Académique Documents
Professionnel Documents
Culture Documents
Food Chemistry
journal homepage: www.elsevier.com/locate/foodchem
Institute of Food Nutrition and Safety, School of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu Province, China
Institute of Food Safety, Kunming University of Science and Technology, Kunming, Yunnan Province, China
c
The State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi, Jiangsu Province, China
d
Human Nutrition Department, Egerton University, PO Box 536, Egerton, Kenya
b
a r t i c l e
i n f o
Article history:
Received 21 September 2013
Received in revised form 9 April 2014
Accepted 20 May 2014
Available online 6 June 2014
Keywords:
Escherichia coli
Antimicrobial peptide
Penetrate cell membrane
DNA binding
a b s t r a c t
The antibacterial activities and mechanism of a new P7 were investigated in this study. P7 showed antimicrobial activities against ve harmful microorganisms which contaminate and spoil food (MIC = 4
32 lM). Flow cytometry and scanning electron microscopy analyses demonstrated that P7 induced
pore-formation on the cell surface and led to morphological changes but did not lyse cell. Confocal uorescence microscopic observations and ow cytometry analysis expressed that P7 could penetrate the
Escherichia coli cell membrane and accumulate in the cytoplasm. Moreover, P7 possessed a strong DNA
binding afnity. Further cell cycle analysis and change in gene expression analysis suggested that P7
induced a decreased expression in the genes involved in DNA replication. Up-regulated expression genes
encoding DNA damage repair. This study suggests that P7 could be applied as a candidate for the development of new food preservatives as it exerts its antibacterial activities by penetrating cell membranes
and targets intracellular DNA.
2014 Elsevier Ltd. All rights reserved.
1. Introduction
Food preservation plays an important role in the food industry.
Food preservatives are used to secure food quality and extend their
shelf life. Microorganisms are one of the important factors that
inuence the safety of the food. Great concerns have arisen from
food safety problems caused by harmful microorganisms that
induce food contamination and deterioration. Microorganisms
from polluted foods may cause a number of infections and the
spread of diseases. Minimally processed and safe foods are in high
demand. Such demands call for better, more efcient antimicrobial
sources of biological preservatives that inhibit food contamination.
Due to the limited safety proles of chemical preservatives and
efciency of natural antimicrobial agents, there is a need for them
to be improved.
Corresponding author at: The State Key Laboratory of Food Science and
Technology, Jiangnan University, Wuxi, Jiangsu Province, China. Tel./fax: +86 510
85917789 (G. Le).
E-mail addresses: lirong.lily@gmail.com (L. Li), lgw@jiangnan.edu.cn (G. Le).
1
Tel./fax: +86 0871 65920171 (L. Li)
http://dx.doi.org/10.1016/j.foodchem.2014.05.113
0308-8146/ 2014 Elsevier Ltd. All rights reserved.
232
bactericidal activities against pathogenic and spoilage microorganisms pertinent to food and possessed good selectivity. This study
was aimed to investigate the antimicrobial mechanism of P7
against Escherichia coli. Insights into the mechanism employed by
P7 will facilitate new approaches to discover and guide the
development of efcient food preservatives.
233
2.9.3. RT-PCR
Quantitative real-time PCRs were performed using the same
cDNA for both the gene of interest and 16S rRNA, using the Greenstar qPCR Master Mix (Bioneer, Korea). Each reaction contained
0.5 ll cDNA, 5 ll SYBR Green PCR Master Mix, 0.4 ll of forward
and reverse primers and 3.7 ll nuclease-free water was used to produce a nal volume of 10 ll. The sequences of the primers were
used as follows: dnaA (chromosomal replication initiator protein)
forward AGCAGTCCATTGATATTATTAAGG, reverse GATGAGTTACCA
GCCACAG; dnaB (replicative DNA helicase) forward CAACAAACAGC
AGGCTGAACC, reverse CTACATCATCCCAGCGTTCGT; dnaG (DNA
primase) forward CGGTCGGGTGATTGGTTTTG, reverse CACAAGCAG
ACGATTGGGTTCA; ssb (single-stranded DNA-binding protein) forward CCAGCAGAGGCGTAAACAAGGT, reverse GATTCGGAAGTAGCC
AGCGTAA; 16s rRNA (16S ribosomal RNA) forward CGGACGGGTGA
GTAATGTCTG, reverse AGGTCCCCCTCTTTGGTCTTG.
The PCR conditions consisted of activation at 95 C for 5 min,
followed by 45 cycles of denaturation at 95 C for 20 s, annealing
at 62 C for 30 s and extension of 72 C for 20 s. A melting curve
step of 95 C for 15 s, 60 C for 15 s and 95 C for 15 s was also
included to verify the specicity of the PCR amplied products
using the software provided with the 7900 real time PCR system
(Applied Biosystems, Foster City, CA, USA). The relative expression
levels of the interest genes were calculated as the ratio to the
housekeeping 16S rRNA gene.
3. Results
3.1. Antibacterial activities of peptides
Compared to ppTG20, P7 exhibited higher antibacterial activity
against all the tested bacterial strains with MIC values between 4
and 32 lM (Table 1). The antibacterial activity against the Gramnegative bacteria was better than the Gram-positive bacteria.
Except for S. aureus, the antibacterial activity of P7 was better than
Nisin, which was active against the Gram-positive bacteria but not
against Gram-positive bacteria.
Table 1
The minimal inhibitory concentrations of peptides against different pathogenic
microorganisms.
Microorganism
MIC (lM)
ppTG20
P7
Nisin
Buforin II (521)
Gram-negative bacteria
E. coli
S. dysenteriae
S. typhimurium
>64
>64
64
8
8
4
>64
>64
>64
1
2
0.5
Gram-positive bacteria
L. monocytogenes
S. aureus
>64
>64
16
32
32
16
1
1
234
Table 2
Peptide induced membranes damage of E. coli cells and the cell-penetrating efciency of E. coli cells treated with FITC-labelled peptides.
Experimental conditions
Control
ppTG20
P7
Buforin II (521)
0.06 0.03
1.67 0.82
9.60 2.97*
NT
0.34 0.10#
9.17 0.36*,#
87.9 2.57*
94.2 3.02*
Each value of cell-penetrating efciency is expressed as the mean SD of three independent experiments.
NT, Not test.
*
Signicant difference with control group (P < 0.05).
#
Signicant difference with buforin II (521) group (P < 0.05).
Fig. 1. E. coli cells treated with phosphate buffered saline (A), 8 mM P7 for 0.5 h (B), 1 h (C) and 2 h (D) visualized by scanning electron microscopy.
235
P7 Fluorescence image
P7 DIC image
P7 Merge image
Fig. 2. Confocal uorescence microscopic images of E. coli cells. E. coli cells were treated with 8 lM of FITC-labelled ppTG20 (A), P7 (B) and Buforin II (521) (C) at 37 C for
30 min. FITC-labelled peptides penetrated the cell membrane and accumulated in the cytoplasm. For each of the peptide treatments, uorescence, differential interference
contrast (DIC) and merge images of each cell type are shown.
(521) (Fig. 4D). These results indicated that P7 caused most cells
to remain in phase S, affecting the DNA replication of bacteria intracellularly rather than targeting the membrane.
3.8. Change in gene expression in E. coli cells
The quantitative reverse transcriptionpolymerase chain reaction was carried out to analyse whether the expression of the
DNA replication and DNA damage repairing related genes were
236
Fig. 3. Gel retardation analysis of the binding of peptide to E. coli genomic DNA. Various amounts of peptides were incubated with 250 ng of E. coli genomic DNA at room
temperature for 10 min and the reaction mixtures were applied to a 0.8% agarose gel electrophoresis. The weight ratio (peptide: DNA) was indicated above each lane.
affected after treatment with the peptide. In Fig. 4E, there was a
signicant decrease in the expression of dnaG mRNA (P < 0.05).
No signicant difference in the expression of the other ve interested genes was observed between the ppTG20 treated and the
control groups (P > 0.05). In contrast, a total of six interest genes
were found to be responsive to P7. P7 included signicantly
decreased expression of genes encoding DNA replication compared
with the control group (P < 0.05). These genes included dnaA, dnaB,
dnaG and ssb. Exposure to P7 resulted in the up-regulation of recA
and recN genes, which are involved in the SOS response to DNA
damage repair. Similar, but more pronounced, expression proles
of recA and recN genes were seen in buforin II (521) treated
groups. The results demonstrated that P7 binded to DNA and it
4. Discussion
Natural preservatives are always being developed to satisfy
consumer demand with regard to nutritional, preservative-free
and minimally processed aspects of foods (Tiwari et al., 2009).
Unfortunately, they show a narrow range of antibacterial spectrum
and low antimicrobial activities. Meanwhile, multi-resistant pathogenic bacteria are emerging and pathophoresis caused by foodborne pathogens have created an urgent need for the development
237
Fig. 4. Effect of peptide on cell cycle and verication of the expression changes of dnaA, dnaB, dnaG, ssb ,recA and recN of E. coli. cells analysis by ow cytometry. (A) The cell
cycle of normal E. coli cells, (B) cells treated with ppTG20 for 0.5 h, (C) cells treated with P7 for 0.5 h, cells treated with buforin II (521) for 0.5 h (D), (E) The relative
expression level of samples were calibrated by the comparative threshold cycle method, using 16s rRNA as an endogenous control. Data are expressed as fold changes,
normalized to 16s rRNA mRNA expression, where the values for the control group were set at 1.0. Results are showed as means SD. P < 0.05 compared with the control
group. Statistical different versus control as determined by ANOVA post hoc Tukeys test.
of new kinds of preservatives (Rydlo, Miltz, & Mor, 2006). Safe and
efcient preservatives can be used alone or in combination with
other natural preservatives to replace traditional chemical preservatives. Antimicrobial peptides are small peptides with a wide
range of antimicrobial activity (including bacteria, yeasts, and
fungi), effective and safe therapeutics without antibiotic resistance
(Brandenburg, Merres, Albrecht, Varoga, & Pufe, 2012). Their enzymatic hydrolysis products are also safe for changing into small
peptides. There they show prospective applications in the food
industry. The antimicrobial peptides Nisin, which was initially
evaluated as a clinical antibiotic, has been used as a food preservative in dairy products and canned goods (Delves-Broughton et al.,
238
5. Conclusion
More studies of the molecular mechanisms are needed. However, our results clearly demonstrated that P7, derived from the
cell-penetrating peptide ppTG20, has strong antibacterial activities
against food-borne pathogenic microorganisms. This peptide
might be an attractive and valuable candidate as an effective food
biological preservative. Moreover, antimicrobial mechanism analysis revealed that unlike most membrane-active peptides, P7 had a
minor damaging effect on the cytoplasmic membrane of E. coli.
However P7 could penetrate the E. coli cell membranes and accumulate in the cytoplasm but did not lyse the cells. After uptake into
239
Joshi, S., Bisht, G. S., Rawat, D. S., Kumar, A., Kumar, R., Maiti, S., et al. (2010).
Interaction studies of novel cell selective antimicrobial peptides with model
membranes and E. coli ATCC 11775. Biochimica et Biophysica Acta (BBA)
Biomembranes, 1798, 18641875.
Li, L. R., Shi, Y. H., Su, G. F., & Le, G. W. (2012). Selectivity for and destruction of
Salmonella typhimurium via a membrane damage mechanism of a cellpenetrating peptide ppTG20 analogue. International Journal of Antimicrobial
Agents, 40, 337343.
Lutkenhaus, J. (1990). Regulation of cell division in E. coli. Trends in Genetics, 6,
2225.
Pan, L. Z., Na, J., Xing, Z., Fang, H. J., & Wang, G. L. (2007). Inhibiting effect of melittin
on pathogens of crops. Chinese Science Bulletin, 52, 639644.
Park, C. B., Kim, H. S., & Kim, S. C. (1998). Mechanism of action of the antimicrobial
peptide buforin II: Buforin II kills microorganisms by penetrating the cell
membrane and inhibiting cellular functions. Biochemical and Biophysical
Research Communications, 244, 253257.
Park, C. B., Yi, K. S., Matsuzaki, K., Kim, M. S., & Kim, S. C. (2000). Structureactivity
analysis of buforin II, a histone H2A-derived antimicrobial peptide: The proline
hinge is responsible for the cell-penetrating ability of buforin II. Proceedings of
the National Academy of Sciences, 97, 82458250.
Richard, J. P., Melikov, K., Vives, E., Ramos, C., Verbeure, B., Gait, M. J., et al. (2003).
Cell-penetrating peptides a reevaluation of the mechanism of cellular uptake.
Journal of Biological Chemistry, 278, 585590.
Rittner, K., Benavente, A., Bompard-Sorlet, A., Heitz, F., Divita, G., Brasseur, R., et al.
(2005). New basic membrane-destabilizing peptides for plasmid-based gene
delivery in vitro and in vivo. Molecular Therapy, 5(2), 104114.
Rydlo, T., Miltz, J., & Mor, A. (2006). Eukaryotic antimicrobial peptides: Promises
and premises in food safety. Journal of Food Science, 71, R125R135.
Splith, K., & Neundorf, I. (2011). Antimicrobial peptides with cell-penetrating
peptide properties and vice versa. European Biophysics Journal, 40, 387397.
Steen, H. B., & Boye, E. (1980). Bacterial growth studied by ow cytometry.
Cytometry, 1, 3236.
Subbalakshmi, C., & Sitaram, N. (1998). Mechanism of antimicrobial action of
indolicidin. FEMS Microbiology Letters, 160, 9196.
Tiwari, B. K., Valdramidis, V. P., ODonnell, C. P., Muthukumarappan, K., Bourke, P., &
Cullen, P. (2009). Application of natural antimicrobials for food preservation.
Journal of Agricultural and Food Chemistry, 57, 59876000.
Ulvatne, H., Samuelsen, ., Haukland, H. H., Krmer, M., & Vorland, L. H. (2004).
Lactoferricin B inhibits bacterial macromolecular synthesis in Escherichia coli
and Bacillus subtilis. FEMS Microbiology Letters, 237, 377384.
Yang, S. T., Shin, S. Y., Hahm, K. S., & Kim, J. I. (2006). Design of perfectly symmetric
Trp-rich peptides with potent and broad-spectrum antimicrobial activities.
International Journal of Antimicrobial Agents, 27, 325330.
Yonezawa, A., Kuwahara, J., Fujii, N., & Sugiura, Y. (1992). Binding of tachyplesin I to
DNA revealed by footprinting analysis: Signicant contribution of secondary
structure to DNA binding and implication for biological action. Biochemistry, 31,
29983004.