Veterinary Parasitology 133 (2005) 283287

www.elsevier.com/locate/vetpar

Genotyping of Giardia intestinalis from domestic and

wild animals in Japan using glutamete
dehydrogenase gene sequencing
Tadashi Itagaki a,b,*, Shizuka Kinoshita a, Mikiko Aoki a, Naoyuki Itoh c,
Hideharu Saeki d, Naoto Sato e, Junya Uetsuki f, Shinji Izumiyama g,
Kenji Yagita g, Takuro Endo g
a

Laboratory of Veterinary Parasitology, Faculty of Agriculture, Iwate University, 3-18-8 Ueda, Morioka 020-0105, Japan
b
The United Graduate School of Veterinary Sciences, Gifu University, 1-1 Yanagido, Gifu 501-1193, Japan
c
Kamome Veterinary Clinic, 7-9-2932 Sozen Nishi, Hashikami, Sannobe, Aomori 039-1212, Japan
d
Department of Medical Zoology, College of Environmental Health, Azabu University, 1-17-71 Fuchinobe, Sagamihara 229-8501, Japan
e
Research Institute for Environmental Sciences and Public Health of Iwate Prefecture, Morioka 020-0852, Japan
f
Shimokita Wildlife Research Institute, 42-39 Kamimachi, Ohminato Mutsu, Aomori 035-0086, Japan
g
Department of Parasitology, National Institute of Infectious Diseases, 1-23-1 Toyama, Shinjuku, Tokyo 162-8640, Japan
Received 25 February 2005; received in revised form 19 May 2005; accepted 28 May 2005

Abstract
To determine the genotypes of Giardia intestinalis from domestic and wild animals in Japan, Giardia isolates obtained from
feces of 24 dogs kept in households and breeding kennels, three companion cats, five dairy calves and three wild monkeys,
Macaca fuscata, were genotyped using the 177 bp sequence of the glutamete dehydrogenase gene (gdh). The genotypes were
assemblages A, C, D or A/D for dog isolates, Assemblage F for cat isolates, assemblages A or E for calf isolates and assemblage
B for monkey isolates. This is the first report on the genotypes of Giardia isolates from cats, calves and wild monkeys in Japan.
# 2005 Elsevier B.V. All rights reserved.
Keywords: Giardia intestinalis; Dog; Cat; Cattle; Wild monkey; Genotype

1. Introduction
Giardia intestinalis (syn. G. duodenalis, G. lamblia)
is the most common intestinal parasite of humans as well
* Corresponding author. Tel.: +81 19 621 6219;
fax: +81 19 621 6219.
E-mail address: itagaki@iwate-u.ac.jp (T. Itagaki).

asofdomesticandwildanimals.AlthoughG.intestinalis
isolates from different host species are morphologically
indistinguishable from each other, they have been
grouped into genotypes on the basis of molecular
characteristics. Giardia isolates from humans have
exclusively shown one of two major genotypes referred
as to assemblages A and B (Mayrhofer et al., 1995;
Monis et al., 1996), which coincide with the formerly

0304-4017/$ see front matter # 2005 Elsevier B.V. All rights reserved.
doi:10.1016/j.vetpar.2005.05.061

284

T. Itagaki et al. / Veterinary Parasitology 133 (2005) 283287

used terms Polish and Belgian in Europe (Homan et al.,

1992) and groups 13 in North America (Nash, 1995),
respectively. Assemblages A and B have also been found
in isolates from domestic and wild animals, such as dogs,
cats, cattle, pigs, slow loris, siamang, beavers, whitetailed deer and so on, suggesting that these assemblages
have zoonotic potential. On the other hand, Giardia
isolates from animals revealed some genotypes that
differed from assemblages A and B. Assemblages C and
D in dogs isolates, assemblage E in cattle isolates and
assemblages F and G in cat and rat isolates, respectively
(Monis et al., 1996, 1999). These animal-derived
genotypes seem to be each host-specific and nonzoonotic (Thompson, 2000).
In Japan, Giardia infection has been found in 14.6
22.9% of dogs kept in households and breeding kennels
(Itoh et al., 2001, 2004) and 31.2% of companion cats
(our unpublished data). Further, Giardia infection has
also been found in 26.7% of wild monkeys, Macaca
fuscata, in Shimokita Peninsula, and in 13.8% in wild
serows, Capricornis crispus, in the north part of Japan
(our unpublished data). There is only one report on the
genotype of Giardia isolated from four dogs (Abe et al.,
2003), though genotyping is of importance in view of
public health for the above-mentioned reasons. In the
present study, we clarified the genotypes of G.
intestinalis isolated from domestic dogs and cats, dairy
calves and wild monkeys in Japan using glutamete
dehydrogenase (gdh) gene sequencing.

2. Materials and methods

2.1. Source of isolates
G. intestinalis isolates were obtained from feces of
seven dogs (D1D7) kept in households in Aomori
Prefecture and 17 dogs (D8D24) at six breeding
kennels (af) in Aomori, Akita, Nagano, Niigata and
Tokyo, three cats (Ct1Ct3) in households in Aomori,
five calves (Cf1Cf5) from two farms (g and h)
in Iwate and three wild monkeys, Macaca fuscata
(M1M3), in Shimokita Peninsula.
2.2. Extraction of genomic DNA
Giardia cysts were collected from the feces using
centrifugal sedimentation in sucrose solution of

specific gravity 1.21 and/or a Dynabeads anti-Giardia

kit (Dynal A.S, Oslo, Norway) and were kept at 4 or
80 8C until use. Genomic DNA was extracted as
described by Kuhn et al. (2002). Briefly, Giardia cysts
were suspended in a mixture of 75 ml TE buffer
(10 mM TrisHCl, 1 mM EDTA, pH 8.0) and 25 ml of
10% SDS and incubated at 37 8C for 24 h. The
suspension was treated with phenol/chloroform, and
DNA was precipitated with chilled ethanol. The dried
DNA was suspended in 10 ml MQ and used as a
template for a nested PCR.
2.3. DNA amplification by nested PCR and
sequencing
A DNA fragment (about 220 bp) of the gdh gene
was amplified using nested PCR with primer sets of
GDH1 and GDH4 (Homan et al., 1998) in the first
round of PCR and GDHF3 and GDHB5 (Abe et al.,
2003) in the second round of PCR. An additional
primer set of gdh 1f 2nd (forward), AGGATGCTTGAGCCGGAGCG and gdh 4r 2nd (reverse), GGATACTTNTCCYTGAACTC, was also used in the first
PCR. Amplification was performed in a total reaction
volume of 25 ml containing template DNA and the
following PCR mix: 5  GoTaqTM Reaction buffer,
0.2 mM dNTPs, 1.25 units of GoTaqTM DNA
polymerase (Promega, Madison, USA) and 25 pmol
of each primer. Three microlitre of the solution after
the first PCR was used as a template for the second
PCR. The conditions of the first and second rounds of
PCR were 94 8C for 3 min initially, then 40 cycles of
94 8C for 30 s, 50 or 55 8C for 30 s and 72 8C for
1 min, and finally 72 8C for 7 min. The reactions were
performed on a GeneAmp PCR System 2700 (PE
Applied Biosystems, Norwalk, USA). The products of
the second PCR were visualized by electrophoresis
in 1.2% agarose gel with ethidium bromide and
sequenced using an ABI Prism Big Dye Terminator
Cycle Sequencing Kit ver. 3.1 (PE Applied Biosystems) and the same primer set as that used in the
second PCR. Sequencing reactions were analyzed on a
3100-Avant Genetic Analyzer (PE Applied Biosystems). Each DNA sample was sequenced at least two
times using both forward and reverse primers. The
DNAsis program (ver. 3.2, Hitachi Software, Tokyo)
was used to edit sequences. Miscalled bases were
corrected by analyzing chromatogram peaks and

T. Itagaki et al. / Veterinary Parasitology 133 (2005) 283287

comparing those to the sequences deposited in

Genbank. The sequences of the isolates used in this
study were aligned with known sequences by the
Clustal-X program (Thompson et al., 1997). The
known sequences of Giardia isolates chosen to
represent each of the major assemblages were
obtained from Genbank. The accession numbers were
as follows: L40509 for assemblage A (Monis et al.,
1996), L40508 for assemblage B (Monis et al., 1996),
U60985 for assemblage C (Monis et al., 1998),
U60986 for assemblage D (Monis et al., 1998),
AY178740 for assemblage E and AY17874 for
assemblage F.

3. Results
Fourteen, 1 and 6 isolates from dogs were grouped
into assemblages A, C and D, respectively (Table 1),
since the sequence of each group of isolates showed
similarity of 100, 100 and 99.4% to the corresponding
sequence of L40509 (A), U60985 (C) and U60986
(D), respectively. The remaining three dog isolates
(D18, D21 and D23) had both sequences of
assemblages A and D; chromatogram peaks corresponding to both assemblages were found at the
nucleotide positions characterizing the genotype. The
isolates from dogs kept in households had assemblages A, C or D, and those from breeding kennels had
assemblages A and/or D. Three isolates from cats and
three from monkeys had the same sequences as
AY178744 (F) and L40508 (B), respectively. Four of
the calf isolates showed 99.4% similarity to
AY178740 (E) and the other was 100% identical to
L40509 (A). The sequences obtained in this study
were deposited in DNA Data Bank of Japan (DDBJ) in
accession numbers of AB199735AB199742.

4. Discussion
The use of partial nucleotide sequences (690
864 bp) of gdh gene has enabled successful genotyping of G. intestinalis isolated from various mammalian
hosts (Ey et al., 1997; Homan et al., 1998; Monis et al.,
1996, 1998). Recently, a sequence of 218 bp that is
present in the gdh sequences used in these previous
studies has also been found to be useful for genotyping

285

Table 1
Genotypes of Giardia isolates determined by sequence analysis of
gdh gene
Isolate code

Host

Origin

Genotype

D1
D2
D3
D4
D5
D6
D7
D8
D9
D10
D11
D12
D13
D14
D15
D16
D17
D18
D19
D20
D21
D22
D23
D24
Ct1
Ct2
Ct3
Cf1
Cf2
Cf3
Cf4
Cf5
M1
M2
M3

Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Dog
Cat
Cat
Cat
Calf
Calf
Calf
Calf
Calf
Monkey
Monkey
Monkey

Household
Household
Household
Household
Household
Household
Household
Kennel a
Kennel a
Kennel b
Kennel b
Kennel b
Kennel b
Kennel b
Kennel b
Kennel c
Kennel d
Kennel d
Kennel d
Kennel d
Kennel e
Kennel e
Kennel f
Kennel f
Household
Household
Household
Farm g
Farm g
Farm g
Farm h
Farm h
Wildlife
Wildlife
Wildlife

D
C
A
D
A
D
D
A
A
A
A
A
A
A
A
D
A
A/D
A
A
A/D
A
A/D
D
F
F
F
E
A
E
E
E
B
B
B

of Giardia isolates, although subtypical discrimination between assemblages AI and AII, BIII and BIV is
impossible (Abe et al., 2003). Therefore, we used a
177 bp sequence excluding the primer region (41 bp)
from the 218 bp sequence for genotyping Giardia
isolates and developed a nested PCR for amplification,
since a nested PCR is more sensitive. However, no
fragments could be amplified for calf isolates, though
the annealing temperature was decreased from 55 to
50 8C in both rounds of PCR. Therefore, we used a
primer set of gdh 1f 2nd and gdh 4r 2nd in the first
round of PCR and were be able to amplify the
fragments of calf isolates. These findings indicate that

286

T. Itagaki et al. / Veterinary Parasitology 133 (2005) 283287

Giardia isolates from calves may have much

variability within the sequences of GDH1 and
GDH4 primers.
Giardia isolates from dogs characterized to date
have been grouped into assemblages AD (Monis
et al., 1998, 1999; Read et al., 2004). In Japan, there
has been one study in which only four dog isolates
were confirmed to be the genotype of assemblage D
(Abe et al., 2003). The present results revealed that
assemblage A, which appears to have zoonotic
potential, also occurred in dogs in Japan in addition
to assemblages C and D, which seem to be specific for
dogs. Thus, the significance for public health of dog
isolates should be taken into account, although the
potential for zoonotic transmission of Giardia from
dogs to humans remains largely an unresolved issue
(Ashford and Snowden, 2001). In the present study,
three isolates from three breeding kennels revealed
both genotypes of assemblages A and D, suggesting
that the kennels had been contaminated with G.
intestinalis of both assemblages. Mixed infection with
some genotypes has been reported to date (Upcroft and
Upcroft, 1994; Traub et al., 2004; Berrilli et al., 2004).
Cat isolates have been shown to be assemblages A,
B or cat-specific F (Thompson et al., 2000; van Keulen
et al., 2002; Monis et al., 1999). Although three
isolates from cats were found to be assemblage F in the
present study, more isolates must be analyzed for
characterizing the genotype of Giardia from cats in
Japan.
Assemblage E, which seems to be infectious to
hoofed livestock, is the predominant genotype in
cattle, but assemblage A has also been detected
(OHandley et al., 2000; Appelbee et al., 2003; Becher
et al., 2004; Trout et al., 2004). Our results suggested
that assemblages A and E are widely distributed in
Japan, though the number of isolates examined in the
present study was small. Analysis using more isolates
from calves will be needed for confirming this
speculation.
Monis et al. (1996) reported that isolates from the
slow loris and siamang showed genotypes of
assemblages AI and B, and Karanis and Ey (1998)
reported that an isolate from a monkey was
characterized as assemblage B. The monkeys used
in those studies had been housed at a zoo and were not
wild animals. Therefore, the present study is the first
report of Giardia isolates from wild monkeys, Macaca

fuscata, being characterized in genotype as assemblage B. Wild animals, such as Japanese maquaqua,
have been habituated to humans in Japan due to
conservation and protection management. Furthermore, the relatively close contact between wild
animals and humans is believed to enhance the
zoonotic transmission of parasites. Thus, control of
potential transmission of zoonotic pathogens, such as
G. intestinalis is a serious challenge.

Acknowledgements
This study was supported in part by a Grant-in-Aid
for Scientific Research (The 21st Century Center-ofExcellence Program) from the Ministry of Education,
Culture, Sports, Science and Technology of Japan
(E-1) and by a grant from the Ministry of Health,
Labour and Welfare, Japan (H15-Shinkou-16).

References
Abe, N., Kimata, I., Iseki, M., 2003. Identification of genotypes of
Giardia intestinalis isolates from dogs in Japan by direct
sequencing of the PCR amplified glutamate dehydrogenase
gene. J. Vet. Med. Sci. 65, 2933.
Appelbee, A.J., Frederick, L.M., Heitman, T.L., Olson, M.E., 2003.
Prevalence and genotyping of Giardia duodenalis from beef
calves in Alberta. Can. Vet. Parasitol. 112, 289294.
Ashford, R.W., Snowden, K.S., 2001. Dogs and protozoan zoonosis.
In: Macpherson, C.N.L., Meslin, F.X., Wandeler, A.I. (Eds.),
Dogs, Zoonosis and Public Health. CABI Publishing, New York,
pp. 127128.
Becher, K.A., Robertson, I.D., Fraser, D.M., Palmer, D.G.,
Thompson, R.C.A., 2004. Molecular epidemiology of Giadria
and Cryptosporidium infections in dairy calves originating
from three sources in Western Australia. Vet. Parasitol. 123,
19.
Berrilli, F., Cave, D.D., Liberato, C.D., Franco, A., Scaramozzino,
P., Orecchia, P., 2004. Genotype characterisation of Giardia
duodenalis isolates from domestic and farm animals by SSUrRNA gene sequencing. Vet. Parasitol. 122, 193199.
Ey, P.L., Mansouri, M., Kulda, J., Nohynkova, E., Monis, P.T.,
Andrews, R.H., Mayrhofer, G., 1997. Genetic analysis of Giardia from hoofed farm animals reveals artiodactyl-specific and
potentially zoonotic genotypes. J. Euk. Microbiol. 44, 626
635.
Homan, W.L., van Euckevort, F.H., Limper, L., van Eys, G.J.,
Schoone, G.J., Kansprzak, W., Majewska, A.C., van Knapen,
F., 1992. Comparison of Giardia isolates from different laboratories by isoenzyme analysis and recombinant DNA probes.
Parasitol. Res. 78, 316323.

T. Itagaki et al. / Veterinary Parasitology 133 (2005) 283287

Homan, W.L., Gilsing, M., Bentala, H., Limper, L., van Knapen,
F., 1998. Characterization of Giardia duodenalis by polymerase-chain-reaction fingerprinting. Parasitol. Res. 84, 707
714.
Itoh, N., Muraoka, N., Aoki, M., Itagaki, T., 2001. Prevalence of
Giardia lamblia infection in household dogs. J. Jpn. Assoc. Inf.
Dis. 75, 671677.
Itoh, N., Muraoka, N., Aoki, M., Itagaki, T., 2004. Detection of
Giardia antigen in puppies using enzyme-linked immunosorbent
assay. J. Jpn. Vet. Med. Assoc. 57, 579582 (in Japanese with
English summary).
Karanis, P., Ey, P.L., 1998. Characterization of axenic isolates of
Giardia intestinalis established from humans and animals in
Germany. Parasitol. Res. 84, 442449.
Kuhn, R.C., Rock, C.M., Oshima, K.H., 2002. Occurrence of
Cryptosporidium and Giardia in wild ducks along the Rio
Grande River Valley in southern New Mexico. Appl. Environ.
Microbiol. 68, 161165.
Mayrhofer, G., Andrews, R.H., Ey, P.L., Chilton, M.B., 1995.
Division of Giardia isolates from humans into two genetically
distinct assemblages by electrophoretic analysis of enzymes
encoded at 27 loci and comparison with Giardia muris. Parasitology 111, 1117.
Monis, P.T., Mayrhofer, G., Andrews, R.H., Homan, W.L., Limper,
L., 1996. Molecular genetic analysis of Giardia intestinalis
isolates at the glutamate dehydrogenase locus. Parasitology
112, 112.
Monis, P.T., Andrews, R.H., Mayrhofer, G., Mackrill, J., Kulda, J.,
Isaac-Renton, J.L., Ey, P.L., 1998. Novel lineages of Giardia
intestinalis identified by genetic analysis of organisms isolated
from dogs in Australia. Parasitology 116, 719.
Monis, P.T., Andrews, R.H., Mayrhofer, G., Ey, P.L., 1999. Molecular systematics of the parasitic protozoan Giardia intestinalis.
Mol. Biol. Evol. 16, 11351144.

287

Nash, T.E., 1995. Antigenic variation in Giardia lamblia. In: Boothroyd, J.C., Komoniecki, R. (Eds.), Molecular Approaches to
Parasitology. Wiley-Liss, pp. 3142.
OHandley, R.M., Olson, M.E., Fraser, D., Adams, P., Thompson,
R.C.A., 2000. Prevalence and genotypic characterisation of
Giardia in dairy calves from Western Australia and Western
Canada. Vet. Parasitol. 90, 193200.
Read, C.M., Monis, P.T., Thompson, R.C.A., 2004. Discrimination
of all genotypes of Giardia duodenalis at the glutamate dehydrogenase locus using PCR-RFLP. Inf. Genet. Evol. 4, 125130.
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The Clustal X windows interface: flexible
strategies for multiple sequence alignment aided by quality
analysis tools. Nucl. Acids Res. 24, 48764882.
Thompson, R.C.A., 2000. Giardiasis as a re-emerging infectious
disease and its zoonotic potential. Int. J. Parasitol. 30, 12591267.
Thompson, R.C.A., Hopkins, R.M., Homan, W.L., 2000. Nomenclature and genetic groupings of Giardia infecting mammals.
Parasitol. Today 16, 210213.
Traub, R.J., Monis, P.T., Robertson, I., Irwin, P., Mencke, N.,
Thompson, R.C.A., 2004. Epidemiological and molecular evidence supports the zoonotic transmission of Giardia among
humans and dogs living in the same community. Parasitology
128, 253262.
Trout, J.M., Santin, M., Greiner, E., Fayer, R., 2004. Prevalence of
Giardia duodenalis genotypes in pre-weaned dairy calves. Vet.
Parasitol. 124, 179186.
Upcroft, J.A., Upcroft, P., 1994. Two distinct varieties of Giardia in
a mixed infection from a single human patient. J. Euk. Microbiol. 41, 189194.
van Keulen, H., Macechko, P.T., Wade, S., Schaaf, S., Wallis, P.M.,
Erlandsen, S.L., 2002. Presence of human Giardia in domestic,
farm and wild animals, and environmental samples suggests a
zoonotic potential for giardiasis. Vet. Parasitol. 108, 97107.