Vous êtes sur la page 1sur 11

Ticchi, Ana Julia

Biologa Molecular II, 2014

Anlisis de mutantes de insercin de ADXR


Introduccin
El ciclo de vida de las plantas alterna entre una etapa haploide y otra
diploide. Las clulas diploides del cuerpo de la planta (esporofito)
sufren meiosis dando as clulas

que luego sufren varias divisiones

mitticas formando estructuras especializadas haploides (gametofito),


del cual se producen las gametas sexuales. En angiospermas, el
esporofito

es

la

generacin

prominente

(Pagnusat,

2005).

La

generacin de las gametas femeninas o masculinas ocurre por medio


de un proceso que se conoce como gametognesis y que involucra en
una

primera

instancia

meiosis

posteriormente

mitosis

diferenciacin celular.
En Arabidopsis thaliana, el gametofito femenino o saco embrionario
es una estructura altamente polarizada compuesta de siete clulas,
juega

un

rol

fundamental

en

todas

las

etapas

del

proceso

reproductivo. Con el fin de conocer los genes requeridos y las rutas


involucradas en el desarrollo de este gametofito en angiospermas se
han realizado muchos estudios de mutantes gametofitos. El screening
de lneas con inserciones de T-DNA para

determinar genes

funcionalmente importantes para el desarrollo del gametofito ha


llevado a la identificacin de varios mutantes gametofitica en
Arabidopsis. (Pagnusat 2005)
Las mutaciones gametofitica afectan aspectos del desarrollo del
gametofito

que

ocurren

despus

de

la

meiosis,

incluyendo

megagametognesis y el funcionamiento de del gametofito maduro.


Los mutantes gametofticos son tpicamente identificados usando dos
criterios: 1) Reduccin del set de semillas, 2) Distorsin de la
segregacin (Yadegari, 2014).
Una de las

mutantes gametofitica identificadas presenta una

insercin en un gen codificante para una protena tipo Adrenodoxina


reductasa (ADXR), la cual presenta gametofitos femeninos que
arrestan su desarrollo en diferentes estadios.

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

En base a lo anterior el objetivo del presente trabajo se centr en


caracterizar la mutante gametofitica ADXR a partir del anlisis de
plantas ADXR/adxr las mismas presentan un 38.4% de abortos y
dificultades de transmisin a travs del lado materno, sugiriendo un
defecto en la gametognesis o en la funcin del gametofito femenino.
Materiales y Mtodos
Material Vegetal: A partir de semillas sembradas en placas con
medio ATS de Arabidopsis thaliana wild type ecotipo Columbia (Col-0)
o mutantes de insercin T-DNA se seleccionaron cinco plantas
aleatoriamente.
Preparacin de ADN genmico y Genotipificacin: Se realiz una
extraccin de ADN genmico a partir de hojas de Arabidopsis thaliana
wt y mutantes de insercin de T-DNA utilizando el protocolo de
extraccin de DNA genmico (Gua TP, 2014). Se realiz un dosaje
(Abs260/280) y se determin el genotipo de las cinco plantas (P1-P5)
mediante reacciones de PCR a partir del protocolo (Gua TP, 2014),
debido a que se utiliz la polimerasa que se utilizo fue la Taq Pegasus
y no la indicada en el protocolo se realizaron cambios en las
concentraciones de los reactivos para as ajustarlo a esta polimerasa.
Se utiliz, para las PCR, extracto de DNAg como templado o Tejido
tratado (Tissue-PCR) con las siguientes combinaciones de primers:
Primers especficos del gen AT4g05450, ADXR (Fw + Rv)
Primer especfico de ADXR (Rv) + primer especifico de inserto (LBB1)
Primer adxrLB,

5 GCTTGCATATGGTGCTGAAA

Primer adxrRV,

5 CCCGTCTTCCGATGAGATAC

Primer LBb1.3,

5 TTTTGCCGATTTCGGAAC

Se realiz en paralelo una Tissue-PCR segn indicado en la gua de


trabajos Prcticos.
Extraccin de RNA,

se extrajo RNA total a partir de pistilos de

plantas mutantes y wild type siguiendo el mtodo de extraccin


fenlica con Trizol (Gua TP, 2014).

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

Cuantificacin del RNA, se ley la absorbancia de las extracciones


a 260nm y 280nm y se realiz una electroforesis en gel de agarosa.
RT-PCR, se realiz la sntesis de primer hebra, cDNA, a partir del RNA
extrado utilizando dos transcriptasas reversas

distintas (M-MLV

IP2) y un mix que contiene buffer, oligodT, mezcla de dNTPs y DTT


(Gua TP, 2014). Se utilizaron 3ul de la muestra de cDNA para las
reacciones de PCR cuantitativa ajustada para los ciclos 26, 30 y 34.
Se utilizndose los mismos primers especficos del gen ADXR que en
el genotipado as como primers especficos de Actina2 como control
de expresin.

Resultados y Discusin
Analisis del DNA genmico.
Con el fin de determinar el genotipado de las 5 plantas de
Arabidopsis thaliana se realiz una extraccin de DNA genmico a
partir de 2-3 hojas a cada una de las plantas. Se midi luego la
absorbancia

del

precipitado

para

determinar

la

concentracin

cualitativa de la muestra de DNA extrada de cada planta y se realiz


tambin una corrida electrofortica en un gel de agarosa con el fin de
corroborar la integridad del DNA (Fig. S1).
En la tabla 1 se puede observar las plantas 1, 2 y 3 tuvieron una
concentracin de ADN y Absorbancias similares sin embargo a
relacin 260/280 para la planta 1 y 3 es muy alta, esto indicara que
podra presentar contaminacin con RNA o fenol, por otro lado la
Planta 2 presenta una buena relacin de absorbancias por lo que
podra decirse que casi su totalidad corresponde a DNAg. Con
respecto a la planta 4 se mantiene la relacin entre absorbancia y
concentracin presente en las plantas antes mencionados pero con
valores de aproximadamente la mitad de estas, sin embargo, estos
valores caen dentro del rango de error del espectrofotmetro por lo
cual no podran tomarse como valores estimativos. Por ltimo la

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

planta 5 presenta una alta absorbancia pero concentracin muy baja


de DNA, esto significa que en esta muestra hay una gran cantidad de
contaminante, probablemente debido a un error con la ltima dilucin
en donde se resuspendi con un volumen mayor del indicado.
Planta
1
2
3
4
5

[DNAg]

260/28

Tabla 1. Cuantificacin de DNA.


(g/l)
0
Se midi la Abs260 y 280 de 5ul del
0,621
1,89
extracto de DNAg de cada planta.
0,645
1,703
Concentracin Abs260 =1 para
50
0,684
1,925
g/ml.

0,365
0,041

1,75
1,835

OD
0,161
0,155
0,156
0,094
0,827

Genotipificacion

de

A.

thaliana

Luego se procedi a verificar la presencia del inserto de T-DNA


utilizando dos mtodos diferentes anlisis, PCR y Tissue-PCR. Las
muestras, DNAg o tejido tratado, se amplificaron utilizando primers
especficos del gen de ADXR y del inserto T-DNA, los productos de
PCR se corrieron luego por electroforesis en gel de agarosa para as
poder determinar el genotipo de cada pl anta.
El gel correspondiente a la corrida electrofortica de las reacciones de
PCR y Tissue-PCR se observa en la figura 1. El tamao esperado para el
gen de inters sin inserto amplificado con los primers de ADXR, LB y RB, es
de aproximadamente 672 bp lo cual demostrara un genotipo Wild Type, en
cambio para la combinacin primer de ADXR + primer de T-DNA (Rv+LBB1)
se esperara un tamao de aproximadamente 950 bp lo cual indicara un
genotipo mutante. A partir de estos datos se pudieron determinar los
genotipos de las distintas plantas:

Planta 1 en las calles G1 y T1 se observa una banda de


aproximadamente 700pb la cual correspondera al gen sin insercin y
en la calle G2 otra de 900pb correspondiente a la insercin. Por lo
tanto se podra decir que la Planta 1 es una mutante heterocigota.
Planta 2 Se observa solo resultados en las reacciones de TissuePCR los cuales son los mismos que los de la planta 1 por lo que podra
decirse que esta tambin presenta un genotipo mutante.
Planta 3 Debido a que no se encontraron bandas especficas en
ninguna calle no se pudo determinar el genotipo de esta planta.
Planta 4 A partir de las calles correspondientes a las reacciones de
PCR se puede determinar que esta planta presenta un genotipo wild
10

Ticchi, Ana Julia

type homocigota

Biologa Molecular II, 2014

debido a la presencia de una sola banda de

aproximadamente 700pb en la calle G1.


Planta 5 Se determina que esta planta presenta un genotipo
mutante debido a las bandas que se observan en las calles G1 y G2
(difusa) de aproximadamente 700pb y 900pb respectivamente.

Figura 1. Genotipificacin por PCR con


DNA de hojas o tejido tratado. Los productos
se corrieron por electroforesis en gel de
agarosa. P: Planta de A. thaliana, G1/T1:
primers de ADXR (LB + RB) G2/T2: primers de
ADXR Rv + primer de T-DNA LBB1. G PCR;

La ausencia de bandas en las

T Tissue-PCR. Pm: marcador de peso

molecular. C: Control
respectivas
callessin DNA
puede deberse a

varios factores: los primers no hibridaron correctamente en las


reacciones de PCR, presencia de muestra excedente, ya sea de hoja
tratada o extracto de ADN, mal sembrado en el gel, etc.

Expresin de ADXR
Extraccin y anlisis de RNA
Luego, con el fin de determinar el nivel de expresin de las
distintas plantas, se procedi a realizar una RT-PCR a partir de RNA.
Se realiz entonces una extraccin de RNA total con Trizol a partir de
pistilos de cada una de las plantas segn el protocolo indicado (Gua
de TP, 2014). Se continu con una cuantificacin de RNA de cada
extraccin a una ABS. 260/280 con el fin de determinar la cantidad
necesaria para la sntesis de primer hebra y a su vez se realiz una
corrida electrofortica para evaluar la integridad de la muestra,
verificar que el RNA extrado no se encuentre degrado,
corroborar su dosaje.

y para

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

[RNA]

260/2

Grupo
1
2
3
4

(g/l)
0,36
0,62
1,061
0,17

80
1,65
1,56
1,49
1,9

OD
0,094
0,173
0,28
0,25

1,004

1,86

0,284

Tabla 2. Cuantificacin de RNA. Se


midi la Abs260 y 280 de 6ul de la solucin
de extraccin de RNA de cada planta.
Concentracin Abs260 =1 para 40ug/ml.

Figura 2. Anlisis de RNA. Se corrieron


por electroforesis 2ug del extracto RNA
de cada planta en gel de agarosa. P:
Planta de A. thaliana

En la tabla 2 se muestran los valores obtenidos de la


cuantificacin de RNA, en base a estos se puede determinar que las
extracciones de las plantas 4 y 5 presenta una buena pureza debido
a que la relacin 260/280 es cercana a 2, sin embargo la
concentracin presente en la muestra de la planta 4 es muy baja. En
el caso de las plantas 1 2 y 3 la relacin Abs. 260/280 obtenida fue
baja lo cual indicara que podra haber contaminacin con protenas o
DNA, las plantas 1 y 2 presentan a su vez una baja concentracin de
RNA lo cual concuerda con la relacin Abs260/280, pero en la planta 3
se ve una buena concentracin de muestra de RNA.
En la corrida electrofortica de la extraccin de RNA total de las
distintas plantas (figura 2), se pueden observar dos bandas marcadas
correspondientes a RNAr 28 y 18S, en las plantas 1, 2 y 5, lo cual me
indicara que no hay degradacin del RNA. En las plantas 3 y 4 las
bandas son muy difusas, esto podra deberse a degradacin de RNA o
contaminacin alta con DNAg. A su vez se cabe destacar las bandas
presentes en la parte de arriba de las calles lo cual podra
corresponder tambin a contaminacin por DNAg.
Anlisis de expresin por RT-PCR
Se continu a partir de las muestras de RNA con una dilucin de
1:2 y luego con la sntesis de primer hebra segn lo indicado en el

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

protocolo (Gua TP, 2014), obtenindose el cDNA el cual se utiliz


luego en reacciones de PCR semicuantitativa. Para esta reaccin se
utilizaron los primers especficos del gen ADXR as como tambin
primers de ACTINA2 para control de expresin, en reacciones
separadas. Se analizaron las reacciones procedentes a los ciclos 20,
30 y 34 en un gel de agarosa para poder estar dentro la fase
exponencial de la amplificacin para el anlisis de expresin. La
banda

esperadas

para

los

amplicones

de

ACTINA2

es

de

aproximadamente 690pb y para los amplicones de ADXR alrededor de


300pb.
En la figura 3 se observan las reacciones de RT-PCR para las 5
plantas

distintas.

En

la

planta

se

observan

bandas

de

aproximadamente 800-900 bp ya sea en la calle de actina o de ADXR


correspondientes a los ciclos 30 y 34 y se ve que estas aumenta en
por cada ciclo. Dado que el peso esperado para la actina es de 690pb
y para el gen de 300pb, se determina que estos productos son
inespecficos y no brindan la informacin deseada. En las plantas 2, 3
y 4 no se ven bandas claras que puedan determinar alguna expresin.
Por ltimo con respecto a la planta 5 solo se observan bandas en los
ciclos 30 y 34 de el gen ADXR, de nuevo la banda es de
aproximadamente 800-900pb lo cual no corresponde al gen en
estudio.
Por ende se podra decir que el anlisis de expresin realizado por
RT-PCR present resultados inespecficos.

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

Figura 3. Anlisis de expresin por RT-PCR del gen ADXR.


Se corrieron los productos de RT-PCR de los ciclos 26, 30 y 34 de
ADXR (X) y de Actina (A). Pm: peso molecular, C: control sin cDNA;
A: Control de expresin Actina2; X: expresin de ADXR, P, Planta
de A. thaliana; N de Ciclos 26, 30,34

Debido a estos resultados inconclusos se


repiti la RT-PCR siguiendo el mismo protocolo
anterior con una modificacin, el templado se diluy 1:5 para
disminuir la posible contaminacin con DNA genmico (figura S2).
Para las plantas 1, 2 3 y 4 no se observ banda y en el gel
correspondiente a la planta 5 se obtuvo un resultado similar al
anterior. Una de las hiptesis por lo cual se cree que fallaron las
primeras dos RT-PCR es que la enzima transcriptasa reversa (MLMV)
no estaba funcionando ptimamente, por lo tanto se realizaron dos
nuevas reacciones de RT-PCR, en la cada sntesis de primer hebra se
utilizaron dos transcriptasas reversas distintas (MLMV e IP2). Luego se
tomaron 2l de los productos cDNA y se procedi con las reacciones
de PCR semicuantitativa.

Figura
4.
Anlisis
de
expresin por RT-PCR de
ADXR.
Se
corrieron
los
productos de RT-PCR del ciclo
35 de ADXR (X) y de Actina
(A). Pm: peso molecular, A:
Control de expresin Actina2;
X: expresin de ADXR, P1-5,
Planta de A. thaliana; MLV,
IP2, transcriptasas reversa.

En la figura 4, correspondiente al gel de la tercera RT-PCR, se ve


que en las reacciones con las distintas enzimas hay presencia de

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

bandas en ambos casos, lo cual indicara que la transcriptasa reversa


no fall. En las calles correspondiente a la amplificacin con los
primers de ADXR se pueden observar bandas de aproximadamente
300pb las cuales corresponderan a los amplicones del gen especifico,
demostrando as que las mutantes heterocigotas presentan expresin
de ADXR. Con respecto a los controles con actina solo se observa la
banda correspondiente a aproximadamente 690pb en la ltima calle
de la planta 5 correspondiente a la enzima IP2, que los amplicones de
actina no estn presente en las calles correspondientes podra
deberse a que los primers correspondientes a ACTINA2 no hibridaron
correctamente con el gen de actina.
Conclusin
El anlisis de genotipificacin de las plantas ADXR/adxr determin
que las plantas 1, 2 y 5 eran mutantes, la 4 wild type pero la planta 3
no se pudo determinar su genotipo. Si bien no se obtuvieron
resultados en todas las reacciones de PCR o Tissue, estos fueron
suficientes para determinar el genotipo de cada planta pero no para
comparar la efectividad de los distintos procedimientos.
Los primeros dos anlisis de expresin realizados mediante RT-PCR
presentaron resultados dudosos los cuales podran deberse a diversos
factores:

RNA degradado u oxidado


Que el RNA no haya sido limpiado totalmente de Trizol por ende

quedan fenoles que interfieren en la reaccin


Contaminacin con DNA genmico.
No se haya mantenido el templado de RNA en fro, formndose
as estructuras secundarias.
A partir de la tercer RT-PCR se pueden ver los amplicones

correspondientes al gen (300pb), lo cual indicara que no hubo falla


en la enzima transcriptasa reversa, sin embargo

no se observ

expresin del gen Housekeeping, actina, lo cual podra indicar algn


tipo de falla con los primers de actina. A partir de estas PCRs se
puede determinar que el gen es expresado en plantas mutantes
ADXR/adxr, pero como las dos ltimas reacciones de PCR se hicieron
10

Ticchi, Ana Julia

Biologa Molecular II, 2014

a partir de dos plantas mutantes no se pudo hacer una valoracin


comparativa entre mutante y Wild Type. A su vez como no se obtuvo
expresin de Actina tampoco se pudo realizar un anlisis sobre la
expresin relativa de ADXR con respecto a la actina.
Teniendo en cuenta la cantidad de resultados inespecficos se
recomienda, entonces, repetir los procedimientos evitando errores en
los pasos claves de la RT-PCR, as como utilizar DNasa para eliminar
la contaminacin con DNA genmico en las muestras de RNA
extrado.
Bibliografa
1) Drews

G.

N.,

Koltunow

A.

M.

G.

(2011).

The

Female

Gametophyte. The Arabidopsis book.


2) Gua de Trabajos Prcticos, Biologa Molecular II, 2014.
3) Pagnussat G. C., Yu H., Ngo Q. A., Rajani S., Mayalagu S.,
Johnson C. S., Capron A., Xie L., Ye D., Sundaresan V. (2005).
Genetic and molecular identification of genes required for
female gametophyte development and function in Arabidopsis.
Development 132: 603-614.
4) Takubo K., Morikawa T., Nonaka Y., Mizutani M., Takenaka S.,
Takabe K., Takahashi M., Ohta D. (2003). Identification and
molecular characterization of mitocondrial ferredoxins and
ferredoxin reductase from Arabidopsis.Plant Molecular Biology
52: 817:830.
5) Yadegari R.,

Drews

G.

N.

(2004).

Female

Gametophyte

Development. The Plant Cell, Vol. 16, S133-S141.

Figuras Suplementarias

Fig. S1. Anlisis de DNA. Corrida electrofortica de 2l de


extracto de DNAg en gel de agarosa, 20 para P5. P1-5: Planta
de A. thaliana

10

Ticchi, Ana Julia

Biologa Molecular II, 2014

RT-PCR

Fig. S2. Anlisis de expresin por RT-PCR, Se corrieron los


productos de RT-PCR de los ciclos 26, 30 y 34 de ADXR (X) y de
Actina (A). Pm: peso molecular, C: control sin cDNA; A: Control de
expresin Actina2; X: expresin de ADXR P1-5: Planta de A.
thaliana; N de Ciclos 26, 30,34

10