Vous êtes sur la page 1sur 20

I.E.P.

SAN ALFONSO

BIOLOGA

I. INTRODUCCIN A LA BIOLOGA
1. ETIMOLOGA DE BIOLOGA:
Deriva de las voces griegas:
BIOS
VIDA
LOGOS TRATADO O ESTUDIO
ARISTTELES
2. DEFINICIN DE BIOLOGA:
Biologa es la ciencia que estudia todas las manifestaciones de vida que existen, teniendo
en cuenta su origen, estructura, funciones, sus relaciones con el medio ambiente y los
complicados procesos que en ellas ocurren.
3. ANTECEDENTES HISTRICOS:
El primer bilogo fue Aristteles, es llamado tambin el Padre de la Zoologa.

Teofrasto, estudi en cambio las plantas y se le considera el Padre de la Botnica.


William Harvey, mdico y fisilogo Ingls, descubri el funcionamiento de la
circulacin sangunea.
Hans y Zacaras Janssen, construyeron el primer microscopio compuesto.
Anton Van Leewenhoeck (Naturalista holands). Padre de la Protozoologa.
Observ los llamados animalculos en su microscopio.
Carl Von Linneo (Naturalista sueco). Padre de la Sistemtica.

LOUIS PASTEUR

Ernest Haeckel: (Naturalista alemn). Padre de la Ecologa.

5. DIVISIN DE LA BIOLOGA.
Bacteriologa: Estudio de las bacterias.
Bioqumica: Estudia las molculas y compuestos qumicos que intervienen en los
procesos vitales.
Botnica: Estudio de las plantas.
Citologa: Estudia la estructura y funcin celulares.
Histologa: Estudia los tejidos y asociaciones celulares.
Embriologa: Estudia las etapas del desarrollo embrionario de un ser vivo.
Ecologa: Estudia la relacin de los seres vivos y su medio ambiente.
Micologa: Estudio de los hongos.
Paleontologa: Estudia los fsiles de seres vivos.
Protozoologa: Estudio de los protozoarios.
Taxonoma: Estudia la clasificacin de los seres vivos.
Virologa: Estudio de los virus.
Zoologa: Estudio de los animales.
Gentica: Estudio de la Herencia y la variacin.
Evolucin: Estudio de los cambios que han experimentado los seres vivos a travs
del tiempo.
Biogeografa: Estudio de la distribucin de los seres vivos sobre la tierra.

Watson y Crick: (1953): Propusieron el Modelo Doble


Hlice del ADN.

6. EL MTODO CIENTFICO.

Robert Koch (Mdico alemn). Identific los agentes infecciosos del carbunco, TBC,
y el clera. Introdujo los medios de cultivo.
Louis Pasteur: Padre de la Microbiologa mdica. Neg la Generacin espontnea
y apoy la Hiptesis de la Biognesis.
Gregorio Mendel (Monje y Naturalista Austriaco Agustino). Padre de la Gentica.
Charles Darwin (Padre de la Evolucin). Obras: Origen de las Especie por la
Seleccin Natural y el Origen del Hombre.
Schleiden y Schwann: Propusieron la Teora Celular.
Alexander Von Humboldt: Padre de la Biogeografa.
Alexander Fleming: Descubri la Penicilina.
Alexander Ilich Oparin: (Ruso) Public el Origen de la Vida.
Max Knoll y Ernest Ruska, construyeron el primer microscopio electrnico.

CHARLES

4. IMPORTANCIA DE LA BIOLOGA:
DARWIN
El conocimiento de la Biologa nos permite:
Explicar los procesos que rigen la existencia de los seres vivos.
Conocer los agentes causales de las enfermedades y estudiar los mecanismos que
detengan su desarrollo.
Elaborar antibiticos y otros medicamentos que controlen el curso de las
enfermedades y restablezcan la salud del individuo afectado.
Mejorar las caractersticas genticas de plantas y animales por medio de la
Ingeniera Gentica.
Comprender el funcionamiento de los Ecosistemas para aprovecharlos
racionalmente y protegerlos.

Es un mtodo de investigacin para conocer, describir, explicar los procesos en los


seres vivos, es una manera de recopilar informacin y comprobar ideas. Es la forma en
que un cientfico trata de hallar respuestas a sus interrogantes sobre la naturaleza. El
mtodo cientfico consta de los siguientes pasos generales:

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

A) La Observacin del problema:


Las observaciones de un cientfico, adems de ser exactas, deben tambin constar en
un registro escrito, pelcula, cinta magnetofnica, archivo electromagntico o en otra
forma. Esa informacin constituye la matriz de datos del experimento. La observacin
origina preguntas de tipo Cmo sucedi esto?

3) ................................................ acu por primera vez el trmino clula al hacer

B) Planteamiento de una Hiptesis:


Una hiptesis es una posible respuesta a una pregunta acerca de la naturaleza, basada
en observaciones, lecturas y los conocimientos de un cientfico.

5) La ciencia que estudia a los peces se llama.................................., mientras que

observaciones en un pedazo de corcho.


4)

El

modelo

Doble

Hlice

en

la

estructura

del

ADN

lo

propusieron ......................................y...........................
la...................................... estudia a los gusanos parsitos.
6) Una............................................. es una posible respuesta a una pregunta al
planteamiento

C) Experimentacin:
Un cientfico debe disear un experimento para probar la hiptesis que propone.
Mientras se realiza un experimento debe anotarse las observaciones exactas.

de

un problema,

basadas en

observaciones,

lecturas

los

conocimientos de un cientfico.
7) Los pasos del Mtodo Cientfico son: ....................................... .....................................
8) La ciencia que estudia la herencia biolgica recibe el nombre de................................,

D) Resultados:
Una vez terminado el experimento, los datos obtenidos deben organizarse y analizarse.
Los experimentos producen resultados que niegan o dan validez a la hiptesis.

mientras que la......................................., estudia los restos fsiles de los seres vivos.
9) El naturalista ingls..........................................................., es considerado el Padre de

E) Conclusiones y teoras:
Los resultados analizados permiten al investigador llegar a una conclusin, la cual apoya
la hiptesis o la niega.
Una teora es una explicacin de algo en la naturaleza y que la evidencia o
experimentacin ha apoyado repetidas veces.

la Evolucin.
10) Los hermanos holandeses................................. y.......................... construyeron el
primer microscopio compuesto.
III. Relaciona: ( pt. c/u)

PRCTICA DIRIGIDA N 01
I. Escribe V o F segn corresponda: ( pt. c/u)
1.- Gracias a la Biologa se pueden producir protenas humanas como la insulina.
( )
2.- La Micologa se encarga del estudio de los hongos.
( )
3.- La Taxonoma estudia a los restos fsiles.
( )
4.- La matemtica no es una ciencia auxiliar de la Biologa.
( )
5.- Adems de teoras, la ciencia tiene leyes o principios.
( )
6.- La Hiptesis consiste en la explicacin racional anticipada de la observacin de ( )
un fenmeno.
7.- En la medida que otros experimentos continen apoyando la hiptesis, sta se ( )
convertir en una teora.
8.- Un experimento nico no resulta ser nunca la base adecuada para realizar una ( )
conclusin.
9.- Con la experimentacin se puede probar la veracidad de una hiptesis.
( )
10 La Mastozoologa estudia a los reptiles.
( )
.
II. Completa:( pt. c/u)
1) ........................................... es considerado el padre de la Biologa, mientras

a) Leewenhoeck

Padre de la Ecologa

b) Knoll y Ruska

microscopio compuesto

c) Carcinologa

Padre de la Gentica

d) Hermanos Janssen

Crustceos

e) Micologa

Padre de la Protozoologa

f) Ernest Haeckel

Moluscos

g) Malacologa

Microscopio electrnico

h) Gregorio Mendel

Hongos

IV. Subraya la respuesta correcta: ( pt. c/u)


1) Discpulo de Aristteles que clasific a los vegetales en hierbas, arbustos y rboles:
a) Platn
b) Teofrasto
c) Galeno
d) Tales de Mileto
e) Hooke
2) Identific a los agentes infecciosos del carbunco, TBC y el clera:
a) Pasteur
b) Harvey
c) Koch
d) Mendel

que.............................................. se le considera el Padre de la Botnica.

3) Propusieron la Teora Celular:


a) Watson y Crickb) Schwann y Hooke
c) Schleiden y Schwann
d) Schleiden y Ruska
e) Hermanos Janssen

2) ............................................... propusieron la Teora Celular por los aos 1838 - 1839.

1 SECUNDARIA I PERIODO - 2010

e) Darwin

I.E.P. SAN ALFONSO

4) Descubri la penicilina:
a) Leewenhoeck b) Fleming

c) Harvey

5) Es considerado el Padre de la Sistemtica:


Ruska
b) Schleiden
c) Virchow

BIOLOGA

d) Crick

e) Linneo

d) Cuvier

e) Linneo

A) Celular.- Corresponde a las unidades funcionales como son las clulas. La clula es
la unidad bsica de los seres vivos, es decir, la mnima estructura que tiene vida. Ej:
bacterias, protozoarios, levaduras, etc.
B) Tisular.- Corresponde a los tejidos, un tejido es un conjunto de clulas con el mismo
origen, la misma morfologa y fisiologa. Ej: tejido epitelial, tejido muscular, etc.
C) Organolgico.- Corresponde a los rganos, estos resultan de la asociacin de un
conjunto de tejidos. Ej: corazn, pulmones, riones, etc.
D) Sistmico.- Corresponde a los sistemas, un sistema es un conjunto de rganos
asociados para cumplir funciones especficas. Ej: sistema nervioso, sistema
endocrino, etc.
E) Individual.- Corresponde al individuo que resulta de la integracin de los sistemas. Ej:
un reptil, un ave, un hombre, etc.

6) Seleccin Natural es a Darwin como Sistema Binomial es a:


Von Humboldt
b) Linneo
c) Darwin
d) Virchow
e) Newton
V. Desarrolla en tu cuaderno las siguientes preguntas:
1) Describe en que consisten las especialidades que iniciaron cada uno de los siguientes
cientficos o naturalistas (4 pts: c/u): Aristteles, Cuvier, Darwin, Hooke, Humboldt,
Haeckel, Linneo, Mendel.
2) Cules son los campos de accin de la Biologa? Escribe 6 acciones y dibjalas.
(6 pts: c/u)
3) Explica brevemente la historia del Microscopio. Dibuja sus tres tipos principales.
(4 pts: 1 c/u)
4) Plantea un problema y encuentra su solucin utilizando el Mtodo Cientfico. Dibja.
(4 pts: c/u)
5) Vocabulario: ( pto. c/u) Busca en el diccionario el significado de las siguientes
palabras: etimologa, prejuicio, auxiliar, fsil, naturalista, evolucin, herencia,
conclusin, ciencia y experimento.

2.3. ECOLGICO: Es el segundo nivel de organizacin superior (abitico y bitico).


Presenta los siguientes subniveles:
A) Poblacin.- Es el conjunto de individuos de una misma especie que ocupa un lugar
fsico determinado en un momento determinado. Ej: una poblacin de seres
humanos, de vicuas, de leones, etc.
B) Comunidad.- Es el conjunto de individuos de diferente especie que ocupan un lugar
o espacio fsico determinado (biocenosis). Ej: Una playa rocosa es una comunidad
formada por estrellas de mar, erizos de mar, cangrejos, etc.
C) Ecosistema.- Relaciona a todos los seres vivos de una comunidad con el medio
ambiente. Ej: Un lago, un ocano, un desierto, un charco, etc.

II. NIVELES DE ORGANIZACIN DE LA MATERIA VIVA

3. BIOELEMENTOS
Son aquellos elementos qumicos que los encontramos formando parte estructural y
funcional de la materia viva y que dan origen a las biomolculas. stos se clasifican en:

1. DEFINICIN.
La materia ha sufrido profundas transformaciones a lo largo del tiempo dando origen a
diversos grados de complejidad llamados Niveles de Organizacin , los cuales estn
divididos en 3 grandes grupos: organizacin qumica, biolgica y ecolgica.

3.1. PRIMARIOS.- Son los ms abundantes; se llaman tambin organgenos porque


estn ntimamente relacionados con la formacin de las biomolculas orgnicas. Se
dividen en:

2. NIVELES DE ORGANIZACIN.
2.1. QUMICO: Es el nivel de organizacin abitico presentando los siguientes sub
niveles:
A) Atmico.- Constituye la base de la organizacin de la materia, como son los
elementos qumicos: C, H, O, N, Na, K, etc.
B) Molecular.- Se forman por la unin de elementos qumicos, por ejemplo: O 2, O3,
H2O, HCl, aminocidos, azcares simples, bases nitrogenadas, etc.
C) Macromolecular.- Se forman por la unin de molculas, por ejemplo: muchos
aminocidos forman las protenas,
muchos azcares simples forman los
polisacridos, muchos nucletidos forman los cidos nucleicos (DNA, ADN), etc.
D) Agregados supramoleculares.- Resultan de la unin de las molculas a travs de
enlaces dbiles. Por ejemplo: los virus, ribosomas, membranas, centrolos, etc.

BSICOS

COMPLEMENTARIOS

C, H, O, N

P, S

3.2. SECUNDARIOS.- Se encuentran en menor cantidad; llamados tambin


oligogensicos. Forman parte de biomolculas orgnicas como las vitaminas y
macromolculas como las protenas, etc. Se les considera como minerales, esenciales
para regular nuestras funciones vitales. Se dividen en:

2.2. BIOLGICO: Es el primer nivel de organizacin bitico (con vida). Presenta los
siguientes subniveles:

MACROCONSTITUYENTES

MICROCONSTITUYENTES

Na, Cl, K, Ca, Mg

Fe, Co, I, Zn, Cu, Mn, F

4. BIOMOLCULAS
Son compuestos qumicos que los encontramos formando parte estructural y funcional
de la materia viva. Se dividen en:

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

4.1. BIOMOLCULAS INORGNICAS: Son las molculas ms sencillas de la materia


viva. Se caracterizan porque no derivan o no provienen del tomo de carbono. Ej:
agua, sales inorgnicas, gases.
4.2. BIOMOLCULAS ORGNICAS: Son consideradas las molculas ms complejas
de la materia viva. Se caracterizan porque todas provienen o derivan del tomo de
carbono. Ej: glcidos simples o monosacridos aminocidos, bases nitrogenadas,
vitaminas, etc.
5. MACROMOLCULAS
Son el resultado de la unin de muchas molculas. Las encontramos formando parte
estructural y funcional de la materia viva. Se dividen en: glcidos (polisacridos,
carbohidratos o hidratos de carbono), lpidos, protenas y cidos nucleicos.

BIOMOLCULAS
2)

Se dividen en:

Alimentos que poseen protenas: menestras (leguminosas), carnes (pescado en


primer lugar), leche, huevos, queso, cereales, sper cereales.
Alimentos que poseen grasas: man, palta, carnes, huevo, queso, aceites, helados,
chocolates.
Alimentos que poseen carbohidratos: frutas, menestras (leguminosas), tubrculos,
harinas, dulces, helados
Alimentos que poseen vitaminas y minerales: esencialmente todo lo fresco como
verduras, leguminosas (menestras), frutas.

Ejemplos :

III. Completa: ( pt. c/u)

PRCTICA DIRIGIDA N 02
I.

Ejemplos

1. Los bioelementos primarios, tambin llamados.............................................,

Escribe V o F segn corresponda: ( pt. c/u)

se

dividen en: ................................ y........................................... .

Los diversos grados de complejidad que se manifiesta en los seres vivos se debe a
cambios en la materia a los largo del tiempo.
(
)
2. El subnivel molecular corresponde al nivel atmico de la materia viva.
(
)
3. Los ribosomas y centriolos pertenecen al nivel qumico de la materia viva. (
)
4. Una bacteria es un agregado supramolecular del planeta.
(
)
5. El sistema nervioso del hombre pertenece al nivel tisular.
(
)
6. Una poblacin es una agrupacin de individuos de diferentes especies.
(
)
7. Los cidos nucleicos son ejemplos de biomolculas orgnicas.
(
)
BIOELEMENTOS
8. C, H, O y N son elementos organgenos.
(
)
9. Los cidos nucleicos son ejemplos
de
macromolculas.
(
)
Se dividen en:
10. Muchos aminocidos ( por ejemplo 400) forman una protena
(
)

2.

II.

5. Las.................................................................... son las molculas ms sencillas de la

1.

1)

El

nivel........................................

est

formado

por

los

factores

biticos

y............................. .
3. La................................................... est formada por individuos de diferentes
especies que ocupan un lugar determinado. Esta tambin recibe el nombre
de............................................
4. Los..............................................................se encuentran en menor cantidad y estn
formando parte de las.............................. orgnicas como las vitaminas, enzimas,
adems de regular nuestras funciones vitales, etc.

Completa los siguientes mapas conceptuales: ( pt. c/u)

materia viva. Se caracterizan porque no..................... o no provienen del tomo de

(Organogensicos)
Se dividen en:

(Oligogensicos
Se dividen
) en:

carbono.
6. Los glcidos complejos son ejemplos de..................................................., en cambio
los glcidos simples son ejemplos de................................................
IV. Relaciona: ( pt. c/u)

Ejemplos:

Ejemplos:

Ejemplos:

a)

Ejemplos:

Carbohidrato simple.

Agregado supramolecular.

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

b) Co, Cu, I.
(
) Biomolculas inorgnicas.
c) Levadura.
(
) Oligoelementos.
d) C, H, O.
(
) Subnivel molecular.
e) Virus.
(
) Elementos organgenos.
f) H2O, CO2.
(
) Subnivel celular.
g) Ca, Mg.
(
) Macromolculas.
h) Protenas.
(
) Microconstituyentes.
i) Elementos Traza.
(
) Almidn.
j) 200 glcidos simples.
(
) Macroconstituyentes.
V. Desarrolla en tu cuaderno las siguientes preguntas:

1.1 ORGANIZACIN COMPLEJA.


Todos los seres vivos estn formados por estructuras complejas llamadas clulas las
cuales estn a su vez formadas por diversas molculas inorgnicas y orgnicas. En
algunos seres vivos estas clulas se organizan para formar tejidos, los cuales
componen rganos, que a su vez forman aparatos o sistemas y todos estos juntos
forman al Ser vivo o individuo.

1. Cul es la diferencia entre bioelementos primarios y secundarios? Da 5 ejemplos de


c/u.
(4 pts: c/u)
2. Cul es la diferencia entre biomolculas inorgnicas y orgnicas? Da 5 ejemplos de
c/u.
(4 pts: c/u)
3. Escribe 3 ejemplos de macromolculas y sus unidades estructurales y represntalas
grficamente.
(3 pts: c/u)
4. Vocabulario.- ( pto c/u) Busca el significado de los siguientes trminos: poblacin,
comunidad, ecosistema, rgano, especie, glcido, lpido, protena, cido nucleico,
elemento.

III.

1.2. IRRITABILIDAD
Todos los seres vivos poseen irritabilidad. Esta propiedad es fundamental en los seres
vivos y consiste en responder a los estmulos y cambios fsicos o qumicos del medio
en que se encuentran.
Entre los principales estmulos, podemos citar: la variacin de la temperatura, los
cambios de color, la intensidad o direccin de la luz, los cambios de la presin
atmosfrica, los cambios de sonido, los cambios de la composicin qumica de la
tierra, el agua o el aire, etc. En las plantas se producen las taxias, las nastias y los
tropismos.

EL SER VIVO

1.3. METABOLISMO.
Consiste en una serie de cambios o procesos fsicos y qumicos mediante los cuales
los seres vivos mantienen y producen su energa para crecer, conservarse o
repararse. Los fenmenos metablicos, pueden ser anablicos o catablicos.

1. CARACTERSTICAS DEL SER VIVO.


Cuando estudiamos los niveles superiores de organizacin de la materia viviente,
podremos notar que existen determinadas caractersticas propias de los seres vivos.
Estas son:

La organizacin compleja.

La irritabilidad

El metabolismo.

La reproduccin.

El movimiento o desplazamiento.

El crecimiento.

La Homeostasis

La Adaptacin y Evolucin.

a) El Anabolismo.
Con este nombre se conoce a las reacciones qumicas que permiten cambiar
sustancias sencillas para formar otras ms complejas, dentro de un organismo
viviente. A travs de este fenmeno el organismo almacena energa, produce
nuevos materiales celulares con los cuales puede crecer, desarrollar y repararse.
Por ejemplo la Fotosntesis.
b) El Catabolismo.
Se llama as a las reacciones qumicas que permiten desdoblar las sustancias
complejas, con liberacin de energa y desgaste de materiales celulares. Este
fenmeno permite obtener la energa que el organismo necesita para su
funcionamiento. Por ejemplo la Respiracin Celular.
1.4. REPRODUCCIN.
La reproduccin es una caracterstica distinta de los seres vivos, que permite a las
clulas duplicar su material gentico, transmitido de una generacin a otra y, a los
organismos, originar sus descendientes con idnticas caractersticas que el
progenitor. La reproduccin puede ser asexual o sexual.
1.5. MOVIMIENTO O DESPLAZAMIENTO.

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Las plantas, en su mayora, no se desplazan de un lugar a otro; es decir, son fijas,


pero realizan un movimiento constante durante su crecimiento.
Las algas cianofceas, las bacterias, las euglenas, los sacordinos (amebas) y los
ciliados (paramecios), reaccionan ante los estmulos del ambiente, produciendo en su
cuerpo movimientos ameboideos, o desplazamientos originados por el batido de
flagelos.
El desplazamiento o locomocin de los animales es ms visible, es as como
podemos observar que ellos nadan, bucean, caminan, corren, reptan, saltan, vuelan,
planean, etc.

PRCTICA DIRIGIDA N 03
I. Escribe V o F segn corresponda: ( pt. c/u)

1.6. CRECIMIENTO.
El crecimiento es el aumento de la masa celular de los seres vivos, que puede ser el
resultado del mayor tamao de las clulas como ocurre en los animales unicelulares
o tambin, el crecimiento se debe a la mayor cantidad de clulas, como es el caso de
los seres pluricelulares.
Casi todas las plantas crecen hasta su muerte; generalmente los animales tienen un
perodo de crecimiento limitado, que termina cuando llegan a la adultez. Algunos
animales pueden regenerar las partes que pierden de su cuerpo, tales como, las
hidras, las planarias (los gusanos planos), las lagartijas, las salamandras, las
estrellas de mar, el cangrejo, etc.
1.7. HOMEOSTASIS.
Es la capacidad del organismo para buscar el equilibrio tanto en sus funciones como
en todas las caractersticas y propiedades que poseen. Cuando este equilibrio se
rompe ya sea por factores externos (estrs) o internos (metabolismo inadecuado) se
tiene como consecuencia el desarrollo de enfermedades.

1)
2)
3)
4)
5)
6)

La organizacin especfica no es una caracterstica de los seres vivos.


La fotosntesis es un ejemplo de proceso catablico.
La formacin de protenas es un proceso metablico.
La fiebre es un ejemplo de homeostasis.
Las plantas poseen irritabilidad.
Las bacterias se reproducen en forma sexual con la participacin de

(
(
(
(
(

)
)
)
)
)

7)
8)
9)

gametos.
Las branquias de ciertos organismos es un ejemplo de adaptacin.
La nutricin auttrofa se da en bacterias.
Las aletas de los peces y el aparato bucal de los insectos es un tipo de

(
(
(

)
)
)

10
11
12

adaptacin.
Un erizo de mar posee organizacin especfica.
Las garrapatas y los zancudos carecen de reproduccin sexual.
En la reproduccin asexual la esperanza de vida es mayor.

(
(
(
(

)
)
)
)

II.- Completa: ( pt. c/u)


1.- La............................. es la capacidad de los seres vivos para responder frente a un
estmulo determinado del medio ambiente.

Las respuestas ante estos estmulos

pueden ser de.............................. y...................................


2.- El................................... es el incremento de la masa celular, la cual aumenta en

1.8. ADAPTABILIDAD Y EVOLUCIN.


Las plantas y los animales soportan los cambios del medio donde viven. Esta
propiedad se denomina adaptacin, debido a la facilidad con que les permite realizar
ajustes inmediatos, que dependen de la irritabilidad de las clulas. Tambin existen
ajustes a largo plazo, resultante de fenmenos de seleccin y mutacin los cuales
son la materia prima de la evolucin.
Cada organismo es producto de
interacciones complejas entre genes y las condiciones ambientales. Un organismo
que ha logrado el xito est adaptado a su medio y por lo tanto los organismos ms
adaptados o mejor adaptados son producto de la evolucin.

tamao y nmero mientras que la........................................ es la capacidad que tienen


los seres vivos para mantener un equilibrio interno de su cuerpo con el medio que lo
rodea.
3.- La.............................. es un tipo de movimiento interno que se da a nivel
del......................................... de las clulas de las hojas de una planta.
4.- En la reproduccin............................ los descendientes son idnticos al organismo

2. FUNCIONES VITALES DE LOS SERES VIVOS:

progenitor. Mientras que en la reproduccin............................. los seres descendientes

Son aquella que nos diferencian de los seres inertes:


a) Relacin.
Nos permite sobrevivir en un ambiente determinado, gracias a nuestros sentidos,
sistema nervioso, sistema locomotor y hormonas.
b) Nutricin.
Nos permite sobrevivir como individuos. Se subdivide en digestin, circulacin,
respiracin, excrecin, secrecin, asimilacin, desasimilacin.
c) Reproduccin.
Permite la continuidad de la especie en el tiempo.

son semejantes al organismo progenitor.


5.- El anabolismo es una reaccin de tipo.................................... porque consume
energa.

Mientras

que

el.....................................

libera

energa

es

una

reaccin.....................................
6.- La........................................ es un proceso en donde los organismos forman
descendencia, todo ello con la finalidad de

...........................................................

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

7.-..............................es la funcin vital que nos permite crecer, desarrollarnos, y


6) Es el incremento de la masa celular como resultado del aumento en el tamao de las
clulas individuales:

mantener en equilibrio cada parte de nuestro cuerpo.


8. Las..................................... son fijas, pero realizan un movimiento constante durante

a) irritabilidad

su crecimiento.
III.- Relaciona: ( pt. c/u)
(

fototropismo

b) adaptacin

fiebre y sudor

c) irritabilidad

respiracin celular

d) catabolismo

ciclosis

e) anabolismo

aletas, branquias

f) homeostasis

fotosntesis

g) metabolismo

reproduccin sexual

h) catabolismo

exergnico

i) cianobacteria

realiza fotosntesis

j) bacteria

endergnico

k) anabolismo

intercambio materia y energa

l) caracol

reproduccin asexual

a) irritabilidad

a) adaptacin

d) ciclosis

b) irritabilidad

c) adaptacin

d) metabolismo

b) organizacin

c) anabolismo

d) crecimiento

b) procariota

c) eucariota

d) hetertrofo

d) adaptacin

e) homeostasis

b) reproduccin c) homeostasis

d) irritabilidad

e) N.A.

d) VVV

e) FFF

V.- Desarrolla en tu cuaderno las siguientes preguntas:

e) N.A.

1.- Ejemplifica y dibuja cada una de las caractersticas de los seres vivos. (4 pts: c/u)
2.- Menciona que tipo de reproduccin tienen los siguientes seres vivos. (2 pts: c/u)

e) b y c

e) N.A.

4) Una cianobacteria es un organismo:


a) auttrofo

c) metabolismo

10) Marca V o F segn corresponda:

Las amebas poseen movimientos

La ciclosis es un tipo de movimiento

Una bacteria es eucaritica


a) FFV
b) VVF
c) VFV

3) No es una caracterstica del ser vivo:


a) adaptacin

b) crecimiento

a) Se forma un clon.
b) El nmero de descendientes suele ser abundante en corto tiempo.
c) Los descendientes exhiben caracteres recombinados de sus progenitores.
d) No intervienen gametos.
e) Se requiere un solo individuo.

2) Conjunto de reacciones qumicas que ocurren dentro de las clulas con la finalidad de
intercambiar materia y energa con el medio ambiente:
a) homeostasis

e) N.A.

9) No es una caracterstica de la reproduccin asexual:

1) Capacidad que tienen los seres vivos para mantener un equilibrio interno de su cuerpo
con el medio que lo rodea:
c) anabolismo

d) metabolismo

8) Es cuando el ser vivo produce respuestas especficas frente a un estmulo temporal y


transitorio:

IV.- Subraya la respuesta correcta: ( pt. c/u)

b) homeostasis

c) crecimiento

7) Se da cuando el estmulo que proviene del medio ambiente es constante y


permanente en donde el ser vivo modifica determinada forma de vida:

a) movimiento

a) metabolismo

b) adaptacin

e) a y b

a) Rana

: .......................................................................

b) Estrella de mar

: .......................................................................

c) Pepino de mar

: .......................................................................

d) Cucaracha

: .......................................................................

e) Ornitorrinco

: .......................................................................

f) Malagua

: ......................................................................

g) Hidra de agua dulce

: .......................................................................

h) Bacteria

: .......................................................................

5) Las malaguas y los erizos de mar son organismos:


a) procariotas

b) eucariotas

c) metablicos

d) b y c

3.- Cul es la diferencia entre reproduccin sexual y asexual? (4 pts: c/u)

e) N.A.

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

4.- Cules son las funciones vitales de los seres vivos? Explica y dibuja un ejemplo de
cada uno. (3 pts: 1 c/u)

Cu (Cobre).- Forma parte de algunos citocromos; adems de la hemocianina que es el


pigmento encargado de transportar O2 de la mayora de invertebrados. Su deficiencia
produce anemia.
I (Iodo).- Componente de las hormonas tiroideas (tiroxina). Su dficit o carencia
produce el bocio en el adulto y cretinismo en nios.
F (Flor).- Es considerado como endurecedor del esmalte dentario previniendo la
formacin de caries.

5.- Vocabulario.- Busca el significado de las siguientes trminos. ( pto c/u)


Materia, molcula, inerte, seudpodo, locomocin, adaptacin, energa, tropismo,
progenitor, nastia, taxia.

IV. BIOLOGA MOLECULAR

2. BIOMOLCULAS

1. BIOELEMENTOS

2.1. CONCEPTO: Son entidades moleculares que resultan de la interaccin de dos o


ms bioelementos. Adoptan mltiples conformaciones y cumplen diversas funciones
de acuerdo al grado de composicin y estructura que presenten.

1.1. CONCEPTO: Son todos aquellos elementos qumicos que forman parte de los seres
vivos en condiciones normales. De los 107 elementos que existen (92 naturales y 15
obtenidos en el laboratorio) slo aproximadamente 27 de ellos se encuentran en la
inmensa diversidad de organismos.

2.2. CLASIFICACIN: Las biomolculas pueden clasificarse en dos grandes grupos:


2.2.1. BIOMOLCULAS INORGNICAS:

BIOELEMENTO

1.2. CLASIFICACIN DE LOS BIOELEMENTOS:

PRIMARIOS

H
N

A) AGUA

Caractersticas:
Es la biomolcula inorgnica ms abundante de la
superficie terrestre. Como componente corporal de los organismos es el ms
abundante.
En animales inferiores como las medusas poseen un 98%
de agua, en el hombre adulto, el 63% del peso corporal.
Representa el 75-80% del volumen de clulas.
Entre el tomo de Oxgeno y cada uno de los tomos de
Hidrgeno se establece un enlace covalente, la disposicin de los tomos de
Hidrgeno respecto al Oxgeno es tal que entre ellos forman un ngulo de
104,5 (un par de electrones compartidos).

O
S

1.3. ACTIVIDAD FISIOLGICA DE LOS BIOELEMENTOS:


Na (Sodio).- Catin principal del lquido extracelular, regula el volumen plasmtico, las
funciones nerviosas y muscular, (Na+/K+
SuCadeficiencia
Na ATPasa).
K
Mg provoca
Cl
deshidratacin.
K (Potasio).- Catin principal en el lquido intracelular, participa en la funcin nerviosa
y muscular. SECUNDARIOS
Fe
I
F
Cu
Cl (Cloro).- Importante en el equilibrio del agua en los organismos y anin principal
entre clulas.
Ca (Calcio).- En su forma ionizada (Ca++) participa en la coagulacin sangunea, en la
contraccin muscular y conduccin nerviosa. Su deficiencia produce raquitismo.
Mg (Magnesio).- Bioelemento que bajo la forma de sales se encuentra formando parte
de estructuras seas, es componente principal del pigmento fotosinttico de algas y
plantas (la clorofila). Interviene en la sntesis de glcidos, lpidos y cidos nucleicos.
Fe (Hierro).- Componente de protenas tales como la hemoglobina, mioglobina y como
citocromos. Su deficiencia en humanos y primates produce anemia.

Funciones bsicas:
Termoaislante
Termorregulacin
Solvente

B) CIDOS Y BASES

Caractersticas:
En los seres vivos encontramos con frecuencia
determinadas sustancias que pertenecen a dos tipos de compuestos
qumicos: los cidos y las Bases.
Muchos frutos y alimentos contienen cidos; el cido ctrico
se encuentra en la naranja y los limones, el cido mlico, en las manzanas; el
cido lctico en el yogurt y el cido actico, en el vinagre.
Entre las bases que encontramos con mayor frecuencia
podemos citar el amonaco (NH3), que es un producto de excrecin de
organismos acuticos, que asocindose con el agua forma el Hidrxido
amnico (NH4OH).

Escala de pH:
1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

El pH es un indicador del grado de acidez o alcalinidad de


una solucin o sustancia. Presenta un intervalo del 0 al 14.
Un pH igual a 7 indica neutralidad, uno menor de 7 indica
acidez y un pH mayor de 7 indica basicidad o alcalinidad.

- Clasificacin:

a)

Monosacridos: Estn formadas por una molcula.


Entre las ms importantes estn:
Glucosa.- Se conoce como dextrosa, es la principal fuente de energa de los
seres vivos.
Fructosa.- Se conoce como azcar de frutas o levulosa.
Galactosa.-Es el azcar de la leche.
Ribosa.- Pentosa caracterstica del RNA (cido ribonuclico).
Desoxiribosa.- Pentosa caracterstica del ADN (Acido desoxiribonuclico).
b)
Disacridos: Formados por unin de dos
monosacridos mediante enlace glucosdico:
Sacarosa.- Llamado tambin azcar de caa, que usamos a diario en nuestra
mesa es el disacrido de mayor consumo mundial en la alimentacin.
Maltosa.- Est presente en las semillas en germinacin.
Lactosa.- Est presente en la leche de los mamferos. Se usa en farmacia
como vehculo y en medicina como diurtico y laxante suave.
c)
Polisacridos: Formado por ms de diez unidades
de monosacridos unidos por enlaces glucosdicos de peso molecular
elevado.
Almidn.- Polisacrido de reserva energtica en vegetales se le encuentra en
el tallo, raz y frutos. Est formado por unidades de glucosa. Cuando
comemos arroz, yuca, papa o maz estamos comiendo almidn, ste por
procesos digestivos en la boca, estmago e intestino se transforma de nuevo
en unidades de glucosa.
Glucgeno.- Es un polmero de glucosa, polisacrido de reserva energtica
de origen animal, se almacena en el hgado y msculos; as cuando nosotros
necesitamos energa extra por un ejercicio fuerte, el glucgeno se desdobla en
unidades de glucosa.
Celulosa.- Polmero de glucosa, polisacrido estructural que forma parte de
las paredes celulares de las plantas, algas. La celulosa es componente
principal de la madera, el algodn, las fibras vegetales y sus productos
derivados como el papel.
Quitina.- Polisacrido estructural que forma la cubierta externa de los
insectos, arcnidos y crustceos, tambin se le encuentra en paredes
celulares de hongos.

Amortiguadores:
Se les conoce tambin como tampones o buffer.
Son sustancias que evitan los cambios bruscos de pH en
un medio, buscando mantener un equilibrio orgnico interno sin variaciones u
HOMEOSTASIS.
Entre los principales buffer tenemos: Bicarbonatos,
Fosfatos, Hemoglobina.
-

C) SALES
Son biomoleculas inorgnicas que resultan de la unin de
un elemento metlico con un radical no metlico.
Estas molculas se encuentran disociadas en IONES. Si
presentan carga positiva son denominados CATIONES. Ejemplo: Na+, K+,
Ca++, Fe++, Mg++
Si presentan carga negativa, son denominados ANIONES.
Ejemplo: Cl - ; PO4-2; CO3-1; SO4-3; I- .
D) GASES
Son biomolculas inorgnicas formados por tomos de un
mismo elemento o por la interaccin de elementos diferentes.
Se caracterizan por que se difunde rpidamente en la
atmsfera y se comprimen fcilmente. Entre ellos tenemos:
O2. Es un gas que se forma gracias a un proceso anablico, forma
aproximadamente la quinta parte de la atmsfera, se le encuentra disuelto en
el agua; indispensable para la respiracin.
CO2. Es una pequea molcula que esta formada por un tomo de carbono y
dos tomos de oxigeno. Su participacin en lo organismos vivos no es tan
amplia como el agua, pero juega un papel importante en dos procesos
biolgicos: la respiracin y la fotosntesis.
N2. Forma parte de compuestos inorgnicos u orgnicos como: Nitratos, Nitritos
y protenas.
O3. Es el estado alotrpico del oxigeno es un gas que se encuentra en la
estratosfera y absorbe los rayos ultravioletas.

B)
LPIDOS
- Importancia biolgica:
Estructural: Los lpidos constituyen aproximadamente el 40% de las
membranas celulares.
Energtica: Las grasas son reserva de energa. Se almacenan en el
tejido adiposo bajo la forma de triglicridos.
Termoaislante: Al almacenarse en el tejido adiposo forma una barrera
que impide la prdida de calor producido en el tejido muscular. Las ballenas, focas
y otros animales de regiones polares, soportan las bajas temperaturas porque tiene
gran cantidad de lpidos debajo de la piel.
Electroaislante: Los lpidos que existen alrededor de los axones
neuronales favorecen la transmisin, rpida del impulso a lo largo de los nervios.

2.2.2. BIOMOLECULAS ORGNICAS:

A)

GLCIDOS (Carbohidratos)
- Importancia:
Energtica: A los glcidos por su alto poder energtico se
les considera los combustibles de los seres vivos.
Estructural: Muchas molculas de glucosa se combinan
para formar complejos llamados polisacridos como por ejemplo, la quitina,
etc.

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Las rayas y anguilas elctricas no se electrocutan por la gran cantidad de lpidos


que existe alrededor de sus nervios.
Nutricional: Intervienen en el transporte y absorcin de las vitaminas A,
D E y K (liposolubles).

Las Enzimas, biocatalizadores que aceleran las

o
reacciones biolgicas.

Los Anticuerpos, protenas de defensa contra


cuerpos extraos llamados antgenos.
o
Las Histonas, componentes de la cromatina.
o
Las Tubulinas, constituyentes de los cilios, flagelos y
centrolos.
o
Las Albminas, protenas de reserva (ovoalbmina)
de transporte (seroalbmina).
o

- Clasificacin:
Lpidos simples: Biomolculas constituidas por un alcohol y cidos
grasos, unidos entre s por enlaces ster. Dentro de los lpidos simples tenemos a
los Glicridos y a las Ceras.
Lpidos complejos: Biomolculas constituidas por un alcohol, cidos
grasos y otros grupos qumicos. Dentro de los lpidos complejos se encuentran los
fosfolpidos y los glucolpidos.
Lpidos derivados: Los principales son los Esteroides. Funcin:
Reguladora, estructural y metablica.

a)
b)

C)
PROTENAS
- Definicin:
Las protenas son biomolculas principalmente cuaternarias
compuestas por C, H, O y N, la mayora contienen adicionalmente azufre (S).
Todas las protenas son macromolculas (alto peso molecular) cuyas
unidades monmeras son molculas simples denominadas aminocidos (aa).
Son las biomolculas orgnicas ms abundantes en los seres vivos.
D)

- Importancia biolgica:
Estructural.- Constituyen estructuras protectoras externas como los
cuernos, escamas, uas, pelos y plumas de los animales, adems esqueletos
celulares y corporales. Ejemplo: La Queratina, Tubulina.
Movimiento.- Intervienen en el movimiento a nivel celular y corporal.
Esta funcin la , desempean las protenas contrctiles. Ejemplo: La Actina y la
Miosina.
Transporte.- Algunas protenas son encargadas de transportar oxgeno,
CO2, lpidos, hormonas, Iones.
Biocatalizadores.- Porque aceleran las reacciones intracelulares.
(Metabolismo). Ejemplo: Enzimas.

Segn su composicin:
Simples: Cuando estn constituidos nicamente por aminocidos. Ejemplo:
Tubulinas, albminas, queratina.
Conjugadas: Cuando estn constituidas por aminocidos y un grupo prottico que
se caracteriza por no ser aminocido, pueden ser:
o
Hemoprotenas (grupo Hemo): Hemoglobina,
Citocromos, Mioglobina.
o
Glucoprotenas (glcidos): Mucina interferon.
o
Fosfoprotenas (fosfatos): Caseina, Vitelina.
o
Metaloprotenas (Metal): Hemocianina.
CIDOS NUCLEICOS

- Definicin:
Son compuestos orgnicos de gran tamao y peso molecular, las unidades que lo
constituyen se llaman nucletidos, por tanto, un cido nuclico puede definirse como
una molcula de polinucleotidos.
- Diferencias entre cidos nucleicos:
CARACTERISTICA

- Clasificacin de las protenas:


Segn su estructura:
a) Fibrosas: Cuando slo tienen un tipo de estructura secundaria. Constituyen
estructuras resistentes, elsticas y flexibles.
o
El Colgeno que constituye la sustancia intercelular.
o
La Queratina que constituye pelos, uas, pezuas,
cuernos.
o
La Elastina que constituye las paredes de los vasos
sanguneos.
o
La Fibroina que constituye la seda y telas de araa.
o
La Fibrina que constituye los cogulos sanguneos.
b) Globulares: Cuando tienen 2 ms tipos de estructuras secundarias: Ejemplo:

E)

ADN

ARN

Pentosa

Desoxiribosa

Ribosa

B.N.

A. T. G. C

AUGC

Cadena

Doble

Simple

Ubicacin:

Ncleo, Mitocondrias y
Cloroplastos

Ncleo, Citoplasma y
Ribosomas

Funcin:

Depsito de informacin
gentica

Copia y traduccin de la
informacin gentica

VITAMINAS

- Definicin:

10

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Son compuestos orgnicos relativamente sencillos requeridos por los organismos en


pequeas cantidades. No pueden ser usadas como fuentes de energa.

16.- Interviene en el transporte del oxgeno : Hemoglobina y Fe...........................


(
)
17.- La deficiencia de Yodo me causa ceguera......................................................
(
)
18.- Mn se concentra en la hemoglobina................................................................
(
)

- Clasificacin:
Existen 2 clases de vitaminas.

II.

a) Vitaminas liposolubles:
Son solventes en grasas o lpidos.
Son transportadoras en la sangre por protenas fijadoras especficas.
Se designan mediante la letra: A, D, E, K :

1.- Un ejemplo de.................................................................... es el Hidrgeno, mientras


que el sodio y cloro son ejemplos de ....................................................
2.- El............................ se concentra en los huesos y dientes, su dficit en los nios
puede causar....................................................

Vitamina A.- Llamada retinol, lo encontramos en las verduras (Nabo, zanahoria), en el


hgado, en la mantequilla, queso. Favorece el funcionamiento normal de los ojos.
Vitamina D.- Conocida como antirraqutica, lo encontramos en el aceite de hgado de
bacalao, pescado, huevo, leche, exponer la piel a la luz solar.
Vitamina E.- Conocida como tocoferol, es la vitamina de la fertilidad lo encontramos en
aceites vegetales, carne, leche, espinacas, en los grmenes o semillas. La vitamina E
es necesaria para la fertilidad de los animales.
Vitamina K.- Es antihemorragica, lo encontramos en la alfalfa, lechuga.

3.- El.......................... es el principal anin extracelular interviniendo en el equilibrio


hdrico. Mientras que el potasio es el........................................................................
4.- Los bioelementos primarios o tambin llamados..................................................... se
clasifican en ................................... y............................................ .
5.- Los bioelementos secundarios se caracterizan porque se localizan en menor
proporcin dentro de la materia viva, y se dividen en...................................................

b) Vitaminas hidrosolubles:
- Son solubles en agua, entre las vitaminas hidrosolubles tenemos al complejo de la
vitamina A y la vitamina C.
Vitamina B1 (Tiamina o Aneurina).- Su deficiencia causa el Beri-Beri.
Vitamina B2 (Riboflavina).- Su dficit causa la dermatitis y quellosis.
Vitamina B3 (Niacina).- Su dficit causa la pelagra o mal de la rosa.
Vitamina B5 (cido Pantotnico).- Su dficit causa la calvicie.
Vitamina B12 (Cianocobalamina).- Su dficit causa la anemia perniciosa.
Vitamina C (Antiescorbtica).- Su dficit causa el escorbuto.

y.................................................
6.- C, H, N y O son................................. ...................................... porque se encuentran
en grandes................................................. en los seres vivos.
7.-

Las biomolculas orgnicas se forman a partir de los bioelementos..............


(
Oligogensicos : Organgeno.........................................................................
(
Los azcares estn formados por C, H, N y O...............................................
(
C, H, O, N son elementos microconstituyentes...............................................
(
Los bioelementos slo estn presentes en las bacterias................................
(
Los alimentos son la principal fuente de bioelementos...................................
(
C, H , N y O estn cantidades mayores al 90%..............................................
(
El I es el principal catin intracelular.............................................................
(
El P y el S son bioelementos macroconstituyentes....................................
(
El cloro es el principal anin extracelular.........................................................
(
El Na es el principal catin intracelular..........................................................
(
El Mg est presente en la molcula de clorofila............................................
(
En nuestro cuerpo debemos encontrar I, Fe .................................................
(
Muchas biomolculas forman un bioelemento................................................
(
Intervienen en el equilibrio hdrico celular : sodio y Cl....................................
(

unir

C,

podemos

obtener

biomolculas

como

por

otros.
8.- Las biomolculas............................. resultan de la unin de bioelementos diferentes
unidos por enlaces carbono carbono.

Escribe V o F segn corresponda. ( pt. c/u)


1.2.3.4.5.6.7.8.9.10.11.12.13.14.15.-

Al

ejemplo ....................................., .......................................... y...........................entre

PRCTICA DIRIGIDA N 04
I.

Completa: ( pt. c/u)

Dos ejemplos de ellas lo constituyen

los.............................. y los...............................
)
)
)
)
)
)
)
)
)
)
)
)
)
)
)

9.- El.......................

es el medio en el cual tienen lugar la mayor parte de las

reacciones metablicas.
10.- Un biomolcula..................................... elemento indispensable de la materia viva
es el agua, en ella se realizan todas las reacciones...................... que hacen posible
la vida de los organismos.
III.- Subraya la respuesta correcta: ( pt. c/u)
1.- Seale el compuesto cuyas unidades estructurales son el glicerol y cidos grasos
a) Lpidos
b) Protenas
c) Carbohidratos
d) Vitaminas
e)
Enzimas
2.- Las protenas son anfteras por que actan como:
a) Enzimas
b) cidos bases c) cidos
d) Bases

11

1 SECUNDARIA I PERIODO - 2010

e) Micelas

I.E.P. SAN ALFONSO

3.- De la caa de azcar se extrae:


a) La maltosa
b) El almidn
c) Glucgeno

BIOLOGA

d) Lactosa

4.- Seale el compuesto que corresponde a una macromolcula:


a) Protena
b) Vitamina
c) Glucosa
d) Colesterol

15.- No corresponde al ADN:


a) replicacin semiconservadora
c) estructura helicoidal
e) formacin de estructuras biolgicas

e) La sacarosa
e) Triglicrido

IV. Relaciona: ( pt. c/u)


a) B
(
) Favorece el endurecimiento del esmalte dentario.

5.- El Fe++ interviene conformando la molcula de:


a) Clorofila
b) Hemoglobina c) Tiroxina
d) cido nucleico e) cido graso
6.- Las molculas que aportan mayor energa en la dieta son:
a) Lpidos
b) Protenas
c) Vitaminas
d) Glcidos
7.- Los lpidos ms abundantes en la naturaleza son:
a) Vitaminas liposolubles
b) Triglicridos
d) Hormonas
e) Fosfolpidos

b) transcripcin de la informacin gentica


d) autoduplicacin

e) Celulosa

c) Esteroides

8.- Los lpidos pertenecen a varias clases de molculas diferentes, pero su carcter
comn es que son:
a) Solubles en solventes orgnicos
b) Solubles en agua
c) Contiene nitrgeno
d) Solubles en soluciones salinas
e) Contienen azufre

b) Na

Subnivel atmico ( a,b, c,d,e, f, g, h, i, j, k , l ).

c) K

Presente en huesos y dientes.

d) Mg

Su dficit causa Bocio en adultos.

e) F

Presente en la Vitamina B12.

f) Ca

Principal catin intracelular.

g) Co

Biolemento bsico.

h) Carbono

Principal catin extracelular.

i) I

Componente de la clorofila.

j) Cloro

Participa en el crecimiento de las plantas.

k) Fsforo

Principal anin extracelular.

9.- Son llamados elementos biogensicos:


a) Agua, oxgeno y CO2
b) cidos nucleicos
c) Glcidos, lpidos y protenas
d) Carbono nitrgeno, oxigeno e hidrgeno
e) B y C

l) Cu
(
) Bioelemento complementario.
V. Desarrolla en tu cuaderno las siguientes preguntas:
a.

Cul es la diferencia entre bioelementos primarios y secundarios? (4 Pts: c/u)

10.- Son todos polisacridos excepto:


a) Almidn
b) globulina
c) Celulosa

b.

Elabora un mapa conceptual de las protenas sealando su clasificacin y funciones.


(4 pts: c/u)

c.

Realiza un cuadro comparativo entre los lpidos y glcidos. (3 pts: c/u)

d.

Que son los cidos nucleicos y cul es su principal importancia? Dibjelos (3 pts:
c/u)

d) Quitina

11.- Son lpidos que constituyen la membrana celular:


a) Grasas
b) Ceras
c) Aceites
d) Fosfolpidos

e) Glucgeno
e) Esteroides

12.- El oso polar puede resistir las bajas temperaturas del ambiente donde vive porque
almacena una gran cantidad de:
a) Grasas
b) Ceras
c) Aceites
d) fosfolpidos
e) Esteroides

e. VOCABULARIO.- Busca el significado de los siguientes trminos: ( pto. c/u)


Elementos, solvente, evaporacin, amortiguar, homeosttico, inodoro, fotosntesis,
atmsfera, osmosis, fosfato, anin, catin.

13.- Se le atribuye el descubrimiento de los cidos nucleicos a:


a) Oswald Avery (1944 )
b) Frederich Miescher (1869)
c) Watson y Crik (1953)
d) Gregorio Mendel (1865)
e) N.A.
14.- Son funciones del ADN, excepto:
a) transmisin de rasgos biolgicos
b) almacenamiento de la informacin gentica
c) transcripcin del cdigo gentico
d) traduccin del cdigo gentico
e) replicacin momentos antes de la mitosis

V. DOGMA DE LA BIOLOGA MOLECULAR


1.

12

SNTESIS DE PROTENAS.

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Es un proceso biolgico vital que realizan las clulas de todos los seres vivos y que
consiste en la produccin de gran cantidad de protenas, las cuales cumplen una
funcin importante en el organismo como por Ej.: ser responsables de los
caracteres fsicos y sexuales, realizar diversas funciones metablicas, etc.

2.

ETAPAS DE LA SNTESIS DE PROTENAS.


A

ADN
Protenas

ADN
(Ncleo)

2.2. TRANSCRIPCIN: (ADN


ARN)
Consiste en el pasaje de la informacin gentica del ADN (copia de la informacin
hereditaria) a la molcula de ARN, que empieza a sintetizarse por medio de la
complementariedad de las bases nitrogenadas.

C
ARN

(Ncleo)

(Citoplasma)

Cadena superior
Hebra codificante
Hebra con significado
(con sentido)

TRANSCRIPCIN

A.- Replicacin
B.- Trascripcin
C.- Traduccin

ATGCCGTTAGACCGTTAGCGGACCTGAC
TACGGCAATCTGGCAATCGCCTGGACTG

ADN

2.1. REPLICACIN: (ADN


ADN)
Para qu se duplica el ADN? Todos los seres vivos son temporales; pueden vivir
unos minutos como las bacterias, varios siglos como las tortugas marinas; o incluso
ms de un milenio como los olivos, pero para que la especie no se extinga ha de
haber siempre por lo menos un momento en que la informacin biolgica se replique
(auto duplica) y las copias pasan a la descendencia.
La clula para dividirse, previamente duplica su DNA, de este modo, las
generaciones celulares mantienen una cantidad constante de DNA.

5
Sntesis
de ARNm

Hebra inferior
Hebra templada
Hebra sin significado
(Antisentido)

ARNm AUGCCGUUAGACCGUUAGCGGACCUGAC

2.3. TRADUCCIN: (ARN


PROTENAS)
Es un proceso que consiste en la sntesis de protenas a partir de la molcula de
ARN. Se realiza en el citoplasma, especficamente entre las 2 subunidades del
ribosoma y participan: ribosomas, ARNm y ARNt. El proceso es el siguiente:

13

El ARNm posee los codones, los cuales son tripletes de bases


nitrogenadas y son el complemento de los anticodones.

El ARNt posee los anticodones, los cuales son tripletes de bases


nitrogenadas y son el complemento de los codones.

Los ribosomas, al hacer la lectura del ARNm, se detienen ante un codn,


esperando que el ARNt ingrese con su anticodn correspondiente. Cuando
existe el encuentro: codn-anticodn, un aminocido se une a otro
aminocido formndose as las protenas.

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Valina
Valina
Valina
Valina

Alanina
Alanina
Alanina
Alanina

c. Asprtico
c. Asprtico
c. Asprtico
c. Glutmico

Glicina
Glicina
Glicina
Glicina

U
C
A
G

PRCTICA DIRIGIDA N 05
I.

3.

CDIGO GENTICO.

Escribe V o F segn corresponda: ( pt. c/u )


1. La informacin gentica o hereditaria de todos los seres vivos est
almacenada en el RNA bajo la forma de un cdigo gentico.
(
2. Un gen es un segmento de ADN que contiene la informacin gentica
necesaria para sintetizar una protena determinada.
(
3. El ADN dirige directamente la sntesis de protenas.
(
4. La transcripcin es un proceso que consiste en la formacin de ARN a
partir de ADN y ocurre en el citoplasma.
(
5. El ARNt capta aminocidos y a la vez posee los anticodones necesarios
para la sntesis de protenas.
(
6. Para que pueda sintetizarse una protena es necesario la participacin
de los 3 tipos de ARN.
(
7. El cdigo gentico rene una serie de codones, los cuales son responsables
de la sntesis de un aminocido particular.
(
8. La traduccin es un proceso de sntesis de protenas a partir del ARN
y ocurre en el ncleo celular.
(

Se entiende por cdigo gentico al Alfabeto Qumico que posee todo organismo del
planeta, en donde se renen una serie de tripletes de nucletidos de ARN o tambin
denominados codones, los cuales, a su vez guardan una correspondencia especial
con determinados aminocidos (aa), los cuales al reunirse constituirn a una
protena especfica. Las protenas que logren formarse habrn de ser utilizadas con
fines: estructurales, inmunolgicos, hormonales, enzimticos, contrctiles, etc.

)
)
)
)
)
)
)
)

SEGUNDA BASE NITROGENADA

C
A

Fenilalanina
Fenilalanina
Leucina
Leucina

Leucina
Leucina
Leucina
Leucina
Isoleucina
Isoleucina
Isoleucina
Metionina

C
Serina
Serina
Serina
Serina

Prolina
Prolina
Prolina
Prolina
Treonina
Treonina
Treonina
Treonina

A
Tirosina
Tirosina
Alto
Alto

Histidina
Histidina
Glutamina
Glutamina
Asparagina
Asparagina
Lisina
Lisina

II. Relaciona :

G
Cisteina
Cisteina
Alto
Triptfano
Arginina
Arginina
Arginina
Arginina
Serina
Serina
Arginina
Arginina

U
C
A
G

U
C
A
G
U
C
A
G

BASE NTROGENADATERCERA

NITROGENADAPRIMERA BASE

( pt. c/u )

a)

ARNm

) AUG

b)

Metionina

) citoplasma

c)

Transcripcin

) codn

d)

Replicacin

) ADN

e)

ARNt

) ncleo

f)

Triptofano

) UGG

g)

Traduccin

) nucleolo

h)

ARNr

) anticodn

III. Completa los espacios en blanco:

( pt. c/u )

1. La ____________es un proceso que consiste en la sntesis de _______ a


partir de ________.

14

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Mientras que la _______________ implica la sntesis de ___________ a


partir de __________.
2. El _________ se dirige al ______________ para colocarse entre los
subunidades del _____________.
Por otro lado el _________ capta aminocidos y posee los ______________,
los cuales son tripletes de bases nitrogenadas que se complementan con los

VI.- Subraya la respuesta correcta: ( pto. c/u)

___________.
1. Seala lo incorrecto respecto a la sntesis de ARN:
a) Las cadenas del ADN se separan
b) Los nucletidos de ARN se colocan frente a los nucletidos de ADN.
c) Slo hay formacin de enlaces puente hidrgeno.
d) Hay ruptura y formacin de enlaces puente hidrgeno.
e) N.A.

3. ________________________ es el alfabeto qumico que posee todo


organismo en donde se renen una serie de tripletes de nucletidos, llamados
___________, los cuales guardan una correspondencia especial con
determinados __________ que al reunirse constituirn una protena.
4. El ______ no puede dirigir directamente la ______________________, por lo

2. Seala lo correcto acerca de la sntesis de protenas y su relacin con los


genes:
a) Los genes no almacenan informacin hereditaria para producir protenas.
b) Los genes estn formados por diferentes tipos de bases nitrogenadas.
c) Las diferentes protenas que existen en el organismo poseen secuencias de
aminocidos colocadas al azar.
d) La secuencia de bases nitrogenadas presentes en el ADN son responsables
de la secuencia de aminocidos presentes en una protena.
e) b y d

tanto, debe haber una molcula llamada _______ que lleve la informacin
gentica desde el ___________ al ______________.

La
IV. Completa el siguiente mapa
conceptual:
Sntesis
de protenas

3. La base nitrogenada Timina en el ADN es reemplazada por........ en el ARN:


a) Adenina
b) Citosina
c) Guanina
d) Uracilo
e) a y d

( pt. c/u )

4. Proceso que consiste en el pasaje de la informacin gentica del ADN al ARN,


y que se lleva a cabo en el ncleo :
a) Replicacin
b) Transcripcin
c) Traduccin
d) Autoduplicacin
e) N.A.

Comprende tres etapas

Consiste en la
formacin de

Consiste en la
formacin de

5. Tipo de ARN que posee los codones necesarios, los cuales sern ledos por los
ribosomas:
a) ARNm
b) ARNt
c) ARNr
db y c
e) N.A.

Consiste en la
formacin de

A partir de:

A partir de:

A partir de:

Esto ocurre en
el :

Esto ocurre en
el :

Esto ocurre en
el :

6. Tipo de ARN que capta aminocidos y posee los anticodones necesarios para
la sntesis de un aminocido particular:
a) ARNm
b) ARNt
c) ARNr
d) b y c e) N.A.
7. El ADN eucaritico:
a) Interviene directamente en la sntesis proteica al abandonar el ncleo y ser
trasladado al ribosoma.
b) Toma parte indirectamente en la sntesis proteica (el DNA permanece en el
ncleo)
c) No tiene nada que ver con la sntesis proteica. Slo interviene en la divisin
celular.

15

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

d) Interviene en la sntesis proteica que se lleva a cabo en el ncleo.


e) Codifica para RNAm, pero no para RNAt ni para RNAr.

son: AAU, AAA, ACG, GCU, UCU, CAU, CAA, GGU, CGA, CUG, AAG, GGG.
Dichos codones con responsables de la formacin de 12 aminocidos
presentes en dicha protena y aparecen en ese mismo orden.
(5 Pts.)
a)
Haciendo uso de la tabla del cdigo gentico, encuentra esos 12
aminocidos que forman parte de dicha protena y el orden en que
aparecen.
b)
Cul es la secuencia de nucletidos presentes en el ARNm?
c)
Cul es la secuencia de nucletidos presente en el ARNt?
d)
Escribe la secuencia de nucletidos presente en la molcula de
ADN bacteriano que dio origen indirectamente a dichos aminocidos.
e)
Encuentra el nmero de enlaces fosfodiester y puente hidrgeno
en la molcula de ADN.

8. En relacin al proceso de sntesis de protenas, marca la respuesta correcta:


El ARNr se dirige a los nucleolos donde es organizado en 2 subunidades, los
cuales luego formarn los ribosomas.
El ARNt se dirige al ncleo donde adopta la forma de hoja de trbol para
captar aminocidos.
El ARNm se dirige al citoplasma para colocarse entre las 2 subunidades del
ribosoma, quien har la lectura correspondiente.
Los codones y anticodones derivan del ARNm y se unen para formar
aminocidos.
a) VVFV
9.
a)
b)
c)
d)

b) FVFV

c) VFVF

d) FFVV

e) VFFF

VIII. Desarrolla en tu cuaderno las siguientes preguntas


1. Define los siguientes trminos: (4 Pts. c/u)
ARN
Base Nitrogenada
Nucletido
Cdigo gentico
Transcripcin
ADN

Anticodn es el trmino que se aplica a:


La lista de aminocidos que corresponde al cdigo gentico.
El concepto de que mltiples codones en ocasiones codifican para un solo
aminocido.
La parte del RNAt que interacta con el codn.
b y c
e) T.A.

2. Cul es la funcin del ARNm y el ARNt? (4 Pts. 2 c/u)


3. Cul es la diferencia entre transcripcin y traduccin? (4 Pts. 2 c/u)
4. Qu ocurrira con la sntesis proteica de un organismo si se produce una
mutacin en el ADN de sus clulas? (3 Pts.)
5. Cul crees tu que es la importancia del cdigo gentico? (3 Pts.)

10.

Seala lo incorrecto acerca de la sntesis proteica:


a) Los ribosomas al hacer la lectura del ARNm se detienen ante un anticodon.
b) El proceso de traduccin es intracitoplasmtico.
c) El ARNt transporta los codones y los aminocidos hacia el lugar donde el
ribosoma lee al ARNm.
d) a y b
e) a y c
VI. Resuelve los siguientes ejercicios:
1.
Un organismo x presenta en su cdigo gentico las bases nitrogenadas
que darn origen a una protena y particular, la cual forma parte de su cuerpo.
Por otro lado, se sabe que los siguientes codones:
(4 Pts.)
1ro: UAU
4to: AGC
2do: UGU
5to: CCU
3ro: CGU
6to: GUU
Codifican 6 aminocidos diferentes que al unirse formaran dicha protena. Lo
que debes hacer es lo siguiente:
a)
Usando la tabla del cdigo gentico, encuentra los 6 aminocidos que
conforman dicha protena y el orden en que aparecen.
b)
Escribe la secuencia de nucletidos presentes en el ARNm.
c)
Escribe la secuencia de nucletidos presentes en el ARNt.
d)
Escribe la secuencia de nucletidos presente en el ADN que dio origen
indirectamente a esta protena.
2.

Codn Anticodn

VOCABULARIO.- Busca el significado de las siguientes palabras: (1 Pto. c/u)


Dogma Cdigo ARN Replicacin Triplete - Codn

VI. BIOLOGA CELULAR


1. TEORA CELULAR Y CONCEPTO MODERNO
1.1. Etimologa:
La palabra clula proviene de 2 voces:
Griego: Kytos Clula.
Latn: Cella Espacio vaco

1.2. Definicin:
Es la unidad anatmica, funcional y gentica de los seres vivos.
Anatmica: Porque forma parte de los seres vivos, ya sean stas unicelulares o
multicelulares (pluricelulares).
Funcional: Porque cumple una funcin especfica en los organismos, ya sea en forma
conjunta o individual.
Gentica: Porque las caractersticas o rasgos hereditarios que lleva cada organismo,
se debe al material gentico (ADN) que contiene cada clula.

Una bacteria patgena intestinal que produce cuadros de diarrea agudos en


diferentes pacientes, posee una protena codificada por su genoma, la cual la
hace muy resistente a un determinado tipo de antibitico. Dicha protena forma
parte de su membrana y est conformada por gran cantidad de aminocidos
(aprox. 100). Se han encontrado los siguientes codones dentro del ARNm que

1.3. La teora celular:

16

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

Fue formulada aproximadamente por los aos 1838 1839 y tiene como autores a dos
bilogos importantes: Matas Schleiden y Teodor Schawnn, los cuales observaron en el
microscopio la presencia de clulas en tejido animal y vegetal. Esta Teora seala lo
siguiente:
- Cada organismo vivo est formado por una o ms clulas.
- Los organismos ms pequeos son clulas nicas y las clulas son las unidades
funcionales de los organismos multicelulares.
- Toda clula, proviene de otra preexistente. (Virchow, 1859).

3.1. ENVOLTURA CELULAR:


- Es la parte ms externa de la clula.
- En los vegetales, algas y hongos es la Pared Celular. La pared celular, es un
agregado supramolecular presente en clulas vegetales y estn formadas de celulosa.
Sus funciones son: dar forma y rigidez a la clula, permite el intercambio de
sustancias, impide el hinchamiento de las clulas vegetales.
- En las bacterias es el Glucoclix. Sus funciones son el reconocimiento celular y la
adherencia entre clulas (controla la proliferacin celular).

2. CLASIFICACIN

3.2. MEMBRANA CELULAR:


- Es una capa muy delgada de las clulas que separa el medio interno del externo. Su
funcin es la permeabilidad selectiva, es decir, permite o selecciona la entrada y
salida de nutrientes y otras sustancias adems de la compartamentalizacin.
- Se caracteriza por ser lipoproteica, flexible, fina, limitante, conservante, dinmica y
asimtrica.

Son muchos los criterios que se toman en cuenta para reunir a las clulas. Es as que
tenemos:

2.1. Por su forma:


* Circulares: Ej.: Los Hepatocitos.
* Estrelladas: Ej.: Las Neuronas.
* Geomtricas: Ej.: Clulas Epiteliales.
* Fusiformes: Ej.: Clulas musculares

3.3. CITOPLASMA:
- Es una sustancia de consistencia viscosa y gelatinosa, constituyendo el medio interno
de la clula. Presenta sustancias alimenticias para el funcionamiento de la clula como
por ejemplo protenas, carbohidratos, grasas, sales minerales.
- Adems contiene organelas celulares (mitocondrias, lisosomas, cloroplastos) que
cumplen funciones vitales, asociaciones supramoleculares, citoesqueleto, etc.

2.2. Por su tamao:

* Microscpicas: Cuyo tamao oscila entre 0, 12 y 100. ; slo son observables al


microscopio. Ej.: la mayora de clulas animales y vegetales, bacterias,
protozoarios, etc.
* Macroscpicas: Aquellas cuyo tamao es mayor a 100; son visibles a simple vista
debido a que son mayores a la dcima parte de 1 mm. Ej.: yema del huevo de las
aves.

a) Organelas: rganos membranosos.

Mitocondria, son organelas de doble membrana cuya funcin bsica es la


respiracin celular.

Cloroplastos, son organelas de doble membrana presentes slo en algunos


organismos como plantas y algas, encargndose fundamentalmente de la
fotosntesis.

Cromoplastos son organelas bimembranosas responsables del color de ciertos


frutos, hojas y otras estructuras vegetales como:
- Caroteno: Anaranjado:
Ej.: Zanahoria
- Xantfila: Amarillo:
Ej.: Zapallo
- Licopeno: Rojo:
Ej.: Tomate

Lisosomas, organelas con una membrana cuya funcin bsica es la digestin


celular.

Peroxisomas, se encargan de degradar el perxido de hidrgeno (agua


destilada).

Glioxisomas. Transforman lpidos en glcidos y est presente en las semillas.

Vacuolas, son organelas unimembranosas, se localizan en mayor abundancia


en clulas vegetales que en clulas animales. Su funcin es almacenar diversas
sustancias como: agua, sales, pigmentos, glcidos, vitaminas, etc.

2.3. Por su Nutricin:


* Auttrofas: Son aquellas que tienen la capacidad de sintetizar o producir sus propios
nutrientes, es decir, obtienen su energa a partir de molculas inorgnicas. Ej.:
plantas, algas, algunas bacterias.
* Hetertrofas: Aquellas que carecen de la capacidad de sintetizar sus propios
nutrientes, es decir, obtienen su energa a partir de molculas orgnicas. Ej.: la
mayora de bacterias, hongos, protozoarios, animales.

2.4. Por su complejidad:


* Procariotas: Su organizacin estructural es ms sencilla.
Carecen de envoltura nuclear, es decir, el material gentico est disperso en el
citoplasma.
Slo presentan ribosomas.
Ej.: Bacterias, algas cianofitas.
* Eucariotas: Su organizacin estructural es ms compleja. El material gentico (ADN)
est protegido por el ncleo. Presentan diversos tipos de organelas como: ribosomas,
cloroplastos, mitocondrias, etc. Ej.: clulas de hongos, clulas de animales, clulas
de las plantas, etc.

b) Organoides: rganos sin membrana.

Ribosomas, son organelas que no tienen membrana pero cuya funcin es la


fabricacin o sntesis de protenas, las cuales son esenciales para la clula.

Centrolo, permite la divisin celular formando el huso acromtico. Presente en


clulas animales.

3. ESTRUCTURA DE LA CLULA EUCATITICA

17

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

BIOLOGA

c) Sistema de endomembranas:

Aparato de Golgi (Golgisoma), es una agrupacin de sacos membranosos y su


funcin es la secrecin celular de algunas molculas como lpidos, protenas,
glcidos, as como tambin la fabricacin de lisosomas, origina la membrana
celular, pared celular, glicoclix, etc.

Retculo Endoplasmtico (R.E), es un conjunto de canales membranosos y a su


vez puede ser de 2 tipos:

R.E. Liso: (REL), aquel en cuya superficie no existen ribosomas y su funcin es


la detoxificacin, as mismo, se encarga de producir, transportar y almacenar
lpidos, etc.

R.E. Rugoso: (RER), aquel en cuya superficie s existen ribosomas adheridos;


participa indirectamente en la fabricacin de protenas, luego las transporta y
almacena, etc.

Membrana celular
Pared celular
Material gentico
Ncleo
Nuclolo
Mitocondrias
Cloroplasto
Ribosomas
Retculo endoplasmtico
Aparato de Golgi
Lisosomas
Vacuolas

3.4. NCLEO:
Es una estructura generalmente ovoide que se encuentra dentro de todas las clulas
eucariotas. Su funcin consiste en dirigir y controlar todas las funciones y actividades
que realiza la clula, por medio del ADN.

Carioteca, membrana que separa al ncleo del citoplasma.

Cromatina, es el material gentico (ADN) protegido por las histonas.

Cariolinfa, es el contenido del ncleo.

Nuclolo: Son agregados supramoleculares que tambin carecen de


membrana. Se localizan dentro del ncleo y se encargan de formar o sintetizar a los
ribosomas (sintetiza las subunidades mayor y menor).

III. Completa:
1)

( pt. c/u)
Las clulas.................................. son aquellas que sintetizan su propio

alimento, mientras que las clulas.................................................. obtienen su


energa de compuestos..
2)

Las clulas................................... se caracterizan porque carecen de


membrana nuclear o....................................

3)

Las bacterias, de acuerdo a su nutricin pueden ser consideradas


clulas......................... y de acuerdo complejidad seran.......................................

PRCTICA DIRIGIDA N 6
I.

Completa el siguiente cuadro:


Estructura

5)

fue

formulada

por

los

Las........................................ son organelas que se encargan de la


respiracin celular, mientras que los.................................. se encargan de la

)
)
)
)
)
)
)
)

digestin celular.
6)

El............................ es un conjunto de canales membranosos y a su


vez puede ser de 2 tipos: el................, cuya funcin es la detoxificacin y el..............
el cual posee gran cantidad de...................................... adheridos a su membrana.

7)

El........................... es un agregado supramolecular que se localiza


generalmente en el.......................... de la clula y cuya funcin es.................. y

)
)

controlar

todas

las

actividades

que

realiza

la

misma.

material ................... (ADN).

( pt. c/u)

CLULA ANIMAL

La.........................................

cientficos........................... y en 1838 1839.

Escribe V o F segn corresponda: ( pt. c/u)

1.- La clula es considerada la unidad anatmica porque cumple una funcin en un


organismo.
(
2.- La pared celular le da forma geomtrica tpica a la clula vegetal.
(
3.- Un leucocito es una clula microscpica.
(
4.- Las bacterias son seres vivos procariticos, porque tienen carioteca.
(
5.- El alga unicelular verde-azul es un ser vivo procaritico auttrofo.
(
6.- Las clulas de acuerdo a su nutricin pueden ser procariotas y eucariotas. (
7.- Los hongos son organismos procariotas hetertrofos.
(
8.- Todas las bacterias son seres vivos auttrofos.
(
9.- El huevo de un ave es considerado una clula macroscpica porque mide
menos de 100.
(
10.- Todas las clulas que poseemos son auttrofas.
(
II.

4)

CLULA VEGETAL

IVI. Escribe las partes de las siguientes clulas: (1/4 Pto. c/u)

18

1 SECUNDARIA I PERIODO - 2010

Contiene

al

I.E.P. SAN ALFONSO

BIOLOGA

CLULA ANIMALL
V. Relaciona: ( pt. c/u)
a) Ribosomas
b) Vacuolas
c) Nucleolos
d) Mitocondria
e) Membrana Celular
f) Ncleo
g) R. E. R.
h) Lisosoma
i) R. E. L.
j) Pared Celular
k) Cloroplastos
l) Golgisoma

CLULA VEGETAL

(
(
(
(
(
(
(
(
(
(
(
(

)
)
)
)
)
)
)
)
)
)
)
)

contiene al ADN
digestin celular
almacena agua, sales, vitaminas
sntesis de protenas
detoxificacin celular
lipoproteca
respiracin celular
celulsica
secrecin celular
forman a los ribosomas
ribosomas en su superficie
fotosntesis

VI. Subraya alternativa correcta: ( pt. c/u)


1.- La clula es considerada la unidad anatmica o estructural porque:
a) Cumple una funcin especfica en un organismo.
b) Contiene al material gentico.
c) Forma parte de un ser vivo.
d) Se hereda de generacin en generacin.
e) N.A.
2.- Las clulas bacterianas son clulas de tipo:
a) eucariotas

b) macroscpicas

c) procariotas

d) estrelladas

e) a y b

3.- Tipo de clula que se caracteriza por obtener energa a partir de compuestos
orgnicos:
a) Procariotas b) hetertrofas

c) Auttrofas

d) eucariotas

e) N.A.

4.- Clula que carece de membrana nuclear y cuyo ADN est disperso en el citoplasma:

19

1 SECUNDARIA I PERIODO - 2010

I.E.P. SAN ALFONSO

a) Eucariota

b) fusiforme

BIOLOGA

c) auttrofa

d) procariota

e) b y d

5.- Las amebas son organismos:


a) procariotas y hetertrofas.
c) Eucariotas y heteromorfos.

b) Procariotas y auttrofos.
d) Eucariotas y hetertrofos.

e) N.A.

6) El huevo de un ave es una clula que se caracteriza por ser:


a) microscpica hetertrofa eucariota
b) microscpica auttrofa eucariota
c) macroscpica auttrofa procariota
d) macroscpica hetertrofa procariota
e) macroscpica hetertrofa eucariota
VII. Desarrolla en tu cuaderno las siguientes preguntas:
1.- Explica y grafica las diferencias entre clula procariota y eucariota. (4 pts: 1/3 c/u)
2.- Menciona 5 ejemplos de clulas eucariotas. Dibjalas

(2,5 pts: c/u)

3.- Cul es la funcin de las organelas celulares (animales y vegetales)?: Dibjalas.


(4 pts: 1/3 c/u)
4.- VOCABULARIO.- Escribe el significado de los siguientes trminos. (1 Pto. c/u)
Unicelular Pluricelular Microscopio Nutriente Hongo Gentico(a)
Permeabilidad Heterogneo Ovoide Proliferacin Fotosntesis.

20

1 SECUNDARIA I PERIODO - 2010