont de la chlorophylle dans toute la srie de ractions qui interviennent dans le
PS II. Jusquen 1988, o cette tyrosine a t identifie, on lappelait, faute de
mieux, le compos Z.
La phophytine, Pheo, qui est un pigment accepteur des lectrons venant de la
chlorophylle excite.
La plastoquinone Qa qui accepte les lectrons issus de la phophytine
La quinone Qb qui reoit son tour les lectrons de Qa.
Lors de la photosynthse, la chlorophylle du P680 capte un photon. Elle transforme
lnergie du photon, en nergie potentielle en mettant un lectron, immdiatement
capt (moins de 1012 seconde !) par la molcule de phophytine. La chlorophylle
spare aussi les charges lectriques : la chlorophylle ayant mis un lectron porte
alors une charge + (puisquelle sest libre dun lectron, e) et la phophytine une
charge (puisquelle a reu un lectron e). La phophytine transmet la plastoquinone
cet lectron, elle mme le cdant la quinone Qb (elle se charge donc ngativement)
et la tyrosine Z en donnant un lectron la chlorophylle se charge positivement.
Mais, si on veut que le cycle de transfert recommence, il est indispensable que tous
les composants reviennent lectriquement neutres. Puisque la chlorophylle reoit un
lectron de la tyrosine Z quand elle est ltat chlorophylle + : elle revient donc
son tat stable. Il en est de mme pour la phophytine et de la plastoquinone Qa,
mais il y dsquilibre des charges dans le systme puisqu lextrmit la quinone
Qb doit liminer sa charge ngative et au dbut la tyrosine Z doit rcuprer llectron quelle a perdu en le cdant la chlorophylle.
La rgnration de la quinone Qb est simple. En captant deux protons elle redevient
neutre. Comme, elle nest pas fixe au PS II, elle peut alors migrer sur la phase
interne de la membrane du thylacode et passer au PS I o elle participera la synthse
dATP.
La rgnration de la tyrosine Z est beaucoup plus difficile, elle doit accepter des
lectrons dune substance oxydable. Chez les vgtaux chlorophylliens, cest le
186

9782100544141-Laberche.fm Page 187 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

cycle doxydation de leau qui le permet. En effet, cette tyrosine est directement lie
un complexe producteur doxygne pouvant exister sous cinq tats doxydation S 0,
S1, S2, S3, S4. Ce complexe, qui serait li aux polypeptides D 1 et D2, comprend
du manganse (Mn) que les chimistes connaissent bien pour prsenter plusieurs
degrs doxydation (de + 2 + 7). Les physiologistes avaient dabord pens que
ltat S0 correspondait simplement au Mn (II), S1 au Mn (III) et S2 au Mn (IV), pour
les autres niveaux de S le niveau doxydation du manganse tait beaucoup moins
clair ; il apparatrait maintenant que ce sont des mlanges ; S2 par exemple comporterait un atome de Mn (III) et un atome de Mn (IV) ou 3 atomes de Mn (III) et un
atome de Mn(IV).
Chaque fois que le PS II absorbe un photon, le complexe manganique passe dans
un tat doxydation suprieur et libre un lectron. Lorsque le quatrime photon est
absorb, il atteint S4 ou S5. Mais ces deux niveaux sont instables et retournent
spontanment ltat S 0 en librant une molcule doxygne selon la raction :
2H2O 4 H+ + O2+ 4 e.
Toujours plus complexe
Il est vident que de nombreux points sont encore inconnus dans ces ractions
photochimiques. Nanmoins de nombreuses observations suggrent que dans le
cycle doxydation de leau les ions chlorures interviennent sur la libration des
protons soit en augmentant directement lefcacit des ractions doxydation de
leau, soit en stabilisant les ions manganse. De mme les ions calcium semblent
jouer un rle, leur carence en effet bloque le retour vers S0 de S4.
Ce systme PS II prsent chez les plantes vertes ressemble beaucoup celui dcrit
chez les Cyanophyceae (algues bleues) ce qui conrmerait leur parent volutive,
inversement les Cyanobactries (bactries photosynthtiques) ne produisent pas
doxygne et le compos Z est un phytochrome. Elles extraient les lectrons
ncessaires au fonctionnement de leur photosystme, de molcules organiques ou
de minraux simples comme les oxydes se soufre. Elles seraient apparues plus tt
que les algues bleues.

Dunod La photocopie non autorise est un dlit.

Les ractions de la phase II

Cette phase se droule dans le stroma plastidal. Grce lnergie emmagasine


durant la premire phase, le dioxyde de carbone est fix pour tre ensuite incorpor
dans les glucides de la plante selon le cycle (fig. 7.14) de Calvin et Benson (1950).
Deux enzymes sont particulirement importantes dans ces mcanismes.
La RubisCo (ribulose-biphosphate-carboxylase) joue un rle dterminant chez les
plantes dites en C3. Il sagit de la grande majorit des plantes chlorophylliennes et
en particulier la Pomme de terre, la Betterave, les arbres. Cette enzyme fixe le CO 2
atmosphrique sur le ribulose-1,5-diphosphate pour former deux molcules de triose
(C3). Mais cette enzyme peut catalyser aussi les ractions de loxygne avec le ribulose
1-5 diphosphate. Cest la photorespiration. Ceci se produit quand les quantits de
CO2 dans les lacunes du chlorenchyme sont trop faibles. Cette photorespiration pour
la plante nest pas intressante puisquelle entrane la dgradation partielle de la
molcule de ribulose avec libration de CO2. En fait dans ce cas, la photosynthse
187

9782100544141-Laberche.fm Page 188 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Figure 7.14 Le cycle de Calvin.

est inverse. La RubisCo a cependant une affinit plus marque pour le CO 2 que
pour loxygne et la photosynthse continue tant que la concentration en CO 2 est
suprieure 0,005 %, mme si la concentration en oxygne dpasse les 20 %.
Le problme pos par la fermeture des stomates dans une atmosphre chaude et
sche, provoquant un manque de CO2 dans le chlorenchyme, est rsolu par les vgtaux
dits en C4, tels que le mas ou la canne sucre. Chez ces plantes, les cellules du
msophylle fixent grce la PEPcase (phosphonolpyruvate carboxylase) le CO2
sur un C3 (phosphonolpyruvate) et produit des acides dcarboxyliques en C4, (acide
malique essentiellement) (fig. 7.15). La molcule quatre carbones forme par cette
raction est ensuite transporte vers les cellules des vaisseaux vasculaires o elle est
dcarboxyle pour redonner du pyruvate et cest le CO2 libr qui entre dans le cycle
de Calvin, tandis que le C3 retourne dans le cycle initial. Cette activit PEPcase
caractrise les plantes en C4, dcouvertes en 1966 par Hatch et Slack. Ce sont de
nombreuses Poaceae tropicales comme le mas (Zea mays L.), le sorgho (Sorghum
bicolor (L.) Moench) ou la canne sucre (Saccharum officinarum L.), ainsi que les
plantes grasses qui sont en C4.
Au travers de cette prsentation de la photosynthse, on voit combien la signification
de la photosynthse volue. Mme si cologiquement le dgagement doxygne en
reste lvnement majeur, la photosynthse na pas seulement pour rle de synthtiser
de la matire organique mais surtout de produire un excs dATP, levant ainsi le
potentiel nergtique des organismes possdant la photosynthse et par le jeu des
chanes alimentaires de toute la biosphre.
188

9782100544141-Laberche.fm Page 189 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

Fixation du dioxyde de carbone

Msophylle foliaire

Entre du dioxyde de carbone


dans le cycle de Calvin

Transfert

Cellule des faisceaux vasculaires

Figure 7.15 La localisation des ractions II de la photosynthse


chez les plantes de type C4.

Dunod La photocopie non autorise est un dlit.

Les applications pratiques des connaissances sur la photosynthse


Contrairement aux connaissances sur lutilisation de leau par les plantes, ou labsorption minrale, les applications pratiques de la photosynthse sont relativement
peu dveloppes. Elles servent pourtant mieux matriser les chambres de culture
in vitro. Lutilisation des tubes uorescents type blanc industriel ou lumire du
jour est dconseiller, car ayant un spectre dmission dans les courtes longueurs
dondes, ils napportent pas assez dnergie au niveau des systmes photorcepteurs.
Lajout de lampes incandescence est gnralement sufsant pour compenser cette
carence.
La concentration en dioxyde de carbone dans latmosphre est le facteur limitant
de la photosynthse, cest pourquoi des serristes ont envisag daugmenter sa
concentration. De manipulation dlicate et surtout ncessitant des enceintes
particulirement bien tanches, cette technique ne sest gure dveloppe.
189

9782100544141-Laberche.fm Page 190 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

7.3.2 La respiration des cellules vgtales


Le mcanisme de la respiration arobie est commun tous les Eucaryotes et diffre
peu entre les plantes et les animaux. Elle constitue une des pierres angulaires de la
physiologie vgtale et doit tre connue de tout biologiste. Cependant comme les
mcanismes font appel aux ractions biochimiques, seules les grandes caractristiques
sont donnes dans ce chapitre, laissant au lecteur intress le soin de se reporter
des ouvrages spcialiss pour plus de dtails.
Au cours de la respiration, des composs organiques comme le glucose (C 6H12O6)
sont dgrads et lnergie libre libre est utilise pour la synthse dATP selon la
raction gnrale :
C6H12O6 + 6 O2 6 CO2 + 6 H2O + 38 ATP
LATP est la forme dnergie libre utilisable par la cellule pour effectuer diffrents
travaux (chimiques, mcaniques, ou de transport). Cependant, lnergie libre contenue
dans les sucres ne peut tre convertie en ATP directement. Cette conversion ncessite un
ensemble de cinq grands groupes de ractions qui se droulent essentiellement dans les
mitochondries1 (fig. 7.16).
GLUCOSE
TAPES

NAD+ + H+

ADP + phosphate

Glycolyse

NADH + eau

ATP

Cytosol

CO2

PYRUVATE
transporteur

membrane externe
espace
intermembranaire

transporteur

Oxydation du pyruvate

NAD+

H+

+
NADH

PYRUVATE
ACTYL CoA

membrane interne

HS-CoA
CO2
CO2

Cycle de KREBS

H+

matrice
mitochondriale

ADP

1/2 O2

Transporteurs dlectrons

NADH + H+
FADH2

ATP

H2O

NAD+
FAD

ATP synthase
H+

H+

espace
intermembranaire

Figure7.16 Localisation des tapes de la respiration vgtale.


Seule la glycolyse se passe dans le cytosol, les autres ractions dans la mitochondrie.
1. La mitochondrie (cf. figure 4.14) est un organite cellulaire qui comporte une double
membrane : une externe et une interne spares par lespace intermembranaire. Lintrieur
de la membrane interne dlimite la matrice.
190

9782100544141-Laberche.fm Page 191 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

a) La dgradation du glucose par la glycolyse


La voie de la glycolyse, qui seffectue dans le cytosol, correspond une srie de
ractions catalyses par des enzymes qui dgradent une molcule de glucose ( six
carbones) en deux molcules de pyruvate ( trois carbones).
Glucose + 2 ADP + 2 Pi + 2 NAD+ 2 pyruvates + 2 ATP + 2 H2O + 2 NADH
Cette voie mtabolique produit de lnergie libre sous forme dATP.
La glycolyse se dcompose en deux phases :
dans la premire, le glucose est transform en deux trioses phosphates avec
consommation dnergie ;
dans la seconde, il y a production dnergie sous forme dATP.
Les diffrents chanons mtaboliques intervenant dans la glycolyse sont, soit des
ractions simples, soit des ractions dcomposables en ractions simples. Parmi les
dix ractions enzymatiques de la glycolyse, trois dgagent de lnergie (elles sont
exergoniques donc irrversibles). Les autres chanons sont rversibles et permettent
la gluconogense. Enfin, tous les intermdiaires entre le glucose et le pyruvate sont
phosphoryls ce qui fait quils ont une charge ngative nette pH 7, les empchant
ainsi de diffuser lextrieur de la cellule.

b) La dcarboxylation du pyruvate

Dunod La photocopie non autorise est un dlit.

La deuxime phase seffectue dans la mitochondrie. Le pyruvate synthtis dans le


cytosol entre dans la mitochondrie grce un transporteur membranaire. Il transporte
le pyruvate travers la membrane interne en mme temps quun ion K + en utilisant
lnergie de retour de cette charge positive vers la matrice (charge ngativement).
Ce pyruvate subit dans la matrice une dcarboxylation et une oxydation combine
aboutissant la formation dactyl-CoA. Cette raction irrversible est catalyse par
le complexe multi-enzymatique de la pyruvate dshydrognase.
Le groupement carboxyle du pyruvate est retir sous forme dune molcule de
CO2 alors que les deux autres carbones restants deviennent le groupement actyle de
lactyl-CoA. En mme temps se forment de manire concomitante des nuclotides
pyridiniques rduits. La raction bilan est la suivante :
Pyruvate dshydrognase
HS-CoA

CO2
Actyl-CoA

Pyruvate
NAD +

NADH

Le NADH produit sera roxyd ultrieurement par la chane respiratoire et


permettra la synthse de trois ATP (tape 4).
191

9782100544141-Laberche.fm Page 192 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Structure et drivs de lATP


Ladnosine 5- triphosphate (ATP) est un triphosphate de nucloside qui par
hydrolyse donne de ladnosine 5-diphosphate (ADP) ou de ladnosine 5-monophosphate (AMP) plus du phosphate inorganique :

O P O P O P O CH2
O

H
OH

Adnosine 5-triphosphate (ATP

OH
4

H2O

H2O
(1)

(2)

NH2
O

N
H

O P O CH2

H
H
OH
2

+
O

Adnosine 5-monophosphate (ATP

HO P O

H
OH

OH

Adnosine 5-diphosphate (ATP

H
OH

O P O P O CH2

NH2

Phosphate inorganique (Pi)

HO P O P O
O

Pyrophosphate inorganique (PPi)

Dans lATP :
une liaison ester phosphate relie le phosphate a loxygne 5 du ribose ;
une liaison phosphoanhydride relie les phosphates a b et b g.
Lnergie libre de Gibbs contenue dans lATP est transfre au moment o les liaisons
phosphoanhydride sont scindes pour former : (1) de ladnosine diphosphate (ADP)
et du phosphate inorganique (Pi) ; (2) de ladnosine monophosphate (AMP) et du
pyrophosphate inorganique (PPi).

192

9782100544141-Laberche.fm Page 193 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

c) Le cycle de Krebs
Le cycle de Krebs1 ou cycle du citrate a lieu dans la mitochondrie chez les Eucaryotes.
Cest le cycle dont le nom est le plus connu de tous les biologistes. Il constitue
ltape finale du catabolisme oxydatif des glucides (mais aussi ventuellement des
acides gras et plus rarement des acides amins) et assure la plus grande part des besoins
nergtiques de la cellule grce la formation de coenzymes rduits (NADH et le
FADH2) qui seront roxyds dans la chane respiratoire
Le cycle de Krebs peut se dcomposer schmatiquement en trois tapes (fig. 7.17) :
1. la prparation aux dcarboxylations de la molcule de citrate six atomes de carbones. Une molcule dactyl-CoA ( deux carbones) ragit avec une molcule
doxaloactate ( quatre carbones) pour donner du citrate, molcule six carbones ;
2. Les ractions de dcarboxylations. Au cours des ractions suivantes, deux atomes
de carbone du citrate (provenant des carbones de loxaloactate) sont limins
sous forme de CO2 ;
3. La rgnration de loxaloactate qui acceptera nouveau un actyl-CoA.

C4
Oxaloactate

Actyl-CoA

C4

C6

Isocitrate

NADH

NADH

C5

Dunod La photocopie non autorise est un dlit.

FADH2

-ctoglutarate

C4

Succinate

NADH
CO2

Figure7.17 Les trois grandes tapes du cycle de Krebs


et la formation de coenzymes rduits.
(1) prparation la dcarboxylation du citrate, (2) dcarboxylation, (3) rgnration
de loxaloactate.

1. Sir Hans Krebs (1900-1981). Prix Nobel 1953 de physiologie mdecine pour la dcouverte
dans les annes 1930 du cycle qui porte son nom.
193

9782100544141-Laberche.fm Page 194 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

d) La chane respiratoire
La glycolyse et le cycle de Krebs nont produit que quatre molcules dATP par la
phosphorylation au niveau du substrat. La majeure partie de lnergie extraite des
molcules de glucide est entrepose dans les molcules de NADH et FADH 2 lors du
cycle de Krebs. Cette nergie sera convertie en ATP dans la mitochondrie dans la
chane respiratoire qui se dcompose en 2 tapes couples : la chane de transport
dlectrons et la chimiosmose.
La chane de transport dlectrons

Les lectrons riches en nergie provenant du glucose (transports par les NADH et
FADH2) sont transfrs des transporteurs dlectrons situs sur la membrane interne
mitochondriale. Lors de ce processus, le NADH + H+ et le FADH2 donnent leurs
lectrons une srie de transporteurs dlectrons situs dans la membrane interne de
la mitochondrie. Les composants de la chane sont en gnral des protines avec des
groupements prosthtiques qui peuvent aller dun tat rduit un tat oxyd lorsquils
acceptent et donnent des lectrons.
La chane respiratoire est un ensemble de quatre complexes protiques (fig. 7.18)
inclus dans la membrane interne des mitochondries auxquels sont associs deux
cofacteurs qui assurent linterface entre les complexes. La chane respiratoire ne va
pas directement fabriquer de lATP, mais rcuprer lnergie stocke dans la NADH
et la FADH2 pour crer un gradient de protons. Cest ce gradient qui va fournir
lnergie ncessaire la synthse de lATP.
Le premier complexe va oxyder le NADH + H+ et ainsi se rduire, ce qui revient
prendre deux lectrons au cofacteur. Lnergie de cette oxydorduction va permettre
djecter quatre protons hors de la matrice mitochondriale. Le complexe I va ensuite
retrouver son tat doxydation antrieur en transmettant llectron au coenzyme Q
ou ubiquinone. Le second complexe est commun au cycle de Krebs et la chane
respiratoire. Il oxyde le FADH2 en FAD. Le complexe va, en fait, oxyder du succinate
en fumarate, (raction du cycle de Krebs) et les lectrons rcuprs servent rduire
le FAD en FADH2. Comme pour le complexe I, le complexe II retrouve sont tat
antrieur en rduisant lubiquinone.
Aprs laction du complexe I et du complexe II, on a donc une molcule dubiquinone
rduite, cest--dire contenant deux lectrons. Ces lectrons sont transports travers
la membrane jusquau complexe III quil va rduire. Ce complexe va se roxyder en
transmettant les lectrons au cytochrome C. Cette roxydation va fournir lnergie
ncessaire pour jecter quatre nouveaux protons hors de la matrice mitochondriale.
Le cytochrome C transporte les lectrons jusquau complexe IV, le dernier de la
chane quil rduit son tour. Loxydant est loxygne ; elle permet au complexe IV
de retrouver son tat antrieur et djecter quatre protons. Loxygne rduit va former,
avec des protons de la matrice, une molcule deau, ce qui va encore augmenter le
gradient de protons entre les deux cts de la membrane interne.
Au total, la chane respiratoire aura expuls 12 protons, si elle est alimente en
NADH et huit avec le succinate, ce qui fait 56 protons pour chaque cycle de Krebs.
194

9782100544141-Laberche.fm Page 195 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

Espace intermembranaire
4 H+

4 H+

2 H+

4 H+

C
I

IV

III

AS

Membrane
interne

II
NADH

NAD+

succinate fumarate

1/2 O2 + 2 H+

H2O

ADP + Pi
2

ATP
H+

Matrice

Dunod La photocopie non autorise est un dlit.

Figure7.18 La chane respiratoire dans la membrane interne


des mitochondries avec les complexes transporteurs dlectrons (I, II, III et IV)
et lATP synthase (AS) qui permet la synthse de lATP.

La chimiosmose : la synthse dATP


Le fonctionnement de la chane respiratoire a permis la cration dun gradient de pH
entre la matrice mitochondriale et lespace intermembranaire des mitochondries.
Mais il ny a pas encore eu de synthse dATP. Cette synthse est effectue par une autre
protine membranaire, lATP-synthase (ou ATP-synthtase). LATP-synthase (AS)
est semblable une pompe ionique charge de rguler les flux dions de part et
dautre de la membrane. En fonctionnement normal, elle expulserait deux ions H +
pour chaque molcule dATP hydrolyse. Toutefois, le gradient lectrochimique des
ions H+ est tel que la pompe fonctionne lenvers : lentre de deux ions H + assure
la synthse dune molcule dATP partir dADP et de phosphate inorganique. Les
H+ retournent la matrice en passant par lATP synthtase.
Par ce mcanisme nomm la chimiosmose1, le passage exergonique des protons
est coupl avec la phosphorylation des lATP.
Les molcules dATP ainsi formes se retrouvent dans la matrice mitochondriale o
leur prsence est peu intressante. Pour passer dans le hyaloplasme, elles empruntent
un anti-port, une protine permettant de faire passer de lATP dans le sens matrice
mitochondriale vers lespace intermembranaire puis vers le cytosol tandis que de
lADP passe dans le sens inverse mme si la diffrence de potentiel cr en partie par
le gradient de protons induit un transport 30 fois plus rapide de lATP par rapport
lADP.

e) Bilan de la synthse dATP form au cours de la respiration


La respiration cellulaire permet la production dATP partir de la dgradation complte
de molcules organiques, en prsence doxygne. Chaque molcule de glucose
dgrade produit 38 molcules dATP, comme le montre le tableau (tabl. 7.7.) suivant :
1. Peter Mitchell (1920-1992) a reu le prix Nobel de chimie en 1978 pour sa thorie de la
chimiosmose mitochondriale (le gradient de concentration de protons form de part et dautre de
la membrane interne sert de rservoir dnergie libre pour la synthse dATP).
195

9782100544141-Laberche.fm Page 196 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Tableau7.7 Production dATP par une molcule de glucose dgrade


lors de la respiration vgtale.
Formation
dATP
au niveau
du substrat

Phosphorylation
oxydative:
chane respiratoire
et ATP-synthase

Molcules dATP
formes

2 ATP

2 ATP

Pouvoir rducteur du NADH


+ H+ de la glycolyse

2 NADH + H+

6 ATP

Pyruvate dshydrognase

2 NADH + H+

6 ATP

2 ATP

6 NADH + H+
2 FADH2

2 ATP
6 3 = 18 ATP
4 ATP

tape

Glycolyse

Cycle de Krebs

Nombre total de molcules dATP synthtises

38 ATP

Lquation bilan de la respiration cellulaire est donc :


C6H12O6 + 6O2 6CO2 + 6H2O + nergie (38 ATP)
Thoriquement, chaque mole de glucose devrait pouvoir produire 38 moles dATP
(2 dans la glycolyse, 2 dans le cycle de Krebs et 34 dans la chane respiratoire) soit
un rendement denviron 40 % (40 % de lnergie du glucose convertie en ATP et
60 % en chaleur). En pratique, la cellule parvient tirer environ une trentaine dATP
par molcule de glucose.

f) Le mtabolisme des lipides et des protines


comme autres sources dATP
Le glucose nest pas la source unique de substrat pour la synthse de lATP. Les lipides
et les protines peuvent aussi intervenir (fig. 7.19). Cette dgradation des lipides est
particulirement active et importante au moment de la germination.
Les triglycrides des lipides sont cataboliss en acides gras et glycrol. Le glycrol
peut tre converti en pyruvate (fig. 7.19 ) et entrer dans le cycle de Krebs. Les acides
gras sont coups, en deux molcules deux carbones, pour produire de lactyl CoA
qui entre dans le cycle de Krebs galement (fig. 7.19 ).
Le catabolisme des protines suit un scnario similaire. Les protines sont hydrolyses en acides amins. Le groupe amin est coup et entre dans le cycle de lure.
Le reste de la molcule entre dans le cycle de Krebs (fig. 7.19 ).
Ainsi, tous les tres vivants de la biosphre dpendent de cette transformation de
lnergie solaire en nergie chimique par la photosynthse. Quand ils sont autotrophes,
ce qui est le cas des plantes (sauf les plantes parasites), lnergie chimique accumule
dans les glucides est transforme par la respiration en ATP. Cet ATP est la forme
dnergie libre utilisable par la cellule pour effectuer diffrents travaux (chimiques,
mcaniques, ou de transport). En conclusion, la photosynthse des vgtaux alimente
continuellement la biosphre en oxygne et la respiration restitue sous forme de CO 2
le carbone provenant des glucides dgrads.
196

9782100544141-Laberche.fm Page 197 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

Protines

Polysaccharides

Acides amins

Hexoses Pentoses

Lipides

Acides gras

Glycrol
1

ADP + Pi

ATP
Pyruvate

Ure

Actyl-CoA

Cycle
de lure

O2

Cycle
de Krebs

CO2

Chane de transport
des lectrons
Phosphorylation oxydative

ATP

Figure7. 19 Synthse de molcules dATP lors de la dgradation


des lipides () et () et des protines ().

LATP-synthase
LATP-synthase est un complexe protique enzymatique de masse molculaire
leve (entre 550 650 kDa) qui se trouve dans les crtes mitochondriales,
la membrane des thylacodes et la membrane plasmique. Le rle de cette

Dunod La photocopie non autorise est un dlit.

F1

matrice

b
b

e
F0

a
(a)

membrane
interne
espace
intermembranaire

g
a

(b)

Figure7.20 Structure de lATP-synthase montrant les diffrentes units


constitutives de lenzyme.
a) Schma longitudinal, (b) vue apicale de F1.
(Daprs Moreau et Prat, Biologie et multimdia.)

197

9782100544141-Laberche.fm Page 198 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

protine membranaire est de synthtiser lATP partir du gradient lectrochimique de protons entretenus par la chane respiratoire et dadnosine
diphosphate ADP, ainsi que de phosphate inorganique. Les ATP-synthtases (ou
synthases) constituent 15 % de la masse protique de la membrane mitochondriale.
Structure de lATP-synthase (fig.7.20)

La partie F1 (appele aussi partie Knob ou bosse protique hydrophile) fait saillie dans la matrice mitochondriale. Il comprend cinq sousunits de neuf polypeptides (3a, 3b, 1d, 1g, 1e). Les trois sites catalytiques
des nuclotides sont situs aux interfaces a b .
La partie Fo est un complexe protique intgr la membrane. Elle est compose
de 13 sous units : 1 a, b et b et 10 c. La sous-unit a forme deux demi-canaux
protons permettant le passage des protons entre les deux faces de la membrane
lintrieur de la bicouche.
matrice

ADP

b
ATP

H+

Figure7.21 Le moteur molculaire


de lATP-synthase.
(Daprs Moreau et Prat, Biologie
et multimdia.)

H+
H+ H+
+
+
H H H+

H+

espace
intermembranaire

La synthse de lATP

Lenzyme fonctionne comme un moteur molculaire dans lequel le stator est


constitu par les sous-units a et b du F1, les sous units b, b et d et la sousunit a de Fo. Le rotor est constitu de lanneau des 10 sous-units c et de la
tige interne du F1 (sous-units g, d, e). Le passage des ions H+ entrane la rotation de la sous-unit c . Cest ce mouvement qui permet la formation dATP
partir dADP et P dans la partie qui dpasse de la membrane. La sous-unit a sert
lentre des protons qui sont ensuite relays par la couronne forme par les sousunits c. Ce mcanisme de rotation de la tige g par rapport lanneau form
par les sous-units a et b a t dmontr par H. Noji, R. Yasuda, M. Yoshida et
K. Kinoshita en 1997. Le rotor effectue environ 130 rvolutions par seconde, chaque
rotation complte saccompagne de la synthse de trois molcules dATP.
Paul D. Boyer (UCLA) et John E. Walker (Cambridge) ont remport (avec Jens C.
Skou) le prix Nobel de chimie en 1997 pour leur dcouverte du fonctionnement de
lATP-synthase.
198

9782100544141-Laberche.fm Page 199 Jeudi, 4. fvrier 2010 3:47 15

7.3 Le cycle vital du carbone et de lnergie

7.3.3 La photorespiration
Travaillant dans les annes 1970 sur les missions de gaz carbonique par les plantes,
des chercheurs constatrent que lmission de CO2 saccroissait lorsque la plante
tait claire. En cherchant la cause de cette mission supplmentaire de CO 2 la
lumire, ils montrrent que la respiration mitochondriale ntait pas influence par
lintensit de la lumire. Ceci impliquait que la plante possde une autre respiration
(dgagement de CO2) qui ne prend naissance qu la lumire et dont lintensit est
fonction de lactivit photosynthtique de la plante. Cette respiration a t appele
photorespiration. En effet, lmission de CO2 et labsorption de O2 seffectuent la
lumire. Son mcanisme est dcrit dans la figure 7.22.
O2

ribulose 1,5-biphosphate

cycle
de
Clavin

3-phosphoglycrate

2-phosphoglycolate

glycrate
H2O
Pi

chloroplaste

O2

proxysome

glycolate

glycolate

H2O2

glyoxylate

glycocolle
1/2 O2

oxalate

Dunod La photocopie non autorise est un dlit.

1/2 O2 + 2 H+

glycrate
NAD+

transaminase
srine

NADH + H+
-OH pyruvate

H2O

2 CO2

Figure7.22 Les tapes de la photorespiration.


Fixation de loxygne sur le phosphoglycolate. Formation du glycrate 3-phosphate. Oxydation du glycolate. Formation doxalate. Formation de CO2.
Exemples dautres synthses lies la photorespiration.

Le mtabolite consomm pour produire le CO2 est le phosphoglycolate (fig. 7.22,


) qui est fabriqu pendant le droulement du cycle de Calvin sous laction de la
RubisCo en prsence du ribulose 1,5-biphosphate et de loxygne comme substrats.
Dans le chloroplaste la RubisCo en fixant une molcule doxygne sur le ribulose
1,5-biphosphate produit un intermdiaire instable qui se casse en donnant un glycrate
199

9782100544141-Laberche.fm Page 200 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

3-phosphate qui rintgre le cycle de Calvin et un phosphoglycolate (fig. 7.22, ).


Cest ce dernier qui est lobjet dune squence de ractions, dans le peroxysome,
conduisant au dgagement de deux molcules de CO2.
Le phosphoglycolate est dphosphoryl dans le chloroplaste en glycolate. Il peut
ainsi traverser les membranes pour tre oxyd dans les peroxysomes. La raction est
catalyse par la glycolate oxydase avec formation de peroxyde dhydrogne qui est
dgrad par une catalase (fig. 7.22, ). Toujours dans les peroxysomes, le glyoxylate,
peu soluble, est oxyd dabord en oxalate par la glyoxylate oxydase (fig. 7.16, ).
Le glyoxylate est oxyd, son tour, en deux molcules de CO 2 par loxalate oxydase
(fig. 7.22, ).
La respiration mitochondriale consomme 20 % des assimilats journaliers produits
par la photosynthse au niveau des feuilles et entrane une perte de 40 % 50 % des
produits de la photosynthse journalire au niveau de la plante entire. La photorespiration par son implication avec le cycle de Calvin, reprsente aussi une perte de
30 % de la totalit du CO2 assimil. la fin dune journe seuls 20 30 % du carbone
assimil demeurent dans la plante. La respiration mitochondriale est un processus
indispensable aux organismes arobies et le prlvement des 40 50 % peut tre
considr comme normal puisquelle produit lATP, ncessaire au mtabolisme. La
photorespiration a longtemps t considre comme un gaspillage nergtique chez
la plante, pourtant elle est ncessaire car elle est lorigine de nombreuses synthses
au niveau de la plante comme le glycocolle ou la srine (fig. 7.22).
La photorespiration rsulte du fonctionnement de la RubisCo qui existe donc dans
toutes les espces. Cependant, lorsquon compare les plantes de type C3 et celles de
type C4 (cf. les ractions de la phase II de la photosynthse) les mesures montrent
que le dgagement de CO2, provenant de la photorespiration, est rduit ou mme
inexistant chez les plantes de type C4. Ceci a conduit souvent, par abus de langage,
dire que les plantes de type C4 nont pas de photorespiration. Lexplication de ce
phnomne est simple. Compte tenu de la localisation profonde du Cycle de Calvin
dans les chloroplastes des cellules de la gaine privasculaire, le CO 2 produit par
photorespiration est pig par la PEPCase au niveau des cellules msophylliennes et
restitu aux chloroplastes avant leur sortie de la feuille. Ce recyclage de CO 2 est une
composante de lefficacit photosynthtique leve, reconnue aux plantes de type C4.

7.4 LA

CIRCULATION DE LA SVE BRUTE


ET DE LA SVE LABORE

7.4.1 Lensemble transporteur: xylme et phlome


Lors de lalimentation hydrique de la plante (cas des Angiospermes), nous avons vu
(cf. 5.7, 7.1.2) que leau absorbe par les racines constitue la sve brute et transite
dans les vaisseaux du xylme. Les produits du mtabolisme, sont aussi vhiculs
dans la plante mais dans la sve labore qui circule dans les vaisseaux du phlome.
Ainsi :
200

9782100544141-Laberche.fm Page 201 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

7.4 La circulation de la sve brute et de la sve labore

Le xylme est constitu essentiellement de longs vaisseaux forms dune suite


continue de cellules mortes et rigides, dun diamtre compris entre 20 et 400 mm.
Les parois transversales se sont rsorbes formant ainsi de vritables tuyaux
transporteurs deau. Les parois latrales sont imprgnes de lignine, leur confrant
une rsistance mcanique importante. Les changes sont nanmoins possibles
avec les parenchymes environnants au travers des ponctuations sans lignine. Chez
toutes les plantes vasculaires, on voit aussi quelques trachides, longues cellules
vivantes, aux extrmits effiles, beaucoup moins favorables aux mouvements de
leau (elles constituent, cependant, les lments conducteurs des Gymnospermes).
lintrieur des vaisseaux du bois circule la sve brute. Cest une solution lgrement acide, trs dilue (99 % deau) de nombreux ions (nitrates, ammonium,
phosphates, sulfates, chlorures) absorbs par les racines et transfrs aux bourgeons, feuilles, fleurs et autres fruits. Gnralement, elle ne contient pas de glucides ;
except chez les plantes ligneuses prennes, la fin de lhiver1. Ils proviennent
des rserves carbones de la plante et sont destines alimenter les bourgeons
vgtatifs et floraux en croissance, incapables deffectuer la photosynthse. De
mme, elle transporte aussi des rgulateurs de croissance (cf. 9.3.1). Cette sve
brute se dplace une vitesse de 1 6 mtres par heure avec des variations journalire (maximale le matin, minimale la nuit) et saisonnire (maximale au printemps,
minimale en hiver). Cette circulation est assure par la pousse radiculaire agissant
de bas en haut sur la colonne de sve, contre la pesanteur et la transpiration foliaire
aspirant la sve de bas en haut. Cette dernire le rle le plus important. Pour que
la circulation puisse se faire sans problme, il ne faut pas que dans les vaisseaux,
la colonne deau soit interrompue par une bulle dair, qui romprait la cohsion des
forces de succion. Pour viter cet inconvnient, les vaisseaux sont parfois munis
de petits diverticules en forme danse recourbe vers le haut, destins piger une
bulle inopportune !
Le phlome est constitu de longues cellules vivantes de 15 60 mm de diamtre
formant les tubes cribls. Le cytoplasme, dpourvu dorganites2, trs mince est
plaqu contre la paroi. Pour vivre, ces cellules doivent puiser leurs nutriments,
essentiellement des protines, dans les cellules compagnes, peu diffrencies, grce
des plasmodermes branchus qui connectent les cellules. La sve labore qui y
circule, est lgrement basique (pH 7,5/8,5) et beaucoup plus concentre. Elle
contient majoritairement des glucides des concentrations pouvant dpasser les
300 grammes par litre. Tous les sucres transports sont non rducteurs, donc
stables. Chez beaucoup despces le saccharose est le seul glucide, pourtant chez
les Cucurbitaceae, comme le melon, il est accompagn doligosaccharides de la
famille du raffinose, tandis que chez dautres plantes la sve labore vhicule des
1. Cest la sve brute des rables (Acer saccharinum L., Aceraceae) qui est collecte au Canada dans
les rablires. Une fois rduite, par vaporation de leau, le liquide rcolt donne le sirop drable.
Chez le pommier (Malus primila Mill., Rosaceae), la sve brute contient en hiver du sorbitol (glucide
rduit) assurant par une baisse du point de conglation (loi de Raoult) une protection contre le gel.
2. Dpourvues de noyau, les cellules des tubes cribles, constituent, comme les globules rouges
sanguins, un des trs rares exemple de cellules anucles.
201

9782100544141-Laberche.fm Page 202 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

polyols (mannitol, chez le frne, sorbitol chez le pommier). On ne trouve pas de


glucides rducteurs comme le glucose et le fructose dans la sve labore 1. Sont
prsentes aussi, des substances azotes rduites comme le glutamate et laspartate
ainsi que des rgulateurs de croissance et des ions, comme le potassium, le
calcium, le magnsium ou les phosphates. linverse de la sve brute qui se
dplace vite, unidirectionnellement et dun seul tenant avec relativement peu
dchanges sur le trajet, la sve labore se dplace lentement, dans toutes les
directions et fait lobjet de trs nombreux changes. Cependant les deux flux de
sves ne sont pas totalement indpendants. Tout au long des tissus conducteurs, le
phlome et le xylme qui suivent exactement des chemins parallles des racines
jusquaux plus petites nervures foliaires changent continuellement de leau et
des substances minrales ou plus rarement organiques.

7.4.2 Le transport des assimilats


Aprs leur synthse les assimilats ne peuvent rester sur place et doivent rejoindre les
zones en croissance ou les organes de stockage. Ceci est le rle de la sve labore.
Il comprend trois phases principales : un transport latral des sucres et des acides
amins qui se dversent dans les tubes cribls, un dplacement longitudinal vers le
haut et/ou vers le bas dans le phlome, puis de nouveau un transfert latral vers les
organes en croissance ou de rserve comme les fruits, les graines ou les tubercules

a) Le dversement des assimilats dans les tubes cribls


Depuis quelques annes, les physiologistes ont tabli quil seffectue selon au moins
deux modalits :
1. Dans les feuilles, les acides amins et les glucides issus du mtabolisme circulent
dans les parenchymes en passant par les plasmodesmes cellulaires. Au niveau de
la cellule compagne, les plasmodesmes sont peu nombreux et ce sont des transports actifs secondaires avec transporteurs (intrieur de la cellule du parenchyme/
paroi) et cotransporteurs (paroi/intrieur de la cellule compagne) qui permettent
leur entre puis leur dversement dans le tube cribl simplement par des plasmodesmes (souvent branchus). Deux points importants sont retenir quant aux
glucides : 1) il nexiste pas la surface des cellules compagnes des transporteurs
actifs de glucose et fructose, la sve labore ne peut donc en contenir ; 2) le
transport actif secondaire du saccharose permet davoir une concentration de cet
lment beaucoup plus importante dans le phlome que dans les parenchymes
foliaires, ce qui explique les fortes concentrations observes.
2. Chez plusieurs espces, comme celles appartenant la famille des Cucurbitaceae,
il nexiste pas de transports actifs secondaires du saccharose. Tous les changes
se font par des plasmodesmes. Arriv dans la cellule compagne le saccharose est
transform en raffinose (trisaccharide) par adjonction dune molcule de galactose
1. Le glucose nest pas transport dans le systme circulatoire des vgtaux, alors que cest la
forme privilgie du transport des glucides chez lanimal.
202

9782100544141-Laberche.fm Page 203 Jeudi, 4. fvrier 2010 3:47 15

7.4 La circulation de la sve brute et de la sve labore

ou stachyose (ttrasaccharide) deux galactoses. La cellule compagne, diffrente du


premier cas, porte alors le nom (imprcis) de cellule intermdiaire. Ces glucides
passent dans le phlome par les plasmodesmes branchus mais ne peuvent, par
leur configuration spatiale et leur encombrement, revenir vers le parenchyme ; ils
restent donc dans le phlome.

b) Les dplacements longitudinaux


Lentre active des glucides dans le phlome des feuilles va crer un gradient osmotique
entranant un apport deau, venant du xylme, dans les tubes cribls. Cette eau va
pousser la sve labore en place vers le bas. Simultanment dans les organes de
rserve ou les mristmes, des molcules de glucides vont sortir du phlome. Dans les
tissus avoisinants, le potentiel hydrique est, alors, plus ngatif que dans le phlome ; de
leau sort du tube cribl et la sve labore est aspire. Lensemble de ces diffrentes
actions met en mouvement la sve labore mais de manire trs passive.

c) La redistribution vers les mristmes


et les organes de rserve
Gnralement le saccharose des tubes cribls passe dans les cellules des fruits et des
organes de rserves par des transports actifs secondaires. Arrivs dans le cytoplasme
des cellules receveuses, ils sont souvent hydrolyss en glucose et fructose par des
invertases, ces sucres peuvent rejoindre la vacuole toujours par des transports actifs.
Dans les mristmes le saccharose et les acides amins quittent les tubes cribls
essentiellement par les plasmodesmes, la permabilit de ceux-ci progressivement
diminue en mme temps quaugmente le diffrenciation des cellules. Les transports
actifs secondaires se mettant en place progressivement.
Transports par la sve et agronomie
En plus des aspects strictement physiologiques, la conduction des sves est dune
grande importance en agronomie. En effet de nombreux pesticides, comme les
herbicides, les fongicides, les insecticides ou les nmaticides sont des produits
systmiques. Ceci signie quappliqus en pulvrisation foliaire, ils vont pntrer
lintrieur des feuilles et tre vhiculs dans la plante par la sve labore. Cest
le cas par exemple du glyphosate (nom commercial : Round up) qui est un inhibiteur
de la photosynthse, donc un herbicide. La bonne connaissance de cette systmie
permet de concilier efcacit et matrise des quantits apportes.

203

9782100544141-Laberche.fm Page 204 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 7 La nutrition de la plante

Rsum

Pour se nourrir les plantes ont besoin deau, de sels minraux et danhydride
carbonique.
Elles puisent leur eau dans le sol au moyen des racines, et plus particulirement par
les poils absorbants. Leau entre dans la racine par des gradients de potentiels
hydriques. Arrive dans les vaisseaux du xylme, elle transite dans la plante
avant de parvenir au niveau des feuilles o il se produit un changement dtat.
De liquide, elle devient gazeuse et sort par les stomates. Ces derniers peuvent
souvrir et se fermer en fonction des conditions extrieures. Leau sert peu au
mtabolisme direct mais constitue le moyen employ par la plante pour rguler
lnergie solaire quelle reoit.
Les plantes se nourrissent aussi dlments minraux quelles prlvent dans le
sol. Les besoins sont diffrents selon les lments. Les macrolments absorbs
sont le potassium, le calcium, les nitrates et les phosphates ainsi que toute une
srie doligo-lments. Ce sont des ions qui pntrent lintrieur du vgtal
soit par diffusion facilite, soit par transport actif.
La photosynthse est aussi une grande fonction physiologique des plantes. Elle
se produit dans les chloroplastes grce la chlorophylle. Il est possible de
sparer les ractions I (ractions claires) des ractions II (ractions sombres).
Dans les premires, les deux photorcepteurs sont excits par la lumire ce qui
permet de produire de lATP. Pour que le systme fonctionne, il est ncessaire
quil se produise une coupure de la molcule deau librant deux lectrons et de
loxygne, qui est limin. Dans la deuxime tape, le CO2 est fix par lintermdiaire de la Rubisco dans un cycle en C3 permettant la synthse de glucose.
Chez certaines plantes cette fixation passe par un intermdiaire le phosphonolpyruvate. Cest un moyen pour les plantes de saffranchir des conditions
climatiques trop rudes ou trop sches qui pourraient perturber la photosynthse.
Le bilan final de la photosynthse est un excdent dnergie fixe sous forme
dATP.

204

9782100544141-Laberche.fm Page 205 Jeudi, 4. fvrier 2010 3:47 15

LA

PLANTE
DANS SON MILIEU
ENVIRONNANT

Les plantes pour leur immense majorit sont immobiles, ce qui implique quelles
subissent continuellement les actions du milieu environnant comme la pluie, le vent,
le gel mais aussi la scheresse et la chaleur. Pour ne pas tre limines ds la moindre agression du milieu extrieur, les plantes doivent exprimer des adaptations aux
conditions du milieu.
Le rythme des saisons influe grandement sur la vie des plantes. Arcimboldo
(1527-1593), dans ses tableaux composs dassemblages tudis de vgtaux, a
montr, peut-tre mieux quaucun autre peintre, que, dans lanne, il y a la priode
des feuilles, des fleurs, des fruits. La vie des plantes se synchronise avec les saisons.
Les deux priodes les plus dures pour les plantes sont lhiver et ses froidures et
lt avec la scheresse. Pour affronter la premire, elles adoptent des cycles
biologiques pendant lesquels les organes offrent le maximum de rsistance au gel.
Pour la seconde, elles modifient leur comportement de manire particulirement
efficace.
Mais la plante nest pas un individu, seul, isol sur une le dserte en plein milieu
de locan pacifique ou atlantique. Des relations stablissent entre les plantes et les
autres organismes qui vivent en un mme lieu. Ce sont toutes ces adaptations et ces
relations qui seront dveloppes dans ce chapitre.

Dunod La photocopie non autorise est un dlit.

8.1 LES

PLANTES ET LE RYTHME DES SAISONS

Pour affronter le froid, les plantes adoptent des rythmes de vie ne dpassant pas un
an, ou entrent en vie ralentie.

8.1.1 Les types biologiques


Les plantes ont des dures de vie trs variables. Elles peuvent tre regroupes en trois
catgories.
Les plantes annuelles. Il sagit de plantes qui font leur cycle de dveloppement
complet en moins dune anne. Pour rappeler quelles ne voient quune fois lt
les biologistes les appellent aussi des throphytes. La production de diaspores
trs dshydrates est un moyen daffronter les rigueurs de lhiver. Ce sont les graines
205

9782100544141-Laberche.fm Page 206 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

des Spermaphytes ou les spores sexues des champignons, comme le mildiou de


la vigne (Peronospora viticola Berl. & De Toni, Peronosporaceae). Ces diaspores
assurent la dissmination des plantes et leur survie.
Les plantes bisannuelles. Ce sont des plantes, qui ont besoin de deux annes
civiles pour effectuer un cycle complet de dveloppement. Au cours de la premire
anne de dveloppement, elles accumulent des rserves dans leurs racines avant
de fleurir lors de la seconde anne (la carotte (Daucus carota L. Apiaceae), le salsifis
(Tragopogon porrifolium L. Apiaceae).

Myrtille

Pissenlit

Ortie

Scille

Pausette

Cyclamen

Pavot

CHAMPHYTES
PHANROPHYTES

HMICRYPTOPHYTES

GOPHYTES

THROPHYTES

niveau de la neige

Figure 8.1 Schmas des diffrents types biologiques


selon la terminologie de Raunckiaer.
a, plantes en priode de vgtation ; b, les mmes en hiver (les chelles entre les
diffrents exemples ne sont pas respectes).

206

9782100544141-Laberche.fm Page 207 Jeudi, 4. fvrier 2010 3:47 15

8.1 Les plantes et le rythme des saisons

Les plantes prennes (vivaces). Elles peuvent vivre de nombreuses annes. Certains
Squoias dAmrique du nord dpasseraient ainsi les 2 000 ans. En Europe, la dure
de vie des arbres est certainement plus courte. On connat, cependant, en fort de
Fontainebleau des chnes (Quercus robur L. Fagaceae), remarqus par Franois
1er au XVIe sicle pour leur port particulirement magnifique, qui sont morts aux
environs des annes 1970, donc un ge oscillant autour de 800 ans.
La trs grande majorit des plantes vivaces fleurissent tous les ans. Il en existe
cependant qui ne fleurissent quune fois avant de mourir. Deux exemples sont bien
connus en Europe : les agaves (Agave americana L. Agavaceae) et les bambous1.
Les plantes bisannuelles et les prennes conservent une partie de leur appareil
vgtatif en hiver. Les biologistes classent les plantes en fonction du degr de protection
des bourgeons. la suite de Raunckiaer (1907) ils dfinissent ainsi quatre grandes
catgories (fig. 8.1).
Les phanrophytes regroupent les arbres, arbustes et arbrisseaux. Leurs bourgeons
sont visibles toute lanne mme en plein hiver.
Les champhytes ont les bourgeons prennes situs quelques centimtres du sol.
Ils seront protgs du froid par la couverture nivale.
Les hmicryptophytes ont leurs bourgeons au niveau du sol, les plantes sont
donc bien protges.
Les gophytes dont les bourgeons sont bien protgs dans la terre.

Dunod La photocopie non autorise est un dlit.

8.1.2 La diapause et la dormance des graines


Au moment de sa dissmination, la graine est en phase de repos ou diapause. Les
tissus sont trs dshydrats et les changes respiratoires trs faibles. Lembryon a
cess de saccrotre ds avant la maturit de la graine. Ce phnomne est induit
directement et seulement par lembryon qui, dshydrat, ne peut pas germer. La
diapause des graines dure plus ou moins longtemps selon les circonstances extrieures.
Sa dure est variable. Les graines olagineuses ont en moyenne une longvit assez
faible. Leurs huiles soxydent et donnent des acides toxiques. De mme les graines
de peupliers (Populus sp. L. Salicaceae), de saules (Salix sp. L. Salicaceae), ou de
lrable sucre, doivent rencontrer tout de suite lhumidit favorable leur germination. Leurs graines sont peu dshydrates maturit. Dautres graines gardent plus
longtemps leur pouvoir germinatif. Les haricots, pois, crales qui ont des rserves
amylaces se conservent en gnral bien. Naturellement le pouvoir germinatif
persiste de trois quinze ans. En faisant des essais sur des chantillons dherbier, il
apparat que des graines sont capables de germer au bout dun trs grand nombre
dannes : de 100 250 ans pour certaines Fabaceae et de 300 500 ans pour le
Nelumbium de la famille des Nympheaceae. Quant lexistence de grains de bl
trouvs dans les tombeaux des Pharaons et capables de germer notre poque, cest
de la pure lgende.
1. Les bambous sont des plantes monocotyldones appartenant la famille des Poaceae. Ils
comptent pas moins de 80 genres se dclinant en prs de 1200 espces.
207

9782100544141-Laberche.fm Page 208 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Quand la longvit du pouvoir vgtatif est un handicap


La longvit du pouvoir vgtatif des graines est considre comme un caractre
nfaste pour les agriculteurs. La betterave sucrire a des graines qui ont un pouvoir
de germination dans le sol avoisinant les 20 ans. Ceci provoque de gros problmes
de dsherbage dans les cultures. Il est donc indispensable pour les agriculteurs de
ne jamais laisser ces cultures monter graines.

Dans de trs nombreux cas, ds que la graine se trouve une temprature et une
humidit suffisantes la germination a lieu. Les tissus simbibent deau et la croissance
de lembryon commence. La radicule, mieux diffrencie que la tigelle, est la premire
sortir de la graine.
Cependant, il y a des cas o les conditions de temprature et dhumidit sont
insuffisantes pour permettre la germination. Dautres facteurs interviennent et empchent la germination. On dit alors que la graine est en dormance. Ces inhibitions
seront leves par le milieu.
Repos ou dormance?
Il y a souvent confusion sur le sens des termes repos et dormance . Parfois
mme ils sont considrs comme synonymes. Pour certains auteurs (surtout des
horticulteurs), la dormance sapplique la graine inactive, quelle que soit la
raison de linactivit : par exemple, une graine qui ne germe pas parce quelle est
ltat sec. Mais pour les physiologistes, le sens des termes est inverse. Dormance
voque lide de sommeil, qui implique un tat plus particulier que le repos, donc
de substances inhibitrices. Il faut rserver dormance , pour ce phnomne et
repos pour les phnomnes plus vagues.

Bien que trs nombreuses, ces causes de dormance peuvent tre regroupes en
quatre grandes catgories.

a) Linhibition tgumentaire
Lenveloppe de la graine est la cause unique de linhibition. Ds que la graine est
dcortique, elle germe immdiatement. Les tguments de la graine peuvent tre trs
durs et impermables leau. Dans la nature, les tguments sont lentement attaqus
par le milieu extrieur et se dgradent (bactries, actions chimiques, abrasion par le
sable, frottement contre les rochers, ou feu comme dans le chaparral amricain).
Parfois aussi, les tguments sont impermables loxygne. La dormance cesse lorsque
le tgument est assez altr. Enfin le tgument peut contenir une substance chimique
inhibant la germination. Celle-ci peut tre limine par lavage. Cest encore le cas
de nombreuses plantes dsertiques, dont les graines ne germent que lorsquelles ont
subi laction de pluies prolonges. Cette disposition est avantageuse. Les graines ne
germent que lorsque le sol a t suffisamment imprgn deau, tandis quune simple
humidification qui laisserait ensuite la plantule dans des conditions de scheresse
nfastes, ne dclenche pas la germination. Artificiellement, la scarification de ces
graines permet une imbibition rapide suivie immdiatement de la germination.
208

9782100544141-Laberche.fm Page 209 Jeudi, 4. fvrier 2010 3:47 15

8.1 Les plantes et le rythme des saisons

b) La dormance embryonnaire
Gnralement pour que la graine puisse germer, il faut que lembryon subisse une
priode de froid humide entre 0 et 10 C. Pratiquement, on laisse ces graines pendant
les mois dhiver en couches stratifies dans du sable humide (rosiers (Rosa sp. L.
Rosaceae), pchers (Prunus persica Batsch Rosaceae)). Des combinaisons dinhibition
tgumentaire et de dormance embryonnaire peuvent se rencontrer, ce qui complique
leurs exigences vis--vis des facteurs du milieu.

c) Inuence de la lumire
La lumire peut galement avoir un rle trs important dans les dormances des graines.
Daprs leur comportement vis--vis de la lumire, on peut classer les graines en trois
groupes.
Les indiffrentes. Elles sont peu nombreuses mais comptent des plantes importantes
pour lagriculture comme les crales et les lgumineuses.
Les dormantes lobscurit. Elles exigent de la lumire pour germer. La plupart
des espces rentrent dans cette catgorie (70 %). Ne dit-on point que les graines
de haricot ont besoin de voir les pieds du paysan pour germer ?
Les dormantes la lumire. Elles exigent lobscurit pour germer. La lumire
manifeste son activit inhibitrice mme une trs faible intensit lumineuse.
Les diverses longueurs dondes nagissent pas de la mme manire. Chez les
graines de Laitue, dormantes lobscurit, les radiations rouge clair lvent la dormance.
Les autres radiations sont inactives et le rouge sombre est mme inhibiteur. Ainsi
lorsque les graines ont subi laction du rouge clair, un traitement au rouge sombre,
donn peu aprs, annule la stimulation et les graines restent dormantes. Dans la
lumire blanche, leffet du rouge clair dpasse celui du rouge sombre et la rsultante
est une leve de dormance. Les consquences pratiques de ces inhibitions sont loin
dtre ngligeables. En effet lors des labours les agriculteurs enfouissent des graines
disposes en surface mais remontent un stock qui ne germait pas car il tait priv de
lumire. Retrouvant la clart du ciel, les graines peuvent germer abondamment si la
viabilit de leur embryon le permet.

Dunod La photocopie non autorise est un dlit.

d) Les inhibiteurs de germination diffusibles


Cette dormance sobserve essentiellement dans les fruits charnus (la pomme, la poire).
Le msocarpe produit des inhibiteurs de germination. Des composs de nature trs
diffrente se sont rvls tre inhibiteurs de la germination. Le plus connu est la
coumarine. Cest une lactone lodeur caractristique, reconnaissable dans les foins
frachement coups. La prsence dinhibiteurs nest pas limite aux tissus des fruits.
Toute autre partie de la plante est susceptible den contenir ou den scrter. Les
radicelles, en particulier, laissent diffuser dans le sol une foule de substances banales
pouvant empcher la germination des graines situes dans leur voisinage. Enfin des
plantes font le vide autour delles en librant au niveau des feuilles des inhibiteurs de
germination. Les feuilles de noyer (Juglans sp. L. Juglandaceae) scrtent la juglone.
Lessive par les pluies, elle empche les graines de germer y compris celles de sa
propre espce.
209

9782100544141-Laberche.fm Page 210 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Inhibitions inattendues
ct des inhibitions naturelles de la germination, il faut penser aussi aux inhibitions
induites et accidentelles. Par exemple, il ne faut jamais conserver des graines dans
des meubles en bois constitus de panneaux de particules. Les colles employes
pour les fabriquer sont hautement toxiques et inhibent totalement les germinations.
Les armoires mtalliques, inversement, disposes dans des lieux secs et peu chauffs
sont idales pour conserver des graines

8.1.3 La dormance des bourgeons


En automne les tiges sarrtent de sallonger. Seules quelques plantes feuilles
persistantes, comme la bruyre (Calluna vulgaris L. Ericaceae), ne sarrtent de
crotre que lorsque la temprature est trop basse pour permettre lactivit vitale. Les
bourgeons dj forms prsentent une diapause hivernale, mais celle-ci est, dans la
plupart des cas, une vraie dormance car les bourgeons ne se rveilleront que sous
linfluence dun stimulus particulier.

a) Les bourgeons des tiges ariennes


Presque toutes les plantes vivaces de nos rgions prsentent un cycle annuel qui
comprend :
une phase dlongation printanire ;
un arrt dlongation en t et la formation du bourgeon qui dbourrera lanne
suivante ;
un arrt de toutes les activits.
Cet arrt nest pas caus par le froid. Les plantes arrtent de sallonger lorsque les
jours sont encore beaux. Le stimulus responsable est en gnral le raccourcissement des
jours (ou lallongement des nuits). Ceci correspond une modification de la photopriode.
Certaines plantes entrent en dormance sous dautres influences que la photopriode. Le lilas (Syringa vulgaris L. Oleaceae), par exemple, obit un mcanisme
purement interne : aprs avoir fleuri et mis un nombre dtermin de feuilles, il
sarrte automatiquement de crotre jusqu lanne suivante.
Les causes de rveil sont multiples et varies. Il peut sagir tout simplement du
retour des photopriodes plus longues en jour. Mais le plus souvent la cause du rveil
est la quantit totale de froid subit par la plante. Le froid ne fait naturellement pas
revenir la plante ltat actif, mais il permet lallongement ultrieur des bourgeons
lorsque la temprature est redevenue plus tide. Lhellbore (Helleborus niger L.
Ranunculaceae), a un rveil trs facile et une croissance possible une temprature
assez basse. De ce fait, la floraison normale se fait aux environs de Nol (Rose de
Nol). Le besoin de froid diffre pour chaque plante ; les tempratures efficaces sont
gnralement comprises entre 0 C et 10 C et la dure de la priode de froid est de
quelques jours quelques mois. Cette quantit de froid efficace diffre aussi selon
lpoque dapplication : la dormance de la plante est trs profonde au dbut de
lhiver mais au fur et mesure que la saison savance, il suffit dun froid de plus en
plus lger et court pour provoquer le rveil.
210

9782100544141-Laberche.fm Page 211 Jeudi, 4. fvrier 2010 3:47 15

8.1 Les plantes et le rythme des saisons

Dunod La photocopie non autorise est un dlit.

Pour certaines plantes, comme le htre, il faut, non seulement une longue priode
de froid, mais encore lapparition de jours plus longs pour un rveil complet. Chez
le marronnier, la scheresse est un stimulus efficace de dbourrement des bourgeons.
Ainsi, la suite dune priode automnale exceptionnellement sche, le marronnier
peut reprendre sa croissance sous leffet dune forte pluie et il prsente ainsi une
refoliaison anticipe. Ceci est relativement frquent chez les arbres disposs sur des
dalles couvrant des travaux de gnie civil et ne disposant de ce fait que de peu de
terre pour se dvelopper.
Beaucoup de ces facteurs peuvent tre utiliss par les horticulteurs pour rveiller
les bourgeons. Ceci leur permet davoir des plantes de contre-saison. Il peut sagir,
soit dapplications de bains chauds comme chez le lilas o il suffit de plonger des
branches quelques heures dans de leau 40 C, soit lemploi de substances chimiques (lther est employ depuis longtemps dans les forceries de lilas, de mme que
lthylne, le dichlorthane, ou la thio-ure). Le rveil est un phnomne purement
local, et seule la partie dune plante traite par le stimulus adquat reprend sa croissance. Ainsi chez le lilas, si on plonge un seul rameau dune plante dans un bain
chaud, toute la plante restera dormante sauf le rameau trait.
Cette dormance est une protection contre les rigueurs de lhiver. Le bourgeon est
peu hydrat. Dans cet tat, il est peu sensible au froid, ainsi qu la scheresse. Il
prsente des ressemblances avec les graines. Au contraire, si le froid saisit une pousse
tendre, aux tissus turgescents trs riches en eau, il entrane facilement sa mort. Les
plantes dormance induite par la photopriode et qui vivent dans les pays relativement
chauds ont une dormance peu profonde. Elles sont veilles par de courtes priodes
de froid modr. Si elles sont transfres dans des rgions plus froides, elles se
rveillent souvent trop tt la suite des premiers froids et reprennent leur croissance
ds le premier redoux, de sorte que les geles plus tardives les tuent. Ceci confirme
le vieil adage paysan selon lequel on pouvait descendre une plante (vers le sud)
mais jamais la remonter (vers le nord) sous peine de la voir craindre les dernires
geles du printemps. Il existe, bien sr des contre-exemples. Ainsi des plantes qui
ont besoin dune longue priode hivernale pour se rveiller peuvent ne pas russir
dans des pays chauds. Cest le cas de nombreux pommiers en Afrique du Nord.
Lhiver nest pas assez froid pour initier les bourgeons floraux. Les arbres poussent
au printemps dune manire la fois tardive, paresseuse, et irrgulire.

b) Les bourgeons des tubercules et des bulbes


Tubercules et bulbes sont des tiges souterraines. La pomme de terre est lexemple le
plus connu des tubercules. La tubrisation se produit seulement quand la tige
feuille a atteint un certain volume. De son ct, loignon forme son bulbe en jours
longs condition davoir de la chaleur. Pour ldification des bourgeons souterrains
qui se forment sur les tubercules et dans les bulbes, la lumire na pas dinfluence.
Plusieurs facteurs lvent la dormance.
La leve spontane (pomme de terre)

Lors de la rcolte les bourgeons des tubercules (les yeux ), sont en dormance. Si
on replante un jeune tubercule ds larrachage, il ne pousse pas. Cette dormance est
211

9782100544141-Laberche.fm Page 212 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

plus ou moins profonde selon les varits de pomme de terre. Pour certaines, cette
croissance des tiges sur les tubercules peut avoir lieu peu de temps aprs la rcolte,
et pour dautres, il faut attendre plusieurs mois. Lveil est spontan et rsulte du
simple stockage des tubercules ou de leur conservation en terre. La temprature na
pas dinfluence notable, la lumire non plus. Aprs un repos suffisant, lveil se traduit
par lallongement rapide des germes et lapparition de racines adventives leur base.
On peut prolonger la dormance interne, propre aux bourgeons et inhiber llongation
des germes en traitant les tubercules par lester mthylique de lacide naphtalne
actique. Cest une pratique trs utilise pour les stockages de pommes de terre.
Le cas de la pomme de terre, o lentre en dormance et lveil sont dtermins
dune manire purement interne, nest pas un cas gnral. Dautres rhizomes sont sous
laction de la temprature. Ainsi le muguet (Convallaria majalis L. Convallariaceae)
est veill par le froid hivernal.
Linuence de la temprature

Les bulbes, en gnral, prsentent des exigences trs complexes vis--vis de la temprature. Celles-ci sont connues, suite aux importants travaux raliss par les Hollandais.
Ces grands spcialistes des tulipes (Tulipia sp. L. Liliaceae), jacinthes (Hyacinthus sp.
Hyacinthaceae), et autres narcisses (Narcissus sp. L. Amaryllidaceae), les cultivent sur
dimmenses surfaces aussi bien pour la fleur que pour les diaspores sur des polders
au sud de Harlem. la fin du printemps, aprs la floraison, la partie arienne de la
plante sche mais le bulbe souterrain persiste. Il organise, alors, ses bauches de fleurs
et de feuilles pour lanne suivante. Un mme bulbe peut persister plusieurs annes
(jacinthe) ou bien ne durer quun an, et cest alors un bulbe latral ayant atteint sa
maturit de floraison qui le remplace (tulipe). Chez les horticulteurs, les bulbes sont
arrachs au dbut de juillet et stocks. Ces conditions artificielles doivent tre favorables
la production ultrieure de belles hampes florales. En tudiant toute une gamme de
tempratures aux divers moments du stockage, Blauw a lucid en dtail les besoins
des plantes les plus caractristiques. Chez la jacinthe trois priodes de tempratures
sont bien prcises.
La premire la temprature de 34 C. Elle permet lorganogense des feuilles et
des fleurs.
La deuxime est seulement 13 C. Elle est ncessaire pour obtenir le rveil.
La dernire plus chaude (20 C) permet llongation de la hampe florale.
Grce la connaissance prcise des besoins des bulbes, on peut stopper leur
volution telle ou telle phase et, par exemple, expdier dans lhmisphre sud des
bulbes retards de six mois et prts fleurir lors du printemps austral.

8.1.4 Les conditions de la germination


La germination est un moment dlicat dans la vie dune plante. Dans la nature, la
graine ne doit pas, en effet, germer trop vite mais dclencher le processus de germination des moments bien prcis et favorables sa croissance et son dveloppement.
Elle ne doit pas, par exemple, confondre le signal automne doux et printemps .
212

9782100544141-Laberche.fm Page 213 Jeudi, 4. fvrier 2010 3:47 15

8.1 Les plantes et le rythme des saisons

Pour assurer la prennit des espces, les germinations des graines despces sauvages
sont souvent asynchrones et peuvent schelonner sur plusieurs annes. Il existe donc
des freins la germination, parfois trs bien verrouills qui constituent des obstacles
la germination. Inversement, les exigences de lHomme quant la germination des
plantes cultives sont diffrentes : la germination de ses graines doit tre rapide et
surtout synchrone dans le temps.
La germination dune graine, dpend de nombreux paramtres internes et externes.
Une des principales conditions de la germination est la prsence deau : elle permet
limbibition des tissus dshydrats conduisant la mise en solution des molcules
ainsi quaux hydrolyses mtaboliques. Si les autres conditions sont remplies comme
par exemple la temprature, la lumire ou ltat de la graine, le redmarrage du
mtabolisme va suivre avec son cortge dactivits cellulaires induisant de profondes
transformations dans la graine. Lembryon va se dvelopper en une racine, une tige
et des feuilles partir des bauches dont il tait constitu. Redevenu autotrophe, il va
entamer sa croissance jusqu ltat adulte o, son tour, il pourra se reproduire.

Dunod La photocopie non autorise est un dlit.

a) Les conditions de germination externes ou lies au milieu


Pour germer, toute graine a besoin en plus deau, doxygne, de la chaleur et ventuellement de lumire.
Loxygne doit tre la pression ordinaire de latmosphre ; les graines ne germent
ni dans le vide ni sous une pression trop leve. Cet oxygne se combine avec les
glucides et les lipides que renferme la graine lors des processus de respiration. Sous
linfluence de lhumidit, la graine se gonfle, les enveloppes clatent ou se ramollissent.
La temprature ncessaire la germination est variable suivant les graines. Le
cresson (Nasturtium officinale, R. Br., Brassicaceae), par exemple, germe entre 1,8
et 48 C, mais la temprature optimum est de 31 C ; lorge (Hordeum vulgare L.
Poaceae) germe entre 5 et 37,7 C, son optimum est 28,7 C ; le mas (Zea mays L.
Poaceae) germe entre 9,5 et 46,2 C, son optimum est 33,7 C. Il existe des graines,
notamment celles des plantes dites pyrophytes, qui vivent dans des milieux sujets aux
frquents incendies, survivent trs bien au passage du feu. Chez certaines espces
mmes, le feu ou une chaleur intense est ncessaire la germination. La chaleur,
en effet, dgrade les composs phnoliques et les rsines prsents dans les tguments de
la graine et qui inhibent la germination en temps normal. Ces substances tant dgrades, lenveloppe de la graine devient alors permable lair et leau, la dormance
est leve et la graine peu alors commencer germer. On peut donner en exemples
les graines de certains acacias ou dune plante australienne arbustive, le kennedia
(Kennedia rubicunda Vent., Fabaceae) qui ncessite de tremper les graines pendant
une minute dans une eau bouillante puis de les laisser progressivement se refroidir.
Par contre, une graine qui a commenc son processus de germination est beaucoup
plus vulnrable la chaleur quune graine en dormance. Exposer une graine germe
une temprature de cet ordre a un effet ltal.
La lumire est aussi un facteur externe de la germination. On a cru pourtant, dans
le pass, que la lumire ntait pas ncessaire la germination. Mais, chez certaines
espces, on note une nette action positive de la lumire sur la germination. Il est
213

9782100544141-Laberche.fm Page 214 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

aussi bien connu que certaines graines ne doivent pas tre recouvertes. Elles germent
en surface, exposes lalternance jour/nuit. Inversement chez dautres espces, la
germination est meilleure en obscurit totale. La lumire joue un rle prpondrant
dans la germination des graines qui possdent, au mme titre que les feuilles, des
rcepteurs photosensibles (phytochrome).

b) Les conditions de germination internes


La maturit est la premire des conditions. Les graines mres conservent dautant
plus longtemps leur facult germinative quelles sont plus riches en amidon. Si elles
sont charges de matires grasses et dessences, elles rancissent et se dtriorent la
longue. Mais dautres facteurs internes interviennent.
Le contrle de la germination par les rgulateurs de croissance
Lacide abscissique (cf. 9.3.1) est la principale substance responsable de la non-leve
des semis. Elle saccumule dans la graine lors de sa maturation et lempche de germer.
Son taux dcrot ensuite lentement lors du stockage de la graine et tant quelle est
prsente en quantit suffisante, cette substance joue parfaitement son rle de retardant
de la germination. Son action est contrecarre par une autre classe de rgulateur de
croissance, les gibbrellines. Chez certaines espces vgtales elles sont sans effet et
ce sont dautres rgulateurs, telles que les auxines ou les cytokinines, qui contrebalancent leffet inhibiteur de lacide abscissique.
Linhibition mcanique
Les tguments de la graine constituent une barrire mcanique qui empche lembryon
de se dvelopper. Pour quils se dlitent plusieurs solutions sont possibles. Gnralement la dure passe dans des conditions un peu humides (pour quait lieu une
digestion lente par les enzymes scrtes par la graine elle-mme) en vient bout. Mais
dautres moyens plus brutaux peuvent tre ncessaires comme par exemple le gel ou le
feu, moins que ce ne soit le transit des graines dans le systme digestif des oiseaux,
comme, par exemple, pour le gui (Viscum album L. Loranthaceae). En horticulture, on
incise souvent les tguments pour faciliter la germination Cest le cas, par exemple,
des graines de drosophyllum (Drosophyllum lusitanicum, Link, Drosraceae) ou
dibicella (Ibicella lutea, Pedaliaceae) qui sont des plantes carnivores souvent
commercialises en jardineries.
Linhibition tgumentaire
Des drivs phnoliques aux proprits antimicrobiennes stocks dans les tguments
des graines jouent galement un rle dinhibiteurs des processus germinatifs. On
parle dinhibition tgumentaire. Ces drivs peuvent soit avoir une action spcifique
en bloquant la mobilisation des rserves, soit empcher leau de mouiller la graine
du fait de leur caractre hydrophobe. Gnralement, ils soxydent lentement avec le
temps. Dans la nature, ces composs inhibiteurs sont vacus de la graine par lessivage lors des prcipitations. Parfois en horticulture il est prconis de laisser tremper les
graines ; cest le cas du persil Petroselinum crispum (Mill.) Nyman ex A. W. Hill, (syn.
Petroselinum sativum), famille des Apiaceae qui a une germination souvent dlicate.
214

9782100544141-Laberche.fm Page 215 Jeudi, 4. fvrier 2010 3:47 15

8.1 Les plantes et le rythme des saisons

Ainsi, la germination dune graine est contrle par de nombreux facteurs comme
le montre la figure 8.2.
lumire
hydrolyse
des parois

temprature

lessivage
des
inhibiteurs

eau
+

oxygne
+

inhibiteurs
acide
gibbrellique

eau

activit
mtabolique
mobilisation
des rserves

pousse
radiculaire

acide abscissique

temps

dioxyde
de carbone

Figure8.2 Les facteurs internes et externes qui agissent


sur la germination.

Toutes les conditions de germination doivent tre satisfaites en mme temps pour
quil y ait leve de dormance puis pousse radiculaire.

8.1.5 Les conditions de mise fleurs


Le terme floraison voque lpanouissement des fleurs. Cest une priode
magnifique, mme si les conditions du milieu environnant comme les geles blanches
peuvent anantir en quelques instants la beaut si fugace de ces moments.

Dunod La photocopie non autorise est un dlit.

Lennemi de la floraison: les geles blanches


Les geles blanches sont des phnomnes microclimatiques qui apparaissent par
temps calme et clair, en n de nuit au printemps. Il sagit dune accumulation dair
froid. Les arbres fruitiers y sont trs sensibles et ce dautant plus que la fcondation
ne sest pas encore produite ; les arboriculteurs sen protgent en installant des
chaufferettes dans les vergers. Elles ne rchauffent pas latmosphre, mais produisent un brassage de lair vitant ainsi que les masses froides saccumulent prs du
sol. Dautres solutions sont possibles, comme les ventilateurs ou les arrosages par
brumisation qui entourent les bourgeons dune gangue de glace isolante.

Mais ce nest pas ce stade morphologique qui intresse le biologiste. Ce sont les
mcanismes transformant le mristme floral en fleur qui retiennent son attention.
En effet, ils sont sous la dpendance de facteurs extrieurs importants comme la
temprature et la dure de la lumire. Pour pouvoir fleurir, la plante doit avoir atteint
215

9782100544141-Laberche.fm Page 216 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

un stade vgtatif prcis, trs variable selon les espces. Pour certaines varits de
tomate (de type Marmande), la mise fleurs peut avoir lieu seulement quand la plante
possde 13 entre-nuds, pour le pois, il est souvent ncessaire davoir dj sept feuilles
panouies, quant aux melons les premires fleurs apparues sur la tige principale sont
mles, les fleurs femelles napparaissant que sur les rameaux secondaires (do la
taille prcoce effectue par les agriculteurs favorisant la ramification). Les conditions
de nutrition sont aussi trs importantes, car on a remarqu depuis longtemps (Klebs,
1918) des diffrences dans la composition dune mme plante suivant quelle se trouve
ltat vgtatif ou reproducteur. Les horticulteurs savent bien que les produits
azots, particulirement les nitrates, favorisent la croissance de lappareil vgtatif,
mais quune lgre carence en cet lment favorise la mise fleurs, surtout si le milieu
nutritif contient aussi du potassium. Pour certaines plantes, les conditions de nutrition
favorables sont suffisantes. Chez dautres, il faut encore que se ralisent des conditions
extrieures. Elles concernent la photopriode et la temprature.

a) Le photopriodisme
Linfluence de la photopriode sur la mise fleur a t dcrite aux tats-Unis par
Garner et Allard en 1920 sur une varit gante de tabac (Nicotiana tabacum L.
Solanaceae varit Maryland Mammouth). lautomne, alors que les autres varits
fleurissent et cessent de donner des nouvelles feuilles, ce tabac continue sa croissance
vgtative jusqu ce que le froid larrte.
Soucieux de connatre son comportement ultrieur, ils la transportrent en serre
une temprature favorable, et ils constatrent quelle formait ses fleurs la fin de
lautomne et en hiver. De jeunes plantes semes lautomne et mises en serre fleurissaient la mme poque. Ils attriburent cette floraison linfluence des jours courts.
En effet la floraison peut tre obtenue en t en obscurcissant les plantes avant la
tombe de la nuit, de faon les soumettre une journe suffisamment courte. Inversement, la floraison peut tre empche en hiver grce un clairage dappoint donn
aux plantes la fin de la journe.
Classiquement les plantes sont classes en trois groupes.
1. Les indiffrentes sont insensibles la photopriode. Ce sont par exemple le
pissenlit (Taraxacum sp. Weber, Asteraceae), le lilas ou le cotonnier (Gossypium
sp., Malvaceae). La tomate est un cas un peu particulier quant au photopriodisme.
Si actuellement elle peut tre considre comme une plante indiffrente, il nen a
toujours pas t toujours ainsi. Les varits locales anciennes, ncessitaient des jours
longs pour fleurir. Ceci a pos de trs srieux problmes au moment des premiers
essais en culture de contre-saison. Les tamines se formaient mal et le pollen tait
gnralement peu fertile, ce qui a ncessit des techniques de pollinisation artificielle (les vibreurs, appels aussi abeilles mcaniques, et surtout lutilisation de
substances de croissance permettant le dveloppement parthnocarpique du fruit).
Actuellement la slection procure des plantes indiffrentes la dure du jour.
2. Les plantes de jours courts (JC). Pour quelles se mettent fleurs, il faut que la
longueur du jour ne dpasse pas une certaine valeur critique (gnralement
216

9782100544141-Laberche.fm Page 217 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

8.1 Les plantes et le rythme des saisons

10-12 heures). Le tabac Mammouth . est une plante jours courts. Il en est de
mme des chrysanthmes (Chrysanthemum sp. Asteraceae) qui sont traditionnellement des fleurs de la Toussaint. Linitiation florale se fait en jours courts. Mais
depuis quelques annes apparaissent sur les marchs des plantes fleuries ds le
printemps. Pour les obtenir les serristes cultivent les boutures trs tt dans la
saison afin quelles acquirent leur maturit physiologique permettant linitiation
florale ds les premiers jours de mars, donc encore en jours courts.
3. Les plantes de jours longs (JL), rclament une dure de jour importante (plus de
12-14 heures). Cest le cas de nombreuses plantes annuelles.
Plusieurs observations ont permis de caractriser les facteurs de linduction.
Le nombre de cycles de 24 heures ncessaires pour induire la mise fleurs est trs
variable : une seule nuit longue de 15,5 heures pour la lampourde Xanthtum
pennsylvanicum (Asteraceae dAmrique), contre 30 nuits longues, environ, pour le
chrysanthme.
Une fois linduction obtenue, on peut souvent repasser en mauvaise photopriode
sans que leffet soit dtruit. Cependant, ceci entrane parfois des troubles dans
lorganogense, ayant pour rsultat lavortement des boutons.
Cest la longueur de la nuit qui est importante. On peut interrompre le jour par des
priodes dobscurit sans que cela ait de limportance.
La perception de la lumire se fait par les feuilles. Le principe induit peut tre
transmis partir dune seule feuille traite, probablement par le phlome. Mais on
ne doit pas couper leffet de la nuit par un clairement mme fugace, qui rtablit
la situation des jours longs. Les radiations actives pour interrompre la nuit sont
constitues par la lumire rouge clair (optimum vers 6 550 ) et leur effet peut
tre annul par le rouge sombre (optimum vers 7 300 ).
Cette induction a t tudie, voici dj quelques annes par Borthwick et
Hendricks (1954). Ces physiologistes montrrent que linduction de la croissance et
du dveloppement est li deux formes trs voisines dun seul pigment bleu-vert
appel phytochrome. Le phytochrome est beaucoup moins abondant dans les plantes
que la chlorophylle. Il se prsente sous deux formes interchangeables. Le premier,
appel Pr, absorbe la lumire rouge de longueur donde voisine de 660 nanomtres
(cest pourquoi, cette forme tait jadis appele P660). Lautre forme, Prl, absorbe
dans le rouge lointain (sombre) 730 nanomtres (dou son ancien nom de P 730). Ce
phytochrome est un commutateur biologique : lorsquune forme (Pr ou Prl) reoit de
la lumire, il se transforme en lautre forme. Ainsi Pr en prsence de lumire rouge
clair se transforme en Prl et si ce dernier reoit de la lumire rouge sombre, il redevient
du Pr. Seule la forme Prl est physiologiquement active. On sait depuis peu quil active
une dizaine de gnes de la croissance et du dveloppement, en particulier celui codant
la synthse de la RubisCo, enzyme participant la fixation du dioxyde de carbone
atmosphrique. Ce Prl rgule galement sa propre synthse en inhibant lexpression
du gne qui en est responsable (fig. 8.3). On est en prsence dune rgulation de
lexpression gntique par la lumire.
217

9782100544141-Laberche.fm Page 218 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Biologie molculaire et phytochrome


Les biologistes molculaires tudient en dtail la structure du phytochrome. Il est
vraisemblable quil active des intermdiaires molculaires qui transmettent le
signal llment photoractif, et des biologistes ont dj identi dans le noyau
de la cellule une protine qui doit avoir ce rle. Elle se xe deux squences dADN,
prsentes dans chacune des parties du phytochrome. Des mutations perturbant
cette liaison diminue lexpression du gne de la RubisCo.
Lumire rouge clair

Pr
Gnes de croissance
(ex. : Rubisco)

transduction

Prl

Expression
quand pas de Prl
Blocage
en prsence de Prl

Gne de synthse
du phytochrome

induction
CROISSANCE

Lumire rouge sombre

Figure8.3 Rgulation de lexpression gntique par la lumire


agissant sur le phytochrome.
Le Prl actif dclenche la transduction qui correspond une srie dtapes activant
des gnes ; ceux-ci sont traduits en protines qui inuencent le dveloppement de
la plante. Dun autre cot le phytochrome contrle son propre gne de synthse.

b) La vernalisation
Certaines plantes, mme places en bonnes conditions photopriodiques, sont incapables de se mettre fleurs si elles nont pas subi au pralable linfluence du froid. Ce
phnomne par lequel une plante acquiert laptitude fleurir sappelle la vernalisation.
Cette notion dcoule des observations effectues sur le comportement des crales
dhiver et de printemps. Le bl (Triticum aestivum L. Poaceae) et le seigle (Secale
cereale L. Poaceae) dits de printemps , sems au printemps, fleurissent la mme
anne, en t. Au contraire, les varits dhiver sont semes lautomne, elles
lvent et produisent une touffe de brins, les talles, qui passent lhiver ; au printemps
les pis apparaissent. Semes au printemps, elles donnent des plantes qui restent
longtemps ltat vgtatif. Leur floraison est inexistante ou tardive et mauvaise.
Les agriculteurs utilisent leur profit cette proprit pour obtenir des fourrages sans
pi donc de meilleure qualit alimentaire pour les animaux. Ils sment au printemps
des ray-grass (Lolium perenne L. Poaceae) dhiver, qui ne fleuriront pas la premire
anne. Les plantes ont donc besoin du froid hivernal pour fleurir.
Comme pour le photopriodisme, on peut classer les plantes en trois groupes.
Les indiffrentes. Elles comprennent des plantes annuelles qui, semes au printemps,
fleurissent dans le courant de la mme anne sans avoir eu besoin de froid.
218

9782100544141-Laberche.fm Page 219 Jeudi, 4. fvrier 2010 3:47 15

8.1 Les plantes et le rythme des saisons

Les prfrantes. Ce sont essentiellement les annuelles dites dhiver donc semes
lautomne, ainsi que quelques plantes prennes.
Les plantes vernalisation obligatoire. Il sagit des bisannuelles comme la betterave
(Beta vulgaris L. Chenopodiaceae) ou la carotte. Ces plantes forment pendant la
premire anne une rosette de feuilles insres sur une tige trs courte. Elles
accumulent en mme temps une grande quantit de rserves dans leurs racines
tubrises. La deuxime anne, quand la rosette a subi le froid de lhiver, la plante
met une hampe florale, fleurit, puis meurt.
Les tempratures efficaces sont comprises entre 1 et 10 C et la dure de la priode
de froid va de quelques jours quelques semaines. Il faut, par exemple, de 20
50 jours une temprature de 1 3 C pour les crales. Laction est cumulative :
chez le bl, le froid peut tre donn en plusieurs priodes. Cest la quantit totale de
jours froids qui compte. Le stade pendant lequel la plante est sensible diffre suivant
les cas. Pour les crales, la graine imbibe est vernalisable, de mme que la graine
immature. Enfin, quand un mristme a t vernalis, tous les bourgeons qui en sont
issus le seront aussi. La proprit, une fois acquise par les cellules, se transmet leurs
descendantes.

8.1.6 La rsistance des plantes la scheresse


Ce sont les feuilles qui sont le plus sensibles la chaleur et la scheresse. Si le sol
est trop sec, la plante est incapable dextraire de leau du sol, bien quelle en perde
au niveau des feuilles.
Des modalits trs diverses leur permettent de rsister efficacement.

Dunod La photocopie non autorise est un dlit.

a) Les feuilles coriaces


Chez les sclrophytes (de skleros = dur, sec) les feuilles sont coriaces, dures et mme
piquantes et ne se fltrissent pas. La cuticule est paisse, les pidermes sclrifis. Les
stomates sont le plus souvent localiss sur une seule face et des dispositifs divers les
protgent, empchant de ce fait les sorties deau. La face stomatique est couverte
de poils et les stomates sont groups dans des cryptes ou des sillons situs la face
interne (fig. 8.4).
Les feuilles des gramines senroulent ds que la teneur en eau de la feuille
sabaisse en dessous dun minimum caractristique de lespce : 85 % chez le nard
(poil de bouc), Nardus stricta L. Poaceae, 50 % chez le Deschampsia flexuosa (L.)
Trin. Poaceae.
Nard et Deschampsia
Le nard est la composante principale des prairies alpines au-dessus de 2 000 mtres
daltitude au-del de la limite de la fort. Compos de feuilles troites et dures, il
ne prsente aucune apptence pour le btail. La canche exueuse (Deschampsia
exuosa) est une gramine frquente dans les clairires et les sous-bois de nos forts
septentrionales.
219

9782100544141-Laberche.fm Page 220 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

1 mm
crypte

poils

stomate
parenchyme
faisceau
criblovasculaire
collenchyme
piderme
interne

cellules bulliformes
cuticule paisse
piderme externe

Figure 8.4 Schma de la coupe transversale de la feuille doyat


(Ammophila arenaria Link.) montrant la structure du limbe.
Lpiderme externe est dpourvu de stomates et est protg par une paisse cuticule.
Lpiderme interne est couvert de nombreux poils de grande taille et dune ne
cuticule Les stomates sont localiss sur les crtes et les cellules bulliformes apparaissent au fond des sillons. Celles-ci assurent lenroulement du limbe quand elles
se dshydratent.

b) La diminution de la taille des feuilles


Chez beaucoup de plantes devant supporter de fortes tempratures et des scheresses
leves, on constate une diminution de la taille des feuilles. Il sagit de laphyllie qui
peut prendre diffrentes formes. La diminution de la surface, permet une rduction
des surfaces vaporantes, donc une consommation plus faible en eau. Les feuilles
peuvent tre soudes la tige, cailleuses voire mme phmres comme chez certains
gents (Cytisus purgans L. Fabaceae).

c) La succulence
Chez de nombreux vgtaux les organes peuvent accumuler des quantits deau
considrables dans des organes hypertrophis. Il sagit de la succulence qui peut prendre
diffrents aspects.
220

9782100544141-Laberche.fm Page 221 Jeudi, 4. fvrier 2010 3:47 15

8.2 Les plantes dans leur environnement daphique

La succulence souterraine des bulbes. La quantit deau stocke dans les feuilles
charnues atteint des valeurs disproportionnes par rapport au poids de la partie
arienne de la plante. Lalimentation hydrique de cette dernire est alors garantie
mme pendant des priodes trs prolonges de scheresse. Cest par exemple, chez
Pachypodium densiflorum Baker, Apocynaceae, un organe de stockage situ au
niveau du sol compose de la base de la tige et dune racine enfle. On parle alors
dun caudex.
La succulence foliaire. Les feuilles succulentes limbe aplati contiennent un parenchyme aquifre trs dvelopp. Lexemple le plus connu est la joubarbe des toits,
Sempervivum tectorum L. Crassulaceae. Elle tait volontairement place par
lhomme au fate des toits en chaume pour maintenir largile charge dassurer
ltanchit. Bien sr dautres exemples viennent lesprit comme les agaves, les
sdums, etc. Les cactes sont aussi des plantes succulentes, mais ce sont les tiges
qui shypertrophient.

8.2 LES

PLANTES DANS LEUR ENVIRONNEMENT


DAPHIQUE

Les plantes subissent les influences des sols (environnement daphique), Une accumulation de sels peut tre rdhibitoire pour la survie des plantes. Les actions des ions azots,
du calcium et des sels (comme le chlorure de sodium) seront successivement tudies.

8.2.1 Les plantes nitrophiles

Dunod La photocopie non autorise est un dlit.

Elles occupent des sols dans lesquels les nitrates sont abondants. Ces espces sont
dites rudrales (du latin rudera : dcombres). Elles se trouvent sur les dblais et les
remblais, dans les terrains vagues et de plus en plus dans les cultures sarcles. Parmi
les plantes nitrophiles les Chenopodiaceae sont trs reprsentes (Atriplex) de mme
que les Urticaceae (Orties), les Polygonaceae (Rumex), ainsi que des Asteraceae
(chardons, matricaire). Lhomme assure souvent leur propagation dune manire
bien involontaire lors de ses activits pastorales. Cest le cas de laconit (Aconitum
napellus Rchb. Ranunculaceae), que lon trouve dans les pturages alpins dans les
lieux frquents par les bovins.

8.2.2 Les plantes calcicoles et les plantes calcifuges


La simple observation sur le terrain montre que la flore nest pas identique sur des
terrains installs sur des sols calciques et des sols siliceux. En fort, le pin dAlep
(Pinus halepensis Willd Pinaceae) se trouve sur sol calcaire. Il est calcicole. De son
ct, le chtaignier Castanea sativa Mill. Fagaceae, pousse sur sol siliceux. Cest
une plante calcifuge. Manifestement les plantes calcicoles poussent sur des terrains
contenant du calcium et a fortiori les sols calcaires tandis que les calcifuges prfrent
les sols siliceux. En fait, beaucoup de plantes calcicoles sont indiffrentes au calcium.
Si elles stablissent en ces lieux, cest quen ralit, elles recherchent la chaleur des
sols calcaires. La plupart des espces calcifuges sont des plantes qui absorbent trop
221

9782100544141-Laberche.fm Page 222 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

facilement le calcium. Ce cation agit comme un poison. Elles sont intoxiques et


elles en meurent.
Les espces calcifuges se rfugient sur les terrains siliceux o elles ne trouvent que
peu de calcium. Cest le cas des bruyres (Ericaceae), mais aussi du sarothamne (un
gent), Sarothamnus scoparius (L.) Koch, appartenant aux Fabaceae ou de la digitale,
Digitalis purpurea L., de la famille des Scrofulariaceae. Elles sont souvent qualifies
aussi de silicicoles, mais il ne faut pas en conclure quelles ont un besoin particulier
de silice.
Le calcium a une autre consquence sur la chimie des sols, il modifie le pH.
Grossirement, on peut dire que les sols calciques sont basiques et les sols siliceux
acides. Les espces calcicoles redoutent lacidit du sol. Au contraire, les calcifuges
sont acidophiles. Parmi les espces acidophiles, certaines vivent sur des sols trs acides
(pH de 3 5). On peut trouver des sphaignes, des lycopodes, des fougres comme
losmonde royale (Osmunda regalis L., Osmundaceae), ou des forts de rsineux
avec le pin sylvestre (Pinus silvestris L.) et le pin maritime (Pinus pinaster Soland L.
Pinaceae). Dautres plantes se dveloppent dans des sols pH entre 5 et 6, comme
la fougre aigle, Pteridium aquilinum (L.) Kufin Hypolepidaceae ou le Teucrium
scorodonia, L. Lamiaceae. Au contraire le mouron (Anagallis arvensis L. Primulaceae),
le pas dne (Tussilago farfara L.), ou le pissenlit (Taraxacum officinale Weber
Asteraceae) sont basophiles (pH > 7).

8.2.3 Les plantes halophiles


Les halophytes (du grec halos = sel) sont des vgtaux qui se dveloppent en prsence
de sels. Toutes les plantes vivent dans un milieu contenant des sels varis puisquelles
se nourrissent dions minraux prlevs dans leau du sol, mais, pour les halophytes,
la quantit de sels solubles est anormalement grande.
Les anions sont essentiellement des chlorures, des sulfates et des bicarbonates.
Les deux premiers sont naturellement toxiques pour les plantes ds quils atteignent
des concentrations leves. Cest pourquoi dans les solutions nutritives utilises pour
les cultures hydroponiques (sans sol, mais sur film deau nutritif) on doit rester en
dessous de 2 milliquivalents par litre de chlorure et de 5 milliquivalents par litre de
sulfate. Les cations les plus reprsents sont le sodium, le calcium et le magnsium.
Les halophytes se rencontrent dabord en bordure des rivages maritimes, o ils
sont soumis plus particulirement laction du chlorure de sodium (sur 35 g de sels
dissous par litre deau de mer, il y a environ 30 g de NaCl), mais aussi lintrieur
des terres, autour des dpressions sales chlorure de sodium ou sulfate de calcium
(rivages des Chotts dAfrique du Nord), ainsi qu proximit des gisements de sel
gemme ou des sources sales comme en Lorraine. Trs peu de Bryophytes et de
Ptridophytes supportent le chlorure de sodium et vivent en bord de mer. Parmi les
Angiospermes, la famille des Chenopodiaceae est particulirement bien reprsente.
On trouve la Betterave maritime, Beta maritima L., qui est la souche des varits cultives de betteraves. On rencontre aussi des Brassicaceae comme le Brassica oleracea
(L.) DC des falaises de craie et qui, lui aussi, est la souche des nombreux choux cultivs.
222

9782100544141-Laberche.fm Page 223 Jeudi, 4. fvrier 2010 3:47 15

8.3 Les plantes et les organismes qui les entourent

Les conditions de milieu extrmes sont une source de diversit


Il est intressant de constater combien les bords de mer, ainsi que les prairies alpines,
qui prsentent des conditions cologiques particulirement rudes et difciles sont
le lieu privilgi dobservation des botanistes pour suivre des phnomnes de
microvolution.

8.3 LES PLANTES ET LES ORGANISMES QUI LES ENTOURENT


Parmi les relations qui peuvent exister entre plusieurs vgtaux, la plus connue est
certainement celle des lichens. Un champignon se dveloppe avec une algue dispose
entre ses hyphes. Contrairement ce que bien souvent on peut penser, les relations
entre les deux individus ne sont pas identiques. Les algues sont parasites par le
champignon. Le parasitisme est incontestablement une relation entre un vgtal et
son milieu environnant puisque pour se nourrir et se dvelopper, le parasite dtourne
son profit les produits du mtabolisme de son hte ; 85 % des parasites sont des
Champignons. Les relations entre plantes ne sont pas toujours aussi svres. Dans les
micorhizes et la symbiose, il y aura changes pratiquement parit entre les individus.
Changeant dchelle, il est possible aussi de voir que les plantes vivent dans la
biosphre. Elles participent aux grands quilibres que lhomme par ses activits modifie
bien souvent. Ce sont ces aspects qui seront abords dans les paragraphes qui suivent.

8.3.1 Le parasitisme
Le parasitisme est une relation entre un parasite et un hte. Ce dernier est exploit
par le premier. Les parasites sont trs largement rpandus parmi les Protocaryotes et les
Thallophytes. De trs nombreuses bactries et des champignons attaquent les vgtaux
(comme les animaux). En revanche, le parasitisme est inconnu chez les Bryophytes,
les Ptridophytes et les Monocotyldones. Les Gymnospermes nen comptent quune
espce. Seules quelques familles de Dicotyldones sont concernes. Quant leurs
htes, ce sont de prfrence des Spermaphytes, quelquefois des Ptridophytes.
Deux grandes catgories de parasites se distinguent parmi les Dicotyldones.

Dunod La photocopie non autorise est un dlit.

a) Les hmiparasites
Ce sont des organismes chlorophylliens, donc encore capables dassurer la photosynthse. Prlevant au niveau du xylme de leur hte des substances nutritives, ils se
comportent, ce sujet, comme les organes ariens des vgtaux autotrophes. Ils rduisent lazote nitrique, et utilisent lazote organique emprunt la sve de leur hte.
Lexemple le plus connu dun hmiparasite est celui du gui (Viscum album L.,
Loranthaceae).
Quand il germe, sort de la graine un hypocotyle chlorophyllien dpourvu de racine,
mais dont lextrmit basale est termine par un renflement aplati. Dou dun phototropisme ngatif, cet hypocotyle ne tarde pas sincurver. Il sapplique alors, sur
lcorce de son hte. Son bouton terminal stale en un disque qui produit en son
milieu une racine. Elle perfore lcorce de la tige-hte. Au sommet de lhypocotyle
223

9782100544141-Laberche.fm Page 224 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

un bourgeon comprenant les deux premires feuilles se forme et la tige arienne se


dveloppe et se ramifie. Pendant ce temps les racines secondaires du gui sinsinuent
sous lcorce de lhte, donc au contact du xylme. Elles mettent de nombreux
suoirs (ce ne sont pas des racines). Ils assurent une fixation trs solide du parasite et
dtournent son profit une quantit de sve brute dautant plus importante que leur
grand nombre permet une large surface de contact entre le gui et son hte (fig. 8.5)

feuille

Figure 8.5 Les suoirs du gui,

tige

observs sur une coupe


longitudinale de tige darbre.

cotyldon
tige de lhte
suoir
1 cm

b) Les holoparasites
Ce sont des organismes non chlorophylliens incapables de raliser la photosynthse.
Ils oprent leurs prlvements non seulement au niveau du xylme (eau + lments
minraux), mais aussi dans du phlome (sve labore). Chez la cuscute odorante,
Cuscuta suaveolens L. Cuscutaceae (parasite la luzerne), le suoir primaire est un
axe travers par des lments conducteurs. Les cellules terminales de ce suoir
tablissent des contacts avec le xylme de lhte en sappliquant contre les tubes
cribls, sans jamais pourtant y pntrer. Quant lhte, il met en place des trachides
nouvelles qui rejoignent celles du parasite. Ainsi le parasite utilise une partie des
substances que son hte prlve dans le milieu extrieur, ainsi que les matriaux que
celui-ci labore. Pour arriver ses fins, il libre des substances (enzymes, toxines)
responsables de ncroses tissulaires ce qui produit une intoxication plus au moins
gnralise de lhte. Ce dernier ragit cependant par une prolifration cellulaire
localise pouvant aboutir des ncroses, des tumeurs ou des dformations de rameaux
(les balais de sorcire).
Dune manire gnrale, il existe un degr de spcificit entre le parasite et lhte. Le
cas du Viscum album est typique. Il parasite au moins 120 espces darbres, feuillus
ou conifres. Il est donc dit polyphage. En ralit, il comprend diffrentes races
physiologiques, mieux dfinies par la nature de leur hte que par des caractres morphologiques. On reconnat actuellement : le gui des feuillus (var. platyspermum Keller),
le gui du Sapin (var. abietis Beck), le gui du Pin (var. pini Auct.).

224

9782100544141-Laberche.fm Page 225 Jeudi, 4. fvrier 2010 3:47 15

8.3 Les plantes et les organismes qui les entourent

Dautres parasites sont oligophages. Ils sont spcfiques dune plante (Orobanche
concolor Duby sur Scabiosa columbaria L. Dipsacaceae) ou plus rarement de
quelques espces (Orobanche gracilis Smith sur les Fabaceae).

8.3.2 Les symbioses dans la rhizosphre


La symbiose est une relation au profit mutuel des deux participants. Les relations
entre les Cormophytes et les micro-organismes qui se dveloppent dans le voisinage
de leurs racines constituent un bon exemple de symbiose.
En effet, les racines des Cormophytes modifient les caractristiques physicochimiques du sol, comme lhumidit et le pH. Elles mettent aussi du gaz carbonique
et excrtent des substances organiques apportes par la sve labore aprs synthse
aussi bien dans les feuilles que dans les racines (acides amins, acides organiques
aliphatiques et aromatiques, sucres, vitamines, enzymes, nuclotides, etc). Celles
qui ne sont pas toxiques servent daliments aux micro-organismes prsents dans le
sol. Gnralement leur croissance est stimule (parfois elle peut tre inhibe). Do
labondance de ceux-ci dans la sphre daction des racines (rhizosphre). Il stablit
distance, entre racines et les micro-organismes de la rhizosphre, des quilibres
subtils, car les Bactries et Champignons du sol modifient aussi les conditions
dhabitat des racines. La microflore de la rhizosphre synthtise, quant elle, des
molcules qui favorisent lalimentation minrale des plantes, grce des molcules
ayant des proprits chlatantes.

Dunod La photocopie non autorise est un dlit.

8.3.3 Les mycorhizes


Les mycorhizes sont des associations, prenant des formes variables, entre des
champignons et les Cormophytes. Les hyphes peuvent soit entourer les radicelles
(mycorhizes ectotrophes) et former de vritables manchons, soit carrment pntrer
entre les cellules de la racine (mycorhizes endotrophes). Comme pour la rhizosphre
il est certain que les champignons, qui par nature sont htrotrophes, profitent des
molcules organiques exsudes par la plante. Mais les relations plantes-champignons
sont toutes autres que celles dcrites dans la rhizosphre. La possession de mycorhizes est souvent un facteur de russite parfois mme la condition sine qua non de
la germination, de la croissance, voire de la floraison du vgtal suprieur. En effet :
Le feutrage myclien des micorhizes contribue la stabilit du pH autour des
racines, ce qui favorise lassimilation des ions minraux par la plante. De mme il
peut solubiliser les phosphates tricalciques insolubles et assurer ainsi une meilleure
alimentation phosphate.
En remplaant la zone pilifre, les micorhizes contribuent augmenter la surface
dabsorption do une meilleure absorption hydrique.
La stimulation de la croissance est un phnomne gnral. Ainsi grce leurs
mycorhizes, trois mois aprs leur germination, des plantules de pins sont deux
trois fois plus grandes que celles qui nen possdent pas.
Chez les orchides, la prsence du champignon est obligatoire pour assurer la
germination.
225

9782100544141-Laberche.fm Page 226 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Dsertification et reforestation
Pour enrayer le phnomne majeur de la dsertication, qui a t chiffr prs de
13 millions de km2 en lespace dun demi-sicle (soit 23 fois la supercie de la France
mtropolitaine !), par les chercheurs du World Soil Information (fondation indpendante nerlandaise travaillant en association avec luniversit de Wageningen), la
reforestation sest impose comme lune des solutions envisager. Ce fut le barrage
vert au Sahara dans lAlgrie du Prsident Boumdienne dans les annes 1970 et
cest le cas du programme chinois qui a pour ambition de reboiser un quart de sa
surface de 2005 2020 en rhabilitant ainsi son territoire dtruit pour des raisons
conomiques. Pour faciliter la reconstitution de ces nouveaux cosystmes forestiers,
souvent les sylviculteurs locaux choisissent des essences darbres exotiques
croissance rapide, parmi lesquelles gurent leucalyptus (Eucalyptus camaldulensis
LHr, Myrtaceae) ou lacacia australien (Acacia holoserica Miller, Mimosaceae).
Malheureusement ces plantations ont souvent des effets ngatifs sur les sols car,
dune part, les arbres absorbent jusqu la moiti des prcipitations annuelles au
sein mme de la nappe phratique, provoquant non seulement un appauvrissement
hydrologique, mais surtout une augmentation de la salinit du sol quand le soussol prsente une couche de gypse comme cest trs souvent le cas en Afrique du
Nord, et dautre part, comme lont soulign les chercheurs de lInstitut de recherche
pour le dveloppement (IRD) ces reboisements ne tiennent pas compte de la microore des sols. Les champignons mycorhiziens ne sont pas adapts ces arbres
imports.
Ceci explique peut-tre, mais seulement en partie, les checs souvent frquents
de tels programmes de reboisement, trop htivement lancs.

8.3.4 La fixation symbiotique de lazote


Mme si dans le langage courant, on dit que les plantes se nourrissent dazote, (mais
aussi de phosphore et de potasse) jamais aucune plante na pu vivre partir dazote
atmosphrique. Ce sont les ions nitrates et nitriques qui sont absorbs par les plantes.
Cependant des Procaryotes, quils soient libres ou symbiotiques, sont capables de
fixer lazote atmosphrique. Dans la quasi-totalit des cas, cette association se ralise
au niveau des racines des Cormophytes.
Le cas le plus connu concerne la fixation de lazote dans les nodosits des Fabaceae
par des Rhizobium1 (Protobacteriaceae). Ces bactries sont responsables de lapparition des nodosits mais peuvent vivre libres dans la rhizosphre, particulirement au
voisinage des racines des trfles, des luzernes et autres Fabaceae (de 106 108 cellules
par g de terre). Leur pntration se fait en quelques heures par les poils absorbants
ou par des blessures. Les corps bactriens, (bactrodes) en forme de btonnets,
constituent un cordon qui envahit les cellules du parenchyme cortical.
Une fois lintrieur des cellules, ils y prolifrent, tandis que ces cellules parenchymateuses shypertrophient et se divisent, entranant la formation dune nodosit
(fig. 8.6) qui croit en mme temps quelle se charge dune hmoglobine particulire,
la leghmoglobine.
1. Sinorhizobium chez la luzerne.
226

9782100544141-Laberche.fm Page 227 Jeudi, 4. fvrier 2010 3:47 15

8.3 Les plantes et les organismes qui les entourent

F
D
A
M
0,5 mm

cylindre central
de la racine Fabaceae

nodule

Figure 8.6 Schma dune coupe transversale dun nodule,


montrant les diffrentes zones.
M, zone mrisitmatique ; A, zone daccroissement cellulaire et dinvasion ; C, cortex
nodulaire ; F, zone bactrienne xatrice ; D, zone de dgnrescence. (La forme
des cellules de chaque zone est seulement esquisse.)

Dunod La photocopie non autorise est un dlit.

Des faisceaux conducteurs se diffrencient dans la nodosit et se raccordent ceux


de la racine. ce stade, chaque nodosit a la capacit de fixer lazote atmosphrique,
contrairement chacun des deux organismes pris sparment (fig. 8.7).

Figure 8.7 Rduction de lazote dans les nodules.


Chane de transfert des lectrons au cours de la raction de nitrognation.

Ensemble, ils ont acquis une fonction que seuls ils ne possdaient pas. La dure de
vie de ces nodosits est assez limite. Curieusement la floraison, les bactriodes se
lysent et la leghmoglobine se dgrade en biliprotines, ce qui provoque le verdissement
des nodosits qui dgnrent.
227

9782100544141-Laberche.fm Page 228 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Lors du fonctionnement des nodules, on constate une vritable collaboration entre


les deux partenaires. Le Rhizobium utilise la leghmoglobine que les cellules de la
Fabaceae a synthtis sous son influence. partir des acides amins synthtiss
par les bactries, les cellules de la Cormophyte achvent la synthse de protines.
Celles-ci migreront vers les organes ariens qui ont fourni pralablement les composs
glucidiques. Durant cette fixation symbiotique de lazote, il est possible de dire que
la Fabaceae utilise trs indirectement lazote atmosphrique, mme si elle absorbe
prfrentiellement de lazote minral. En prsence de celui-ci, lors dun apport dengrais
par exemple, lactivit des nodules cesse.
Nimporte quel Rhizobium ne peut pas sassocier avec nimporte quelle Fabaceae.
chaque espce correspond une race (ou une espce de Rhizobium). Ainsi, le
Rhizobium trifolii du Trifolium repens L. donne des nodosits actives avec le Trifolium
pratense L. mais non fonctionnelles avec le Trifolium glomeratum L.
Mme si lexemple souvent cit de fixation symbiotique de lazote est celui
prcdemment dcrit, il faut savoir que prs de 200 espces environ dAngiospermes
portent des nodules au niveau de leurs racines. Ce sont toujours des arbres et des
arbustes appartenant seulement sept familles : les Casuarinaceae, les Betulaceae
(les aulnes), les Myricaceae, les Coriariaceae, les Eleagnaceae, les Rhamnaceae et les
Rosaceae. Chez les Gymnospermes, on ne trouve que trois familles : les Araucariaceae
(lAraucaria ou arbre aux singes), les Podocarpaceae et les Taxaceae (les ifs).
La nature de lagent responsable de la fixation de lazote, nest pas toujours connue
avec prcision (Bactries ou Champignons). Nanmoins ces fixations sont loin dtre
ngligeables et elles peuvent avoir une grande importance pour enrichir les sols en
ions azots (cas des aulnes).

8.3.5 Les dfenses contre les organismes pathognes


chaque instant les plantes sont en contact avec des champignons, des bactries, des
virus ou des nmatodes qui vont les agresser. Dune manire gnrale, la plupart des
espces vgtales sont protges contre ces agresseurs, car ceux-ci sont incapables
de franchir les barrires protectrices que constituent la cuticule pidermique, ainsi
que les parois pecto-cellulosiques. Toutefois, certains agresseurs contournent ces
barrires et pntrent dans le vgtal soit par les lenticelles et les stomates, soit plus
frquemment par les blessures. Ne pouvant se dplacer et fuir ces prdateurs, les
plantes mettent en uvre des dfenses tout fait originales qui sont progressivement
mieux connues, grce aux progrs raliss par la biologie molculaire. Cependant
toutes les plantes ne peuvent se protger et les dgts sont considrables : ne dit-on
point quenviron 20 % des rcoltes mondiales sont perdues par ces attaques.
Les mcanismes de dfense sont de trois types (fig. 8.8).
1. La reconnaissance de lagent pathogne.
La plante reconnat son agresseur grce une molcule, un liciteur, que celui-ci
met. Ce sont souvent des oligo- ou polysaccharides, des glycoprotines ou des
acides gras et les gnes qui sont lorigine de leur synthse sont nomms gnes
davirulence. Ces liciteurs ne sont pas des molcules scrtes spcialement par
228

9782100544141-Laberche.fm Page 229 Jeudi, 4. fvrier 2010 3:47 15

8.3 Les plantes et les organismes qui les entourent

K+ + Cl
liciteur de lagent
pathogne non reconnu

Ca++

Signaux
intercellulaires
b

Renforcement
de la paroi
O2

Apoptose

Signaux
intracellulaires
(MAPKs)

Phytoalexines

Protines
de dfense

Vacuole

Paroi
Signaux
intercellulaires

Plasmalemme
Noyau
REG

liciteur de lagent
pathogne reconnu

Activation de gnes
de rsistance

Figure 8.8 Ractions un agent pathogne.

Dunod La photocopie non autorise est un dlit.

a: liciteur reconnu, b: raction dhypersensibilit, c: activation de moyens de dfense.

lagent pathogne, mais des produits de son mtabolisme indispensables son


dveloppement. Deux cas peuvent se prsenter.
Soit la plante reconnat avec prcision cet liciteur et elle possde des gnes
susceptibles de neutraliser lenvahisseur ; la rsistance est gntique et ces gnes
se transmettent selon les lois de Mendel. Dcouverts dans les annes 1940,
chez la tomate, ces gnes de rsistances, trs spcifiques, sont une trentaine et
protgent les plantes contre des agents pathognes de nature varie (virus,
bactries, champignons, nmatodes). Trois catgories de gnes de rsistances
ont t reconnues par les gnticiens : les gnes de rsistances rcessifs, qui
sont des gnes muts codant pour des facteurs de sensibilit devenus non fonctionnels, des gnes de rsistance dominants codant pour un inhibiteur dune
fonction du pathogne et les gnes de rsistance non spcifiques dclenchant
des mcanismes de dfense. La deuxime catgorie a toujours intress les
slectionneurs qui avec force croisements essaient de les introduire dans des
plantes horticoles et marachres sensibles, afin de leur faire acqurir une rsistance agronomiquement (donc conomiquement) intressante (tabl. 8.1).
La majorit des gnes de rsistance code des protines riches en leucine et ce
sont les squences dADN non codant qui assurent la spcificit de la reconnaissance entre lagent pathogne et la plante attaque.
229

9782100544141-Laberche.fm Page 230 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Tableau 8.1 Quelques plantes slectionnes par les gnticiens


pour devenir rsistantes des pathognes.
Pathogne
Plante
Nom

Type

Nom vernaculaire

Lin

Melampsora lini

Champignon

Rouille du lin

Tomate

Fusarium oxysporum

Champignon

Fusariose

Poivron

Tomato mosac virus (ToMV)

Virus

Mosaque

Laitue

Bremia lactuca

Champignon

Meunier

Beaucoup plus frquemment lliciteur ne correspond pas un gne de rsistance spcifique. La plante met alors en place un systme de dfense naturelle
plusieurs facettes dont la premire manifestation est une raction dhypersensibilit. Celle-ci se manifeste par une tache ncrotique localise sur le site
de pntration du pathogne. Les premires cellules infectes produisent des
formes trs ractives de loxygne comme lanion O2 et du peroxyde dhydrogne H2O2 au moyen dune enzyme, la NADPH-oxydase, localise dans le
plasmalemme. Ces formes ractives de loxygne peuvent tre directement toxiques pour lagresseur et jouer un rle dantimicrobien. Elles dclenchent aussi
la production de molcules qui constituent des signaux dalerte vers les autres
cellules de lorganisme pour les prparer ragir efficacement contre lagresseur.
Enfin, elles renforcent la paroi vgtale en polymrisant ses protines mais
dun autre cot en peroxydant les lipides du plasmalemme, elles les dtruisent
ce qui entrane la mort de la cellule. Cette mort programme est une vritable
apoptose vgtale visant circonscrire linvasion du pathogne et de retarder
sa propagation en attendant que les autres mcanismes de dfense, notamment
la production dantibiotiques aient eu le temps de se mettre en place dans les
cellules voisines.
2. Lactivation des moyens de dfense.
Les liciteurs agissent directement au niveau de la membrane plasmique et activent
des protines transmembranaires que faute de mieux, les physiologistes nomment
les protines G. Elles assurent la transmission du message entre lextrieur de la
cellule et lintrieur. Cette activation se manifeste par une entre massive dions
calcium et une sortie tout aussi importante dions potassium et chlorure. En 2000,
Hirt et Scheel1 ont montr que ce calcium activait dans le cytoplasme des Mitogen
Activited Protein Kinases (MAPKs) et particulirement en premier la MAPK
kinase-kinase. Par un phnomne de cascade, celle-ci active la MAPK kinase par
phosphorylation de rsidus de thronine et de srine, qui elle-mme active son
tour la MAPK par phosphorylation de rsidus de tyrosine et de thronine. Cette
dernire MAPK agit comme facteur de transcription permettant la production
1. HIRT H. et SCHEEL D., Receptor mediated MAPkinase Activation in plant Defense , Results
and Problems in Cell Differenciation, 2000, 27, 11-27.
230

9782100544141-Laberche.fm Page 231 Jeudi, 4. fvrier 2010 3:47 15

8.4 Les plantes dans la biosphre

dantibiotiques, les phytoalexines, ou de protines de dfense Pr (Pr pour


Pathogenesis related) capables de dtruire ou de matriser le prdateur.
Phytoalexines et protines de dfense
Les phytoalexines sont des mtabolites secondaires qui, absents normalement
dans la cellules, saccumulent au voisinage des sites dinfection en prsentant de
trs fortes activits antimicrobiennes. Leur nature chimique est trs diversie.
Ainsi les Fabaceae (ex Lgumineuses) produisent des isoavanodes, les Asteraceae
(ex Composes) des polyactylnes, les Solanaceae (comme la pomme de terre) et
les Malvaceae (la mauve) des terpnodes.
Les protines de dfense Pr, sont connues depuis 1970. Elles sont trs stables en
milieu acide et certaines ont une activit enzymatique identique la b-1,3-glucanase,
ou la chitinase, qui dgradent la paroi des champignons. Dautres protines Pr
peuvent inhiber des protases ou des polygalacturonases microbiennes, au pouvoir
pathogne important. Elles dsarment ainsi les agresseurs.

3. La signalisation intercellulaire.
Trois types de molcules semblent agir dans la signalisation intercellulaire pour
activer les ractions de dfense dans les cellules voisines : lacide salicylique,
lthylne et lacide jasmonique. Le premier joue un rle cl de molcule signal.
Il dclenche lexpression des protines de dfense Pr et se dplace de cellule cellule
par les plasmodesmes. Le rle de lthylne est plus flou. Beaucoup moins ubiquiste
que lacide salicylique, il ne dclenche les ractions de dfense quen prsence de
pathognes prcis mais diffusant partout dans la plante il jouerait un rle de signal
endogne trs mobile. Quant lacide jasmonique, molcule prsente dans bien des
cas de stress chez le vgtal, quils soient hydriques ou thermiques, il agit en synergie
avec lacide salicylique pour dclencher la synthse des protines de dfense.

Dunod La photocopie non autorise est un dlit.

Des dfenses varies


Chez les arbres blesss et/ou attaqus par des organismes pathognes, les ractions
de dfense visent un isolement de la zone contamine ou blesse par la cration
de barrires cellulaires, produites par les cambiums et constitues par de petites
cellules aux parois trs paisses rsistant mieux aux micro-organismes. De plus,
les vaisseaux conducteurs se bouchent pour viter la propagation du pathogne,
tandis que le mtabolisme des cellules du bois lentour se modie. De nouvelles
molcules aux proprits microbiennes apparaissent. Il sagit essentiellement des
acides gallique et tannique ainsi que de nombreux phnols.

8.4 LES

PLANTES DANS LA BIOSPHRE

Si aprs ltude des relations entre deux organismes notre intrt se tourne vers la
biosphre en gnral, il est facile de voir quil existe des communauts dindividus
(plus ou moins grandes) groupant des vgtaux et des animaux qui vivent en quilibre
avec leur milieu environnant. De trs nombreux changes nutritifs stablissent entre
ces organismes. Considre sur le plan des changes de matire et dnergie, la
communaut constitue un cosystme. Dans celui-ci, on trouve des producteurs (vgtaux), des consommateurs (animaux) mais aussi des dcomposeurs (champignons et
231

9782100544141-Laberche.fm Page 232 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

bactries) (fig. 8.9). Ces derniers dgradent les molcules complexes de la matire
organique par minralisation et librent des lments simples qui seront repris et
remtaboliss ultrieurement par les vgtaux chlorophylliens. Pour que le cycle des
lments fonctionne, il est donc indispensable que la minralisation de la matire
organique seffectue. Les dcomposeurs sont tout aussi importants et utiles que les
producteurs.
CONSOMMATEURS
Animaux
Minralisation
PRODUCTEURS
vgtaux chlorophylliens

Synthses de molcules
organiques

DECOMPOSEURS
Champignons , Bactries

Figure 8.9 Schma des chanes trophiques dans un cosystme.

Les vgtaux tiennent une part importante dans ce flux de matires. Certes les
Cormophytes sont des producteurs primaires la surface des continents, mais les
Thallophytes tiennent un double rle. Comme producteurs primaires dabord (avec, en
particulier, le phytoplancton marin), mais aussi comme dcomposeurs (champignons
du sol). Les bactries et les champignons effectuent le recyclage des lments carbons
et azots partir des dchets (excrments, dbris vgtaux) issus de tous les tres
vivants, animaux ou vgtaux. Leur quantit et leur diversit atteignent dans le sol des
valeurs souvent mconnues. Souchon en 1970 a trouv, ainsi, par hectare de prairie,
la prsence denviron 17 quintaux de dcomposeurs dont 67 % de champignons, 20 %
de protozoaires, 6 % de vers et 2 % de bactries. Les valeurs sont encore plus leves
dans un sol forestier, o la production de biomasse vgtale est plus importante quen
milieu unistrate, comme la prairie.
Les relations entre les diffrents composants de lcosystme sont du domaine de
lcologie. Dans le cadre de cet ouvrage, seules les interfaces cologie/biologie vgtale seront abordes. Il sagira : de la biomasse vgtale, des dpendances trophiques,
de lincidence des vgtaux sur trois cycles cochimiques.

8.4.1 La biomasse et la productivit primaire


La biomasse est la masse de matriel vgtal exprime par unit de surface. Si cette
notion est relativement facile apprhender pour des petits cosystmes bien dfinis
(un champ de bl par exemple), elle est beaucoup plus difficile connatre pour de
grands ensembles comme une fort, surtout si lon veut sparer les diffrents
composants que sont les producteurs, les consommateurs et les dcomposeurs. Le
tableau 8.2 donne quelques valeurs de biomasses vgtales totales et de productivit
(production par unit de surface et par an) gnralement admises.
232

9782100544141-Laberche.fm Page 233 Jeudi, 4. fvrier 2010 3:47 15

8.4 Les plantes dans la biosphre

Tableau8.2 Phytomasse et productivit primaire nette dans la biosphre


(simplifi daprs Whitacker et Likens).

Surface
106 km2

Phytomasse
kg par m2

Phytomasse
mondiale
106 tonnes

Productivit
primaire nette
t/ha/an

Productivit
mondiale nette
108 tonnes

Fort tropicale

20

40

800

20

40

Fort tempre

18

30

540

13

23,4

Fort borale

12

20

240

9,6

Prairies tempres

1,5

12

Toundras et alpages

0,6

1,4

1,1

14

6,5

9,1

Terres cultives
Lacs et cours deau

14
2

CONTINENTS

148

OCANS

361

BIOSPHRE

510

1
0,02
12,5
0,008

0,04
1852
2,8
1855

7,3

108

1,55

55
164

Phytomasses et productivits sont exprimes en masses de matires sches. Toutes les composantes de la
biosphre nont pas t reproduites.

Dunod La photocopie non autorise est un dlit.

Il est facile de remarquer limportance des formations forestires dans la phytomasse totale. Ceci tient au fait que les arbres accumulent une quantit importante de
matire organique nettement plus grande que les plantes herbaces, pour une production
annuelle assez peu diffrente. La productivit primaire nette prsente dans ce tableau
correspond au produit de la photosynthse totale (productivit brute) diminu des
produits dgrads dans la respiration de maintenance de tous les organes existants,
mais aussi partiellement dtruits par les consommateurs primaires. Cette productivit
nette mondiale est relativement faible compare lnergie incidente dorigine solaire
dont peuvent disposer les plantes Elles nen fixent quune trs faible partie, environ
1 % pour la vgtation terrestre.

8.4.2 Chanes alimentaires et pyramides cologiques


Grce la photosynthse, les plantes vertes peuvent se nourrir elles-mmes. Elles sont
autotrophes, par opposition aux htrotrophes qui puisent leur nergie dans des
molcules organiques. Des dpendances nutritives (ou trophiques) relient les tres
vivants et un flux dnergie existe entre eux. Les plantes chlorophylliennes sont
lorigine de ces chanes. Ce sont les producteurs primaires. Une partie est consomme
pour produire une nouvelle biomasse qui, elle-mme, sera consomme par dautres
consommateurs et ainsi de suite. Il est possible ainsi dtablir des chanes trophiques
(fig. 8.10).
233

9782100544141-Laberche.fm Page 234 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Producteurs

Consommateur
primaire

Herbe
Pomme de terre
Pomme de terre
Pomme de terre
Phytoplancton

Vache
Homme
Porc
Doryphore
Carpe

Consommateur
secondaire

Consommateur
tertiaire

Homme
Homme
Perdrix
Brochet

Homme
Homme

Figure 8.10 Quelques exemples de chanes alimentaires simples.


(Daprs Lebreton.)

Mais la biomasse des consommateurs primaires, en gnral les herbivores, ne peut


tre quinfrieure celle des vgtaux qui leur servent de nourriture puisque tout
individu, est incapable de transformer en sa propre substance toute la matire vivante
quil consomme. Lindemann en 1942 a propos, comme ordre de grandeur pour les
transferts nergtiques, un rendement maximum de 10 %. Il introduisait par l mme,
la notion de pyramide des biomasses (fig. 8.11).
Homme : 1 kg
Brochet : 10 kg
Carpe : 100 kg
Phytoplancton : 1 000 kg

Figure 8.11 Pyramide des biomasses dans une chane alimentaire.


Chaque niveau de consommateur ne rcupre que 10 % de la masse de son producteur.

Ces pyramides cologiques aussi simplistes quelles puissent paratre sont cependant
trs intressantes connatre, puisquelles donnent une ide des masses rcuprables
chaque niveau. Les cologistes parlent alors de capacit biognique limite. Cest
une notion trs utilise en agriculture puisquelle permet de connatre la charge en
btail quil ne faut pas dpasser par hectare pour ne pas risquer de dtruire la prairie
par surpturage (en prairie riche : deux units de gros btail lhectare).

8.4.3 Les plantes dans le cycle du carbone


Tous les tres vivants interviennent dans le cycle du carbone. Les vgtaux fixent le
gaz carbonique lors de la photosynthse mais ils respirent, donc librent du gaz
carbonique, tout comme les animaux. Enfin les dcomposeurs librent eux aussi lors
de la minralisation du gaz carbonique.
Mais le carbone existe sous diffrentes formes dans la biosphre et les biologistes
ont essay de chiffrer les diffrentes masses des composants du cycle du carbone.
La figure 8.12 en donne un exemple.
234

9782100544141-Laberche.fm Page 235 Jeudi, 4. fvrier 2010 3:47 15

8.4 Les plantes dans la biosphre

Figure 8.12 Le cycle du carbone. (Daprs Bolin, simplifi, in Lebreton, 1978.)

Dunod La photocopie non autorise est un dlit.

Les chiffres sont estims en milliards de tonnes de carbone :


dans les cadres, biomasses et rservoirs ;
prs des ches, productivit ou mouvements annuels.

La quantit de carbone prsente dans la biosphre sous forme organique, et dans


latmosphre, sous forme de gaz carbonique est trs faible en comparaison de celle
emprisonne dans la lithosphre. Il sagit de carbonates (pour les 3/4), comme le
calcaire. Dans les eaux, lion HCO 3 reprsente le vritable rservoir du carbone
impliqu dans le cycle photosynthtique : les mers et les ocans contiennent environ
50 fois plus de CO2 que latmosphre.
La teneur moyenne de lair en CO2 est de 350 ppm (ppm = partie par million, soit
des mg par kg) trs prs du minimum (de lordre de 100 ppm) ncessaire une
photosynthse active et fort loin, en tout cas, des valeurs toxiques pour les plantes ou
les animaux. En milieu arien, le gaz carbonique est le principal facteur limitant de
lassimilation chlorophyllienne. Depuis le milieu du XIXe sicle o elle approchait
280 ppm, la teneur en CO 2 de lair na fait que crotre. Laugmentation annuelle
actuelle est de 0,8 ppm. Pourtant ce nest que le tiers de ce qui rsulte de la combustion
du charbon et des hydrocarbures annuellement brls. Que deviennent les deux tiers
restants ? La majeure partie est absorbe par les eaux marines. Mais une fraction est
rcupre par les vgtaux et augmente le rendement photosynthtique. Cette augmentation de teneur en CO2, ne prsente aucun danger physiologique pour les animaux et
235

9782100544141-Laberche.fm Page 236 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

procure des avantages pour les vgtaux. Elle provoque, cependant, leffet de serre aux
consquences beaucoup plus nfastes. Les experts de la FAO qui tudient les consquences des changements climatiques sur la production agricole mondiale, voient
dans laugmentation du CO2 dans latmosphre une action antitranspirante bnfique
pour les plantes ainsi quune augmentation de leur efficience photosynthtique. Mais
cette augmentation en gaz carbonique entrainera la dgradation des sols avec un
puisement des nutriments do des modifications hydrologiques importantes. Tout
ceci aura des consquences sur la scurit alimentaire des populations avec une
augmentation des disparits entre les rgions agricoles.

8.4.4 Les plantes dans le cycle de loxygne


Comme le gaz carbonique, loxygne est li la photosynthse et la respiration. Certes
les quantits thoriques doxygne dans latmosphre sont normes (6 1016 tonnes)
mais, cest loxygne dissous dans leau qui est important pour la vie des vgtaux et
des animaux aquatiques. 20 C la teneur thorique ne dpasse pas 8 ppm (mg/L)
et dcrot avec la temprature. Ceci constitue un des aspects nocifs de la pollution
thermique. Cette diminution de la quantit doxygne dans leau est un des facteurs
de leutrophisation. Les vgtaux constituent la base biologique dun lac ou dune
rivire. Approvisionnes en CO2 dissous, les plantes rclament galement, pour btir
leur matire organique, nitrates et phosphates. faible teneur, ces lments sont les
facteurs limitants pour la production primaire. Peu nutritif et, par consquent, pitre
nourrisseur pour les htrotrophes, un tel milieu sera qualifi doligotrophe, ce qui
nindique pas labsence de vie, mais une faible biomasse, trs souvent hautement
spcialise. Lorsque de fortes quantits de nitrates et/ou de phosphates sont apportes
par lhomme (cas des engrais), les organismes chlorophylliens pullulent rapidement
dans le milieu ainsi favoris, en particulier les Cyanophyceae. Mais, la phase de
croissance passe, se pose le problme du recyclage de cette biomasse qui est dvore
par des consommateurs, ou minralise par des dcomposeurs. Ces derniers exigent
cette fin dnormes quantits doxygne que le milieu est rarement capable de
fournir, surtout en milieu calme et chaud (en t). Eutrophis, le lac asphyxi prit
de son abondance de matire organique et sous ses dchets.
Les cycles biologiques de loxygne et du gaz carbonique rpondent aux mmes
principes, mais dpendent de rservoirs diffrents ; les rservoirs doxygne (loxygne
de latmosphre et de leau) sont tellement volumineux que lon peut admettre un
turn-over infini notre chelle biologique et mme cologique (2 000 ans au niveau
de latmosphre ; 2 millions dannes au moins au niveau de lhydrosphre), le tout
recycl par la photosynthse.

8.4.5 Les plantes dans le cycle de lazote


Mme si lazote nintervient pas directement dans la photosynthse et la respiration,
lazote est un constituant primordial de la matire vivante. Cette importance na pas
toujours t vidente et le nom mme dazote (sans vie) en est une rminiscence.
236

9782100544141-Laberche.fm Page 237 Jeudi, 4. fvrier 2010 3:47 15

8.4 Les plantes dans la biosphre

ition
mp
os

on
mpositi

fixation

d
co

ific

dco

r
nit
d
at
io
n

absorption

Le cycle de lazote est complexe puisquil fait intervenir de nombreuses tapes


(fig. 8.13).

Figure 8.13 Le cycle de lazote dans la nature.


(Daprs Mohr, modifi.)

Dunod La photocopie non autorise est un dlit.

Selon le principe des chanes alimentaires lazote protique des vgtaux est cd
aux consommateurs primaires puis secondaires. Les dchets et les cadavres livrent
tt ou tard des produits amins, qui sont recycls par tout un ensemble de microorganismes dcomposeurs, essentiellement des bactries arobies mais aussi quelques
champignons (en sols trs acides). Ce processus est la minralisation.
Cette minralisation seffectue en deux tapes.
Lammonification donnant de lammonium NH +4 . Elle est assure par une
microflore nombreuse et htrogne.
La nitrification qui amne en deux temps la production de nitrates NO 3 . La
premire tape, la nitrosation, transforme le cation ammonium NH +4 . en anion
nitrite NO 2 . Ceci est luvre de Nitrosomonas. La deuxime tape, la nitration, fait
passer le nitrite en nitrate NO 3 . Cest Nitrobacter qui permet cette transformation.
Les conditions cologiques de dveloppement des bactries intervenant dans
lammonification sont diffrentes de celles de la nitrification. Les premires sont
actives des tempratures relativement froides (une dizaine de degrs) tandis que les
secondes exigent des tempratures plus leves 15-16 C.
237

9782100544141-Laberche.fm Page 238 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 8 La plante dans son milieu environnant

Mais ce cycle comporte dautres tapes dont la dnitrification qui est la transformation de lammonium en azote gazeux. Ce phnomne est loin dtre ngligeable.
Il est estim par les microbiologistes du sol 60 kg dazote par hectare et par an. Ces
pertes sont contrebalances par des synthses qui se produisent selon deux types.
1. Des processus abiotiques. Ainsi sous linfluence des orages, mais aussi de lnergie
lumineuse, des oxydes dazote se forment dans latmosphre.
2. Des processus biotiques comme la fixation symbiotique dans les nodosits. En plus
des Rhizobium dautres micro-organismes libres sont capables de fixer directement
de lazote atmosphrique. Il sagit dAzotobacter (2 5 kg/ha/an) et de quelques
Cyanophyceae.
Lhomme intervient dans ce cycle de lazote essentiellement par ses activits
agricoles, plus que par ses industries. Si voici quelques annes, les rejets dans le milieu
de nitrates taient particulirement importants, les nouvelles techniques culturales
(bilans azots, analyses de sols et de vgtaux, rejets contrls des djections animales)
beaucoup plus soucieuses de lenvironnement permettent de minimiser ces perturbations. Mais le temps de latence entre laction de polluer et sa manifestation, essentiellement au niveau des nappes phratiques est au moins dune vingtaine dannes.
Alors, beaucoup deau (pollue) passera encore sous les ponts avant que napparaissent
les rsultats des actions dinformation et de formation dveloppes inlassablement
par les divers formateurs et trop peu relayes par les mdias.

Rsum

Immobiles, les plantes croissent et se dveloppent dans un milieu environnant


souvent hostile. Pour se protger des agressions du climat, les graines entrent
en dormance et ne se rveillent que sous laction de diffrents stimulis. Les
organes vgtatifs prennes se protgent ou senfoncent dans le sol pour ne pas
exposer leurs bourgeons aux froidures de lhiver. Certaines plantes ragissent
aussi aux conditions du sol. Les calcifuges sont intoxiques par le calcium,
elles ne poussent donc pas dans les sols qui en contiennent. Les plantes aussi
ragissent avec les organismes qui les entourent. Certaines sont parasites et
prlvent chez leurs htes leurs lments nutritifs. Dans bien des cas, ces relations sont positives, soit au travers des mycorhizes, soit grce aux symbioses
fixatrices dazote. Dans la biosphre, les vgtaux chlorophylliens sont des
producteurs de matires organiques qui ont vocation tre consomms par des
consommateurs primaires, amorant ainsi des chanes trophiques. Enfin, les
plantes sont des chanons fondamentaux dans les grands cycles de loxygne ou
du gaz carbonique.

238

9782100544141-Laberche.fm Page 239 Jeudi, 4. fvrier 2010 3:47 15

LHOMME
ET LES PLANTES

Depuis la nuit des temps lhomme utilise les plantes pour vivre. Toutes ses activits
sont lies plus ou moins directement aux plantes. Trs vite il a voulu matriser et
amliorer ses sources dapprovisionnement. Depuis des millnaires, il a cherch
slectionner des plantes plus conformes ses besoins. Parfois mme, il a cr des
espces nouvelles comme le Triticale. Mais ceci na t possible que parce que les
vgtaux sont capables de variation. Ceci constitue une proprit fondamentale de
tous les organismes vivants.
Depuis le dbut du sicle la connaissance des lois de la gntique, puis les
possibilits offertes par les cultures in vitro ont entran une acclration considrable
de laction de lhomme sur les vgtaux. Les mcanismes naturels de lvolution des
vgtaux, tels quils ont t noncs par Darwin, seront dabord tudis. Certes
lhomme ne les matrise pas mais il les copie pour son intrt. Dans cette utilisation
deux aspects seront particulirement dvelopps. Lun implique la reproduction
sexue, il sagit de lamlioration des plantes par slection. Lautre fait appel la
multiplication vgtative artificielle grce aux techniques de cultures in vitro.

9.1 LES

MCANISMES NATURELS DE LVOLUTION

Dunod La photocopie non autorise est un dlit.

CHEZ LES VGTAUX


9.1.1 Les notions de base
Quelques dfinitions importantes de gntique doivent tre dabord rappeles.
Le phnotype dun individu est lensemble de ses caractres apparents (morphologiques, biomtriques, histologiques ou biochimiques).
Le gnotype dun individu est lensemble des particules hrditaires quil a
reues de ses parents au moment de la caryogamie.
Le phnotype est donc lexpression apparente dun gnotype. Compte tenu du fait
que les allles rcessifs ne sont pas exprims par le gnotype et que la traduction
phnotypique dun gnotype peut varier selon les conditions du milieu, il est normal
de considrer qu un mme gnotype peuvent correspondre des phnotypes diffrents.
239

9782100544141-Laberche.fm Page 240 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Le gnome est lensemble des n chromosomes contenus dans un gamte. Le


gnotype dun individu diplode est donc form par les gnes apports par les deux
gnomes runis au moment de la fusion des deux gamtes.
Chacun de ces gnes est lui mme diffrenci en deux allles : dans deux chromosomes homologues dun double gnome (diplode), les deux allles occupant la place
du gne quils reprsentent peuvent tre diffrents. Ainsi, dans lensemble des individus dun mme biotype, les combinaisons gnotypiques possibles sont extrmement
nombreuses.
chaque gnration issue de la reproduction sexue seffectue un brassage des
gnotypes. Les allles sont redistribus. Chez les plantes allogames, qui se reproduisent par croisements entre individus diffrents, chaque gne possde dans son double
gnome, un assortiment dallles qui lui est propre et que la miose partage ensuite
et rpartit entre les cellules sexuelles. Cet ensemble de gnes a t le plus souvent
modifi au moment de la miose par les chiasmas forms au cours de la premire
prophase. Le gnotype de luf est diffrent de celui de ses parents. Chez les plantes
autogames, moins rpandus que les allogames, les deux gnomes qui sunissent au
moment de la fcondation proviennent du mme parent. Le brassage dun assortiment
gnique en principe jamais renouvel, ne peut quaboutir un phnotype invariable
et lentretenir indfiniment.
Ces situations peuvent exister localement, dans des conditions de milieu invariables
et pendant une dure limite. Dans la nature, surtout ds que le milieu change, des
vnements surviennent qui, lentement ou soudainement, modifient la composition des
gnotypes.
propos de la terminologie des niveaux de plodie
Les mots haplode et diplode prtent confusion car il existe une ambigit pour
chacun de ces termes selon quils sont employs propos de lalternance de phases
nuclaires ou du niveau de plodie spcique. Ils ne caractrisent pas uniquement
un rapport numrique 1/2 de la garniture chromosomique respective du sporophyte
et du gamtophyte. En effet, la diplodie est ltat dun organisme uni-ou pluricellulaire pour lequel chaque noyau cellulaire comporte la juxtaposition de deux
lots de chromosomes homologues ou gnomes, tandis que, dans lhaplodie chaque
noyau nest pourvu que dun seul gnome dni par le nombre chromosomique de
base x.
Dans le cas dune espce diplode, comme lengrain sauvage (cf. page 80) le sporophyte est diplode 2n = 2x = 14 et le gamtophyte haplode n = x = 7, le premier
comprend deux gnomes (2x) et le second un seul (x). En revanche il en est tout
autrement pour les espces polyplodes caractrises par un sporophyte plus de
deux gnomes par noyau et dun gamtophyte plus dun gnome par noyau.
Considrons le bl dur, cest une espce 2n = 28 (cf. page 74). Il est ttraplode,
4 gnomes sont en jeu (AABB) et cette fois sporophyte et gamtophyte sont caractriss respectivement par 2n = 4x = 4 7 = 28 et n = 2x = 2 7 = 14, chaque
gnome est 7 chromosomes. La ttraplodie sporophytique a pour consquence
directe la diplodie gamtophytique.
Chez les plantes cultives, il nest pas rare dtre en prsence de plantes hexaplodes
(2n = 6x) voire octoplodes (2n = 8x). Ainsi le bl tendre est une espce 2n = 42
240

9782100544141-Laberche.fm Page 241 Jeudi, 4. fvrier 2010 3:47 15

9.1 Les mcanismes naturels de lvolution chez les vgtaux

(cf. page 80). Elle est hexaplode, six gnomes sont en jeu (AABBCC) et cette fois
sporophyte et gamtophyte sont caractriss respectivement par 2n = 6x = 6 7 = 42
et n = 3x = 3 7 = 21, chaque gnome est toujours 7 chromosomes
Daprs Robert Gorenot- La terminologie des niveaux de plodie. In Revue de Cytologie et Biologie
vgtales Le Botaniste, 2001, 24, 1/2,3-6.

9.1.2 Lexpression de la variation


De nombreuses espces sont doues dune souplesse adaptative dont tmoigne leur
prsence sous des climats ou dans des biotopes diffrents. Leur variabilit phnotypique
devient alors tellement large que les contours de celles-ci sestompent et que les
dfinir devient difficile.
Deux types de variation sont alors reconnaissables : les accommodats et les biotypes.

a) Les accommodats

Dunod La photocopie non autorise est un dlit.

Un accommodat, (on dit aussi morphose), est une plante qui a une forme adapte
au milieu o elle vit. Change de milieu, elle se dveloppe suivant des modalits
diffrentes qui lui confrent une autre forme, plus ou moins nettement accommode
aux conditions nouvelles. Ces formes sont parfaitement rversibles et non hrditaires
et induites par des facteurs externes. Les exemples daccommodats sont nombreux et
touchent de nombreux groupes de vgtaux. Le mouron deau Veronica anagallis L.
Scrophulariaceae se prsente sous des formes compltement diffrentes selon quil
vit dans lair ou dans leau. Dans le premier cas (fig. 9.1), les tiges sont glabres et
paisses et les feuilles petites. Dans leau les tiges sont paisses et les feuilles beaucoup
plus grandes.

10 cm

Figure 9.1 Les deux formes (accommodats) de Veronica anagallis L.


a, forme terrestre ; b, forme aquatique.

241

9782100544141-Laberche.fm Page 242 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Dautres accommodats se trouvent chez lEdelweiss Leontopodium alpinum Cass.


Asteraceae, bien connu (et recherch) des montagnards. Dans leur habitat naturel, en
haute montagne, les fleurs sont portes par de courts pdoncules trs velus, ce qui leur
confre cette blancheur tant apprcie. Cultivs en plaine, les individus sont dfigurs
par la rduction de la pilosit des pdoncules, cumule lallongement de ceux-ci.

b) Les cotypes
Les cotypes expriment, comme les accommodats, mais dune tout autre manire, la
variabilit de lespce laquelle ils appartiennent. Lcotype est le type moyen, stable,
dune espce dans une aire gographique. Lcotype est donc la plante ou la population de plantes prsentant des adaptations, gntiquement fixes donc hrditaires,
adaptes au milieu o elles vivent. Sil est cultiv dans un nouveau milieu, il conserve
tous ses caractres distinctifs.
Les exemples dcotypes sont trs nombreux et les facteurs les induisant sont
parfois faciles reconnatre. Ainsi lanmone des Alpes (Pulsatilla alpina L.
Ranunculaceae) a des fleurs jaunes sur roche mre cristalline et blanches sur calcaire.
Transplante sur roche mre cristalline, la blanche produit toujours des fleurs blanches,
tandis que les plantes fleurs jaunes ne se dveloppent pas et meurent sur calcaire. Ce
sont des cotypes daphiques. Il existe aussi des cotypes altitudinaux, gographiques
ou maritimes comme chez la pense sauvage, Viola tricolor L. Violaceae (fig. 9.2).

a1

b1

a2

b2

Figure 9.2 cotype de Viola tricolor L.


La race de rfrence est reprsente en a (a1 : eur ; a2 : feuille). Lcotype maritime
est en b (b1 : eur, b2 : feuille). Les caractres de cette dernire sont conservs
quand elle pousse en dehors de ses dunes dorigine (daprs Mangenot).

242

9782100544141-Laberche.fm Page 243 Jeudi, 4. fvrier 2010 3:47 15

9.1 Les mcanismes naturels de lvolution chez les vgtaux

Les accommodats sont les expressions phnotypiques rversibles dun seul et mme
gnotype dont la direction sur le dveloppement, trs souple, est immdiatement
influence par le milieu ; laccommodation nest pas un facteur dvolution. Les
cotypes sont les expressions phnotypiques irrversibles de gnotypes slectionns
par le milieu. Cest un puissant facteur dvolution.

9.1.3 Les mcanismes


Lexistence des cotypes rvle que les gnotypes varient dans le cadre de lespce.
Celle-ci apparat donc comme une unit systmatique toujours en voie de transformation. Il convient dapprofondir ces notions et de rechercher quels sont les mcanismes
conduisant la diffrenciation despces nouvelles partir despces antrieures,
phnomne auquel on donne le nom de spciation. Les vnements qui conduisent au
renouvellement des espces sont de quatre types : la mutation qui modifie constamment les gnotypes, lhybridation qui les mlange et les enrichit, lisolement qui
fragmente les populations, la slection qui trie les phnotypes.
Les individus les mieux adapts sont conservs et les autres limins. Les mcanismes ont leur maximum deffet chez les allogames ; mais il importe aussi dexpliquer
comment ils se prsentent chez les autogames et dtudier leur interfrence avec la
multiplication asexue.

a) Les mutations
La mutation est un changement subit et alatoire, par consquent irrversible, qui
affecte le matriel gntique dun individu.

Dunod La photocopie non autorise est un dlit.

Les diffrentes mutations

1. Mutations gniques. Elles consistent en un changement de la squence des


nuclotides dans un gne et ont pour effet lapparition dun allle nouveau.
2. Mutations chromosomiques. Elles provoquent un changement de la squence
des gnes dans un chromosome et ont pour effet une rpartition nouvelle de ceuxci. Ceci modifie le fonctionnement du gnotype.
3. Mutations gnomiques. Elles consistent dans un changement du nombre des
chromosomes. Le changement peut affecter soit tous les chromosomes ; cest une
polyplodie. Plusieurs cas sont alors possibles. Aux deux gnomes normaux sen
ajoute un troisime (triplodie) voire un quatrime ; on a alors une ttraplodie.
Ou bien, le changement consiste dans laddition, au double gnome normal, dun
chromosome supplmentaire ; lun des deux gnomes contient ainsi un chromosome en triple (trisomie) ou en quadruple exemplaire, moins que dans lun des
gnomes, un chromosome existe seulement un exemplaire.
La frquence des mutations

Dans la nature, les risques de mutation dun gne sont infimes au cours de la vie dun
organisme. Mais, les gnes sont extrmement nombreux (de lordre de 900 chez une
Bactrie, de 90 000 chez une Drosophile, de 1000 000 chez lhomme) et les risques
243

9782100544141-Laberche.fm Page 244 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

de mutation, non pas dun gne dtermin, mais de lun quelconque de ces gnes, ou
bien dun groupe de gnes, sont beaucoup moins infimes. Les chanes dsoxyribonucliques et les chromosomes sont des difices trs fragiles. La mitose et la miose
sont des mcanismes dlicats sensibles toutes les causes qui peuvent changer. Une
variation soudaine et insolite dans lintensit dun facteur cologique dune cellule
peut causer des modifications lors de la division cellulaire.
Les consquences des mutations

Le gne mut peut tre dominant : le changement de phnotype est alors rapide. Le
plus souvent, il est rcessif de sorte que le changement peut rester longtemps inaperu.
Entran dans le brassage gnique effectu par les mioses, le nouvel allle se manifestera cependant, tt au tard, suivant sa position et le jeu des recombinaisons par lapparition dun phnotype indit. Malgr la perte de la plupart des mutants, les mutations
assurent une diversification plus ou moins lente des gnotypes et offrent ainsi la
slection un matriel renouvel. La mutation est la source premire de toute volution.

b) Lhybridation
Lhybridation est la runion, dans un mme individu de deux gnomes diffrents
dont chacun est apport par les gamtes. Il y a formation dun hybride, qui peut tre
strile ou fertile.
La strilisation de lhybride

Les individus appartenant une mme espce allogame shybrident lors de chaque
fusion sexuelle. Les deux gnotypes ne diffrent lun de lautre que par un petit nombre
dallles et lhybride est fertile. Mais mesure que les croisements stendent et se
diversifient, les hybrides ralisent des combinaisons de gnomes de plus en plus
dsquilibres ; des gnes de strilit peuvent se trouver runis ltat homozygote.
Les mcanismes de la miose sont perturbs, voire inhibs par le manque daffinit
entre les chromosomes. La fertilit de ces hybrides diminue aboutissant la strilit de
lhybride. Lorganisme strile nest pas ncessairement condamn disparatre tout
fait. Laffaiblissement de la sexualit, chez les hybrides saccompagne souvent
dun dveloppement compensatoire des mcanismes asexus. Ainsi un ou plusieurs
embryons peuvent se former dans lovule sans rduction chromatique ni fcondation
(apomixie) ; ces ovules deviennent des graines parfaitement constitues et qui germent
ds quelles trouvent des conditions de milieu favorables. Il est possible aussi que
lhybride ne forme pas de graine, mais se multiplie, soit par bouturage naturel, soit
en utilisant ses organes de rserves (tubercules, bulbes, etc.), dont chaque fragment
peut donner naissance une plante entire.
Les hybrides sont souvent striles
La strilit des hybrides, lie des mcanismes gntiques, peut tre due des
causes diverses.
1. Les sacs embryonnaires et le pollen avortent par suite dune perturbation de la
miose.
244

9782100544141-Laberche.fm Page 245 Jeudi, 4. fvrier 2010 3:47 15

9.1 Les mcanismes naturels de lvolution chez les vgtaux

2. Les grains de pollen et les stigmates sont incompatibles entre eux : la pollinisation est sans effet.
3. Les tubes polliniques conduisent les noyaux mles jusquaux oosphres. Mais
les gamtes sont incompatibles et ne sunissent pas.
4. La fusion des gamtes a lieu et lembryon est form. Mais il est cras par un
dveloppement anormal des tguments ovulaires.

La sexualit retrouve chez lhybride : lallopolyplodie

Dans une cellule mristmatique ou dans une cellule-mre de ttraspore, la mitose ou


la miose peuvent sinterrompre vers la fin de la prophase par suite dune dficience
au niveau du fuseau. Les chromatides dj spares ou les chromosomes apparis, ne
vont pas se rpartir, par moiti, dans les deux noyaux fils. Cependant ils continuent de
se rorganiser et ils subissent ensemble les transformations tlophasiques lintrieur
du noyau-pre. Celui-ci contient alors deux gnomes paternels (AA) et deux gnomes
maternels (BB), soit 4n chromosomes : il est ttraplode (AB AB). Lhybride est un
allopolyplode, fertile puisquil produira des gamtes (AB). Dans son gnotype sont
mls deux gnotypes doubls originellement diffrents.
Polyplodie artificielle
On peut provoquer articiellement la polyplodie en traitant les bauches orales
(donc lors de la miose) ou les bourgeons (sur les mristmes apicaux) par certaines
substances mitoclasiques (qui brisent la mitose), parmi lesquelles la colchicine,
alcalode des Liliaceae, est la plus efcace. Chez des individus miose parfaitement rgulire la polyplodie peut aussi apparatre. Il ne sagit alors que de la
rptition dun mme gnome. Ces organismes sont autopolyplodes. Ils diffrent
souvent des individus normaux par certains caractres phnotypiques. On trouve
beaucoup dalloplodes chez les plantes cultives.

Dunod La photocopie non autorise est un dlit.

Lhybridation est une autre tape particulirement importante dans lvolution


des plantes. Mme si elle produit un hybride strile contenant deux gnomes incapables de sapparier (A et B), la polyplodie permet le doublement de ces gnomes ce
qui assure chaque chromosome un partenaire homologue. Une miose rgulire,
condition dune sexualit normale, est alors rtablie.

c) Lisolement
Au sein dune population dindividus interfconds, lisolement consiste dans lexistence de conditions qui restreignent ou interdisent les changes de gnes entre certains
individus de cette population. Chaque territoire gographiquement isol prsente
ainsi une flore et une faune qui lui sont propres, et dont le degr doriginalit mesur
par la proportion, dans lensemble de la flore et de la faune, des espces endmiques
dpend de lanciennet de lisolement et de lefficacit de la barrire isolante.
Lisolement gographique est un facteur extrmement puissant disolement
gntique. Il engage les populations spares dans des cadres volutifs nouveaux.
Il accrot lefficacit de la mutation, cre des cotypes nouveaux et ainsi rnove le
matriel hybridable.
245

9782100544141-Laberche.fm Page 246 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

d) La slection
La slection constitue un des mcanismes essentiels de lvolution. Elle intervient
constamment et partout. Cest le tri des phnotypes effectu par lensemble des
facteurs du milieu (climatiques, daphiques, biologiques). Dans une population, les
phnotypes nouveaux sont mis lpreuve du milieu : les uns russissent, les autres
sont limins parce quinadapts La dysharmonie dun seul caractre morphologique
ou fonctionnel avec un seul facteur cologique suffit llimination, brutale si
lincompatibilit est absolue, plus ou moins rapide si linadaptation nest quune
cause de faiblesse dans la lutte pour la vie.
La slection tend liminer les caractres inhabituels. Une mutation est toujours
un vnement alatoire, ne touchant quun seul individu. Si la slection nintervenait
pas, les chances de maintien de cette mutation seraient trs faibles. Mais la slection
agit contre le hasard. Elle supprime en un lieu donn les mutations en dsaccord
avec les conditions du milieu et favorise celles ayant un caractre adaptatif.

e) Lasexualit
De trs nombreuses plantes se multiplient non seulement par la voie sexue, mais
encore par des mcanismes asexus. Or lasexualit est un mcanisme compensateur
de la strilit qui rsulte souvent de lhybridation. Ceci permet lapparition de clones
sexuellement striles, dont tous les reprsentants possdent le mme gnotype et
sont phnotypiquement identiques.
Si les mutations, lhybridation, et la slection dirigent les fluctuations naturelles vers
le changement, les caractres des clones asexus pourraient paratre figs dans un
immobilisme sans autre avenir, plus ou moins longue chance, quune snescence.
Il nen est en ralit rien, car cette asexualit contribue efficacement, pendant des
priodes souvent trs longues, la survie et lexpansion des biotypes en voie
dvolution. Lhybride strile, mais vigoureux, dans lequel ont t rassembls les
caractres souvent complmentaires des deux parents, est, par isolement sexuel,
garanti contre toute dgnrescence. Si les moyens de propagation asexuelle sont
efficaces, lorganisme dont les caractres sont prservs peut se multiplier rapidement
et mme stendre sur une aire accrue.
Un exemple dhybridation naturelle en cours
Dans la Principaut dAndorre dans les Pyrnes, les deux narcisses sauvages
Narcissus poeticus L. et Narcissus pseudo-narcissus L. Amaryllidaceae sont des
plantes qui vivent dans le mme habitat, dans les valles humides. Leurs dates de
oraison sont lgrement dcales. Cependant des hybrides entre les deux espces
peuvent se trouver. Ils ont les caractres oraux intermdiaires entre les deux
parents. Ils sont striles, cependant ils se dveloppent et maintiennent lhybridation,
assez rare, par asexualit.

Cette expansion clonale est dune remarquable efficacit et prpare pour lavenir
quand la fertilit sera rtablie, un nouvel essor dans la diversification. Lasexualit
assure ainsi toutes leurs chances aux meilleurs phnotypes.
246

9782100544141-Laberche.fm Page 247 Jeudi, 4. fvrier 2010 3:47 15

9.1 Les mcanismes naturels de lvolution chez les vgtaux

9.1.4 Un exemple dapparition spontane


dune espce nouvelle: Spartina townsendii Groves
Les Spartines sont des Poaceae (Gramines) qui vivent en milieu salin. Elles forment
des prairies sur les vases littorales priodiquement inondes par les mares. Deux
espces taient connues, depuis longtemps, sur le littoral atlantique europen. Lune,
Spartina maritima Fernald. est spontane depuis la Maroc jusqu lAngleterre et
aux Pays-Bas. Lautre, Spartina alterniflora Lois., est probablement originaire de la
cte Est de lAmrique du Nord. Elle a t introduite en Europe depuis au moins
150 ans et dsormais subspontane de lAngleterre lEspagne.
Une troisime espce Spartina townsendii, est apparue, vers 1870, en mlange
avec les deux espces prcdentes, dans la baie de Southampton en Angleterre. On
la signalait, en I906, sur la cote du Calvados puis vers louest jusquau Mont SaintMichel, et dans le Pas-de-Calais. Dans chacune des stations repres, la nouvelle
espce stend rapidement sur les vases sales, quelle fixe par lenchevtrement de
ses rhizomes. Elle lve ensuite le niveau des vasires en ajoutant les dbris de ses
feuilles uses et de ses vieux chaumes aux sdiments apports par les grandes
mares. Spartina townsendii immobilise et exhausse ainsi des vasires, les soustrait
leau sale et les prpare recevoir dautres espces et devenir des prairies hors
eau, Elle-mme alors disparatra. Cette Gramine, trs utile, a t plante en Europe,
en Amrique du Nord, en Guyane britannique et jusquaux Hawaii, afin de prparer
la mise en valeur de boues littorales.

Dunod La photocopie non autorise est un dlit.

Les espces invasives cotent cher lEurope


Une tude europenne (Delivering Alien Invasive Species Inventories in Europe,
DAISIE 2005-2008), a dress linventaire et les consquences des espces introduites
sur le continent europen depuis la dcouverte de lAmrique en 1492. Ainsi, plus
de 10 000 espces vivantes (dont 1224 vgtaux) ont t rpertories. Parmi celles-ci
11 % ont un impact cologique et 13 % un impact conomique. Si en tte du
palmars des espces perturbatrices gurent loie du Canada (Branta canadensis L.,
Anatideae), la moule zbre (Dreissena polymorpha Pallas, Dreissenidae), le cerf
Sika (Cervus nippo L. Cervidae), lomble de fontaine (Salvelinus fontinalis Mitchill,
Salmonidae), le ragondin (Myocastor coypus Molina, Myocastoridae) et lcrevisse
de Louisiane (Procambarus clarkii Girard, Cambaridae). Chez les vgtaux le mas
(Zea mays, L. Poaceae), la tomate (Lycopersicum esculentum L. Solanaceae), la
pomme de terre (Solanum tuberosum L. Solanaceae) en autres plantes, ont un rle
conomique positif trs important puisquils assurent la scurit alimentaire de
lEurope et par l mme la n des famines. Inversement lambroisie (Ambrosia
artemisia L. Asteraceae), lamaranthe (Amaranthus retroexus, Chenopodiaceae)
sont de redoutables adventices des cultures.
Du point de vue conomique, les espces invasives occasionnant chaque anne
les cots les plus importants sont lalgue toxique (Chrysochromulina polylepis
Manton et Parke, Prymnesiophyceae) svissant en Norvge : 8,2 millions deuros/an,
la jacinthe deau (Eichhornia crassipes (Mart.) Solms Pontederiaceae) en Espagne :
3,4 millions deuros/an et le ragondin en Italie : 2,8 millions deuros/an. Avec des
effets cibls plus particulirement sur les cultures et les forts, les invertbrs
terrestres invasifs ne sont pas en reste. De fait, les pertes annuelles dans les rcoltes
247

9782100544141-Laberche.fm Page 248 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

dues aux arthropodes introduits souvent fortuitement (insectes divers, cloportes,


araignes, crabes, etc.) slveraient 2,8 milliards deuros pour le seul territoire
du Royaume-Uni.

Les caractres morphologiques de Spartina townsenii, sont trs constants. Ils sont
intermdiaires entre ceux des deux espces Spartina maritima et Spartina alterniflora auprs desquelles on la dcouverte, mais elle est plus vigoureuse et plus grande
que celles-ci. Les caractres intermdiaires, comme la vigueur accrue, ont suggr
que la nouvelle Spartine serait un hybride, entre les deux espces antrieurement
connues. Les donnes cytologiques sont en faveur de cette hypothse : les nombres
chromosomiques (2n) sont 56 chez Spartina maritima, 70 chez Spartina. alterniflora
et 126 (70 + 56) chez S. townsendii. Il est donc probable quun hybride entre les
deux anciennes spartines a t form (hybride 63 chromosomes, dont 28 apports
par maritima et 35 par alterniflora ; des Spartines striles 63 chromosomes existent
effectivement dans le Sud de lAngleterre), dont certains individus sont devenus
ttraplodes et fconds, grce au doublement de chacun des gnomes. La fixit
remarquable des caractres de Spartina townsendii est intelligible aussi dans cette
hypothse : la diffrence des nombres chromosomiques dans lespce noforme,
dune part, les espces parentes, dautre part, exclut toute possibilit de croisement ;
aussitt cr, Spartina townsendii sest trouve sexuellement isole et multiplie
avec une remarquable rapidit, lie la vigueur que lui confre sa nature hybride.
Spartina townsendii est une espce sauvage soudainement ne lpoque moderne
et sous les yeux de lhomme. Mais sa naissance est, en fait, la consquence dun
vnement anthropique puisquil est la consquence de lintroduction de Spartina
alterniflora dans les milieux littoraux dEurope.
volution et biodiversit
Depuis lapparition de la vie sur terre, les organismes, apparaissent, se dveloppent
et meurent. Plus que cette banale constatation, on sait parfaitement que des espces
sont apparues, puis panouies enn elles ont disparu pour la plupart. Le carbonifre
tait lpoque des fougres. Elles ne reprsentent dans la ore actuelle quune faible
part des plantes recenses Pourtant, tous les relais mdiatiques parlent de disparition alarmante de plantes et danimaux voquant ainsi une diversit biologique en
pril. Le terme de biodiversit a t introduit par Wilson et Peter en 1988. Il a
depuis envahi toute la littrature scientique et sest inltr dans le jargon mdiatique et administratif, notamment depuis la confrence des Nations unies sur lenvironnement et le dveloppement (Rio de Janeiro, juin 1992). Cest quen ralit ce
terme de biodiversit est trs ambigu. Il signie pluralit mais aussi lments
constitutifs de cette pluralit. Ceci permet Blondel (1997) de dire que la biodiversit est : la quantit et la structure de linformation contenue dans les systmes
vivants hirarchiquement embots Elle ne concerne donc pas uniquement les
facteurs qui touchent une espce et qui peuvent provoquer son extinction, mais
tous les facteurs qui agissent au niveau des cosystmes et qui peuvent les
perturber. Pour rtablir cette biodiversit, de nombreux biologistes prconisent
trois actions : 1) revenir dabord la structure, la diversit et la dynamique des
cosystmes originaux en rinstallant des espces indignes et en supprimant les
espces allochtones ; 2) rhabiliter les cosystmes en dbloquant les fonctions
disparues, 3) raffecter dans les milieux.
248

9782100544141-Laberche.fm Page 249 Jeudi, 4. fvrier 2010 3:47 15

9.2 La cration de plantes cultives

9.2 LA

CRATION DE PLANTES CULTIVES

Les plantes cultives sont issues des plantes sauvages qui ont t domestiques
par lhomme depuis le nolithique soit environ 9 000 ans.
Histoire du bl

Dunod La photocopie non autorise est un dlit.

Le Bl tendre farine paniable, ou Froment, Triticum aestivum L. Poaceae, qui


possde 2n = 42 chromosomes, est presque certainement une espce hybridogne
forme, au Proche-Orient, la suite de trs anciens croisements. Une premire
hybridation serait intervenue, ds le Nolithique, entre un Triticum primitif, T. urartu
(?), diplode 2n = 14 (gnomes AA) et une autre Gramine, 14 chromosomes
aussi (gnomes BB), dont on a des raisons de supposer quelle aurait appartenu
T. sitopsis. Lhybride strile (Aegilotricum : gnomes AB, 7 + 7 chromosomes)
aurait retrouv sa fertilit par doublement chromosomique. Les bls durs fertiles,
T. dicoccum, 2n = 28 (4 7) chromosomes (gnomes ttraplodes AABB), trs
cultivs au Proche-Orient 30 40 sicles avant notre re, pourraient avoir t
forms par ce processus. Un nouveau croisement entre le Bl dur ttraplode avec
encore un T. tauschii diplode, gnomes (CC) aurait donn naissance, dabord un
hybride strile 21 chromosomes (14 + 7) aux gnomes ABC, puis, aprs doublement chromosomique, un bl tendre hexaplode 2n = 42 chromosomes (gnomes
AABBCC). Cette histoire reconstitue daprs les donnes de la gntique, de la
cytogntique et de la prhistoire, est vraisemblable : de nombreuses synthses
de bls ttra, hexa, octo et dcaplodes ont t ralises exprimentalement.

Lorsquen 1492, Christophe Colomb aborde lAmrique, il dcouvre aussi une


plante que ses compagnons dcrivent comme un bl gigantesque aux longues feuilles
lisses, la tige lgante et aux graines dores. Cette plante qui constitue la base de
lalimentation des civilisations Mayas, Aztques et Incas, est vnre et assimile
par les autochtones au Dieu de la vie. Comme tel, les plus beaux pis devaient lui
tre chaque anne offerts aux cours de crmonies religieuses. Les dits pis taient
ensuite redistribus aux paysans pour servir de semences. tonnantes coutumes qui
voulaient que les prtres pratiquassent la slection massale bien avant quelle ne soit
dcrite par Vilmorin, lors de ces premiers essais de slection sur le bl 400 ans plus
tard ! Surprenant mas qui est une plante probablement ne du travail des hommes et
qui ne peut survivre que par lhomme puisque lpi portant les caryopses est enferm
dans une gaine bractale qui empche leur libre dissmination. Les origines de la
plante restent floues, le mas ne possde pas danctre naturel. Aucune gramine
sauvage dAmrique centrale, do elle semble tre originaire, ne peut y conduire
par slection. Seuls deux types de plantes sauvages prsentent des similitudes avec
le mas. Les tripsacums qui ont un nombre de chromosomes diffrents du mas, mais
qui peuvent se croiser avec lui, et la tosinte, dont certaines populations actuelles ont
le mme nombre de chromosomes que le mas (2n = 40) et qui surtout sont capables
de se croiser facilement avec lui. Cest cette dernire voie que les chercheurs privilgient. Ils pensent qu la suite de mutations et de slections conduites par lhomme,
la tosinte aurait donn naissance au mas. Au fil des sicles, lhomme sest appliqu
faire voluer le mas en pratiquant des slections de grains destins aux semences
et en crant de nouvelles races adaptes la diversit des terroirs. Grce aux fossiles
249

9782100544141-Laberche.fm Page 250 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

retrouvs, on sait quil y a 7 000 ans, un pi mesurait 2,5 cm ; 2 000 ans plus tard
7 cm ; au dbut de lre chrtienne 9 cm et aujourdhui 30 cm. La taille des grains
est pass du format grain de riz celui dun petit pois. tonnant mas qui au cours
des temps a connu trois rvolutions : lamlioration par la slection massale, lutilisation des ressources gntiques, enfin lassociation de la biologie molculaire et
des cultures in vitro avec lobtention dorganismes gntiquement modifis (OGM).
Lessor du mas en France
La rvolution du mas a eu lieu en France aprs la seconde guerre mondiale.
Durant les 40 dernires annes, la progression des rendements due lhybridation
et au progrs gntique a fait progresser les surfaces. En 1950, le mas tait cultiv
sur seulement 325 000 ha et avait un rendement moyen national de 1,2 tonne/ha.
Aujourdhui, plus de 3 300 000 ha sont consacrs au mas dont 53 % en mas grain,
pour un rendement moyen de 9,4 tonnes/ha.

Le mas nest quun exemple de plante introduite en Europe comme le montre le


tableau 9.1.
Tableau9.1 Origine des plantes cultives en Europe.
Zone dorigine

Plantes introduites

Amrique du Nord et centrale

Mas, haricot, courgette, tomate, cacao, tournesol.

Amrique du sud

Tabac, pomme de terre, coton, manioc.

Europe

Avoine, betterave sucrire, tre, laitue, lupin.

Asie centrale

Luzerne, ail, carotte.

Proche-Orient

Bl, orge, pois, lin, oignon, lentille.

Asie du Sud-est

Soja, riz, chou, fverole, canne sucre, concombre.

Afrique

Sorgho, melon, bl, orge.

m moles de glycosinolates par g

En mme quapparaissent de nouvelles plantes cultives et que les rendements


augmentent, on constate une amlioration de la qualit. Cest par exemple la diminution des taux de glycosinolates dans lhuile de colza (fig. 9.3).
40
35
30
25
20
15
10
1988

1990

1992

1994

1996

1998

2000

annes

Figure9.3 La diminution des taux de glycosinolates dans lhuile de colza


au cours de dernires annes du XXe sicle.

250

9782100544141-Laberche.fm Page 251 Jeudi, 4. fvrier 2010 3:47 15

9.2 La cration de plantes cultives

Les glycosinolates sont des composants naturels du canola, du colza et des graines
de moutarde. Ces composs se trouvent dans tous les lgumes de la famille des
Brassicae (par exemple : chou, chou de Bruxelles, chou-fleur, radis, brocoli) et sont
responsables de la forte odeur et du got prononc pour lesquels ces lgumes sont
recherchs. Les glycosinolates sont aussi des substances toxiques naturelles dont la
consommation en grande quantit est associe au goitre et aux maladies du foie.

9.2.1 La slection massale


Cest de loin, la slection la plus ancienne, puisquelle correspond la domestication
des plantes. Pour les crales par exemple, les paysans ont, au cours des temps,
slectionn un nombre de caractres favorables la culture puis la rcolte. Tout
particulirement, ils ont retenu les varits qui germaient de manire homogne et
rapidement et bien videmment celles qui arrivaient maturit le plus tt dans la
saison, avec les rendements les meilleurs. Ironie du sort, o versatilit de lhomme,
des caractres longuement slectionns pour leurs cts positifs sont devenus, du
fait de la mcanisation, ngatifs. La hauteur des brins de bl a t favorise des
sicles durant. Elle permettait une meilleure production de paille, pour lalimentation
animale, et facilitait la moisson pratique la faux. Actuellement au contraire, on
recherche des bls paille courte, ne versant pas lapproche des moissons, ceci
perturbant lefficacit des moissonneuses batteuses.
Populations anciennes
Il y a encore un sicle, la totalit des varits de cultives en France tait des
populations de pays . Ainsi en bl dans lEst de la France, on rencontrait le
Rouge dAlsace et le Moutot pi blanc, trs rsistantes au froid et dans le sud des
varits prcoces peu sensibles lchaudage comme Saissettes et Touzelles.

Dunod La photocopie non autorise est un dlit.

9.2.2 Lutilisation des ressources gntiques


Une fois les objectifs damlioration connus, qui portent le plus souvent sur la productivit et la rsistance aux diffrents parasites animaux et vgtaux, le slectionneur cr
une varit nouvelle. Pour ce faire, il va amliorer une varit existante en modifiant son
gnotype. Il dispose, pour y arriver, des mmes moyens que ceux utiliss naturellement
par lvolution.

a) Les mutations
Plutt que de chercher modifier le patrimoine gntique en introduisant un caractre nouveau, le slectionneur peut provoquer des mutations ou exploiter celles qui
apparaissent spontanment.
Les mutations provoques sont produites par lutilisation dagents mutagnes,
quils soient physiques (rayons ionisants) ou chimiques (le mtasulfonate dthyle).
Le traitement est souvent appliqu des spores comme le grain de pollen ou sur des
bourgeons. La frquence des mutations est multiplie facilement par 9 000. Seulement,
251

9782100544141-Laberche.fm Page 252 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

ces mutations ne sont pas diriges et les caractres modifis sont trs alatoires. Bien
souvent, les mutations provoquent lapparition de caractres dficients (strilit,
nanisme) ou dallles rcessifs (ce qui pose des problmes pour les exprimer),
voire ltaux. Le bilan des mutations provoques est trs dcevant et cest une technique
qui nest plus gure utilise mme si elle a t plusieurs fois couronne se succs.
Lobtention de mutants de poivrons mles striles, ou le gne mut u de la tomate
qui assure un mrissement uniforme en empchant la rtention de chlorophylle au
collet des fruits mrs, sont des rsultats de mutations provoques.
Beaucoup plus souvent, plutt que de provoquer des mutations, on cherche exploiter
celles qui apparaissent spontanment dans les collections. Des clones peuvent diffrer
des pieds mres parce quune mutation a affect une ou des cellules dun mristme.
Il sagit alors de mutations somatiques. Elles peuvent se rvler, dun point de vue
conomique, particulirement intressantes, surtout quand la plante se multiplie de
manire asexue. Cest ainsi que la slection de bourgeons anormaux est lorigine
de nouvelles varits de pommes, de bgonias, ainsi que de la pche nectarine, du
pamplemousse rose ou de lorange navel.
Des mutations somatiques chez la vigne
Des mutations somatiques ont t observes chez la vigne. Le pinot grains gris
peut spontanment muter et avoir des grains noirs ou blancs. Mis en culture on
constate que :
la mutation en blanc donne lieu une diminution considrable du rendement
par rapport au pinot gris, en revanche le taux de sucres est trs lev ;
la mutation en noir prsente au contraire une forte augmentation du rendement
par rapport au pinot gris, mais son taux de sucres devient trs faible.

b) Lutilisation de la gntique mendlienne pour crer


de nouvelles varits
Tous les travaux de cration de nouvelles varits agricoles vgtales et mme animales
sont bass sur lapplication des lois de la gntique de Mendel.
Un schma de cration comporte trois tapes : 1) disposer dune banque de gnes ;
2) les introduire par hybridation ; 3) les conserver par fixation.
Selon les proprits des plantes, particulirement ses possibilits de fcondation par
son propre pollen (autogamie) ou lobligation dune pollinisation croise (allogamie),
les modalits pourront tre diffrentes. linverse lintrusion depuis une quinzaine
dannes, des techniques de cultures in vitro et de biologie molculaire peuvent
modifier grandement ce schma classique.
Les lois de Mendel
Suprieur du couvent de Brno (actuellement en Tchquie), Mendel entreprend, aux
environs de 1850 des travaux dhybridation entre des varits de pois. Il a la
chance dobserver avec clart une rpartition statistique de ses croisements. Ceci
lui permet de publier en 1866, en langue allemande, donc lpoque de circulation universelle, son exceptionnelle dcouverte. La premire loi concerne lhomognit de la premire gnration (F1) lors dune hybridation. La seconde dcrit la
252

9782100544141-Laberche.fm Page 253 Jeudi, 4. fvrier 2010 3:47 15

9.2 La cration de plantes cultives

sgrgation des caractres la F2 selon des proportions bien dnies : 1/4, 1/2,1/4
dans le cas du monohybridisme. Les travaux de Mendel passrent compltement
inaperus et ne furent redcouverts quen 1900 par trois chercheurs indpendants
les uns des autres : Hugo de Vries en Hollande, Carl Correns en Allemagne et Erich
Tschermark Vienne.

La conservation des ressources gntiques

Pour introduire un caractre nouveau dans une plante, il faut disposer dindividus
disposant de ce caractre. Le slectionneur peut le rechercher dans les populations
commerciales, dans les populations locales (fermires ou de pays) mais aussi dans
les cultivars anciens. Ces derniers assurent la sauvegarde et la diversit gntique de
lespce. Ainsi pour la vigne, on sait quen 1857 des milliers de vignes sauvages
poussaient dans les forts le long du Rhin et que 90 ans plus tard seuls quelques
survivants, pouvant se dnombrer sur les doigts dune main, ont pu tre retrouvs.
On imagine alors facilement la quantit de caractres perdus. Cette conservation est
ralise par des organismes spcialiss (Centres de recherches mais aussi jardins
botaniques) qui changent leurs informations au moyen dun rseau trs structur.
Les cultivars sont prcieusement conservs

Dunod La photocopie non autorise est un dlit.

Pour le Tre rampant, qui fait lobjet de travaux de slection, dans le cadre de
lamlioration des prairies, les principales banques internationales sont :

en Nouvelle-Zlande, 900 cultivars conservs ;

aux USA, 909 ;

en Australie, 602 ;

en Russie, 509 ;

en Grande-Bretagne, 340 ;

en France, 212.

Les varits sauvages dont sont issues les plantes que lhomme exploite, constituent
aussi un trs important rservoir de gnes qui peuvent tre exploits. Ainsi chez la
laitue, Lactuca sativa L., un gne de rsistance au Brmia (maladie fongique) a t
introduit partir dun type sauvage, Lactuca scariola. Parfois les croisements
peuvent tre effectus avec des plantes appartenant des espces diffrentes, parfois
mme avec des genres diffrents. Ainsi chez la Tomate, Lycopersicum esculuntum,
des gnes de rsistance la mosaque du tabac, ont t introduits partir dune
espce voisine L. hirsutum.
Cration par hybridation chez les plantes allogames.
Lexemple du Mas

Le mas (Zea mays L.) est une Poaceae (Gramine) allogame 99 %. Ceci signifie
que sa fcondation est croise. Ce mode de fcondation lempche de se maintenir
gntiquement identique au cours des diverses gnrations qui se succdent. Le
pollen vhicul par le vent ou par les insectes apporte des caractres venus des diffrentes plantes. On est en prsence dhybrides htrozygotes.
253

9782100544141-Laberche.fm Page 254 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Le mas, comme les autres plantes allogames, manifeste deux caractres phnotypiques lis cette proprit.
1. Plus les plantes allogames sont homozygotes plus il se produit une chute de vigueur
dans le dveloppement vgtatif. On parle alors dinbreeding qui se manifeste
quand on essaie dobtenir des lignes pures par autofcondation force. Les plantes
sont naines, les pis (bien que toujours neuf rangs) portent peu dovules et le
nombre de caryopses forms est trs rduit. Ceci sapparente la consanguinit
dans le rgne animal.
2. linverse, quand on croise deux lignes pures homozygotes, les plantes obtenues
partir des graines F1 prsentent une luxuriance exceptionnelle en plus de
lhomognit. Cest leffet dhtrosis. Ce caractre, trs intressant pour lutilisateur potentiel savre par dfinition infixable. Chez le mas, tous les efforts
destins garder la vigueur hybride dans les autofcondations successives se
sont rvls vains.
Htrosis ou vigueur hybride
Lhtrosis ou vigueur hybride dsigne le croisement de lignes ou de populations
qui donne une descendance aux performances suprieures celles du meilleur
parent. Ces performances sont dautant plus importantes que les parents sont
loigns gntiquement. Ce phnomne peut sexpliquer par le fait que lhybride
cumule les allles favorables de chacun des deux parents (si les gnes favorables
sont dominants).
Ce phnomne est li aux systmes de reproduction. Il est plus fort chez les
plantes allogames que chez les plantes autogames. En effet chez les autogames,
les gnes rcessifs dfavorables tendent tre limins au cours de lvolution
par une pression de slection naturelle.
Une autre hypothse est celle de la superdominance. La supriorit de lhybride
par rapport aux parents viendrait de la supriorit de ltat htrozygote li un
certain nombre de loci : Aa suprieur AA ou aa.
Cette vigueur hybride nest pas accepte par tous. Quelques vulgarisateurs trs
engags dnient la notion dhtrosis toute vracit.

Ces contraintes ont amen les slectionneurs de plantes allogames travailler sur
des hybrides F1 qui prsentent donc la fois homognit et luxuriance. Le premier
travail du slectionneur est dobtenir des lignes pures homozygotes qui servent de
parents aux hybrides crs. Ces lignes sont obtenues par une double slection :
massale : il choisit des pis dans les collections en fonction de critres prcis,
comme la rsistance aux maladies ;
gnalogique : il cultive ces pis en lignes durant plusieurs gnrations. Les
fleurs sont autofcondes. Pour cela, elles sont ensaches avant maturit. Lorsque
le pollen est mr il est dispos sur les stigmates et lpi restera protg jusqu
maturit.
Son second travail consiste rechercher les meilleurs croisements possibles entre
les nombreuses lignes pures dont il dispose. Il teste la valeur hybride de ses lignes.
Ceci se fait gnralement avec un testeur qui est une ligne bien connue. Elle
254

9782100544141-Laberche.fm Page 255 Jeudi, 4. fvrier 2010 3:47 15

9.2 La cration de plantes cultives

permet aux caractres des diffrentes lignes pures de sexprimer. La semence issue
de ces croisements sert tablir des essais comparatifs de rendement ou de sensibilit
aux parasites. Les lignes qui se comportent mal en croisements sont limines.
La troisime tape se rsume des croisements entre les lignes retenues et
lobservation en champ des rsultats obtenus.
La dernire tape vise obtenir des graines commerciales. Thoriquement il suffit
de croiser les deux lignes pures intressantes. Mais ceci nest pas rentable conomiquement puisque sur ces plantes les pis sont trs petits et le nombre de graines
susceptibles dtre formes particulirement petit. Le slectionneur va donc croiser
une de ses lignes retenues avec un tmoin qui naffadira et ne disjoindra pas la F2
les caractres quil veut commercialiser. Lhybride F1 sera luxuriant, les pis seront
potentiellement capables de donner de nombreuses graines. Ce sera donc le pied
mre, tandis que le pollen sera apport par la seconde ligne pure. On parle alors
dhybride trois voies. Il est envisageable de croiser aussi la seconde varit avec une
ligne neutre, le pollen sera beaucoup plus abondant et la production de cet hybride
quatre voies amliore. Cependant on risque dobtenir en F2 une certaine htrognit qui doit tre accepte ou refuse en fonction des objectifs commerciaux et
conomiques que lagriculteur se donne.
Le dveloppement des hybrides a permis des progrs particulirement spectaculaires
dans les rendements de mas et dans les caractres culturaux comme la prcocit. Au
niveau des rsistances aux maladies les progrs sont beaucoup plus difficiles car
bien souvent des gnes de rsistance ne sont pas ports par des chromosomes. Les
biotechnologies et la biologie molculaire apportent dans certains cas une solution
originale, mme si elle est fort controverse, comme ceci sera vu dans quelques pages.

Dunod La photocopie non autorise est un dlit.

Mise en uvre des rsultats de la recherche agronomique


Les techniques dobtention des hybrides de mas, en vue de la commercialisation
des semences, sont trs prcises et trs contrles. Les agriculteurs sous contrat
cultivent 8 9 ranges de ligne mre en alternance avec une range de ligne
pre . Les premiers sont castrs manuellement ou mcaniquement pour viter
lautofcondation. Seuls les pis rcolts sur les pieds mres seront commercialiss en semences hybrides.
Les techniques dobtention dhybrides ont connu un trs important dveloppement
ces dernires annes dans toutes les branches de lhorticulture. Les tomates actuelles
sont des hybrides F1 et ce depuis H63/4 datant des annes 1970 jusqu Maestria
mais aussi Philovita reconnues pour leur belle couleur, leur fermet, leur rsistance
lclatement et leurs hautes tolrances au mildiou. Ces techniques concernent
aussi beaucoup dautres plantes alimentaires (melon, vigne) et aussi orales
(ptunia, granium) ou industrielles.

Lobtention de varits nouvelles chez les plantes autogames : cas du bl

Le bl est une plante autogame. Ceci signifie quelle sautofconde et accrot de ce


fait son caractre homozygote. Cest un moyen de dfense contre lapport de gnes
extrieurs qui pourraient contrarier les caractres adaptatifs un milieu donn.
Il est pourtant intressant de vouloir introduire des caractres nouveaux, comme
des rsistances aux maladies. Il faudra donc dans un premier temps introduire le
255

9782100544141-Laberche.fm Page 256 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

gne par hybridation puis le fixer par la mthode des rtrocroisements ou back-cross,
bien connus en gntique.
Le premier travail de lexprimentateur consiste, comme pour le mas, de choisir
les gniteurs. Il est souvent guid par un certain empirisme car si le gniteur
prsente obligatoirement les caractres recherchs, on nest nullement certain que la
transmission souhaite sera ralise. Lhybridation vient ensuite. Elle ne prsente
pas de difficults majeures (sauf chez lavoine et le riz pour lesquels les taux de
succs sont souvent faibles).
Les techniques dhybridation. Lhybridation artificielle consiste raliser une allofcondation force. Il est donc indispensable que lovaire de la plante mre soit
rceptif pendant la priode o le slectionneur dispose dun pollen viable fourni par
la plante-pre. Ceci est obtenu grce des semis chelonns des deux gniteurs. La
castration des fleurs est ralise manuellement, avec des pinces fines. Lpi castr, le
pied femelle, est ensach ce qui le protge des pollinisations. La pollinisation est
ensuite ralise. La F1 est constitue de plantes htrozygotes semblables entre elles.
La slection. Elle consiste choisir dans les descendances dun croisement les individus qui montrent les caractres recherchs prsents chez les parents. Ces individus
sont choisis, rcolts et multiplis en vue dobtenir une ligne fixe, stable. Quatre
techniques de slection sont actuellement utilises en Europe.
1. La mthode des populations hybrides
Cette mthode dcrite par Nillson-Ehle en 1925 est connue sous le nom de
mthode de Svalf ou bulk-mthod. La F1 est cultive en mlange puis rcolte
aprs limination des plants aux caractres parentaux. Elle est battue et resseme
en mlange dannes en annes. Les lois de la gntique disent que le pourcentage
dhtrozygotes va dcrotre avec le temps. Dans la pratique, au bout de sept
neuf ans, les individus homozygotes qui portent les caractres intressants
constituent la majeure partie de la population. Cette mthode est utilise dans la
slection du bl dur et savre efficace pour la slection de varits rsistantes
aux maladies fongiques comme le pitin (Pseudocercosporella herpotrichoides
Derghton, Dematiaceae).
2. La mthode pedigree ou mthode de slection gnalogique
Mise au point par Ducomet et Crespin dans les annes 1921 1925, elle est, depuis
cette date, trs utilise en France et dans de nombreux pays.
Les plantes F1 sont rcoltes et battues sparment. Les grains ainsi rcolts sont
sems en ppinire faible densit, de manire obtenir pour chaque croisement
plusieurs milliers de plantes F2. Cest sur cette gnration que le slectionneur
commence travailler. Systmatiquement, il pratique une slection en liminant
les rcessifs et toutes les plantes portant des caractres indsirables. Le choix en
F2 est donc trs alatoire. Il peut esprer que le ou les gnotypes recherchs se
trouvent bien dans les plantes F2 conserves. Les pis choisis constituent aprs
semis la F3 o les slectionneurs effectuent de nouveau une slection et ainsi de
suite. Ds que les lignes paraissent suffisamment homognes, leur produit est
sem ce qui permet destimer trs rapidement les caractres culturaux (rendement,
rsistance la verse) En F8-F9, on obtient des lignes homozygotes fixes.
256

9782100544141-Laberche.fm Page 257 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

9.2 La cration de plantes cultives

3. La mthode de slection diffre


Cette mthode, est une adaptation des deux mthodes prcdentes. Elle est souvent
dsigne par le nom de ses promoteurs, Lupton et Lukhianenko. Pendant les
premires gnrations, jusquaux F3-F4, on utilise les techniques de la slection
gnalogique. Le slectionneur dispose de lignes possdant dj une certaine
homognit gntique. Adoptant la mthode des populations hybrides, les descendances sont cultives en bulk et compares entre elles pendant plusieurs annes
grce des essais varitaux. Cest une technique intressante pour la slection de
caractres hrdit quantitative, comme le rendement ou la qualit. Par contre,
elle parat moins adapte quand on a affaire des allles rcessifs (nanisme,
rsistance certaines maladies, etc.) moins de ne rcolter dans les premires
gnrations que les seuls gnotypes rcessifs homozygotes, ce qui techniquement
est difficile pratiquer.
4. Hybridations complexes, rtrocroisements ou back-cross, introgression
Lorsque lun des gniteurs, porte une caractristique recherche comme la rsistance une maladie, force est de constater que, malheureusement, ce caractre
est souvent trs dgradant sur le plan de la productivit. Il est alors ncessaire de
transfrer le gne recherch dans une ligne dj de bonne valeur culturale. On
fait alors appel la mthode des rtrocroisements ou back-cross (avec le parent
rcessif). Les exemples de croisements en back-cross sont nombreux. Ils concernent souvent des lignes rsistantes des maladies. Un exemple dj ancien
concerne le cas de la varit descourgeon dhiver (Hordeum vulgare L. Poaceae)
Robur, productive, rsistante la verse, mais sensible lodium (Blumeria
graminis Speer Erysiphaceae). Par la mthode du back-cross, il est possible
dobtenir une nouvelle varit, comparable Robur sur le plan des caractres
agronomiques. mais rsistante lodium. Un premier croisement permet dobtenir
une F1 possdant un allle dominant de rsistance R provenant de la varit
Engledoit-India, rsistante lodium et un allle rcessif de sensibilit de Robur.
Cette F1 (Rr) est alors recroise avec le parent rcurrent. Elle va donner une
descendance comportant 50 % de plantes rsistantes (RR), et 50 % de plantes
(Rr). Le back-cross peut tre rpt. Aprs quatre ou cinq back-cross, il nexistera,
parmi les plantes rsistantes, pratiquement plus que des individus RR, cest-dire comportant lensemble de son patrimoine gntique, mais avec lallle de
rsistance lodium la place de lallle de sensibilit.
Quand slection rime avec perdition
Historiquement, le mas savait se dfendre contre la chrysomle des racines
(Diabrotica virgifera LeConte, Chrysomelideae) qui est un petit coloptre de 5
6 mm de long, sattaquant aux racines des mas. Pour ce faire, le mas mettait
une substance qui attirait les nmatodes lesquels tuaient les larves indsirables et
le dlivraient de son ravageur. Cette aptitude tait trs intressante car originaire
dAmrique centrale, la chrysomle a progressivement envahi lAmrique du Nord
pour devenir le principal ravageur du mas. Mais surtout, elle a t signale pour
la premire fois en Europe en 1992, en Rpublique fdrale de Yougoslavie (Serbie),
prs de laroport international de Belgrade et plus rcemment, puis en 2002,
257

9782100544141-Laberche.fm Page 258 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

deux foyers ont t dcouverts proximit des aroports parisiens de Roissy et


dOrly.
Malheureusement, daprs une quipe de luniversit de Neuchtel, en Suisse, cette
facult du mas se dfendre contre la chrysomle aurait t perdue au cours des
processus de slection mens en Amrique du Nord. En consquence, aux tatsUnis les agriculteurs ont essentiellement recours aux pesticides pour lutter contre
cet insecte en y consacrant plus dun milliard de dollars par an. La rgion Ile-deFrance quant elle, a privilgi la rotation des cultures ce qui a permis dradiquer
lensemble des foyers franciliens.

Lobtention despces nouvelles par hybridation intergntique :


le triticale (Triticosecale Witton ex A. Camus, Poaceae)

Tous les mcanismes dobtention de varits nouvelles prcdemment dcrits concernaient des croisements intraspcifiques, cest--dire des croisements entre des plantes
appartenant la mme espce. Au pire, et ctait le cas de lintroduction du gne de
rsistance au Brmia dans la laitue, lhybridation se faisait entre deux espces trs
voisines. Il est possible dobtenir des hybrides intergnriques. Contrairement ce
que lon peut imaginer lobtention dhybrides intergnriques nest pas nouvelle,
puisque, ds 1876, des tentatives de croisements entre genres voisins ont t ralises.
Mais lexemple le plus spectaculaire est celui des hybrides bl seigle : triticale
(Triticum Secale). Le gnome du bl tendre (n = 21, ABC) nayant aucune affinit avec
celui du seigle S (n = 7), la F1 est strile. Elle possde les quatre gnomes A B C + S
soit n = 28 (21 + 7). Le traitement la colchicine de la F1 permet dobtenir un
doublement chromosomique ; cest une allopolyplodie 6n. On a alors affaire un
triticale 56 chromosomes (2 28). Ces triticales primaires sont assez peu
intressants, mais par croisements entre eux, il est possible dobtenir des varits
agronomiquement trs intressantes quant la rusticit et la richesse en protines.
Des progrs agronomiques certes, mais quel prix?
Utilisant des techniques copies sur les processus naturels de cration et de slection
des espces nouvelles, lhomme depuis une quarantaine dannes a augment
la productivit des espces cultives dans des proportions considrables. Cette
cration, associe aux nouvelles techniques culturales, dont des fertilisations
raisonnes, a permis au bl datteindre en France plus de 100 quintaux par hectare,
pour le mas grains, les rsultats sont encore plus spectaculaires (de 12,5 q/ha
en 1950 84 q/ha en 1996) et la tomate, premier lgume consomm par les
Franais, de passer de 200 grammes au m2 dans les cultures de plein champ vers
1965 plus de 20 kg du m2 actuellement dans les cultures sous abri. Cette augmentation de la productivit sest accompagne, dune perte de la biodiversit par la
disparition des races locales et par la dgradation, au niveau des consommateurs,
des qualits organoleptiques des produits (la tomate et la fraise en sont de dmonstratifs, et bien tristes, exemples). Ceci est d au fait que pendant longtemps les
critres de got ntaient gure pris en compte. Ils venaient bien aprs les critres
agronomiques de productivit et de rsistance aux parasites, ou commerciaux
comme la fermet, permettant une mcanisation des emballages, et la conservation
des produits. Pour avoir nglig ces aspects, pour navoir pas su communiquer,
258

9782100544141-Laberche.fm Page 259 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

les slectionneurs se sont coups des consommateurs qui en raction privilgient


les productions traditionnelles voire biologiques.
Cette fracture est profonde et ce nest pas la mise sur le march dorganismes
gntiquement modis (OGM) qui rconciliera slectionneurs et consommateurs.

9.3 LES

CULTURES IN VITRO

Dunod La photocopie non autorise est un dlit.

On appelle culture in vitro un corpus de mthodes faisant intervenir dune part des
lments dasepsie et dautre part impliquant la mise en place dun environnement
parfaitement contrl. (J.-P. Zrd dans Cultures de cellules, tissus et organes vgtaux.
Presses polytechniques et universitaires romandes).
Les prmices de la culture in vitro dorganes isols se trouvent dans les travaux
dHaberland en 1902. Elles se dveloppent avec Rablens (1932) qui a obtenu des
cultures de pointes isoles de racines. Mais les cultures in vitro prennent leur essor
notablement grce aux travaux de White (1932) et de Gautheret partir de 1934.
Celui-ci obtenait des prolifrations cellulaires partir de tissus cambiaux darbres.
Chez les vgtaux, dans les cultures in vitro, il sagit de faire pousser en milieu
aseptique des plantes entires, des fragments, des organes, voire des cellules, dans
des milieux liquides ou solides, parfaitement dtermins et dans des conditions
environnementales (temprature et photopriode) bien prcises. Les fondements des
cultures in vitro, reposent le fait que les cellules vgtales sont totipotentes. Cette
qualit fondamentale signifie que des cellules de tissus dj spcialiss, donc
diffrencies, peuvent dabord perdre cette spcialisation en revenant un tat
mristmatique, puis se rediffrencier pour donner des cellules dun autre tissu.
Souvent ce stade ddiffrenci sobserve dans un cal, qui est un massif de cellules
mristmatiques (fig. 9.4). Chaque cellule possde la totalit de linformation
gntique qui permet lorganisation et le fonctionnement de la plante dans son
entier. Dans un tissu diffrenci, seule une partie du matriel gntique est exploite.
Quand la cellule se ddiffrencie, la totalit du matriel gntique est de nouveau
potentiellement actif. Le programme de diffrenciation cellulaire peut donc repartir
Cellules
ddiffrencies
Cal

Cellules
diffrencies
Tige

Cellules
diffrencies
Racines, Tige

Figure 9.4 Expression de la totipotence chez les cellules vgtales.


Lexemple pris correspond un bouturage.

259

9782100544141-Laberche.fm Page 260 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

dans un sens ou un autre. Ainsi lors dune bouture de feuille, les cellules de la base
du ptiole vont (en se multipliant) se ddiffrencier et former un cal. Les nouvelles
cellules mristmatiques pourront se diffrencier en cellules de racines, permettant le
dveloppement racinaire. Cette totipotence est une caractristique fondamentale
des cellules vgtales que lon ne retrouve pas chez les animaux suprieurs. Certes, il
peut arriver que la cellule animale perde les attributs acquis lors de sa diffrenciation
et prolifre de nouveau mais celle ci ne donnera que la mme catgorie de cellules
mme si lobtention de cellules souches laisse entrevoir de nouvelles et intressantes
possibilits thrapeutiques.
Ce sont gnralement les rgulateurs de croissance qui en culture in vitro permettent
dorienter le programme cellulaire vers les cals, les bourgeons, les racines ou mme
la rgnration de la plante entire.

9.3.1 Les rgulateurs de croissance


Chez les vgtaux les processus de croissance et de dveloppement sont contrls
par des substances synthtises par le vgtal et efficaces trs petites doses. Trois
grandes classes de rgulateurs de croissance sont bien connues : les auxines, les
gibbrellines et les cytokinines. Les physiologistes y ajoutent aussi souvent lacide
abscissique et lthylne. Plus rcemment dautres auteurs y joignent les polyamines,
les oligopeptides, lacide jasmonique
Dans le cadre de ce chapitre, seuls les trois premiers seront tudis. Ils interviennent
grandement, soit directement soit surtout par leurs drivs synthtiques, dans la
prparation des milieux de culture in vitro.
Hormones vgtales ou rgulateur de croissance?
Souvent on parle dhormones vgtales, par mimtisme avec les hormones animales.
Ces dernires sont produites dans des glandes spcialises et dverses dans le sang
qui les vhicule. Elles agissent sur des cellules cibles et leur action est spcique.
Chez les vgtaux les substances de croissance ont des lieux de synthse, des
moyens de transport et des modes daction forts diffrents. Il est donc plus
logique de rserver le mot hormone pour le monde animal et prfrer lexpression
rgulateurs de croissance pour le monde vgtal.

a) Les auxines
Lauxine est le premier rgulateur de croissance dcouvert chez les vgtaux. Les
observations initiales sur cette substance datent de 1919-1925. Elles ont t effectues
dans des laboratoires dUtrecht en Hollande essentiellement par Went et son quipe.
Cest sur le colptile davoine quils mirent en vidence son action. Puisquelle
facilitait llongation cellulaire donc lauxse, ils la qualifirent dauxine. Elle a t
identifie en 1935 par Kgl. Cest lacide indolyl-3b-actique (AIA), (fig. 9.5). souvent
aussi dnomm IAA, labrviation anglo-saxone de lindolyl-acetic-acid.
Plusieurs actions sont connues lauxine.
Une action stimulatrice de llongation cellulaire. Elle favorise la plasticit et
llasticit de la paroi.
260

9782100544141-Laberche.fm Page 261 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

acide indolyl-3-actique AIA

acide-1-3-butyrique AIB

acide naphtalne actique ANA

acide-2-4-dichlorophnoxy-actique 2.4.D

Figure 9.5 Formules de lacide indolyl-b-actique (AIA) a


et de quelques auxines artificielles: b AIB, c ANA, d 2-4 D.

Un pouvoir rhizognique trs important. Mais cette action est complexe. En effet,
lauxine induit dans un premier temps lorganogense, puis soppose leur
longation.
Lauxine est synthtise dans les apex caulinaires au niveau des mristmes et des
jeunes feuilles. Elle migre ensuite vers les racines par le phlome de prfrence, bien
que tous les tissus soient aptes ce transport. Une faible partie peut monter cependant vers les parties apicales de la plante. La proprit de lAIA sur la rhizogense est
trs utilise en culture in vitro. Cependant cette substance prsente linconvnient
dtre la fois thermolabile et photolabile ce qui est incompatible avec lautoclavage
des milieux de culture. On utilise des substances de synthse (prnommes les auxines),
qui sont des drivs proches de lAIA tout en ne prsentant pas ses inconvnients.
De plus, bien souvent elles ont des proprits rhizogntiques plus importantes.
Parmi ces auxines de synthse, lacide b-indolyl-butyrique (AIB) et lacide naphtalylactique (ANA) sont les plus frquemment utiliss. Lacide 2,4-dichloro phnoxyactique (2,4-D) est trs actif dans linduction de lembryogense somatique (formation
dembryons sur un cal sans passer par un zygote).

Dunod La photocopie non autorise est un dlit.

Auxines et agriculture
Les auxines favorisant la rhizogense, de nombreux produits commerciaux destins
au bouturage (poudres, ptes ou solutions) en contiennent. Les auxines permettent aussi le dveloppement parthnocarpique des fruits (tomate, melon) do
son utilisation frquente en horticulture. Le 2,4-D, quant lui, est un compos
rapidement toxique fortes doses. Il constitue alors un dsherbant trs efcace
contre le Liseron (Convolvulus arvensis L. Convolvulaceae). De mme, lacide mthylchloro-phnoxy-actique (MCPA) (auxine de synthse) est lun des constituants
essentiels des dbroussaillants communment utiliss.

b) Les gibbrellines
Les gibbrellines (GA) sont des rgulateurs de croissance dcouvertes par Yabuta et
Hayashi en 1939. Ils les ont extraites dun riz parasit par un champignon ascomycte
261

9782100544141-Laberche.fm Page 262 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

le Gibberella fujikuroi qui prsentait un allongement des tiges important et anormal.


Les gibbrellines (car elles sont prs dune centaine, toutes naturelles) sont des drivs
terpniques. Elles possdent une structure de base : le noyau gibbrellane (ou gibbane)
constitu dun cycle cinq carbones entour par deux cycles six carbones et
prsentant un, voire deux ponts, entre diffrents sommets carbons. Parmi cette
famille trs riche de rgulateurs, le compos le plus commun est lacide gibbrellique
(ou GA3) qui est couramment utilis en culture in vitro (fig. 9.6).
Figure 9.6 Structure
de la gibbrelline GA3.

Les gibbrellines ont un effet stimulateur sur llongation des entre-nuds.


provoqu par un grandissement des cellules. Elles sont synthtises dans tous les
sites de multiplication cellulaire intense comme les apex des tiges et des racines
ainsi que dans les jeunes feuilles et les embryons. partir de ces lieux de production,
les GA sont distribues dans toute la plante. Lors de leur germination, les embryons
dorge et davoine librent de grandes quantits de GA. Elles stimulent, au niveau de
la couche aleurones, la production damylase qui, diffusant dans lalbumen, permet
la libration de sucres utiliss pour le dveloppement de lembryon.
En culture in vitro les gibbrellines sont utilises pour lever la dormance des
bourgeons et allonger les tiges trop compactes. Elles agiraient alors en sopposant
lacide abscissique responsable du maintien de la dormance.

c) Les cytokinines
Les cytokinines sont des rgulateurs de croissance dcouverts par Skoog en 1956 en
travaillant sur le lait de la noix de coco immature, puis sur des produits de dgradation de lADN. Les cytokinines stimulent la multiplication cellulaire mais en
prsence dauxines. Alors que les auxines participent la croissance en augmentant
la taille des cellules, les cytokinines y sont impliques en augmentant le nombre de
ces cellules. Ceci se fait en fonction dquilibres auxines/cytokinines dterminant
lorganogense (fig. 9.7).
Auxines

Cytokinines
rhizogense, boutures
embryogense
rhizogense cals
callogense
bourgeons adventifs
bourgeons axillaires

262

Figure 9.7 quilibres


auxines/cytokinines dterminant
lorganogense en cultures in vitro.

9782100544141-Laberche.fm Page 263 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

Les cytokinines naturelles sont des adnines substitues. Les plus rpandues sont
lisopentnyl-adnine, la zatine, la dihydrozatine et la kintine. La zatine doit son
nom au Mas (Zea mays) dans lequel elle a t dcouverte (fig. 9.8).

a : 6-(2 furfuryl) aminopurine

b : 6-(4 hydroxy-3-mthylbut-2-ryl) aminopurine

Figure 9.8 Formule de deux cytokinines.


a, kintine ; b, zatine.

En plus de leur proprit fondamentale de stimulation de la multiplication cellulaire,


les cytokinines induisent la formation de bourgeons et la croissance de ceux qui sont
inhibs, tels que ceux soumis la dominance apicale par exemple. En revanche, elles
sopposent au dveloppement des racines. Ce sont des proprits trs intressantes
pour les cultures in vitro et rares sont les milieux ne contenant pas de cytokinines.
Les racines sont les sites privilgis de synthse des cytokinines puis circulent dans
le vgtal avec la sve brute.
ct des cytokinines naturelles, il en existe qui proviennent de synthses chimiques.
Tel est le cas de la benzyl-aminopurine (BAP). De mme certaines ures substitues
peuvent prsenter des proprits biologiques des cytokinines (la diphnylure et son
driv, le thidiazuron).

9.3.2 Lutilisation des cultures in vitro


Actuellement les cultures in vitro sont utilises dans plusieurs domaines comme :
la micropropagation, lobtention de plantes haplodes, le transfert de gnes et la
production de mtabolites secondaires.

Dunod La photocopie non autorise est un dlit.

a) La micropropagation chez la pomme de terre


Cest en 1977, que Nozeran luniversit de Paris-Orsay a propos une technique de
multiplication rapide de la pomme de terre, Solanum tuberosum L., reposant sur les
techniques de culture in vitro. Elle consiste prlever sur des tubercules des germes,
les passer pendant 30 secondes dans de lalcool 70 C puis de les dsinfecter dans
une solution dhypochlorite de calcium 65 grammes par litre durant une vingtaine de
minutes, enfin de les rincer plusieurs fois dans de leau strile. Les germes sont ensuite
fractionns en fragments comportant au moins un nud. Ceux-ci sont implants
dans un milieu axnique glos (milieu de Knop dilue de moiti additionn doligolments, de chlate de fer et de saccharose). Les tubes sont placs en chambre de
culture une temprature de 22 C et clairs durant 12 heures avec un clairage
avoisinant les 120 W par m2.
263

9782100544141-Laberche.fm Page 264 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Dans ces conditions, le bourgeon du nud donne naissance une tige vigoureuse
feuilles dun cm2 environ, pouvant tre simples dabord, composes ensuite, comme
celles de ladulte. Au bout de trois semaines ces boutures peuvent servir de pied mre.
Les tiges sont sectionnes entre deux nuds, et les fragments repiqus aseptiquement
sur un milieu neuf. Le rameau issu du bourgeon axillaire va son tour se dvelopper.
Au bout de quelques repiquages, les plantes obtenues deviennent progressivement
comparables celles issues de germination dune graine, elles prsentent une tige grle,
portant des feuilles simples de petite taille.
Cette multiplication est une micropropagation. Cette technique ne fait donc
quacclrer le fonctionnement normal des mristmes de bourgeons dj forms sur
une plante. On lutilise pour multiplier aussi bien lillet (Dianthus caryophyllus L.
Caryophyllaceae) que le chrysanthme. Il peut arriver que les bourgeons ne soient
pas prsents sur lexplant comme chez le Saintpaulia (Saintpaulia ionantha H. Wendl,
Gesneriaceae). Lexplant est alors un fragment de limbe foliaire ou de ptiole. Il
faut ajouter au milieu de culture des rgulateurs de croissance comme lAIB
0,5 mM et de la BAP 0,1 mM. En quelques semaines apparaissent des bourgeons
noforms comportant quelques feuilles en rosette et trs peu de racines. Repiqus sur
un milieu contenant deux fois moins de BAP, on favorise lenracinement mais aussi
le dveloppement de bourgeons axillaires qui pourront servir pour des repiquages
ultrieurs. La difficult dans la micropropagation rside plus dans le passage de la
plante du tube latmosphre ambiant qu la mise au point de milieux nutritifs.
Nombreuses applications agronomiques et horticoles
Plusieurs utilisations pratiques de la micropropagation en cultures in vitro sont bien
connues (rosiers, chrysanthmes). Mais une autre application, moins mdiatise est
trs importante. Il sagit de la reconstitution de clones sains. En effet, chez la pomme
de terre, la multiplication vgtative normale favorise laccumulation de virus qui
diminuent le dveloppement vgtatif des plants et par l mme les rendements.
Ces virus restent dans les tubercules ce qui fait que de gnrations en gnrations,
le nombre de plantes infectes augmente. Les virus ne sont pas dans les mristmes
mais dans les cellules parenchymateuses. Or linfection des cellules formes lors des
cultures in vitro est moins rapide que le dveloppement des tiges, ce qui fait que
progressivement et grce aux repiquages successifs on peut obtenir des plants
indemnes de virus. Morel et Martin en 1955 ont ainsi rgnr la varit de pomme
de terre Belle de Fontenay . Depuis, la technique sest rapidement tendue de
nombreuses espces de plantes horticoles (fraisier, artichaut) ou orales (illet,
lis) mais galement a des vgtaux ligneux (groseillier, vigne) et diverses
espces tropicales (ananas).

b) Lobtention de plantes haplodes


La cration de varits nouvelles demande lutilisation de plantes homogygotes.
Classiquement on utilise les autofcondations avec tous les effets secondaires qui
ont t dcrits prcdemment. Les cultures in vitro offrent une nouvelle possibilit
dobtenir immdiatement des plantes strictement homozygotes. Des cellules haplodes
isoles, cultives artificiellement en milieu strile sont capables, seules, de redonner
des plantes. Elles ne contiennent quun lot de chromosomes. Elles sont donc haplodes
264

9782100544141-Laberche.fm Page 265 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

et ont le dfaut dtre striles, donc de ne pas pouvoir former de graines. Si lunique
lot de chromosomes est doubl laide de colchicine, les plantes deviennent
diplodes, homozygotes et fertiles.
Landrogense

Guha et Maheshwari en 1964, ont t les premiers avoir russi la production


dembryons haplodes partir de cultures dtamines de Datura (Solanaceae). Aprs
dissection des fleurs, les anthres remplies de grains de pollen haplodes sont disposes
de manire strile sur des milieux de culture contenant des rgulateurs de croissance.

tamine

fleur

miose
miose

grains
de pollen

sac embryonnaire
embryon

cal
cal

Dunod La photocopie non autorise est un dlit.

ANDROGENSE

GYNOGENSE
plante haplode
AUTODOUBLEMENT
DES CHROMOSOMES

Figure 9.9 Schma


de landrogense
et de la gynogense
(daprs Defoug, modifi).

PLANTE DIPLODE

265

9782100544141-Laberche.fm Page 266 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Aprs environ trois semaines, les grains de pollen dans lanthre se divisent pour
former des cals o se diffrencient des embryons somatiques (fig. 9.9). Ceux-ci sont
alors transfrs sur une squence de milieux artificiels, gnralement peu pourvus en
rgulateurs de croissance. La rgnration complte est obtenue. Un autodoublement
des chromosomes est cependant ncessaire pour que ces plantes redeviennent
diplodes donc fertiles.
Depuis, landrogense a t applique sur de nombreuses espces comme par exemple sur le bl, le riz, le piment, lorge ainsi que sur lasperge et le tabac, etc. (fig. 9.10).

Figure 9.10 Jeunes


embryons de Datura
innoxia Mill. haplodes,
apparaissant
sur des tamines
cultives strilement
(clich R.B.Sangwan,
Laboratoire Androgense
et Biotechnologie,
UPJV. Amiens).

La gynogense

En 1976, San Orsay, a obtenu les premires plantes haplodes dorge, partir dovules
non fconds. La technique est pratiquement la mme que pour les anthres, mais il
est beaucoup plus difficile de prlever dans les ovules les sacs embryonnaires. Au plus
tt aprs un mois de culture, plus gnralement entre trois et six mois, loosphre et
les deux antipodes subissent des divisions, qui sont lorigine de cals. Sur ceux-ci se
dveloppent des embryons somatiques qui, repiqus plusieurs fois, donneront des
plantes haplodes (fig. 9.9). Depuis, la gynogense a t tendue dautres plantes,
mme si elle est techniquement plus dlicate que landrogense. Elle a t pratique
sur le tabac, la laitue, le riz, le gerbra mais aussi la betterave sucrire.
Lintrt des plantes haplodes est important. Dabord pour le slectionneur puisquil
est capable dobtenir, rapidement, des plantes homozygotes, mais aussi pour le
gnticien qui peut, ainsi, faire des analyses gntiques plus aisment.

c) Les organismes gntiquement modis


Objets dimpressionnantes campagnes mdiatiques, mettant dans lembarras bien des
autorits politiques, les organismes gntiquement modifis (OGM) sont des tres vivants
266

9782100544141-Laberche.fm Page 267 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

chez qui lhomme a introduit par des techniques de gntique non mendlienne, un ou
plusieurs gnes dintrt. Dans ce paragraphe, seuls des OGM vgtaux seront abords.
Quelques grandes dates du gnie gntique et les plantes
1973. Identication du plasmide Ti dans la bactrie Agrobacterium tumefaciens.
Ce plasmide permet daccueillir le gne porteur dun caractre recherch, quil est
en mesure dintroduire dans le gnome dune plante.
1983. Premire plante transgnique, le tabac, rsistant un antibiotique.
1985. Premire plante transgnique rsistante un insecte.
1988. Premire crale transgnique.
1994. Premier lgume transgnique commercialis aux tats-Unis, la tomate.
1997. Premier tabac producteur dhmoglobine

Lisolement et la multiplication des gnes

Une fois repr, gnralement dans une banque de gnes, il faut isoler le gne afin de
pouvoir le transfrer. Les techniques mises en uvre sont du domaine de la biochimie
molculaire. Elles utilisent des enzymes de restriction dites aussi endonuclases,
extraites de bactries. Elles coupent lADN de faon spcifique et reproductible en
fragments de restriction.
Identification des gnes par PCR

Dunod La photocopie non autorise est un dlit.

Lidentication des fragments de restriction obtenus est possible par la mthode de


Southern (du nom de son inventeur). Lors dune lectrophorse sur gel les deux
brins se sparent, mais il faut les identier. Ceci est possible en les faisant ragir
avec des sondes, constitues par des fragments dADN simple brin dj identis.
Quand une sonde rencontre un brin dADN complmentaire, ils sassemblent ralisant une hybridation molculaire. Lidentication devient possible pour peu quils
subissent une raction damplication (mthode de la Polymerase Chain Reaction,
PCR) qui permet de multiplier les fragments dADN hybrides.

Cette reconnaissance des gnes et leur obtention, ne prsenterait quun intrt


restreint si lADN ntait pas dou de la proprit de pouvoir se recombiner aussi bien
de manire intra- quextracellulaire et avec dautres ADN quils soient dorigine vgtale ou animale. Ceci permet de reproduire le gne en grande quantit en linsrant
dans une bactrie qui se multiplie trs vite (Escherichia coli par exemple). Il est ensuite
introduit dans une bactrie qui permettra le transfert chez le vgtal. Le plus souvent,
il sagit dAgrobacterium tumefaciens.
Le transfert

Les mthodes utilises pour assurer la transformation gntique peuvent tre classes
en deux groupes : 1. les mthodes utilisant un vecteur biologique ; 2. les techniques
de transfert direct dADN par bombardement de microprojectiles et microinjection.
1. Le transfert par Agrobacterium tumefaciens. Agrobacterium tumefaciens est une
bactrie du sol, Gram ngative, de la famille des Rhizobiaceae. Cest un agent pathogne chez un grand nombre de plantes Dicotyldones et de quelques Gymnospermes.
Linfection dune blessure dune tomate par A. tumefaciens, provoque la prolifration
267

9782100544141-Laberche.fm Page 268 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

dune masse de cellules indiffrencies au niveau du collet, formant une galle. Depuis
1992, grce aux travaux de Zambryski, on sait que cette maladie appele galle du
collet , ou crown gall rsulte de la capacit de ces Agrobactries de transfrer
dans le gnome des plantes, un fragment de leur ADN plasmidal : lADN-T.
Le plasmide T1
Les gnes transfrs par A. tumefaciens proviennent du plasmide Ti (i pour inducteur
de tumeur, Tumor inducing). Cest une molcule dADN circulaire qui se rplique
indpendamment du chromosome et dont la prsence nest pas essentielle la
viabilit des bactries. Ce plasmide de 200 kilobases environ prsente cinq rgions
principales (g. 9.11) : la rgion T (ADN-T), la rgion de virulence (rgion Vir), la
rgion portant les gnes de catabolisme des opines, la rgion du rplicateur et la
rgion de transfert par conjugaison. Seules les deux premires rgions ont un rle
direct dans le phnomne dinduction.
LADN-T est le fragment dADN simple brin transfr dans la cellule vgtale. Il est
dlimit par deux squences de quelques kilobases : droite (RB 7kb) et gauche
(LB 14 Kb). Entre elles, se trouvent deux zones distinctes.
La zone oncogne qui porte les gnes responsables de la prolifration cellulaire.
Les deux premiers tmS1, tmS2 codent pour des synthses denzymes (tryptophane oxygnase et indolactamide hydrolase) qui catalysent la biosynthse
dauxines. Le dernier gne, tmr, code aussi pour une enzyme (isopentenyltransfrase) qui intervient dans la synthse des cytokinines.
La zone de synthse dopines.
La rgion de virulence, (rgion vir) est adjacente la bordure gauche de la rgion de
lADN-T. Elle comprend de nombreux gnes regroups en oprons (gnralement
huit). Ceux ci sont impliqus dans les phnomnes de reconnaissance de la cellule
vgtale, mais aussi dans le transfert de lADN-T. Lors de lutilisation des Agrobactries, cette rgion de virulence est supprime. On dit que la bactrie est dsarme.
oncognicit
synthse dopine
LB

RB
T
catabolisme dopine

virulence

transfert entre bactries


rplication

Figure 9.11 Reprsentation schmatique dun plasmide Ti


(daprs Hooykaas et Schilperoort, 1992) (explications dans le texte).

Dans cet ADN-T, seules les bordures interviennent dans son transfert. On peut donc
substituer au fragment dADN compris entre les deux bordures un autre fragment
268

9782100544141-Laberche.fm Page 269 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

dADN intressant inclure dans le patrimoine gntique de la plante. Ces fragments


exognes sont des gnes classs en trois catgories :
Les gnes marqueurs de slection. Ils permettent une slection facile et efficace des
cellules transformes. Ainsi le gne npt II code pour la nomycine phosphotransfrase
et confre la rsistance la kanamycine. Ce marqueur de slection, maintenant
abandonn, tait trs utilis par les biologistes car il suffisait de rajouter au milieu
de culture de la kanamycine pour liminer thoriquement toutes les cellules non
transformes puisque spontanment cet antibiotique est ltal pour les plantes.
Les gnes rapporteurs. Ils permettent de confirmer ltat transgnique des cellules.
Par exemple le gne uid A (Gus) code pour la b-glucuronidase capable dhydrolyser
certains composs glucuroniques. En prsence de lacide 5 bromo-4 chloro-3
(indolyl glucuronique) cette enzyme provoque une coloration bleue.
Des gnes dintrt. Ce sont des gnes insrs pour influencer gntiquement les
vgtaux. Ils sont encore relativement peu nombreux et ont des actions varies.
Ainsi le gne Cry IA de Bacillus thuringiensis qui code pour une d-endotoxine
entrane une augmentation de la rsistance aux insectes chez la pomme de terre ;
le gne P5CR code pour la d-1-pyrroline-5-carboxylase rductase, or cette enzyme
permet la synthse de proline
Les deux extrmits de lADN-T contiennent le promoteur et le terminateur spcifiques de la plante et de lorganisme. Ils servent lexpression du gne. Provenant
des bactries, ils ne peuvent servir pour lexpression du gne dans la plante. Aussi
doivent-ils tre limins et remplacs par des terminaisons efficaces.
2. Le transfert direct. Beaucoup de plantes, et parmi elles les Gramines (Poaceae),
ne peuvent tre transformes par les Agrobactries. Dans ce cas, on utilise des fragments dADN injects directement lintrieur des cellules vgtales, soit laide
dune micropipette, soit par lutilisation de chocs lectriques, soit par bombardement
de microbilles. Ces techniques sont alatoires et le pourcentage de russite est trs
faible. nanmoins, elles restent intressantes pour les espces insensibles aux bactries.

Dunod La photocopie non autorise est un dlit.

Agrobacterium tumefaciens et A. rhizogenes : des actions diffrentes


ct dAgrobacterium tumefaciens existe un autre vecteur de transformation. Il
sagit dAgrobacterium rhizogenes. ltat naturel des gnes Rol A, B et C mis en
vidence sur lADN-T provoquent un drglement de la balance hormonale en transformant un indoxyl-glucoside en AIA. Il se produit alors une formation anarchique
de racines. Ces racines peuvent tre excises de la plante infecte, puis mises en
culture et former des chevelus racinaires importants. On est alors en prsence de
hairy-roots . condition de leur fournir rgulirement un milieu neuf, ces clones
racinaires peuvent tre conservs pratiquement de manire indnie. Comme pour
A. tumefaciens, il est possible dinsrer entre les bordures de lADN-T un gne dintrt.

Poursuivre la slection

Aprs des essais de transformation gntique, il faut vrifier la ralit de la transformation. Les gnes marqueurs, insrs en mme temps que les gnes dintrt
permettent de rapidement trier les individus. Mises en prsence de kanamycine, seules
les plantes transformes ayant intgr le gne npt seront rsistantes. Il nempche
269

9782100544141-Laberche.fm Page 270 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

que la confirmation de la transformation ne peut tre obtenue que par analyse de


lADN, o doit apparatre le gne dintrt insr. Les transformations sont gnralement effectues sur des cultures de tissus comme des fragments de ptioles, des
disques de feuilles, la prsence dune blessure tant indispensable pour que se fixe la
bactrie, il faudra rgnrer la plante entire grce aux techniques habituelles des
cultures in vitro.
Grce aux mdias on connat essentiellement les OGM correspondant aux cultures
vivrires ou industrielles (tabl. 9.2). En 1997, 34 varits de plantes transgniques
taient autorises dans le monde. La modification concerne une tolrance aux
herbicides pour 29 % dentre elles, aux insectes pour 29 %, aux virus pour 9 %, la
qualit du produit (ex. ralentissement de la maturation) pour 24 % et diverses autres
particularits pour 9 %.
Pour les vgtaux, quatre axes sont privilgis par les slectionneurs.
Les plantes rsistantes aux agents pathognes. Le mas Bt modifi gntiquement
rsiste aux chenilles des lpidoptres (pyrale et ssamie) qui sattaquent aux parties
ariennes du mas. Les mas transforms sont protgs par un gne issu de Bacillus
thuringiensis (Bt) qui permet au mas de produire une protine le protgeant
spcifiquement des insectes viss. Les pommes de terre aussi peuvent tre modifies
pour ne plus tre attaques par les doryphores.
Chez le colza, le tournesol, le bananier, lintroduction dun gne spcifique
permet la plante de raliser la synthse dune protine au pouvoir fongicide.
La pomme de terre, le melon, la courge, la tomate, le concombre, mais aussi le
riz peuvent devenir rsistants aux virus.
Les plantes rsistantes aux herbicides. Soja, laitue, melon, pomme de terre, colza,
tournesol, mas, coton ont t modifis pour les rendre tolrants un herbicide, le
glyphosate habituellement utilis comme dsherbant total. Cette transformation
gntique permet au glyphosate de devenir un dsherbant slectif.
Les plantes amliores qualitativement. En 1994 aux tats-Unis, une tomate
transforme gntiquement maturation retarde t autorise la production,
la transformation et la vente.
Les plantes sources de mdicaments. De tout temps les plantes font partie de la
pharmacope humaine. Des OGM permettent de faire synthtiser par des plantes des
molcules non prsentes habituellement dans le monde vgtal. Il peut sagir, par
exemple, dune lipase (protine enzymatique des mammifres), utilise dans le traitement de certains symptmes de la mucoviscidose. Il est possible aussi daugmenter
la production de molcules naturellement mais faiblement synthtises par les plantes.
Ainsi Datura innoxia Mill. Solanaceae tropicale produit de faibles quantits dhyoscyamine (alcalode tropanique utilis mdicalement pour ses proprits neurosdatives
et antispasmodiques). Une double transformation des plantes par A. rhizogenes
afin dobtenir des clones racinaires hairy roots , et par A. tumefaciens introduisant
le gne dintrt P5CR prcurseur de la proline, permet daugmenter notablement
la production dhyoscyamine. Cultive en enceinte de grands volumes (fermenteur), il est alors possible denvisager une production industrielle (fig. 9.12).
Les OGM actuellement cultivs (tabl. 9.3) occupent dj une part importante dans
les surfaces cultives (tabl. 9.4).
270

9782100544141-Laberche.fm Page 271 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

Tableau9.2 Proprits modifies de quelques plantes alimentaires


et industrielles transformes gntiquement.

Dunod La photocopie non autorise est un dlit.

Plantes

Proprits

Banane

Rsistance aux maladies, meilleure conservation, production de molcules


spciques.

Betterave

Rsistance aux maladies, tolrance un herbicide, production de molcules


spciques.

Bl

Tolrance un herbicide, rsistance aux maladies, modication de la teneur


en amidon.

Cacao

Rsistance aux maladies

Caf

Rsistance aux insectes.

Chicore

Tolrance un herbicide

Chou

Rsistance aux insectes

Colza

Rsistance aux insectes, tolrance un herbicide, modication de la


composition en huile, rsistance aux champignons, varits hybrides,
production de molcules spciques (protines, enzymes, acides amins,
enrichi en b carotne).

Concombre

Rsistance aux maladies.

Coton

Rsistance aux insectes, tolrance un herbicide, amlioration de la qualit


des bres

Courge

Rsistance un virus.

Laitue

Diminution de la quantit de nitrate dans la plante, tolrance un herbicide,


rsistance aux maladies

Mas

Rsistance aux insectes, tolrance un herbicide, rsistance aux maladies,


modication de la teneur en protines

Manioc

Rsistance aux virus, amlioration de la qualit nutritive. Melon Rsistance


aux maladies, meilleure conservation, tolrance un herbicide

Millet

Coloration modie, fanage ralenti

Peuplier

Amlioration de la matire premire pour la fabrication du papier.

Papaye

Rsistance un virus. Pomme de terre Rsistance aux maladies, rsistance


aux insectes, tolrance un herbicide, modication de la teneur en amidon.

Pommier

Rsistance aux insectes

Riz

Suppression dun facteur dallergie, tolrance un herbicide, rsistance aux


insectes, production de molcules spciques (enrichi en bta carotne).

Soja

Tolrance un herbicide, modication de la composition en huile, en


protines, production de molcules spciques (enzymes, anticorps)

Tabac

Tolrance un herbicide

Tomate

Meilleure conservation, rsistance aux maladies, rsistance aux insectes,


tolrance un herbicide, enrichissement en bta carotne

Tournesol

Tolrance un herbicide, production dacides gras libres.

Vigne

Rsistance au court-nou (maladie virale)

(Origine des donnes GNIS)

271

9782100544141-Laberche.fm Page 272 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Figure 9.12 La production


dhyoscyamine est possible avec
Datura innoxia doublement transforme
par A.rhizogenes (hairy roots)
et A.tumefaciens (gne P5CR, prcurseur
de la proline) (photographie M. Boitel,
unit BioPi UPJV Amiens)

Tableau9.3 Part mondiale (en surface) des principales espces transgniques


en 2000 (surface en millions dhectares).
Surface mondiale

Surface transgnique

% transgnique

Soja

72

25,8

36

Coton

34

5,3

16

Colza

25

2,8

11

Mas

140

10,3

TOTAL

271

44,2

16

(Origine des donnes : GNIS)

Tableau9.4 Surfaces de cultures transgniques par pays (en millions dhectares)


et principales espces cultives en 2006.
Millions ha

1996

1997

1998

1999

2000

2006

tats-Unis
1,45
Argentine
0,05
Canada
0,11
Chine
Australie
Afrique du sud
France

7,16
1,47
1,68

20,83
3,53
2,75

0,20

0,30
0,06
0,05

28,7
6,7
4,01
0,30
0,1
0,1
<0,1

30,30
10,00
3,00
0,50
0,20
0,20
<0,1

57,7 : soja, mas, coton, colza, papaye


19,1 : soja, mas, coton
7,00 : colza, soja, mas
3,80 : coton, peuplier, tomate, papaye
0,10 : soja, mas, coton
1,80 : soja, mas, coton
<0,1 : mas

10,51

27,80

39,90

44,20

89,60

TOTAL

1,61

Sources : ISAAA, 2001 et 2007.

272

9782100544141-Laberche.fm Page 273 Jeudi, 4. fvrier 2010 3:47 15

9.3 Les cultures in vitro

Ils sont lobjet de controverse tant chez les consommateurs que chez les scientifiques.
Les premiers sont troubls par la conjonction de plusieurs phnomnes, sans rapport
avec le gnie gntique en agriculture, mais touchant lalimentation humaine. Les
plantes transgniques sont prises dans le flot de la rpugnance que suscite chez les
consommateurs limage de vaches cessant dtre engraisses lherbe et amenes
devenir carnivores et mme oviphages .
Tout consommateur la sensibilit cologique souhaite disposer de renseignements
fiables sur les OGM et force est de constater que gnralement les mdiats lui refusent.
Qui connat les conclusions des commissions indpendantes qui ont prcis que la
kanamycine, dont le gne de rsistance est introduit dans les OGM comme gne
marqueur, est un antibiotique rarement utilis dans la pharmacope humaine, que plus
de 50 % des bactries que nous absorbons en mangeant une simple salade verte ou un
petit radis sont elles-mmes rsistantes la kanamycine et quenfin ce gne marqueur est
amen tre remplac ? Il nen demeure pas moins que la prsence de ce gne de
rsistance un antibiotique a de quoi susciter une inquitude toute lgitime quil ne faut
surtout pas occulter comme lont si souvent fait les scientifiques et les slectionneurs.
Les scientifiques quant eux, sinterrogent beaucoup plus sur les problmes de
dissmination des OGM. Ils pensent que les techniques de gnie molculaire sont
susceptibles dentraner dans les organismes des proprits nouvelles non contrles.
Ils dnoncent les importants risques dhybridation avec la flore locale, donc dapparition de rsistances qui peuvent se produire surtout chez les plantes comme le colza.
Ainsi, si ces nouvelles proprits confrent aux OGM, un avantage slectif, ceux-ci
peuvent envahir les cosystmes o ils peuvent savrer nuisibles en se dveloppant
au dtriment des autres organismes comme plusieurs exemples semblent le montrer
dj aux tats-Unis et aux Canada.

Dunod La photocopie non autorise est un dlit.

Biopiratrie
Malgr les mouvements pour la reconnaissance des droits indignes, lappropriation
du vivant par le dpt de brevet, appele biopiraterie, est encore aujourdhui un
des plus agrants cas de pillage et dexploitation des pays du Sud (ce qualicatif
correspond aux pays les plus pauvres, qui sont gnralement situs dans la partie
sud des continents mergs).
Au l du temps, une part non ngligeable de lincroyable richesse biologique dont
regorgent les zones tropicales, a t le support de connaissances et dusages dont les
communauts autochtones sont les dpositaires. La Convention de Rio sur la Biodiversit (1992) reconnat dailleurs ce rle indniable des peuples indignes et considre
que leurs droits motivent un juste retour des prots issus de lexploitation du vivant.
Mais les grands principes de justice voqus lors des conventions internationales
souffrent toujours dun manque dapplicabilit et la complexit des procdures juridiques inhrentes au dpt de brevet et au droit de proprit intellectuelle fait, qu
lheure actuelle, la biopiraterie fait toujours senrichir quelques rmes au dtriment
des populations locales. En 2008 au Brsil, par exemple, seulement sept produits
phyto-thrapeutiques ont t dvelopps en associant les communauts locales,
quand, dans le mme temps, des compagnies ayant pignon sur rue dposaient
700 brevets dexclusivit ! Pourtant, il ne fait aucun doute que les entreprises pharmaceutiques se sont appuyes sur les connaissances indignes et la connaissance des
savoirs traditionnels multiplient par 300 les chances didentier des principes actifs
dans les plantes, de quoi rduire notablement les cots en recherche-dveloppement,
ce qui est un avantage considrable.
273

9782100544141-Laberche.fm Page 274 Jeudi, 4. fvrier 2010 3:47 15

Chapitre 9 Lhomme et les plantes

Les cas de recours en justice contre cette biopiratrie se multiplient, visant lannulation des dpts de brevet sur des varits slectionnes par les communauts et
exploits par dautres. Cest le cas, par exemple, du haricot jaune Enola du
Mexique, soit disant cr et brevet par lAmricain Larry Proctor qui navait
rien fait dautre que de rapporter ce haricot du Mexique au dbut des annes 1990
alors quil ntait pas cultiv aux tats -Unis et de lappeler alors Enola , du nom
de sa femme puis de rexporter les semences en rclamant des royalties de 15 %
du prix de vente sur tous les haricots jaunes commercialiss aux tats-Unis ! Il en
est de mme des sirops antitussifs, issus des racines du plargonium du Cap
(Pelargonium sidoides DC, Geraniaceae) et brevet par un groupe pharmaceutique
allemand bien quil soit traditionnellement employ par des communauts autochtones dAfrique du Sud pour soigner la bronchite et dautres maladies. La pression
sur les rserves en plargonium en Afrique du Sud est de plus en plus forte, allant
jusqu mettre en pril la survie de lespce vgtale.
Mais lissue juridique se confronte la dnition mme de la proprit intellectuelle
et la notion dantriorit du savoir. Quand une entreprise dpose un brevet, elle
doit garantir quil nexiste pas de prcdent. Or ce dernier point demande une visibilit que les connaissances autochtones nont pas vraiment aujourdhui. Les savoirs
traditionnels se transmettent oralement, sont immatriels et communautaires. Ils
nappartiennent pas une seule personne comme dans le droit occidental. Il est facile
alors, pour les rmes, de nier leur existence et, donc, de considrer quelles ne font
pas ofce de prcdents.
Daprs Elisabeth Leciak dans Biopiraterie : une rgion pruvienne avance sur la voie de la justice ,
Univers-nature du 28-01-2009.

Rsum

Les plantes vivent en harmonie avec le milieu, en sadaptant. Certaines modifications du phnotype naffectent pas le gnotype : ce sont des accommodats. Dautres
sont hrditaires : ce sont des cotypes. Mais les plantes voluent, se transforment
sous laction de 4 facteurs : les mutations, qui affectent le matriel gntique,
lhybridation, qui rapproche deux patrimoines gntiques, le rtablissement de
la sexualit par doublement des chromosomes, enfin la slection naturelle, qui
limine toute forme de vie non en accord avec les contraintes du milieu. Lhomme
a copi ces mcanismes pour crer des plantes quil cultive pour sa nourriture et
toutes ses activits. Les techniques diffrent selon quil sagisse de plantes autogames (bl) ou allogames (mas). Chez cette dernire, il se contente de crer des
hybrides F1, tandis que chez les premires, il faut fixer la varit par diffrents
procds de croisements. Depuis quelques dcennies lintrusion des biotechnologies a profondment modifi les techniques de slection. Il est possible de faire
de la micropropagation, ainsi que des plantes haplodes obtenues par andro ou
gynogense. Lobtention dorganismes gntiquement modifis (OGM) constituent
une nouvelle tape. Les biologistes introduisent dans le patrimoine gntique des
plantes, des gnes dintrt permettant lobtention de proprits agronomiques
ou pharmaceutiques nouvelles. Mais lutilisation de ces OGM nest pas sans poser
des problmes pour les utilisateurs et les consommateurs.

274

9782100544141-Laberche.fm Page 275 Jeudi, 4. fvrier 2010 3:47 15

GLOSSAIRE 1

Dunod La photocopie non autorise est un dlit.

acaule : caractristique dune plante chez qui la tige est trs fortement rduite.1
accommodat : phnotype parfaitement rversible et non hrditaire dune plante, induit
par le milieu extrieur.
actinomorphe : qualifie une fleur rgulire.
agamospermie : modalit de lapomixie se caractrisant par la formation de graines dont
lembryon est gntiquement identique au parent femelle.
agent mutagne : substance produisant des modifications irrversibles du patrimoine
gntique.
akne : fruit sec indhiscent contenant une graine libre.
albdo : pourcentage de rflexion de la lumire sur une surface.
albumen : tissu nourricier 3n chromosomes contenu dans la graine et entourant lembryon
des plantes fleurs.
allogame : plante se reproduisant par croisement entre individus diffrents.
allogamie : caractristique des plantes allogames.
allopolyplodie : doublement des chromosomes lintrieur des cellules.
amande : graine enferme dans le noyau.
amidon : glucide form damylose et damylopectine.
ammonification : production dammonium ou dammoniac par une activit biologique.
amylose : type damidon bactrien.
anaphase : stade 3 de la mitose ; les deux chromatides se sparent.
anaphase I : stade 3 de la premire division de la miose. Les chromosomes scartent.
androce : verticille mle de la fleur.
anmochorie : dissmination des graines par le vent.
anmogamie : pollinisation aprs transfert du pollen jusqu la fleur par le vent.
Angiospermes : plantes vasculaires dont les graines sont enfermes dans un ou des carpelles
clos.
anthre : partie sommitale de ltamine o slaborent les grains de pollen.
1. En collaboration avec le Dr J. Par.
275

9782100544141-Laberche.fm Page 276 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

anthridie : gamtange mle des Ptridophytes et des Bryophytes.


anthse : stade dpanouissement de la fleur, correspond sa maturit sexuelle.
anticline : adjectif qualifiant une division cellulaire qui seffectue perpendiculairement
la surface du tissu cellulaire.
antipodes : trois cellules du sac embryonnaire des Angiospermes, situes gnralement
loppos de loosphre et homologues des cellules du prothalle.
apex : notion morphologique qui correspond lextrmit dune tige ou dune racine.
aphyllie : rduction de la taille des feuilles.
apomixie : phnomne de reproduction non vgtatif faisant appel aux organes sexuels
femelles, sans pourtant lintervention de la sexualit.
apomixie gamtophytique : modalit dapomixie se caractrisant par le dveloppement
dune cellule du sac embryonnaire (synergie ou antipode).
apoplasme : paroi cellulaire.
apoptose : mort programme des cellules. Se manifeste dans les ractions dhypersensibilit
un agresseur.
appareil nuclaire : autre appellation du chromosome bactrien.
aquaporines : protines facilitant le transport de leau, situes sur les membranes plasmiques
et vacuolaires des cellules.
archgone : gamtange femelle des Cormophytes contenant loosphre.
archgoniate : plante ayant des archgones.
archthalle : thalle unicellulaire.
ascospore : spore haplode produite par les Ascomyctes.
asque : sporocyste contenant les ascospores haplodes.
assise subro-phllodermique : zone responsable de la formation du lige et du phelloderme
(cambium).
asymtrique : fleur dpourvue de tout plan de symtrie.
autogame : fleur fconde par son propre pollen.
autogamie : caractristique des plantes autogames.
autotrophe : organisme capable de synthtiser ses molcules organiques partir deau,
dlments minraux et de lumire.
auxse : allongement cellulaire.
auxine : acide indolyl-b-actique, rgulateur de croissance.
B

baie : fruit entirement charnu contenant plusieurs graines (ppins).


baside : sporocyste des basidiomyctes.
basidiospore : spore produite par une baside.
biomasse : matire organique vivante.
biosphre : ensemble des tres vivants.
biotope : milieu soumis des conditions cologiques homognes.
bipartition : division cellulaire par coupure de la cellule en deux cellules filles.
276

9782100544141-Laberche.fm Page 277 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

blastomres : premires cellules de lembryon en voie de spcialisation dfinitive, rsultant


de la segmentation du zygote.
bois : tissu secondaire diffrenciation centrifuge form par le cambium libro-ligneux.
bourgeon axillaire : structure laisselle des feuilles susceptible de produire soit une tige
soit une fleur
bracte : pice foliace axilant une fleur.
brvistyle : fleur dont le style est nettement plus court que les tamines.
Bryophytes : embranchement des plantes archgoniates regroupant classiquement les
mousses et les hpatiques.
bulbe : organe souterrain compos dune tige trs rduite, le plateau, et de feuilles embotes
charnues.
bulbille : organe de multiplication vgtative constitu dun bourgeon enfl se dtachant
du pied mre.

Dunod La photocopie non autorise est un dlit.

caduc : adjectif qualifiant un organe vgtatif qui tombe : un fruit caduc ou une feuille
caduque.
calcicole : plante poussant sur milieu calcaire.
calcifuge : plante fuyant le calcaire.
calice : premier verticille strile de pices florales.
cambium : mristme secondaire apparaissant dans un tissu primaire.
cambium libro-ligneux : cambium responsable de la formation du bois et du liber.
canal : lment des systmes de transport actif secondaire constitu dun pore protique
membranaire laissant slectivement passer un ion par diffusion, le long de son gradient
de potentiel lectrochimique.
capacit biognique limite : quantit maximale exploitable.
capacit de rtention maximale : quantit deau dans un sol quand celle excdentaire sest
coule par gravit.
capitule : grappe de fleurs sessiles insres sur le rceptacle en forme de plateau.
capsule : fruit sec dhiscent x carpelles et x fentes.
capsule bactrienne : enveloppe entourant la bactrie.
carpelle : lment constitutif de lovaire.
carpophore : cest le champignon que lon connat, en ralit seulement la partie
fructifre du champignon.
caryogamie : fusion des noyaux au moment de la fcondation.
caryopse : fruit sec indhiscent au pricarpe soud la graine caractristique des Poaceae
(bl, mas, etc.).
caulinaire : de la tige.
cellule : unit lmentaire permettant la vie selon Schleiden et Schwann (1838).
cellule de garde : cellule constituant le stomate.
cellule gnrative : cellule du grain de pollen lorigine du ou des gamtes mles.
277

9782100544141-Laberche.fm Page 278 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

cellule vgtative : cellule du grain de pollen homologue des cellules du prothalle de fougre.
cellulose : polymre du b-1,4-glucose.
cnocytique : (scrit aussi cnocytique) absence de cloison dlimitant les cellules.
centrifuge : de lintrieur vers lextrieur, oppos centripte.
centripte : de lextrieur vers lintrieur, oppos de centrifuge.
centromre : rgion du chromosome qui se fixe au fuseau lors de la mitose.
champhyte : ayant ses bourgeons en hiver quelques centimtres du sol.
chlat : complexe molcule organique lment minral permettant labsorption de ce
dernier par le vgtal.
chiasma : zone de contact entre les chromosomes lors de la miose.
chitine : substance constitue de sous-units dactylglucosamine, remplaant la cellulose
chez les champignons.
chloroplaste : plaste chlorophyllien.
chromatide : hlice lmentaire du chromosome ; il y a deux chromatides par chromosome.
chromatine : mlange dADN et dhistones constitutifs des chromosomes.
chromosome : constituant cellulaire, situ dans le noyau, support de lhrdit.
cladome : thalle trs ramifi.
cladothalle : thalle ramifi.
classe : regroupement taxonomique de tous les Ordres, prsentant des caractres communs
distinctifs.
classification naturelle : systme de classification bas sur les ressemblances entre les
vgtaux.
classifications phylogntiques : classification des plantes selon une perception volutive.
cloisonns : se dit des hyphes de champignons quand les cellules sont bien dlimites.
clone : population dindividus gntiquement identiques.
coiffe : zone terminale des racines, protgeant le mristme racinaire.
complexe (thalle complexe) : type de thalle de lichen.
conduction vasculaire : circulation de leau dans les vaisseaux du xylme.
conjugaison : sexualit occasionnelle chez les bactries.
cne : organe reproducteur des Gymnospermes.
conidiophore : filament dress spcialis dans la multiplication vgtative des champignons.
conidiospore : spore exogne de la multiplication vgtative des champignons.
Cormophytes : organismes posssdant un cormus.
cormus : vgtal possdant des feuilles et des tiges.
corolle : dsigne lensemble des ptales.
corps de Golgi : organite cellulaire constitu de dictyosomes.
corpus : zone cellulaire du mristme apical caulinaire.
corymbe : inflorescence indfinie dont linsertion des fleurs est chelonne de faon quelles
soient disposes sur un mme plan horizontal.
278

9782100544141-Laberche.fm Page 279 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

cotransporteur : lment du transport actif secondaire permettant le passage dions ou de


molcules dans le sens contraire celui des protons donc de lextrieur vers lintrieur
de la cellule.
cotyldon : partie de lembryon, premire feuille embryonnaire.
couche limite : interface vgtal/air ambiant, rduisant lvaporation.
coumarine : lactone insature, inhibitrice de la germination.
crtes mitochondriales : replis de la membrane interne de la mitochondrie.
crustac : qui sincruste (semploie surtout chez les lichens).
Crytogames : organismes nayant pas dorgane reproducteur bien apparent.
culture in vitro : mthode de culture de cellules, dorganes, en milieu aseptique contrl.
cylindre central : partie interne de la racine, limite par lendoderme.
cyme : inflorescence croissance dfinie de type sympodial.
cytokinse : division cellulaire.
cytoplasme : phase interne de la cellule.
cytosol : lensemble cytosol et organites constitue le cytoplasme des cellules.
cytosquelette : lments filamenteux du cytosol.

Dunod La photocopie non autorise est un dlit.

darwinisme : thorie de lvolution dcrite par Darwin et base sur la slection naturelle.
dcidu(e) : adjectif qualifiant les forts composes darbres feuilles caduques : une fort
dcidue.
ddiffrenciation : retour dune cellule diffrencie ltat mristmatique.
dficit de pression : diffrence entre la pression de vapeur deau dans lair et la pression
saturante.
disme : thorie philosophique qui voit dans un tre suprme lauteur de toute chose.
dnitrification : processus bactrien qui produit une dsoxynation des ions nitrates et la
libration de lazote gazeux.
desmotube : composant axial du plasmodesme assurant la continuit du rticulum endoplasmique entre deux cellules contigus.
diacinse : dernier stade de prophase 1 de la miose : les chromosomes homologues
condenss ne sont plus relis que par leurs chiasmas.
diapause : ralentissement de lactivit biologique de lembryon lempchant de germer.
diaspore : terme gnrique dsignant un organe permettant la multiplication dune plante,
mme par voie vgtative.
dicaryon : association constitue dans une cellule par un noyau haplode mle et un noyau
haplode femelle sans fusion des deux.
dictyosome : ensemble des saccules discodes du corps de Golgi.
diffusion passive simple : passage des ions au travers des membranes.
digntique : qualificatif dun cycle de reproduction sexue o interviennent deux types
dorganismes se succdant dans le temps.
dioque : se dit dune plante chez laquelle les sexes sont ports par des individus diffrents.
279

9782100544141-Laberche.fm Page 280 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

diplode : 2n chromosomes.
diplophase : priode diplode du vgtal.
division : regroupement taxonomique de toutes les Classes prsentant des caractres
distinctifs.
division quationnelle : deuxime division (mitose 2) de la miose.
dormance : tat dans lequel des graines ne germent pas malgr des conditions apparemment
favorables pour la germination.
drupe : fruit charnu endocarpe lignifi qui contient gnralement une seule graine enferme
dans un noyau.
E

eau dimbibition : eau des collodes.


eau de constitution : eau des molcules organiques.
eau libre : eau pouvant circuler dans les lacunes et les mats.
bauche foliaire : apparition des premiers tissus de la feuille.
caille : feuille modifie des cnes de Gymnospermes.
cosystme : communaut dorganismes qui vivent en quilibre.
cotype : type moyen, stable, dune espce dans une aire gographique.
daphique : qui se rapporte au sol.
liciteur : molcules extrieures aux plantes dclenchant des ractions de dfense.
embryon : provient du dveloppement du zygote et sbauche dans la graine.
embryon adventif : modalit dapomixie se caractrisant par le dveloppement dune
cellule du nucelle ou des tguments ovulaires aboutissant la formation dun embryon
et assurant la multiplication de lespce (dans le cas des cultures in vitro, lorigine de
lembryon adventif peut tre toute cellule dun explant ou dun cal).
endmique : plante ne se trouvant quen un lieu.
endocarpe : piderme interne du fruit.
endoderme : limite interne du cylindre central dans la racine.
endosperme : tissu issu de lovaire.
entomogamie : pollinisation aprs transfert du pollen jusqu la fleur par les insectes.
enveloppe nuclaire : double membrane dlimitant le noyau.
pi : inflorescence indfinie, avec des fleurs sessiles troitement appliques contre laxe
principal.
picarpe : piderme externe du fruit.
piderme : couche cellulaire externe des tiges et des feuilles.
pigense : thorie qui veut que tous les tres proviennent de germes vivants.
espce : unit fondamentale de la systmatique. Elle est constitue par des individus qui
se ressemblent et sont interfconds.
tamine : feuille modifie, organe mle de la fleur portant les sacs polliniques contenant
les grains de pollen.
ETM : vapotranspiration maximale.
280

9782100544141-Laberche.fm Page 281 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

ETP : vapotranspiration potentielle.


Eucaryotes : cellules ayant un vrai noyau.
Eudicotyldones : dicotyldones vraies, dans la classification de Chase, correspondent
aux Angiospermes ayant trois pores ou plus dans les grains de pollen.
eugnisme : discipline visant amliorer lespce humaine.
vaporation : phnomne physique de passage de leau de la forme liquide la forme
gazeuse.
vapotranspiration : ensemble constitu de la transpiration du vgtal et de lvaporation
du sol.
volution : transformation progressive et irrversible des populations animales et vgtales.
volutionnisme : thorie de la transformation des tres vivants sous linfluence de la
slection naturelle.
exine : paroi externe paisse et fortement ornemente des grains de pollen.
exsorption : sortie dlments des plantes vers le sol.
extrorse : tamine tourne vers le prianthe et librant le pollen vers le prianthe.

Dunod La photocopie non autorise est un dlit.

famille : regroupement taxonomique de tous les genres prsentant des caractres communs.
faisceau criblovasculaire : (faisceau libro-ligneux) structure anatomique runissant des
cellules superposes de xylme et de phlome.
faux fruit : voir pseudo-fruit.
feuille : organe gnralement aplati et chlorophyllien, port sur les tiges, croissance et
dure de vie limites.
feuilles alternes : dnomination des feuilles insres successivement des niveaux diffrents
le long dune tige.
feuilles opposes : dnomination des feuilles insres face face sur une tige.
feuilles verticilles : dnomination des feuilles insres au mme niveau sur un axe.
filet : partie axiale de ltamine portant son extrmit suprieure lanthre.
fixisme : thorie philosophique qui prne limmobilisme des tres vivants.
flagelle : filament plus ou moins sinueux assurant le dplacement des spermatozodes, des
protozoaires et de certaines bactries.
fleur : ensemble complexe de pices protectrices (spales et ptales) et dorganes sexuels
(androce et gynce).
fleur femelle : fleur nayant que le gynce (fleur pistille).
fleur mle : fleur ne possdant que landroce (fleur stamine).
fleur pistille : fleur uniquement femelle.
fleur stamine : fleur uniquement mle.
foliac : semblable une feuille (semploie surtout chez les Thallophytes).
folioles : chez les feuilles composes, le limbe est fractionn en folioles.
follicule : fruit dhiscent un carpelle et une fente unique.
force dimbibition : force lie aux collodes hydrophiles.
281

9782100544141-Laberche.fm Page 282 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

force de capillarit : forces exerces par les surfaces des capillaires et dautant plus fortes
que le diamtre des capillaires est plus petit.
force osmotique : force cre par le dplacement des molcules deau depuis la solution la
plus dilue vers la solution la plus concentre au travers dune membrane hmipermable.
formation secondaire : tissu issu dun cambium.
fructiculeux : semblable un buisson (semploie pour dsigner les lichens).
fruit : organe contenant des les graines et rsultant de la transformation de lovaire aprs
fcondation.
fruit charnu : fruit pais, juteux, ferme mais tendre.
fruit sec dhiscent : fruit souvrant maturit.
fruit sec indhiscent : fruit sec ne souvrant pas maturit.
fruits polycarps : fruits multiples produits partir dune fleur plusieurs carpelles comme
la mre (roncier) ou la framboise.
fruits synanthocarps : fruits composs, forms par la fusion des carpelles de plusieurs
fleurs sur un rceptacle commun comme lananas, la figue ou la mre des mriers.
funicule : liaison entre la paroi du carpelle et lovule.
G

gamtange : organe produisant des gamtes, entour dune paroi cellulaire.


gamte : cellule haplode assurant la reproduction sexue.
gamtocyste : cellule dans laquelle se forment les gamtes.
gamtophyte : phase haplode du cycle des vgtaux.
glatineux : qui a laspect dune gele (semploie surtout chez les lichens).
gemmule : partie de lembryon situe sur lhypocotyle entre les deux cotyldons. Elle
correspond au bourgeon apical de la tige principale.
gnome : caractrise la garniture chromosomique gamtique dune espce diplode. Il
correspond au nombre chromosomique de base.
gnotype : ensemble des lments hrditaires reu au moment de la fcondation des gamtes.
genre : groupe homogne despces.
gophyte : plante dont les bourgeons sont protgs par la terre lors des priodes dfavorables
la croissance.
gotropisme : orientation par rapport laction de la pesanteur.
gibbrelline : rgulateur de croissance favorisant lallongement cellulaire.
glycolyse : voie mtabolique dassimilation du glucose ayant pour produit le pyruvate et
permettant la formation de deux molcules dATP.
glycoprotine : chane polypeptidique, portant des chanes glucidiques latrales.
glyoxysome : organite cellulaire qui assure la transformation des lipides en glucides.
gousse : fruit dhiscent un carpelle et deux fentes.
grain de pollen : gamtophyte mle nayant pas encore diffrenci les gamtes mles.
graine : structure produite par les Spermaphytes, entoure dune gaine protectrice. Elle
contient lembryon et des rserves.
282

9782100544141-Laberche.fm Page 283 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

graine prisperme : graine chez laquelle le nucelle senrichit en totalit ou en partie de


rserves.
graine albumine : graine chez laquelle lalbumen constitue le tissu de rserve.
graine dormante : graines subissant une action lempchant de germer.
graine exalbumine : graine chez laquelle lalbumen a t digr. Les glucides ont migr
vers les cotyldons pour former de lamidon.
granum : ensemble de disques granaires dun chloroplaste (pluriel grana).
grappe : type dinflorescence monopodiale.
guttation : sortie deau sous forme liquide.
Gymnospermes : plantes carpelle ouvert.
gynce : verticille femelle de la fleur.

Dunod La photocopie non autorise est un dlit.

halophyte : plante adapte aux milieux sals.


haplode : cellule contenant n chromosomes.
haplophase : priode haplode du cycle de dveloppement.
hmicellulose : polymre doses varis.
hmicryptophyte : plante ayant ses bourgeons au niveau du sol.
hmiparasite : parasite capable de synthses partir de molcules simples.
herbace : qualit dune tige tendre et flexible.
hermaphrodite : se dit dune fleur possdant la fois landroce et le gynce.
hespride : fruit simple charnu ; baie polysperme. Le pricarpe a laspect de cuir et est
parsem de poches essence (tous les agrumes).
htrosis : luxuriance vgtative produite par lhybridation de deux lignes pures.
htrotrophe : individu se nourrissant de molcules organiques.
htroxyl : bois constitu de plusieurs types de vaisseaux : fibres, traches, trachides.
Cest le cas des Angiospermes.
htrozygote : se dit dune plante pour laquelle les deux allles dun gne sont diffrents.
hile : point dinsertion du funicule sur lovule.
holoparasite : parasite ne possdant pas la photosynthse.
halophyte : plante se dveloppent dans un milieu contenant beaucoup de sels.
homoxyl : bois constitu uniquement dun type de vaisseau. Gnralement de trachides
chez les Gymnospermes.
homozygote : se dit quand les deux allles dun mme gne sont de nature identique.
humidit relative : pourcentage deau dans lair par rapport la quantit saturante.
hyaloplasme : substance fondamentale du cytoplasme.
hybridation : runion dans un mme individu de deux gnomes diffrents.
hybride : individu produit par la runion de deux gnomes diffrents.
hydrogamie : transport du pollen par leau.
hyphe : filament constitutif du thalle des champignons.
283

9782100544141-Laberche.fm Page 284 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

hypocotyle : partie de lembryon appele aussi tigelle, situe entre la radicule et linsertion
des cotyldons, donne ultrieurement la tige principale. Porte son extrmit suprieure
les deux cotyldons.
I

inbreeding : perte de vigueur vgtative par augmentation de lhomozygotie.


individu : nom donn une plante dans le monde vgtal et formant un tout.
inflorescence : ensemble de fleurs.
initium foliaire : premier stade de fonctionnement de lanneau initial lors de lapparition
des feuilles.
intercinse : priode sparant la division rductionnelle de la division quatoriale de la miose.
intergnrique : croisement entre deux espces diffrentes.
interphase : phase entre deux mitoses, avec une duplication de lADN raboutissant
des chromosomes composs de deux chromatides.
intine : paroi interne fine du grain de pollen.
intraspcifique : croisement entre deux varits dune mme espce.
introrse : tamine, la fente de dhiscence situe sur la face suprieure (oppos, extrorse).
isolement : condition interdisant lchange de gnes entre les membres dune mme
population.
isomorphe : se dit quand sporophyte et gamtophyte ont une morphologie identique.
L

lamelle moyenne : constituant de la paroi cellulaire assurant le lien entre des cellules voisines.
leghmoglobine : hmoprotine prsente dans les nodosits des Fabaceae lors des phnomnes de symbiose bactrienne.
liber : tissu secondaire centripte form par le cambium libro-ligneux.
lichen : organisme rsultant de lassociation dun champignon et dalgues unicellulaires.
lige : tissu secondaire externe issu du cambium subro-phllodermique.
lignes pures : plantes homozygotes.
ligneuse : nature de la tige quand elle est dure et solide.
limbe : partie aplatie et verte de la feuille.
longistyle : fleur dont le style est nettement plus long que les tamines.
lysosome : organite cellulaire membrane simple contenant des enzymes lytiques.
lytiques : se dit denzymes qui coupent les molcules.
M

macrolments : lments prsents dans les plantes ou fournis aux plantes dans de fortes
proportions.
miose : divisions cellulaires permettant de passer de 2n chromosomes n chromosomes
dans la cellule.
membrane : couches lipo-protiques dlimitant les compartiments cellulaires.
membrane plasmique : membrane en priphrie de la cellule, appele aussi plasmalemme.
284

9782100544141-Laberche.fm Page 285 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

Glossaire

mrse : multiplication cellulaire.


mristme : tissu indiffrenci assurant la production des organes nouveaux.
mristme apical : mristme se trouvant lextrmit dune tige ou dune racine donc
lapex.
mristme caulinaire : mristme de la tige.
mristme mdullaire : zone de lapex caulinaire lorigine des tissus intrieurs de la tige.
mristme racinaire : mristme de la racine.
mristmes apicaux caulinaires : mristmes lorigine des parties ariennes.
mristmes apicaux racinaires : mristmes produisant lappareil souterrain.
msocarpe : tissu mdian du fruit.
mtaphase : phase de la mitose durant laquelle les chromosomes fissurs en 2 chromatides
se positionnent au milieu de la cellule pour former la plaque quatoriale.
mtaphase I : phase 2 de la premire division de la miose. Les chromosomes se placent
sur la plaque quatoriale.
mtaxylme : xylme diffrenci qui apparat lorsque la croissance de lorgane est termine.
micro-lments : substances minrales absorbes par les plantes dans de trs faibles quantits.
microfilaments : lments de cytosol, constitus dun assemblage dactine et de protines
(ABP), le tout formant des doubles brins, torsads en hlice.
micropropagation : technique de multiplication vgtative en culture in vitro.
micropyle : orifice dans les tguments, au sommet dun ovule, par lequel le tube pollinique
accde au sac embryonnaire.
microspore : cellule diplode lorigine des grains de pollen.
microtubules : structures en forme de cylindre lintrieur de cytosol et constitues de
tubulines et de protines.
minralisation : transformation de la matire organique en lments minraux.
mitochondrie : organite cellulaire qui est le centre de la respiration cellulaire.
mitose : division nuclaire suivie de la division cellulaire.
monogntique : qualificatif dun cycle de reproduction sexue o nintervient quun seul
type dorganisme.
monoque : se dit dune plante aux fleurs unisexues portes par un mme pied.
monopodiale : caractrise un type de ramification, dans laquelle le fonctionnement du
bourgeon terminal assure la croissance en longueur des tiges.
morphose = accommodat.
multiplication vgtative : modalit dapomixie se caractrisant par la production de
bulbes, bulbilles, rhizomes, stolons assurant la multiplication de lespce.
mutation : changement subit et alatoire.
mutation chromosomique : changement dans la squence des gnes dun chromosome.
mutation gnique : changement dans les squences de nuclotides dans un gne.
mutation gnomique : changement dans le nombre de chromosomes.
mycelium : ensemble des hyphes constituant le thalle des champignons.
285

9782100544141-Laberche.fm Page 286 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

mycorhize (mycorrhize) : association entre des lments fongiques et les racines des
plantes suprieures.
mycorhize ectotrophe : les filaments fongiques restent lextrieur de la racine et forment
un manchon.
mycorhize endotrophe : les filaments fongiques pntrent les cellules corticales de la
racine. Il ny a pas de manchon fongique externe.
myxamibe : spore haplode de Myxomycte ayant perdu ses flagelles.
myxoflagelle : spore haplode flagelle participant la reproduction sexue des myxomyctes.
myxomyxte : organisme amibode et mobile caractris par des protoplastes vgtatifs.
N

nastie : mouvements observs, conscutifs un stimulus extrieur.


nmatothalle : thalle filamenteux.
nodarwinisme : complment la thorie de lvolution de Darwin ou toute hrdit des
caractres acquis est exclue.
nervure : bourrelet constitu des faisceaux criblo-vasculaires qui constituent la charpente
du limbe de la feuille.
nervures palmes : divergent partir dun mme point de la zone de contact entre le ptiole
et le limbe.
nervures parallles : parallles les unes par rapport aux autres et parcourent tout le limbe.
Caractristique des feuilles des Monocotyldones.
nervures pennes : distribues des deux cots de laxe commun auquel elles sont attaches
(disposes comme les pennes dune plume).
nitration : passage des nitrites aux nitrates.
nitrification : passage de lammonium au nitrate.
nitrosation : passage de lammonium au nitrite.
noyau : corps ovale, prominent dans le cytoplasme, dlimit par une membrane. Contient
linformation gntique.
noyau : endocarpe lignifi des drupes.
noyaux accessoires : autre dnomination des noyaux polaires.
noyaux polaires : deux noyaux centraux situs lintrieur du sac embryonnaire des
Angiospermes. Aprs fusion avec un gamte mle, il y a formation du tissu nourricier
(3n) : lalbumen.
noyaux secondaires : autre dnomination des noyaux polaires.
nucelle : tissu de lovule quivalent au sporange femelle.
nuclole : corps dense lintrieur du noyau qui est le sige de la transcription des ARNr
qui entrent dans la fabrication des ribosomes.
nucloplasme : lment du noyau structur comme le cytoplasme.
nucule : fruit simple, sec, indhiscent, une ou deux graines, dont le pricarpe porte une
excroissance en forme daile qui facilite la dispersion par le vent. Noisette, gland du
chne, chtaigne
286

9782100544141-Laberche.fm Page 287 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

uf : cellule unique diplode rsultant de la fusion des gamtes.


oligo-lments : lments prsents dans les plantes ou fournis aux plantes ltat de traces.
oligophage : parasite hte unique.
ombelle : inflorescence croissance indfinie de type grappe, dont toutes les fleurs sont
attaches au mme point sur le pdoncule.
oogame : individu chez lequel les gamtes sont de taille et de mobilit diffrentes.
oogamie : caractrise une fcondation dans laquelle les gamtes mles et femelles sont de
taille et de mobilit diffrentes.
oosphre : gamte femelle immobile situ lintrieur de larchgone.
ordre : regroupement taxonomique de toutes les familles prsentant des caractres communs
distinctifs.
organite : lment interne au cytoplasme et dlimit par une membrane.
ostiole : lumire entre les deux cellules stomatiques.
ovaire : ensemble des carpelles.
ovaire infre : ovaire invagin dans le rceptacle floral de telle manire que le prianthe
semble attach sa partie suprieure.
ovaire semi-infre : ovaire en partie invagin dans le rceptacle floral de telle manire
que le prianthe semble attach mi-hauteur.
ovaire supre : situ au-dessus du rceptacle floral et de linsertion du prianthe.
ovule : macrosporange femelle contenu dans lovaire des Angiospermes.
ovule anatrope : ovule courb de telle sorte que le micropyle (sommet) et le hile (base)
soient situs lun ct de lautre.
ovule campylotrope : ovule dont un ct sest dvelopp plus rapidement que lautre
amenant le micropyle prs du hile.
ovule orthotrope : ovule droit dont le micropyle et le hile restent situs aux deux extrmits
de laxe du funicule.

Dunod La photocopie non autorise est un dlit.

palontologie : science qui tudie les fossiles.


papilionace : se dit de la fleur irrgulire (zygomorphe) des Fabaceae.
parasitaire : qualificatif du mode de vie dun parasite.
parasitisme : relation entre deux organismes, au profit de lun, le parasite, et aux dpens
de lautre, lhte.
parenchyme cortical : tissu compos de grandes cellules polydriques, situ au niveau du
cortex.
parenchyme lacuneux : parenchyme foliaire ou racinaire, aux cellules irrgulires peu
jointives.
parenchyme mdullaire : parenchyme du cylindre central de la racine.
parenchyme palissadique : parenchyme foliaire aux cellules allonges et chlorophyliennes.
paroi : zone paisse opaque la priphrie de la cellule.
287

9782100544141-Laberche.fm Page 288 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

paroi cellulaire : paroi cellulaire dpose dans certaines cellules sur la paroi primaire aprs
que cette dernire ait cess daugmenter de surface.
paroi primaire : premire couche de la paroi compose essentiellement de cellulose et
forme durant lexpansion cellulaire.
paroi secondaire : constituant de la paroi cellulaire directement en contact avec le plasmalemme.
parthnocarpie : dveloppement dun fruit partir dun ovaire non fcond.
pectine : polysaccharide acide.
pdicelle : dernier axe portant la fleur dans les inflorescences, fleur pdicelle.
pdoncule : rameau portant une fleur ou une inflorescence.
PEPcase : phosphonol-pyruvate-carboxylase.
pponide : fruit simple charnu. Baie norme enveloppe coriace (citrouille, concombre,
courge, melon, pastque).
prianthe : ensemble des enveloppes (le plus souvent calice et corolle) entourant les
organes sexuels de la fleur.
pricarpe : endocarpe, picarpe plus msocarpe.
pricline (division pricline) : mitose chez lesquelles les cloisons sont parallles la surface.
pricyle : couche cellulaire du cylindre central.
priderme : ensemble des tissus secondaires issus du fonctionnement du cambium subrophellodermique.
prisperme : tissu de rserve contenu dans la graine et provenant du nucelle, cest donc
un tissu diplode dorigine maternelle.
permase : protine des membranes permettant le transport membranaire.
peroxysomes : organites cellulaires, sige des principales tapes de la photorespiration.
persistante : se dit dune feuille qui vit plusieurs annes.
ptale : pice unitaire de la corolle dune fleur situe lintrieur du prianthe.
ptiole : partie de la feuille entre la tige et le limbe.
Phanrogames : plantes possdant des fleurs.
phanrophyte : plante visible toute lanne.
phelloderme : tissu secondaire interne issu du cambium subro-phellodermique.
phnotype : ensemble des caractres apparents.
phialide : cellule spcialise produisant les conidiospores.
phlome : tissu conducteur constitu de petites cellules vivantes.
photopriode : dure alternative du jour et de la nuit.
photorespiration : fixation de loxygne sur la ribulose diphosphate par la RubisCo avec
production de CO2, et ce durant la photosynthse.
photosynthse : processus essentiel permettant la synthse de molcules organiques
grce la lumire.
phototropisme : orientation par rapport une source lumineuse.
phyllotaxie : ordonnancement des feuilles sur la tige.
phylum : terme quivalent embranchement. Terme rarement utilis en botanique car non
reconnu par le code international de nomenclature.
288

9782100544141-Laberche.fm Page 289 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

Glossaire

phytoalexines : mtabolites secondaires qui, absents normalement dans la cellule,


saccumulent au voisinage des sites dinfection en prsentant de trs fortes activits
antimicrobiennes.
phytochrome : pigment bleu-vert se prsentant sous deux formes interchangeables Pr et
Prl et activant des gnes de la croissance et du dveloppement des plantes.
phytomre : ensemble constitue dun axe (ou entre-nud) une ou plusieurs feuilles et un
bourgeon axillaire
pigments : substances colores lintrieur des cellules.
pili : permet lagglutination des cellules bactriennes en dbut de conjugaison.
piridon : fruit intermdiaire entre la baie et la drupe. La moyenne partie du fruit provient
du rceptacle floral.
pistil : partie femelle de la fleur, constitue des carpelles (dont lensemble forme lovaire)
surmonts du style et des stigmates.
placentation : disposition des ovules dans lovaire.
plante annuelle : plante qui germe, se dveloppe, se reproduit et meurt en une anne.
plante bisannuelle : plante ayant besoin de deux annes pour effectuer son cycle complet.
plante nitrophile : plante poussant dans des terrains riches en composs azots.
plante prenne : plante se dveloppant plusieurs annes.
plantule : embryon arriv au terme se son dveloppement dans la graine. Par extension,
dans le cas multiplication vgtative, cest la petite plante produite par un organe
spcialise, prte se dvelopper.
plaque quatoriale : disposition des chromosomes en mtaphase de la mitose.
plasmalemme : membrane qui dlimite le cytoplasme du ct extrieur de la cellule.
plasmide : molcule dADN circulaire extrachromosomique.
plasmode : dnomination particulire lappareil vgtatif des Myxomyctes.
plasmodesme : structure de base assurant la communication intercellulaire.
plasmogamie : fusion des cytoplasmes.
plaste : nom gnrique pour les organites cellulaires contenant de la chlorophylle, ou dautres
pigments ainsi que de lamidon.
poil absorbant : cellule particulire la priphrie subterminale des racines assurant
labsorption de leau et des sels minraux indispensables la vie de la plante.
point de fanaison : moment o leau dans le sol nest plus disponible pour les plantes.
pollen : gamtophyte mle form dans les anthres des tamines produisant des gamtes mles.
pollinisation : transport du pollen dune anthre jusquau stigmate des Angiospermes.
polyembryonie : dveloppement de plus dun embryon dans une seule graine.
polyphage : se dit dune plante parasite susceptible de parasiter plusieurs types dhtes.
polyplode : se dit dune plante ayant plus de deux ensembles complets de chromosomes
par cellule.
ponctuation : perforation des tissus conducteurs.
ponctuation arole : ponctuation des trachides de Gymnospermes.
pore nuclaire : communication entre le noyau et le rticulum endoplasmique.
289

9782100544141-Laberche.fm Page 290 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

port : aspect extrieur dune plante.


potentiel hydrique = pression osmotique.
pousse radiculaire : pression permettant leau de monter dans le vgtal par les vaisseaux
de xylme.
Pr : forme inactive du phytochrome absorbant la lumire 660 nanomtres.
Prl : forme active du phytochrome absorbant la lumire 730 nanomtres.
pression osmotique : force cre entre deux soluts spars par une membrane semipermable.
procaryote : organisme unicellulaire, primitif de petite taille dpourvu de noyau distinct.
producteur primaire : organisme autotrophe.
promristme sporogne : correspond la tunica 2 de lapex caulinaire lorigine des
pices florales reproductrices.
prophase : premire phase de la mitose.
prophase 1 : premire phase de la miose.
proplaste : organite cellulaire lorigine des chloroplastes et des amyloplastes.
protandrie : caractristique dune fleur hermaphrodite dont les tamines sont mres avant
le pistil.
protines de dfense Pr : molcules produites lors de lagression par un pathogne.
Certaines ont une activit enzymatique identique la b-1,3-glucanase, ou la chitinase,
elles dgradent alors la paroi des champignons. Dautres protines PR peuvent inhiber
des protases ou des polygalacturonases microbiennes, au pouvoir pathogne important.
Elles dsarment ainsi les agresseurs.
prothalle : gamtophyte dune plante vasculaire. Dans le cycle biologique dune plante,
portion de lindividu provenant de la germination dune spore et portant les organes sexuels.
protiste : tre unicellulaire vivant dans leau. Eucaryote.
protonema (pluriel : protonemata) : filaments cellulaires au sol reliant les tiges feuilles des
Bryophytes.
protoxylme : premier xylme form.
pseudo-fruit : fruit provenant du dveloppement du rceptacle qui porte les carpelles.
Ptridophytes : embranchement du rgne vgtal regroupant essentiellement les fougres,
les prles et les slaginelles.
pyxide : fruit simple dhiscent sec ayant deux carpelles ou plus, qui se sparent de diffrentes faons maturit : souvent le long des marges des carpelles, ou par une fente
transversale ce qui dlimite une sorte de couvercle qui se soulve maturit, ou encore
par des pores (Amarante).
Q/R

quiescent : zone mristmatique, avec peu de divisions cellulaires.


racmeuse : qualifie une inflorescence monopodiale (grappe).
racinaire : de la racine.
racine adventive : racine apparaissant le long dune tige souterraine ou arienne.
racines ariennes : racines qui pendent dans lair avant datteindre, le plus souvent, le sol.
290

9782100544141-Laberche.fm Page 291 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

racine aplatie : se dit des racines prsentant une symtrie bilatrale et non plus axiale (cas
des racines dorchides ariennes).
racine crampon : racine assurant la fixation de la plante.
radicule : partie de lembryon lorigine des racines.
rameau : tige secondaire. Dsigne souvent une petite branche darbre.
ramification : tige issue dun bourgeon axillaire.
rceptacle : sommet largi de laxe floral sur lequel sinsrent les verticilles floraux.
rniforme : en forme de rein, semploie pour les cellules stomatiques.
reproduction sexue : obtention dun nouvel individu impliquant lunion de gamtes.
respiration : fixation doxygne et dgagement de CO2.
rticulum endoplasmique : rseau de structures tubulaires ramifies lintrieur du cytosol
et limit par une membrane unique. Il y a le rticulum endoplasmique rugueux couvert
de ribosomes et le rticulum endoplasmique lisse dpourvu de ribosomes.
RFU : rserve en eau facilement utilisable.
rhizoderme : assise superficielle de cellules de la racine.
rhizode : systme de fixation des mousses au sol sapparentant aux racines.
rhizome : tige souterraine horizontale, mettant des racines et des rameaux ariens.
Rhizophytes : plantes ayant des racines : regroupent les Ptridophytes, les Prspermaphytes
et les Spermaphytes.
rhizosphre : zone la priphrie des racines dans laquelle se dveloppent des microorganismes.
rhytidome : corce ; terme technique dsignant le priderme et les tissus rejets par celui-ci.
ribosome : ensemble dARN et de protines ayant un grand rle dans la synthse des
protines la surface du rticulum endoplasmique.
RU : rserve utilisable.
RubisCo : ribulose-biphosphate carboxylase.
rudrale : plante de dcombres.

Dunod La photocopie non autorise est un dlit.

sac embryonnaire : gamtophyte femelle des Angiospermes, constitu de six cellules


haplodes (loosphre, les deux synergides et les trois antipodes) et de deux noyaux polaires.
sac pollinique : constituant de ltamine, contient les grains de pollen.
samare : fruit simple, indhiscent sec une seule graine, dont le pricarpe est de consistance
membraneuse ; la graine unique est attache au pricarpe seulement par sa base (rable,
orme, frne).
saprophyte : se dit dun organisme se nourrissant de matires organiques en dcomposition.
schizocarpe : fruit simple indhiscent sec provenant dovaires carpelles souds dont
chaque loge se transforme en un akne qui, maturit, se spare en loges monospermes.
Familles des Asteraceae, Rubiaceae, Lamiaceae, Borraginaceae, Malvaceae.
sclrophyte : plante ayant des feuilles paisses et dures.
slection naturelle : tri des phnotypes adapts aux facteurs du milieu ; cause de
toute volution pour Darwin.
291

9782100544141-Laberche.fm Page 292 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

semence : terme usuel dsignant lorgane permettant la multiplication dune plante, mme
par voie vgtative.
spale : pice florale du calice, la plus externe ressemblant une feuille.
sessile : se dit dun organe dpourvu dun support ou dun pdoncule.
sve brute : mlange deau et de sels minraux circulant des racines vers les feuilles.
Emprunte les vaisseaux du xylme.
sve labore : mlange deau et de molcules organiques circulant des feuilles vers les
racines. Emprunte les cellules du phlome.
silicicole : plante fuyant les sols calcaires.
silique : fruit sec dhiscent au moins trois fois plus long que large, form de deux valves
spares par une cloison portant les graines. la dhiscence, les valves se sparent
partir de la base.
siphonogamie : type de fcondation par dversement du contenu cellulaire dans une autre
cellule.
somatique : qui affecte les cellules non sexuelles.
sore : ensemble de sporanges sur la face infrieure des frondes de fougre.
spciation : apparition despces nouvelles partir despces antrieures.
Spermaphytes (ou Spermatophytes) : plantes produisant des graines. Regroupent les
Gymnospermes et les Angiospermes.
spermatozode : gamte mle flagell.
sporange : organe producteur de spores et ayant une paroi pluricellulaire.
sporocyste : enveloppe de la cellule mre qui, par divisions successives, a donn des spores
qui sont libres dans le milieu.
sporogone : sporophyte parasitant le gamtophyte des Bryophytes.
sporophyte : phase diplode asexue du cycle biologique dune plante.
squamuleux : semblable des cailles (semploie surtout chez les lichens).
stade diplotne de la miose : les chromosomes scartent.
stade leptotne de la miose : les deux chromatides sindividualisent.
stade pachytne de la miose : les chromosomes se condensent.
stade zygotne de la miose : les chromatides sapparient.
stle : ensemble des tissus conducteurs primaires.
strigmate : appendice cellulaire reliant la basidiospore la baside.
stigmate : partie extrme du pistil terminant le style. Cest sur les stigmates que germent
les grains de pollen.
stipules : appendices de la feuille, plus ou moins dvelopps verts ou membraneux.
stolon : tige rampante courant sur le sol et produisant son extrmit des rosettes de feuilles
qui seront lorigine dune nouvelle plante (fraisier).
stomate : ouverture de lpiderme des feuilles et des tiges qui favorisent les changes gazeux.
stroma : intrieur de la mitochondrie ou du chloroplaste.
style : partie du pistil entre lovaire et les stigmates au sommet.
subrine : constituant impermable des cellules de lige.
292

9782100544141-Laberche.fm Page 293 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

succulence : accumulation deau dans les tissus.


symbiose : relation quilibre entre partenaires.
sympodiale : type de ramification o le bourgeon terminal de la tige avorte et est relay
par un bourgeon axillaire qui se redresse.
synergides : les deux cellules du sac embryonnaire, et entourant souvent loosphre.
systme de transport actif primaire : systme membranaire correspondant lATPasepompe protons, avec sortie des protons vers lextrieur de la membrane.
systme de transport actif secondaire : systme membranaire correspondant lATPasepompe protons correspondant lATPase-pompe protons plus un canal ou un transporteur rejetant lion ou la molcule vers lextrieur de la membrane, ou un cotransporteur
permettant lentre dun ion ou dune molcule lintrieur de la cellule

Dunod La photocopie non autorise est un dlit.

taxon : unit occupant un rang dfini dans la classification (pluriel taxa).


taxonomie : science de la classification des taxons.
tgument : tissu protecteur de lovule.
tlophase 1 : phase 4 de la premire division de la miose. Dlimitation des noyaux haplodes.
tpale : ptales et spales identiques.
ttraspore : cellule haplode lissue de la miose.
thalle : appareil vgtatif des Thallophytes.
Thallophytes : ancienne partie des vgtaux comprenant les algues et les champignons.
Plante nayant ni tige, ni feuille, ni racine.
throphyte : plante annuelle cycle court et dveloppement rapide.
thylacode : disque granaire dans les chloroplastes (scrit aussi dans les versions anciennes
thylakodes).
tige : organe allong portant les feuilles et les fleurs.
tigelle : premire tige dans lembryon.
tissu : ensemble organis de cellules formant une entit fonction et structure bien dtermine.
tissus primaires : ensemble des tissus produits directement par les mristmes primaires.
tissus secondaires : tissus produits par un cambium ou une assise gnratrice.
tonoplaste : membrane qui isole la vacuole du cytoplasme.
totipotence : proprit fondamentale des cellules vgtales qui leur permet de se ddiffrencier puis de se rediffrencier.
trache : vaisseau du xylme constitu de cellules mortes.
trachide : vaisseau du xylme plus courte que les traches et dot dune paroi transversale.
Trachophytes : ensemble des vgtaux pourvus de tissus conducteurs lignifis (Ptridophytes, Prspermaphytes et Spermathytes).
transduction : intgration par un bactriophage dune partie du patrimoine gntique de
la bactrie.
transformation : chez les bactries cest un change gntique entre une bactrie et de
lADN bicatnaire exogne.
293

9782100544141-Laberche.fm Page 294 Jeudi, 4. fvrier 2010 3:47 15

Glossaire

transformisme : thorie qui considre que les tres vivants changent au cours des temps.
transpiration : sortie deau, avec changement dtat de liquide gazeux, rgule par
louverture et la fermeture des stomates.
transpiration cuticulaire : sortie deau sous forme de vapeur au niveau de la cuticule.
transpiration stomatique : sortie deau sous forme de vapeur au niveau des stomates.
transport facilit : transport dions effectu grce aux protines membranaires.
transporteur : lment du transport actif secondaire permettant le passage dions ou de
molcules dans le mme sens que les protons, donc de lintrieur vers lextrieur de la
cellule.
triplode : gnome triple.
trisomie : triplement dun chromosome.
trophique : relation nutritive.
tube cribl : lment du phlome o circule la sve labore.
tube pollinique : excroissance du grain de pollen, apparaissant au moment de sa germination ;
traverse les tissus du style et achemine les gamtes mles dans lovule.
tubercule : renflement souterrain dune tige, accumulant des rserves.
tunica : couche cellulaire du mristme apical caulinaire.
U-V

unisexue : fleur ne portant quun seul sexe : androce ou gynce.


vacuole : partie de la cellule vgtale, situe au centre et contenant essentiellement des
substances en solution.
vaisseau du xylme : lment du xylme constitu de cellules mortes.
varit : sous-ensemble homogne dune espce aux caractres morphologiques particuliers.
velamen : tissu vgtal constituant une gaine de cellules mortes recouvrant les racines des
orchides piphytes et dont la fonction consiste absorber leau.
vernalisation : aptitude fleurir dclenche par le froid.
verticille : groupe de feuilles, de spales, de ptales ou de carpelles insrs en cercle autour
dun axe.
vsicule golgienne : petit sac situ en priphrie du dictyosome.
vrai fruit : fruit qui provient uniquement du dveloppement de lovaire.
X-Z

xylme : tissu conducteur de la sve brute.


zone latrale : zone cellulaire du mristme apical caulinaire lorigine des feuilles.
zoochorie : dissmination des graines (ou des fruits) par les animaux.
zoogamie : mode de pollinisation avec transport du pollen par les animaux.
zoospore : spore produite asexuellement, flagelle, capable de se mouvoir dans leau.
zygomorphe : qualifie une fleur irrgulire symtrie bilatrale.
zygote = uf : cellule diplode rsultant de la fcondation de deux gamtes ou de deux
cellules haplodes.
294

9782100544141-Laberche.fm Page 295 Jeudi, 4. fvrier 2010 3:47 15

INDEX

Dunod La photocopie non autorise est un dlit.

A
acacia 226
acaule 14
accommodat 241
Aceraceae 163, 201
acide abscissique 214, 260
Adoxaceae 143
agamospermie 153, 155
agaric champtre 12, 130
Agavaceae 207
agent mutagne 251
Agrobacterium 269
tumefaciens 267
ail 250
akne 35, 40
albdo 170
albumen 32, 149
algues 40
rouges 126
allogamie 146, 240, 252
allopolyplodie 258
amande 37
Amaryllidaceae 212, 246
ambroisie 25
amidon 88
ammonification 237
amyloplaste 88
amylose 72
Anacardiaceae 156
analogie 22
anaphase 82, 122
Anatideae 247
androce 24
androgense 265
anmogamie 146

Angiospermes 10, 31, 56, 57, 62, 67, 110,


115, 117, 142, 149
anthre 145
anthridie 132, 135
anthse 145
antipode 143
apex 99
Apiaceae 48, 206, 214
Apocynaceae 221
apomixie 153
apoplasme 91
apoptose 230
appareil nuclaire 73
aquaporine 164
Aquifoliaceae 108
Arabidopsis thaliana 79, 102, 152
arbre de Jude 163
archgone 55, 132, 133, 135, 144
Archgoniates 55, 121, 133
archthalle 41
Archrochaetum 126
Arcimboldo 205
Arecaceae 48
Aristote 4, 8
ascospore 129
asque 43, 129
assimilat 202
assise subro-phllodermique 110
Asteraceae 25, 40, 48, 216, 217, 221, 222,
231, 247
Astrales 60
ATP-synthase 197
aulne 57
autogamie 146, 240, 252
autotrophie 4, 158, 233
auxse 260
auxine 260
295

9782100544141-Laberche.fm Page 296 Jeudi, 4. fvrier 2010 3:47 15

Index

avoine 250
azote 236
Azotobacter 238

B
baie 36, 39
baside 130
basidiomycte 130
basidiospore 130
bgonia 28, 31
betterave 175, 219, 266
sucrire 250
Betulaceae 163, 228
biodiversit 248
biomasse 232
biosphre 231
biotope 241
bipartition 73
Blastocladiaceae 128
blastomre 149
bl 23, 31, 33, 81, 151, 172, 173, 174, 218,
249, 250, 256
bois 110, 113
htroxyl 115
homoxyl 115
Borraginaceae 40
bouleau 20, 115, 163
bourgeon
axillaire 13, 16, 19
terminal 13, 16
Boussingault 4
bracte 24, 140
Brassicaceae 48, 147, 149, 213, 222
brvistyle 146
Brunfels 45
bruyre 210, 222
bryonne 28
Bryophytes 110, 132
Buffon 4
bulbe 15
bulbille 153
bulk-mthod 256
C
cacao 250
calice 24
Cambaridae 247
296

cambium 110
campanule 146
canal 78
canche 219
canne sucre 188, 250
capacit
biognique limite 234
de rtention maximale 159
capillarit 159
capitule 30, 142
Caprifoliaceae 144
capsule 35, 39, 73
carcophore 12
carotte 23, 250
carpelle 26, 27, 143
carpophore 42
caryogamie 239
Caryophyllaceae 153, 168, 264
caryopse 35, 40
Casuarinaceae 228
cellule
gnrative 145
vgtative 145
cellulose 92
cnocytique 42, 138
centromre 82
Cervidae 247
Cesalpiaceae 163
champhyte 207
champignon 40, 42, 93
saprophyte 57
chanvre 81
Characeae 178
chtaignier 17, 19
chlat 177
chne 17, 20, 22, 35
Chenopodiaceae 219, 221, 247
chiasma 122
chitine 93, 127
chlamydomonas 125
Chlorophyceae 124, 125
chloroplaste 70, 87
chou 126, 250
chromatide 80
chromatine 79
chromoplaste 88
chromosome 80

9782100544141-Laberche.fm Page 297 Jeudi, 4. fvrier 2010 3:47 15

Dunod La photocopie non autorise est un dlit.

Index

chrysanthme 99, 144, 217


Chrysomelideae 257
citron 156
cladome 41
cladothalle 41
classification
de Linn 52
de Takhtajan 60
de Tournefort 51
naturelle de Jussieu 53
phylogntique 51, 54
Clavicipitaceae 42
cloisonn 42
clone 153
Clusiaceae 48
cocotier 106
Codex Lutetianus 45
codium 125
coiffe 103
colza 175
Commelina communis 169
Commelinaceae 169
Composes 46
Compositeae 48
concombre 250
conduction vasculaire 165
conidiophore 154, 155
conidiospore 155
conjugaison 74
Convallariaceae 62, 212
Convolvulaceae 168
Coriariaceae 228
Cormophytes 12, 23, 55, 110, 115, 131, 132
cormus 12
corolle 24
corps de Golgi 71
corpus 100
Corticiaceae 74
corymbe 30
coton 250
cotonnier 216
cotyldon 13, 31, 138, 151
couche limite 170
coumarine 209
courgette 250
Crassulaceae 89, 221

cresson 213
crte mitochondriale 86
Crucifereae 48
Cryptogames 56
Cucurbitaceae 201, 202
culture biologique 4
culture in vitro 252, 259, 261
Cupressaceae 17
Cyanophyceae 238
Cycadaceae 136
cycas 136
cycle
de Krebs 193
de lazote 237
digntique 124
cylindre central 107
cyme 31
cynorrhodon 37
Cyperaceae 30
cytokinse 81
cytokinine 260, 262
cytoplasme 70, 72
cytosol 70, 83
cytosome 89
cytosquelette 83

D
Dahlgren 61
Darwin 9
darwinisme 9
datura 270
de Vries 253
ddiffrenciation 104
dficit de pression 162
disme 8
dlessria 41
Dematiaceae 256
dnitrification 238
Descartes 5
desmotube 84
diacinse 122
diapause 207
diaspore 156, 205
dicaryon 129
Dicotyldones 46, 64, 105, 109, 143, 150
dictyosome 85
297

9782100544141-Laberche.fm Page 298 Jeudi, 4. fvrier 2010 3:47 15

Index

diffrenciation
centrifuge 108
centripte 108
diffusion simple 76
digntique 121, 125
digitale 222
dioque 26, 124, 132, 146
Dioscoride 45
diplodie 80, 120
diplophase 120
division
anticline 100
quationnelle 122
pricline 100
dominance apicale 263
dormance 208, 211
Dreissenidae 247
drosophyllum 214
Drosraceae 214
drupe 37, 39

E
eau
dimbibition 161
de constitution 160
libre 161
bauche foliaire 101
caille 140
cosystme 231, 248
cotype 242, 243
daphique 159
Eleagnaceae 228
liciteur 228
lode 154
embryon 31
adventif 153
endocarpe 34
endosperme 138, 140
entomogamie 146
enveloppe nuclaire 79
pi 29
picarpe 34
piderme 108, 109
rable 20, 163
Ericaceae 210, 222
Erysiphaceae 257
Escherichia coli 267
298

escourgeon 257
espce 46
tamine 24, 136, 140
extrorse 26
introrse 26
thylne 260
eucalyptus 226
Eucaryotes 54
Eudicotyldones 64
euglne 41
vaporation 170
vapotranspiration 172
volutionnisme 9
exine 145

F
Fabaceae 48, 168, 213, 220, 222, 226, 231
Fabales 60
Fagaceae 17, 207
faisceau criblovasculaire 108
FAO (Food and Agriculture Organisation) 172
feuille
alterne 21
caduque 21
oppose 21
persistante 21
verticille 21
Feulgen 80
fverole 250
figuier 38
filet 24
flagelle 73
fleur
actinomorphe 25
asymtrique 25
hermaphrodite 26
pdicelle 29
pistille 26
sessile 29
stamine 26
unisexue 26
zygomorphe 25
foliole 20
follicule 35, 39
fort dcidue 21
formation secondaire 110
forsythia 163

9782100544141-Laberche.fm Page 299 Jeudi, 4. fvrier 2010 3:47 15

Index

Dunod La photocopie non autorise est un dlit.

fougre 222
Fragaricaceae 130
fraisier 15, 37
framboisier 23
frne 35, 202
fruit 34
charnu 36
compos 38
sec
dhiscent 35
indhiscent 35
Fuchs 45
funicule 26

G
gamtange 55, 132
gamtocyste 55, 124
gamtophyte 120
Gautheret 4
gemmule 31, 95, 151
gent 220, 222
gnome 240
gnotype 239
gophyte 207
gotropisme 22
Geraniaceae 274
granium 53
gerbra 266
germination 212
Gesneriaceae 264
gibbrelline 260, 261
girofle 23
glycocolle 200
glycolyse 191
glycoprotine 92
glycosinolate 250
glyoxysome 89
Gorenflot 4
gousse 35, 39
grain de pollen 136, 140, 145
graine 31, 141
prisperme 32
albumine 32
exalbumine 32
Gramineae 48
Gramines 30
grana 88

grappe 29
gui 214, 223, 224
guttation 162
Guttifereae 48
Gymnospermes 10, 56, 57, 105, 115, 117,
144, 152
gynce 24
gynogense 266

H
Haberland 259
Haeckel 54
halophyte 222
haplo-diplophasique 126
haplodie 80, 120, 126, 264
haplophase 120
haricot 22, 32, 33, 250
hellbore 35, 210
hmicellulose 92
hmicryptophyte 207
herbace 14
herbier 54
hermaphrodite 142, 146
hespride 39
htrosis 254
htrotrophe 126, 158, 233
htrozygote 253
htre 18
hile 26
Hippocastanaceae 163
holoparasite 224
homologie 22
homozygote 244
Hoocke 4
humidit relative 162
Hyacinthaceae 212
hyaloplasme 72
hybridation 243
hybride 244, 254
hydrogamie 146
hyphe 42, 127
hypocotyle 151
Hypolepidaceae 222
I
ibicella 214
imbibition 159
299

9782100544141-Laberche.fm Page 300 Jeudi, 4. fvrier 2010 3:47 15

Index

inbreeding 254
inflorescence 29
monopodiale 29
racmeuse 29
sympodiale 31
initium foliaire 101
intercinse 122
intergnrique 258
interphase 82
intine 145
intraspcifique 258
isolement 243
isomorphe 125

J
jacinthe 212
joubarbe 221
Juglandaceae 209
Jussieu 46, 53
K
kennedia 213
Krebs 193
L
Labiateae 48
laitue 127, 172, 250, 253, 266
Lamarck 3, 9
lamelle moyenne 91
Lamiaceae 40, 48
Lamiaces 46
Lamiales 60
laminaire 13
lampourde 217
Lavoisier 4
leghmoglobine 226
Lgumineuses 46
Leguminoseae 48
lentille 250
liber 110, 113
lichen 40, 43
lige 110, 113
lierre 20, 31
ligne pure 254
lilas 210, 216
Liliaceae 109, 156, 212
limbe 20
300

lin 250
Linn 4, 45, 49
lis 156
loi de lhrdit des caractres acquis 9
longistyle 146
Loranthaceae 214, 223
lupin 250
luzerne 250
lychnis 28
lysosome 71, 89

M
macrolment 173, 175
Magnoliales 60
mas 159, 188, 213, 250, 253
Malvaceae 40, 216, 231
manguier 156
manioc 250
marronnier 20, 163, 211
miose 120
melon 216, 250
membrane plasmique 72, 74
mrse 81
mristme
apical 99, 102
caulinaire 99
floral 102
mdullaire 100
primaire 95
msocarpe 34
mtaphase 82, 122
mtaphlome 108
mtaxylme 108
microfilament 83
micropropagation 264
micropyle 26, 32, 138, 140
microtubule 82, 83
Mimosaceae 168, 226
minralisation 237
mitochondrie 71
mitose 81
Monocotyldones 46, 64, 105, 109, 110,
143, 151
monogntique 121
monoque 26
mouron 222
deau 241

9782100544141-Laberche.fm Page 301 Jeudi, 4. fvrier 2010 3:47 15

Index

Dunod La photocopie non autorise est un dlit.

moutarde 35
muguet 212
multiplication vgtative 120, 153
mutation 243
somatique 252
myclium 12, 42, 127
mycorhize 225
Myocastoridae 247
Myricaceae 228
Myrtaceae 226
myxamibe 126
myxoflagell 126
myxomyctes 126

N
narcisse 212, 246
nard 219
Nectriaceae 74
nmatothalle 41
nnuphar 32, 81
no-darwinisme 9
nervure 20
Nitella 178
nitrate 238
nitration 237
nitrification 237
nitrosation 237
noisetier 14, 29
nomenclature binaire 49
noyau 37, 70
accessoire 143
polaire 143
secondaire 143
noyer 27
nucelle 26, 27, 138, 140
nuclole 79
nucloplasme 79
nucule 40
Nyctaginaceae 168
O
illet 264
OGM 266
odium 257
oignon 250
Oleaceae 163, 210
oligo-lment 173, 175

oligophage 225
ombelle 30
Ombellifres 46
Onagraceae 143
oogamie 133, 135
oosphre 55, 132, 143
orange 37
orchide 34, 87
organite 70, 85
orge 33, 213, 250
orme 20
osmonde royale 222
osmotique 159
Osmundaceae 222
ostiole 166
ovaire 24, 26
infre 26
semi-infre 26
supre 26
ovule 24, 26, 140
anatrope 27
campylotrope 28
orthotrope 27
Oxalidaceae 168
oyat 220

P
palontologie 51
Palissy (Bernard de) 4
Palmaceae 106
Palmeae 48
palmier 31
papilionace 142
parasitaire 126
parasitisme 223
parenchyme
cortical 106, 108
lacuneux 109
mdullaire 107
palissadique 109
paroi
cellulaire 70
primaire 91, 92
secondaire 91
pas dne 222
passage de la vie aquatique la vie terrestre
67
301

9782100544141-Laberche.fm Page 302 Jeudi, 4. fvrier 2010 3:47 15

Index

Pasteur 4
pavot 28, 35
pectine 92
Pedaliaceae 214
pdoncule floral 24
Pelargonium 53, 274
pense 242
PEPcase 188
pponide 39
prianthe 25
pricarpe 34
pricycle 107
priderme 113
prisperme 32
permase 76
Peronosporaceae 127, 206
peroxysome 89, 200
persil 214
ptale 24
ptiole 20
peuplier 23, 115
Phanrogames 56
phanrophyte 207
phelloderme 110, 113
phnotype 239
phialide 154
phlome 107, 201
photopriode 216
photophosphorylation cyclique 186
photorespiration 199
photosynthse 65, 70, 182, 236
phototropisme 22
phyllotaxie 21, 101
phylognie molculaire 62
phylum 48
phytoalexine 231
phytochrome 217
phytomasse 233
pigment 88
pili 73
pin 17, 57, 114, 139, 222
Pinaceae 17, 139, 221, 222
piridion 39
pissenlit 216, 222
pistil 24
placentation 28
Plantaginaceae 64, 109
302

plante
annuelle 205
autogame 255
bisannuelle 206
prenne 207
plantule 31
plaque quatoriale 82
plasmalemme 72, 74
plasmide 73, 268
plasmode 126
plasmodesme 74, 83
Plasmodiophoraceae 126
plasmogamie 129
plaste 126
plasticit 260
Poaceae 33, 40, 48, 109, 151, 167, 177, 188,
207, 213, 218, 219, 247, 249, 253, 257, 258
Poales 60
Podocarpaceae 228
poil absorbant 22, 106, 162
point de fanaison 159
poireau 22
pois 21, 32, 35, 216, 250
pollen 24
polyembryonie 156
Polygonaceae 221
polyphage 224
polyplodie 243
polypode 134
Polypodiaceae 134
polytric 132
Polytrichaceae 132
pomme de terre 15, 16, 211, 250, 263
pommier 30, 34, 37, 81, 202
ponctuation 117
arole 117
Pontederiaceae 247
port 21
potentiel hydrique 161
pousse radiculaire 163
pression osmotique 90
Priestly 182
primevre 28, 146
Primulaceae 222
Procaryotes 54, 71
producteur primaire 232
promristme sporogne 102

9782100544141-Laberche.fm Page 303 Jeudi, 4. fvrier 2010 3:47 15

Index

Dunod La photocopie non autorise est un dlit.

prophase 82, 122


proplaste 86
protandrie 146
protine de dfense Pr 231
prothalle 135
protonma 132
protophlome 108
protoxylme 108
Prymnesiophyceae 247
pseudo-fruit 37
Pyronemacetaceae 128
pyruvate 191
pyxide 39

R
racine
arienne adventive 22
aplatie 23
crampon 22
radicule 31, 95, 150
raisin 36
rameaux 14
ramification
ligneuse 14
monopodiale 17, 18
secondaire 14, 18
sympodiale 19
sympodiale-dichasiale 19
sympodiale-monochasiale 19
Ranunculaceae 107, 210, 221
ray-grass 218
rceptacle 24
rniforme 166
renoncule 27, 107
reproduction sexue 120
respiration 182, 236
mitochondriale 200
rticulum endoplasmique 71, 83
Rhamnaceae 228
Rhizobium 226, 228, 238
rhizoderme 106
rhizogense 261
rhizode 23
rhizome 15, 134
Rhizophytes 56
rhizosphre 225
rhododendron 174

rhytidome 113
ribosome 71, 84
ricin 32, 33
riz 250, 266
Roose 3
Rosaceae 178, 201, 209, 228
rosier 22, 37
Rubiaceae 40
RubisCo 187, 217
rudrale 221
Rutaceae 156

S
sac
embryonnaire 26, 143
pollinique 24, 136, 140
Saintpaulia 264
Salicaceae 17
samare 35, 40
sapin 17
saprophytique 126
saule 17, 29
sceau de Salomon 15, 16
schizocarpe 40
sclrophyte 219
Scrofulariaceae 222
Scrophulariaceae 64, 96, 241
seigle 218
Selaginellaceae 156
slection 243, 246, 256
massale 251
naturelle 9
semence 156
spale 24
squoia 17
srine 200
sve
brute 107, 165
labore 107
sexualit des plantes 4
silicicole 222
silique 35, 39
siphonogamie 141, 148
soja 250
Solanaceae 16, 47, 89, 92, 147, 231, 247, 270
sorgho 33, 188, 250
spciation 243
303

9782100544141-Laberche.fm Page 304 Jeudi, 4. fvrier 2010 3:47 15

Index

Spermaphytes 56, 105, 115


spermatozode 132, 135
sporange 55, 126
sporocyste 55
sporogone 132
sporophyte 120, 125
stade
diplotne 122
leptotne 122
pachytne 122
zygotne 122
stle 104
strigmate 130
stigmate 24
stipe 19
stipule 21
stolon 15
stomate 165
striga 96
stroma 86, 88
structure primaire 104
style 24
subrine 113
succulence 220
sureau 111, 144
symbiose 225
synergide 143
synura 41

T
tabac 47, 105, 181, 250, 266
Taxaceae 228
taxon 49
taxonomie 51
tgument 26, 32, 140
tlophase 82
tosinte 249
tpale 25
ttraplodie 243
ttraspore 145
thalle 12, 40
complexe 44
crustac 44
foliac 43
fructiculeux 43
glatineux 44
squamuleux 43
304

Thallophytes 12, 23, 40, 55, 131


Thophraste 45
thorie
de lpigense 8
de lpignisme 6
de lvolution 5
de la gnration spontane 4
du fixisme 4, 8
du transformisme 4, 9
synthtique de lvolution 9
throphyte 205
Thornthwaite 172
thylacode 88
tigelle 31, 151
tilleul 114
tissu
primaire 95
secondaire 95
tomate 36, 92, 172, 182, 216, 250
tonoplaste 74, 89
totipotence 118, 259
Tournefort 46, 52
tournesol 250
trache 116
trachide 116
transduction 73
transformation 73
transpiration 162
cuticulaire 165
stomatique 165
transport
actif 203
facilit 76
transporteur 78
trfle 13, 20, 29, 30, 32, 35, 47, 81, 146, 250
triplodie 243
tripsacum 249
trisomie 243
triticale 258
Triticosecale 258
trophique 233
tube
cribl 116
pollinique 138
tubercule 15
tulipe 15, 17, 24, 28, 212
tunica 100

9782100544141-Laberche.fm Page 305 Jeudi, 4. fvrier 2010 3:47 15

Index

U
ulve 41, 124
Umbellifereae 48
Urticaceae 221

V
vacuole 70, 89
vaporisation 165
varit 46
vernalisation 218
verticille 21, 24
vsicule 85
vigne 163, 252
Vilmorin 249
Violaceae 242
violette 28
Vitaceae 163
vrai fruit 35
vrille 21

xylme 107, 201, 224

Went 260

Z
Zambryski 268
Zea mays (voir mas)
zone
latrale 100
oncogne 268
quiescente 103
zoochorie 157
zoogamie 146
zoospore 125, 154
zygote 123

305

9782100544141-Laberche.fm Page 306 Jeudi, 4. fvrier 2010 3:47 15

Mise en pages et numrisation


TyPAO sarl
75011 Paris